Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
GBP5	115362	broad.mit.edu	37	1	89734854	89734854	+	Intron	DEL	A	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89734854delA	uc001dnc.2	-						GBP5_uc001dnd.2_Intron|GBP5_uc001dne.1_Intron	NM_052942	NP_443174			guanylate-binding protein 5							plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)														---	---	---	---
KIAA1324	57535	broad.mit.edu	37	1	109716637	109716638	+	Intron	INS	-	T	T	rs142957682		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109716637_109716638insT	uc001dwq.2	+						KIAA1324_uc009wex.1_Intron|KIAA1324_uc009wey.2_Intron|KIAA1324_uc010ovg.1_Intron	NM_020775	NP_065826			hypothetical protein LOC57535 precursor						macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)														---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120612224	120612226	+	5'UTR	DEL	GCC	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612224_120612226delGCC	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
ARNT	405	broad.mit.edu	37	1	150849072	150849073	+	5'UTR	DEL	CC	-	-	rs71749764		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150849072_150849073delCC	uc001evr.1	-	1					ARNT_uc001evs.1_5'UTR|ARNT_uc009wmb.1_5'UTR|ARNT_uc009wmc.1_5'UTR|ARNT_uc009wmd.1_5'UTR|ARNT_uc009wme.1_5'UTR|ARNT_uc010pcl.1_5'UTR	NM_001668	NP_001659			aryl hydrocarbon receptor nuclear translocator						positive regulation of hormone biosynthetic process|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hypoxia		aryl hydrocarbon receptor binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity			skin(4)|lung(3)|central_nervous_system(1)|kidney(1)	9	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)					T	ETV6	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	1	184949123	184949124	+	IGR	INS	-	G	G	rs113136902		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184949123_184949124insG								FAM129A (5441 upstream) : RNF2 (65427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	185656667	185656668	+	IGR	INS	-	T	T	rs815388		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185656667_185656668insT								IVNS1ABP (370206 upstream) : HMCN1 (47015 downstream)																																			---	---	---	---
MOSC2	54996	broad.mit.edu	37	1	220928657	220928657	+	Intron	DEL	T	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220928657delT	uc001hmq.2	+						MOSC2_uc001hmr.2_Intron|MOSC2_uc009xdx.2_Intron	NM_017898	NP_060368			MOCO sulphurase C-terminal domain containing 2							mitochondrial outer membrane|peroxisome	molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.00499)|all cancers(67;0.204)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	228707640	228707641	+	IGR	DEL	CA	-	-	rs111341592		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228707640_228707641delCA								RNF187 (23752 upstream) : DUSP5P (73016 downstream)																																			---	---	---	---
ERO1LB	56605	broad.mit.edu	37	1	236385071	236385072	+	Intron	INS	-	TTAATA	TTAATA	rs10647377		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236385071_236385072insTTAATA	uc001hxt.2	-							NM_019891	NP_063944			endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)															---	---	---	---
SLC1A4	6509	broad.mit.edu	37	2	65231295	65231307	+	Intron	DEL	ATGGCCAAATACC	-	-	rs72295994		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65231295_65231307delATGGCCAAATACC	uc010yqa.1	+						SLC1A4_uc010ypy.1_Intron|SLC1A4_uc010ypz.1_Intron|SLC1A4_uc010fcv.2_Intron|SLC1A4_uc002sdh.2_Intron	NM_003038	NP_003029			solute carrier family 1, member 4 isoform 1						cellular nitrogen compound metabolic process|cognition|synaptic transmission, glutamatergic	intermediate filament|melanosome	chloride channel activity|L-alanine transmembrane transporter activity|L-cystine transmembrane transporter activity|L-hydroxyproline transmembrane transporter activity|L-proline transmembrane transporter activity|L-serine transmembrane transporter activity|L-threonine transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(1)	1					L-Alanine(DB00160)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	78937819	78937834	+	IGR	DEL	AAGGAAGGAAGGAAGG	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78937819_78937834delAAGGAAGGAAGGAAGG								SNAR-H (755667 upstream) : REG3G (314992 downstream)																																			---	---	---	---
ACOXL	55289	broad.mit.edu	37	2	111659220	111659221	+	Intron	DEL	CA	-	-	rs71732091		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111659220_111659221delCA	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986			acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	157798215	157798216	+	IGR	INS	-	AC	AC	rs149850281	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157798215_157798216insAC								GPD2 (327968 upstream) : GALNT5 (316124 downstream)																																			---	---	---	---
CASP10	843	broad.mit.edu	37	2	202060401	202060401	+	Intron	DEL	T	-	-	rs41363644		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202060401delT	uc002uxl.1	+						CASP10_uc002uxi.1_Intron|CASP10_uc010zhn.1_Intron|CASP10_uc002uxj.1_Intron|CASP10_uc002uxk.1_Intron|CASP10_uc010fta.1_Intron|CASP10_uc002uxm.1_Intron|CASP10_uc010ftb.1_Intron	NM_032974	NP_116756			caspase 10 isoform b preproprotein						apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	218879590	218879593	+	IGR	DEL	GGAC	-	-	rs61462261		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218879590_218879593delGGAC								TNS1 (11872 upstream) : RUFY4 (20118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237209275	237209278	+	IGR	DEL	TCCT	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237209275_237209278delTCCT								ASB18 (36287 upstream) : IQCA1 (23516 downstream)																																			---	---	---	---
FRMD4B	23150	broad.mit.edu	37	3	69247800	69247800	+	Intron	DEL	T	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69247800delT	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnx.1_3'UTR|FRMD4B_uc003dnu.2_Intron|FRMD4B_uc011bga.1_Intron	NM_015123	NP_055938			FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)														---	---	---	---
PLD1	5337	broad.mit.edu	37	3	171406839	171406840	+	Intron	INS	-	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171406839_171406840insA	uc003fhs.2	-						PLD1_uc003fht.2_Intron	NM_002662	NP_002653			phospholipase D1 isoform a						cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)													---	---	---	---
ATP13A4	84239	broad.mit.edu	37	3	193180770	193180770	+	Intron	DEL	T	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193180770delT	uc003ftd.2	-						ATP13A4_uc003fte.1_Intron|ATP13A4_uc011bsr.1_Intron|ATP13A4_uc010hzi.2_Intron|ATP13A4_uc003ftf.3_Intron	NM_032279	NP_115655			ATPase type 13A4						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)														---	---	---	---
RGS12	6002	broad.mit.edu	37	4	3416752	3416764	+	Intron	DEL	CGTGTGAGAGGGA	-	-	rs145348636	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3416752_3416764delCGTGTGAGAGGGA	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron|RGS12_uc010ict.1_Intron|RGS12_uc003ggz.2_Intron|RGS12_uc010icu.1_Intron|RGS12_uc011bvs.1_Intron|RGS12_uc003gha.2_Intron|RGS12_uc010icv.2_Intron|RGS12_uc003ghb.2_Intron	NM_198229	NP_937872			regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	13234574	13234575	+	IGR	DEL	AG	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13234574_13234575delAG								None (None upstream) : HSP90AB2P (100462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	120022622	120022623	+	IGR	DEL	AG	-	-	rs147028694	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120022622_120022623delAG								SYNPO2 (40229 upstream) : MYOZ2 (34316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	179874911	179874913	+	IGR	DEL	CCG	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179874911_179874913delCCG								LOC285501 (963008 upstream) : None (None downstream)																																			---	---	---	---
ZDHHC11	79844	broad.mit.edu	37	5	845557	845557	+	Intron	DEL	C	-	-	rs11347292		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:845557delC	uc011cma.1	-						ZDHHC11_uc003jbj.2_Intron|ZDHHC11_uc010itd.1_5'Flank|ZDHHC11_uc003jbk.2_5'Flank	NM_024786	NP_079062			zinc finger, DHHC-type containing 11							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)															---	---	---	---
FAM105B	90268	broad.mit.edu	37	5	14692788	14692789	+	Intron	INS	-	T	T	rs144619199		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14692788_14692789insT	uc003jfk.2	+							NM_138348	NP_612357			hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)																	---	---	---	---
BDP1	55814	broad.mit.edu	37	5	70808891	70808892	+	Intron	DEL	AA	-	-	rs34252624		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70808891_70808892delAA	uc003kbp.1	+						BDP1_uc003kbo.2_Intron	NM_018429	NP_060899			transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	130306978	130306989	+	IGR	DEL	GGAAGGAAGGAA	-	-	rs71982858	by1000genomes;by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130306978_130306989delGGAAGGAAGGAA								CHSY3 (784652 upstream) : HINT1 (187886 downstream)																																			---	---	---	---
AFF4	27125	broad.mit.edu	37	5	132234183	132234183	+	Intron	DEL	T	-	-	rs67779737		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132234183delT	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron	NM_014423	NP_055238			ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	857729	857732	+	IGR	DEL	TCCG	-	-	rs116661548	by1000genomes;by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:857729_857732delTCCG								EXOC2 (164620 upstream) : LOC285768 (103510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148619846	148619848	+	IGR	DEL	GAA	-	-	rs71031057		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148619846_148619848delGAA								SAMD5 (728689 upstream) : SASH1 (43881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	155949125	155949126	+	IGR	INS	-	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155949125_155949126insA								NOX3 (172088 upstream) : MIR1202 (318805 downstream)																																			---	---	---	---
CDK6	1021	broad.mit.edu	37	7	92244011	92244012	+	3'UTR	DEL	AC	-	-	rs146055537		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92244011_92244012delAC	uc011khw.1	-	8					CDK6_uc010lez.2_3'UTR	NM_001259	NP_001250			cyclin-dependent kinase 6						cell dedifferentiation|cell division|G1 phase of mitotic cell cycle|gliogenesis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|negative regulation of osteoblast differentiation|positive regulation of cell-matrix adhesion|positive regulation of fibroblast proliferation|regulation of erythrocyte differentiation|regulation of gene expression|response to virus	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleus|ruffle	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			central_nervous_system(1)|skin(1)	2	all_cancers(62;8.72e-12)|all_epithelial(64;3.65e-10)|Breast(17;0.000675)|all_lung(186;0.0392)|Lung NSC(181;0.053)|all_neural(327;0.219)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;1.2e-06)|all cancers(6;3.1e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)					T	MLLT10	ALL								---	---	---	---
TFPI2	7980	broad.mit.edu	37	7	93517857	93517860	+	Intron	DEL	GAAG	-	-	rs72257308		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93517857_93517860delGAAG	uc003umy.1	-						GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_Intron|TFPI2_uc003una.1_Intron|TFPI2_uc003unb.1_Intron|TFPI2_uc010lfg.1_Intron	NM_006528	NP_006519			tissue factor pathway inhibitor 2 precursor						blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	62726156	62726167	+	IGR	DEL	CTTCCTTCTTTT	-	-	rs55690282	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62726156_62726167delCTTCCTTCTTTT								ASPH (98957 upstream) : NKAIN3 (435334 downstream)																																			---	---	---	---
NKAIN3	286183	broad.mit.edu	37	8	63502435	63502448	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs72423486		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63502435_63502448delTGTGTGTGTGTGTG	uc010lyq.1	+							NM_173688	NP_775959			Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)																---	---	---	---
ANKRD46	157567	broad.mit.edu	37	8	101535133	101535138	+	Intron	DEL	ATATAT	-	-	rs66638989		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101535133_101535138delATATAT	uc003yjm.2	-						ANKRD46_uc003yjn.1_Intron|ANKRD46_uc003yjo.1_Intron|ANKRD46_uc003yjp.1_Intron	NM_198401	NP_940683			ankyrin repeat domain 46							integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	111363711	111363714	+	IGR	DEL	TTTC	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111363711_111363714delTTTC								KCNV1 (375635 upstream) : None (None downstream)																																			---	---	---	---
NSMCE2	286053	broad.mit.edu	37	8	126332501	126332502	+	Intron	INS	-	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126332501_126332502insG	uc003yrw.2	+							NM_173685	NP_775956			non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	128762469	128762470	+	IGR	INS	-	TTCC	TTCC	rs144464525	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128762469_128762470insTTCC								MYC (8791 upstream) : PVT1 (44309 downstream)																																			---	---	---	---
SHARPIN	81858	broad.mit.edu	37	8	145154720	145154720	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145154720delG	uc003zba.2	-	4	1029	c.545delC	c.(544-546)GCTfs	p.A182fs	SHARPIN_uc003zbb.2_RNA	NM_030974	NP_112236	Q9H0F6	SHRPN_HUMAN	shank-interacting protein-like 1	182	Interaction with SHANK1 (By similarity).				negative regulation of inflammatory response|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein linear polyubiquitination|regulation of CD40 signaling pathway|regulation of tumor necrosis factor-mediated signaling pathway	cytosol|LUBAC complex	polyubiquitin binding|zinc ion binding			ovary(1)	1	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
SEMA4D	10507	broad.mit.edu	37	9	91978182	91978183	+	Intron	INS	-	C	C	rs139774075	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91978182_91978183insC	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aql.2_Intron|SEMA4D_uc004aqm.2_Intron	NM_001142287	NP_001135759			semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
SPTAN1	6709	broad.mit.edu	37	9	131347295	131347295	+	Intron	DEL	T	-	-	rs35453610		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131347295delT	uc004bvl.3	+						SPTAN1_uc011mbg.1_Intron|SPTAN1_uc011mbh.1_Intron|SPTAN1_uc004bvm.3_Intron|SPTAN1_uc004bvn.3_Intron	NM_003127	NP_003118			spectrin, alpha, non-erythrocytic 1						actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10																		---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30638286	30638286	+	5'Flank	DEL	A	-	-	rs10826784		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30638286delA	uc001iva.3	-						MTPAP_uc001ivb.3_Intron|MTPAP_uc001ivc.2_5'Flank	NM_018109	NP_060579			PAP associated domain containing 1 precursor						cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	49100260	49100261	+	IGR	INS	-	TTTC	TTTC	rs146682587	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49100260_49100261insTTTC								OR4A47 (588988 upstream) : FOLH1 (67927 downstream)																																			---	---	---	---
TMEM134	80194	broad.mit.edu	37	11	67238892	67238898	+	5'Flank	DEL	TGTTAAT	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67238892_67238898delTGTTAAT	uc001olq.1	-						TMEM134_uc001olp.1_5'Flank|TMEM134_uc001olr.1_5'Flank|TMEM134_uc001ols.1_5'Flank|TMEM134_uc001olt.1_5'Flank|TMEM134_uc010rpt.1_5'Flank|TMEM134_uc009yrx.2_5'Flank|TMEM134_uc010rpu.1_5'Flank|TMEM134_uc001olu.3_5'Flank	NM_025124	NP_079400			transmembrane protein 134 isoform a							integral to membrane					0																		---	---	---	---
AASDHPPT	60496	broad.mit.edu	37	11	105961622	105961625	+	Intron	DEL	TACT	-	-	rs138293505		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105961622_105961625delTACT	uc001pjc.1	+						AASDHPPT_uc010rvn.1_Intron|AASDHPPT_uc001pjd.1_Intron	NM_015423	NP_056238			aminoadipate-semialdehyde						macromolecule biosynthetic process|pantothenate metabolic process	cytosol	holo-[acyl-carrier-protein] synthase activity|magnesium ion binding|protein binding				0		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)														---	---	---	---
ASAM	79827	broad.mit.edu	37	11	123021241	123021243	+	Intron	DEL	AAA	-	-	rs10570650		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123021241_123021243delAAA	uc001pyt.2	-							NM_024769	NP_079045			adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)														---	---	---	---
CLSTN3	9746	broad.mit.edu	37	12	7284211	7284211	+	Intron	DEL	G	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7284211delG	uc001qsr.2	+						RBP5_uc001qsq.2_5'Flank|CLSTN3_uc001qss.2_5'Flank	NM_014718	NP_055533			calsyntenin 3 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1																		---	---	---	---
C12orf54	121273	broad.mit.edu	37	12	48876942	48876943	+	5'Flank	INS	-	CTGAGACATCTGTC	CTGAGACATCTGTC	rs138191429	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48876942_48876943insCTGAGACATCTGTC	uc001rrr.2	+						C12orf54_uc009zky.1_5'Flank	NM_152319	NP_689532			hypothetical protein LOC121273												0																		---	---	---	---
PTPRQ	374462	broad.mit.edu	37	12	81001242	81001269	+	Intron	DEL	CTCCCTCCCACCCTCCCTCCTTCCCTTA	-	-	rs57625204	by1000genomes;by1000genomes;by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81001242_81001269delCTCCCTCCCACCCTCCCTCCTTCCCTTA	uc001sze.2	+							NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0																		---	---	---	---
ATP2B1	490	broad.mit.edu	37	12	90015716	90015716	+	Intron	DEL	T	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90015716delT	uc001tbh.2	-						ATP2B1_uc001tbg.2_Intron|ATP2B1_uc001tbf.2_Intron	NM_001682	NP_001673			plasma membrane calcium ATPase 1 isoform 1b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
ZNF219	51222	broad.mit.edu	37	14	21560753	21560758	+	In_Frame_Del	DEL	GAGGCT	-	-	rs3841049		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21560753_21560758delGAGGCT	uc001vzr.2	-	3	1119_1124	c.698_703delAGCCTC	c.(697-705)CAGCCTCCA>CCA	p.QP233del	ZNF219_uc001vzs.2_In_Frame_Del_p.QP233del|ZNF219_uc010aik.1_In_Frame_Del_p.QP233del	NM_016423	NP_057507	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	233_234					negative regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|histamine receptor activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(1)	1	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)												OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	15	99076662	99076663	+	IGR	INS	-	AGGA	AGGA	rs150869635	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99076662_99076663insAGGA								FAM169B (19051 upstream) : IGF1R (116098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	27088694	27088695	+	IGR	INS	-	TCCTTCCT	TCCTTCCT	rs150155389		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27088694_27088695insTCCTTCCT								C16orf82 (8208 upstream) : JMJD5 (126112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	47794599	47794600	+	IGR	INS	-	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47794599_47794600insA								PHKB (59166 upstream) : ABCC12 (322284 downstream)																																			---	---	---	---
PITPNA	5306	broad.mit.edu	37	17	1451501	1451501	+	Intron	DEL	T	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1451501delT	uc002fst.3	-						PITPNA_uc010cjt.2_Intron|PITPNA_uc010cju.2_Intron	NM_006224	NP_006215			phosphatidylinositol transfer protein, alpha						axon guidance|lipid metabolic process|visual perception	cytoplasm	phosphatidylcholine transmembrane transporter activity|phosphatidylinositol transporter activity|protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)														---	---	---	---
CAMTA2	23125	broad.mit.edu	37	17	4882803	4882804	+	Intron	INS	-	A	A	rs5819002		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4882803_4882804insA	uc002gah.1	-						CAMTA2_uc010cku.1_Intron|CAMTA2_uc002gag.1_Intron|CAMTA2_uc002gai.1_Intron|CAMTA2_uc010ckv.1_Intron	NM_015099	NP_055914			calmodulin binding transcription activator 2						cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1																		---	---	---	---
CCDC144C	348254	broad.mit.edu	37	17	20280158	20280159	+	Intron	INS	-	GC	GC	rs139801618		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20280158_20280159insGC	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0																		---	---	---	---
NOS2	4843	broad.mit.edu	37	17	26115222	26115223	+	Intron	INS	-	CACA	CACA	rs138491079	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26115222_26115223insCACA	uc002gzu.2	-						NOS2_uc010crh.1_Intron|NOS2_uc010wab.1_Intron	NM_000625	NP_000616			nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)													---	---	---	---
FMNL1	752	broad.mit.edu	37	17	43314486	43314486	+	Intron	DEL	A	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43314486delA	uc002iin.2	+							NM_005892	NP_005883			formin-like 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1																		---	---	---	---
SKAP1	8631	broad.mit.edu	37	17	46282339	46282340	+	Intron	INS	-	T	T	rs67682493		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46282339_46282340insT	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717			src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0																		---	---	---	---
TBX2	6909	broad.mit.edu	37	17	59482166	59482166	+	Intron	DEL	C	-	-	rs66504335		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482166delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R353fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985			T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0																		---	---	---	---
MARCH10	162333	broad.mit.edu	37	17	60820059	60820066	+	Intron	DEL	TTTTTTCT	-	-	rs28561633		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60820059_60820066delTTTTTTCT	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345			ring finger protein 190								ligase activity|zinc ion binding				0																		---	---	---	---
AATK	9625	broad.mit.edu	37	17	79115718	79115733	+	Intron	DEL	TCCTTCCTTCCTTCCT	-	-	rs72007585		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79115718_79115733delTCCTTCCTTCCTTCCT	uc010dia.2	-							NM_001080395	NP_001073864			apoptosis-associated tyrosine kinase							integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)															---	---	---	---
CCDC57	284001	broad.mit.edu	37	17	80152186	80152186	+	Intron	DEL	T	-	-	rs35785177		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80152186delT	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron	NM_198082	NP_932348			coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)															---	---	---	---
SMCHD1	23347	broad.mit.edu	37	18	2751166	2751167	+	Intron	INS	-	AT	AT	rs148373283	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2751166_2751167insAT	uc002klm.3	+						SMCHD1_uc002klk.3_Intron|SMCHD1_uc002kll.3_Intron	NM_015295	NP_056110			structural maintenance of chromosomes flexible						chromosome organization		ATP binding				0																		---	---	---	---
PPP4R1	9989	broad.mit.edu	37	18	9576901	9576905	+	Intron	DEL	TAAAG	-	-	rs76696293		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9576901_9576905delTAAAG	uc002koe.1	-						PPP4R1_uc010wzo.1_Intron|PPP4R1_uc002kod.1_Intron|PPP4R1_uc010wzp.1_Intron	NM_001042388	NP_001035847			protein phosphatase 4, regulatory subunit 1						protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1																		---	---	---	---
DTNA	1837	broad.mit.edu	37	18	32457924	32457924	+	Intron	DEL	T	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32457924delT	uc010dmn.1	+						DTNA_uc002kxw.2_Intron|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010xby.1_Intron|DTNA_uc010xbz.1_Intron|DTNA_uc010xca.1_Intron|DTNA_uc002kye.2_Intron	NM_001390	NP_001381			dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0																		---	---	---	---
PAPL	390928	broad.mit.edu	37	19	39589870	39589870	+	Intron	DEL	G	-	-	rs11326424		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39589870delG	uc002oki.2	+						PAPL_uc010egl.2_Intron	NM_001004318	NP_001004318			iron/zinc purple acid phosphatase-like protein							extracellular region	acid phosphatase activity|metal ion binding				0																		---	---	---	---
ALDH16A1	126133	broad.mit.edu	37	19	49964548	49964548	+	Intron	DEL	A	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49964548delA	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160			aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	56053834	56053837	+	IGR	DEL	CATC	-	-	rs113583456		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56053834_56053837delCATC								SBK2 (6173 upstream) : ZNF579 (35055 downstream)																																			---	---	---	---
FKBP1A	2280	broad.mit.edu	37	20	1332880	1332880	+	Intron	DEL	T	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332880delT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron					Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	19831683	19831698	+	IGR	DEL	AAGGAAGGAAGGAGAA	-	-	rs11475764		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19831683_19831698delAAGGAAGGAAGGAGAA								SLC24A3 (128143 upstream) : RIN2 (38512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	36046534	36046535	+	IGR	DEL	AC	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36046534_36046535delAC								SRC (12715 upstream) : BLCAP (99285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52908393	52908395	+	IGR	DEL	CAG	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52908393_52908395delCAG								PFDN4 (71902 upstream) : DOK5 (183862 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	59895806	59895806	+	Intron	DEL	G	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59895806delG	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
POTEH	23784	broad.mit.edu	37	22	16278070	16278070	+	Intron	DEL	A	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16278070delA	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron|POTEH_uc002zlj.1_Intron|uc002zlk.2_RNA	NM_001136213	NP_001129685			ANKRD26-like family C, member 3											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	17822279	17822290	+	IGR	DEL	AAGGAAGGAAGG	-	-	rs146543396		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17822279_17822290delAAGGAAGGAAGG								CECR1 (119541 upstream) : CECR2 (18549 downstream)																																			---	---	---	---
CPT1B	1375	broad.mit.edu	37	22	51007555	51007556	+	Intron	INS	-	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51007555_51007556insA	uc003bmk.3	-						CPT1B_uc003bml.2_Intron|CPT1B_uc003bmm.2_3'UTR|CPT1B_uc003bmo.2_Intron|CPT1B_uc011asa.1_Intron|CPT1B_uc003bmn.2_3'UTR|CPT1B_uc011asb.1_Intron|CHKB-CPT1B_uc003bmp.2_Intron|uc003bmr.1_5'Flank	NM_001145137	NP_001138609			carnitine palmitoyltransferase 1B isoform a						carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	221991	221991	+	Intron	DEL	G	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:221991delG	uc004cpd.1	-						uc004cpe.1_Intron	NM_012227	NP_036359			pseudoautosomal GTP-binding protein-like																														---	---	---	---
MSN	4478	broad.mit.edu	37	X	64952922	64952923	+	Intron	INS	-	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64952922_64952923insA	uc004dwf.2	+							NM_002444	NP_002435			moesin						leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton		MSN/ALK(6)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10								T	ALK	ALCL								---	---	---	---
CD40LG	959	broad.mit.edu	37	X	135732732	135732733	+	Intron	INS	-	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135732732_135732733insA	uc004faa.2	+						CD40LG_uc010nsd.2_Intron|CD40LG_uc010nse.1_Intron	NM_000074	NP_000065			CD40 ligand						anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)									Immune_Deficiency_with_Hyper-IgM				---	---	---	---
Unknown	0	broad.mit.edu	37	Y	14548537	14548537	+	IGR	DEL	T	-	-			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:14548537delT								None (None upstream) : TTTY15 (225761 downstream)																																			---	---	---	---
SFRS11	9295	broad.mit.edu	37	1	70716454	70716454	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70716454A>G	uc001des.2	+	13	1545	c.1421A>G	c.(1420-1422)GAT>GGT	p.D474G	SFRS11_uc001det.2_Missense_Mutation_p.D473G|SFRS11_uc001dev.2_Missense_Mutation_p.D284G|SFRS11_uc001dew.2_Missense_Mutation_p.D414G	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11	474					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
FLG	2312	broad.mit.edu	37	1	152283872	152283872	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152283872T>G	uc001ezu.1	-	3	3526	c.3490A>C	c.(3490-3492)ACC>CCC	p.T1164P	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1164	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155449351	155449351	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155449351G>C	uc009wqq.2	-	3	3790	c.3310C>G	c.(3310-3312)CCA>GCA	p.P1104A	ASH1L_uc001fkt.2_Missense_Mutation_p.P1104A|ASH1L_uc009wqr.1_Missense_Mutation_p.P1104A	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1104					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)															---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155450163	155450163	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155450163G>C	uc009wqq.2	-	3	2978	c.2498C>G	c.(2497-2499)TCT>TGT	p.S833C	ASH1L_uc001fkt.2_Missense_Mutation_p.S833C|ASH1L_uc009wqr.1_Missense_Mutation_p.S833C	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	833					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)															---	---	---	---
SIPA1L2	57568	broad.mit.edu	37	1	232564213	232564213	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232564213C>T	uc001hvg.2	-	15	4512	c.4354G>A	c.(4354-4356)GAT>AAT	p.D1452N	SIPA1L2_uc001hvf.2_Missense_Mutation_p.D526N	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1452					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)																---	---	---	---
HEATR1	55127	broad.mit.edu	37	1	236718881	236718881	+	Silent	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236718881G>A	uc001hyd.1	-	40	5849	c.5724C>T	c.(5722-5724)TCC>TCT	p.S1908S	HEATR1_uc009xgh.1_Silent_p.S1070S	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	1908					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
TFB2M	64216	broad.mit.edu	37	1	246727680	246727680	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246727680C>T	uc001ibn.2	-	2	495	c.370G>A	c.(370-372)GAA>AAA	p.E124K	CNST_uc001ibo.3_5'Flank|CNST_uc001ibp.2_5'Flank|TFB2M_uc010pys.1_RNA	NM_022366	NP_071761	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	124					positive regulation of transcription, DNA-dependent|transcription initiation from mitochondrial promoter	mitochondrial nucleoid	protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity|transcription cofactor activity			ovary(1)	1	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)															---	---	---	---
OR2M3	127062	broad.mit.edu	37	1	248366472	248366472	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248366472T>C	uc010pzg.1	+	1	103	c.103T>C	c.(103-105)TTT>CTT	p.F35L		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	35	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)															---	---	---	---
OR2M3	127062	broad.mit.edu	37	1	248366498	248366498	+	Silent	SNP	T	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248366498T>C	uc010pzg.1	+	1	129	c.129T>C	c.(127-129)TCT>TCC	p.S43S		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)															---	---	---	---
OR2M3	127062	broad.mit.edu	37	1	248366499	248366499	+	Missense_Mutation	SNP	G	A	A	rs112063580		TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248366499G>A	uc010pzg.1	+	1	130	c.130G>A	c.(130-132)GTC>ATC	p.V44I		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	44	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)															---	---	---	---
OR2M7	391196	broad.mit.edu	37	1	248487690	248487690	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487690A>G	uc010pzk.1	-	1	181	c.181T>C	c.(181-183)TTC>CTC	p.F61L		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	61	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
OR2M7	391196	broad.mit.edu	37	1	248487715	248487715	+	Silent	SNP	A	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487715A>G	uc010pzk.1	-	1	156	c.156T>C	c.(154-156)GAT>GAC	p.D52D		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	52	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
WDR35	57539	broad.mit.edu	37	2	20135333	20135333	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20135333G>A	uc002rdi.2	-	22	2587	c.2479C>T	c.(2479-2481)CGG>TGG	p.R827W	WDR35_uc002rdj.2_Missense_Mutation_p.R816W|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Missense_Mutation_p.R392W|WDR35_uc002rdk.3_Missense_Mutation_p.R392W	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	827										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50724576	50724576	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50724576G>T	uc010fbq.2	-	14	4371	c.2894C>A	c.(2893-2895)ACT>AAT	p.T965N	NRXN1_uc002rxb.3_Missense_Mutation_p.T597N|NRXN1_uc002rxe.3_Missense_Mutation_p.T925N|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179543553	179543553	+	Silent	SNP	A	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179543553A>G	uc010zfg.1	-	140	30239	c.30015T>C	c.(30013-30015)CCT>CCC	p.P10005P	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.P6666P|TTN_uc010fre.1_Silent_p.P662P|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10932							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
COL3A1	1281	broad.mit.edu	37	2	189859318	189859318	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189859318C>T	uc002uqj.1	+	19	1462	c.1345C>T	c.(1345-1347)CGC>TGC	p.R449C		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	449	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	p.R449C(1)		central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)													---	---	---	---
KIAA1407	57577	broad.mit.edu	37	3	113737520	113737520	+	Intron	SNP	G	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113737520G>C	uc003eax.2	-						KIAA1407_uc011bin.1_Intron|KIAA1407_uc011bio.1_Intron|KIAA1407_uc011bip.1_Intron	NM_020817	NP_065868			hypothetical protein LOC57577											ovary(2)	2																		---	---	---	---
ATP2C1	27032	broad.mit.edu	37	3	130698260	130698260	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130698260A>G	uc003enl.2	+	19	1960	c.1738A>G	c.(1738-1740)ATC>GTC	p.I580V	ATP2C1_uc011blg.1_Missense_Mutation_p.I614V|ATP2C1_uc011blh.1_Missense_Mutation_p.I575V|ATP2C1_uc011bli.1_Missense_Mutation_p.I614V|ATP2C1_uc003enk.2_Missense_Mutation_p.I564V|ATP2C1_uc003enm.2_Missense_Mutation_p.I580V|ATP2C1_uc003enn.2_Missense_Mutation_p.I564V|ATP2C1_uc003eno.2_Missense_Mutation_p.I580V|ATP2C1_uc003enp.2_Missense_Mutation_p.I580V|ATP2C1_uc003enq.2_Missense_Mutation_p.I580V|ATP2C1_uc003enr.2_Missense_Mutation_p.I580V|ATP2C1_uc003ens.2_Missense_Mutation_p.I580V|ATP2C1_uc003ent.2_Missense_Mutation_p.I580V|ATP2C1_uc003enu.2_Missense_Mutation_p.I258V	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	580	Cytoplasmic (By similarity).		I -> V (in HDD; unable to undergo conformational change necessary for ion transport).		actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)									Hailey-Hailey_disease				---	---	---	---
GRID2	2895	broad.mit.edu	37	4	94436498	94436498	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94436498G>A	uc011cdt.1	+	13	2387	c.2129G>A	c.(2128-2130)CGG>CAG	p.R710Q	GRID2_uc011cdu.1_Missense_Mutation_p.R615Q	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	710	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
MTRR	4552	broad.mit.edu	37	5	7869264	7869264	+	Silent	SNP	G	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7869264G>T	uc003jed.2	+	1	48	c.18G>T	c.(16-18)GTG>GTT	p.V6V	FASTKD3_uc011cmp.1_5'Flank|FASTKD3_uc003jeb.2_5'Flank|FASTKD3_uc003jec.2_5'Flank|MTRR_uc010itn.1_RNA|MTRR_uc003jee.3_5'UTR|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2	6					methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)													---	---	---	---
HMGCS1	3157	broad.mit.edu	37	5	43294196	43294196	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43294196G>C	uc003jnr.3	-	8	1352	c.1145C>G	c.(1144-1146)ACT>AGT	p.T382S	HMGCS1_uc003jnp.3_Missense_Mutation_p.T63S|HMGCS1_uc003jnq.3_Missense_Mutation_p.T382S	NM_001098272	NP_001091742	Q01581	HMCS1_HUMAN	hydroxymethylglutaryl-CoA synthase 1	382					cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0																		---	---	---	---
PCDHGA10	56106	broad.mit.edu	37	5	140792994	140792994	+	Silent	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140792994C>T	uc003lkl.1	+	1	252	c.252C>T	c.(250-252)CGC>CGT	p.R84R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Silent_p.R84R	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	84	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
SPRY4	81848	broad.mit.edu	37	5	141694444	141694444	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141694444G>A	uc003lml.2	-	2	489	c.230C>T	c.(229-231)ACG>ATG	p.T77M	SPRY4_uc010jgi.1_Missense_Mutation_p.T100M	NM_001127496	NP_001120968	Q9C004	SPY4_HUMAN	sprouty homolog 4 isoform 2	77					multicellular organismal development	cytoplasm|ruffle membrane	protein binding			ovary(1)|lung(1)	2		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											Testicular_Cancer_Familial_Clustering_of				---	---	---	---
FAT2	2196	broad.mit.edu	37	5	150934214	150934214	+	Silent	SNP	C	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150934214C>A	uc003lue.3	-	4	3667	c.3654G>T	c.(3652-3654)GGG>GGT	p.G1218G	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1218	Extracellular (Potential).|Cadherin 10.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
BTN3A3	10384	broad.mit.edu	37	6	26448472	26448472	+	Intron	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26448472G>A	uc003nhz.2	+						BTN3A3_uc003nia.2_Intron|BTN3A3_uc011dkn.1_Intron	NM_006994	NP_008925			butyrophilin, subfamily 3, member A3 isoform a							integral to membrane					0																		---	---	---	---
GJA10	84694	broad.mit.edu	37	6	90605698	90605698	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90605698C>G	uc011eaa.1	+	1	1511	c.1511C>G	c.(1510-1512)CCT>CGT	p.P504R		NM_032602	NP_115991	Q969M2	CXA10_HUMAN	gap junction protein, alpha 10	504	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)														---	---	---	---
PTPRK	5796	broad.mit.edu	37	6	128298175	128298175	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128298175T>A	uc003qbk.2	-	26	4100	c.3733A>T	c.(3733-3735)ATC>TTC	p.I1245F	PTPRK_uc003qbj.2_Missense_Mutation_p.I1246F|PTPRK_uc010kfc.2_Missense_Mutation_p.I1252F|PTPRK_uc011ebu.1_Missense_Mutation_p.I1268F	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1245	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)														---	---	---	---
MAP3K4	4216	broad.mit.edu	37	6	161470483	161470483	+	Silent	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161470483C>T	uc003qtn.2	+	3	1321	c.1179C>T	c.(1177-1179)CTC>CTT	p.L393L	MAP3K4_uc010kkc.1_Silent_p.L393L|MAP3K4_uc003qto.2_Silent_p.L393L|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	393					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)														---	---	---	---
PEG10	23089	broad.mit.edu	37	7	94293463	94293463	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94293463G>A	uc011kie.1	+	2	1040	c.823G>A	c.(823-825)GAG>AAG	p.E275K		NM_001040152	NP_001035242	Q86TG7	PEG10_HUMAN	paternally expressed 10 isoform RF1	199	Necessary for interaction with ALK1.				apoptosis|cell differentiation|negative regulation of transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)															---	---	---	---
TEX15	56154	broad.mit.edu	37	8	30695201	30695201	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30695201A>T	uc003xil.2	-	3	7450	c.7450T>A	c.(7450-7452)TCC>ACC	p.S2484T		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2484										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)														---	---	---	---
OSGIN2	734	broad.mit.edu	37	8	90937575	90937575	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90937575G>A	uc003yeg.2	+	6	1679	c.1333G>A	c.(1333-1335)GAA>AAA	p.E445K	OSGIN2_uc003yeh.2_Missense_Mutation_p.E489K	NM_004337	NP_004328	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family	445					germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)															---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100673652	100673652	+	Silent	SNP	A	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100673652A>T	uc003yiv.2	+	35	6165	c.6054A>T	c.(6052-6054)ATA>ATT	p.I2018I	VPS13B_uc003yiw.2_Silent_p.I1993I	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2018					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106815406	106815406	+	Silent	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106815406G>A	uc003ymd.2	+	8	3119	c.3096G>A	c.(3094-3096)CTG>CTA	p.L1032L	ZFPM2_uc011lhs.1_Silent_p.L763L	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	1032					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	114186043	114186043	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114186043G>A	uc003ynu.2	-	4	776	c.617C>T	c.(616-618)ACT>ATT	p.T206I	CSMD3_uc003ynt.2_Missense_Mutation_p.T166I|CSMD3_uc011lhx.1_Missense_Mutation_p.T206I|CSMD3_uc010mcx.1_Missense_Mutation_p.T206I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	206	Extracellular (Potential).|Sushi 1.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
GSN	2934	broad.mit.edu	37	9	124094717	124094717	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124094717C>T	uc004blf.1	+	17	2246	c.2185C>T	c.(2185-2187)CGG>TGG	p.R729W	GSN_uc004bld.1_Missense_Mutation_p.R678W|GSN_uc010mvq.1_Missense_Mutation_p.R689W|GSN_uc010mvr.1_Missense_Mutation_p.R689W|GSN_uc010mvu.1_Missense_Mutation_p.R678W|GSN_uc010mvt.1_Missense_Mutation_p.R678W|GSN_uc010mvs.1_Missense_Mutation_p.R678W|GSN_uc004ble.1_Missense_Mutation_p.R678W|GSN_uc010mvv.1_Missense_Mutation_p.R678W|GSN_uc011lyh.1_Missense_Mutation_p.R695W|GSN_uc011lyi.1_Missense_Mutation_p.R678W|GSN_uc011lyj.1_Missense_Mutation_p.R702W	NM_000177	NP_000168	P06396	GELS_HUMAN	gelsolin isoform a precursor	729	Actin-binding, Ca-sensitive (Potential).				actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3																OREG0019445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
URM1	81605	broad.mit.edu	37	9	131151545	131151545	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131151545C>T	uc004buv.2	+	4	256	c.194C>T	c.(193-195)CCA>CTA	p.P65L	URM1_uc011may.1_Missense_Mutation_p.P65L|URM1_uc004buw.2_RNA	NM_030914	NP_112176	Q9BTM9	URM1_HUMAN	ubiquitin related modifier 1 homolog isoform a	65					tRNA thio-modification|tRNA wobble uridine modification		protein binding				0																		---	---	---	---
LAMC3	10319	broad.mit.edu	37	9	133948214	133948214	+	Missense_Mutation	SNP	G	A	A	rs149766298	byFrequency	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133948214G>A	uc004caa.1	+	19	3507	c.3409G>A	c.(3409-3411)GCG>ACG	p.A1137T		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	1137	Domain II and I.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)														---	---	---	---
BAT2L1	84726	broad.mit.edu	37	9	134319661	134319661	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134319661G>C	uc004can.3	+	5	614	c.559G>C	c.(559-561)GAA>CAA	p.E187Q	BAT2L1_uc004cam.1_Missense_Mutation_p.E187Q	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	187							protein binding				0																		---	---	---	---
BAT2L1	84726	broad.mit.edu	37	9	134319676	134319676	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134319676G>A	uc004can.3	+	5	629	c.574G>A	c.(574-576)GAT>AAT	p.D192N	BAT2L1_uc004cam.1_Missense_Mutation_p.D192N	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	192							protein binding				0																		---	---	---	---
MYST4	23522	broad.mit.edu	37	10	76789623	76789623	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76789623G>A	uc001jwn.1	+	18	5534	c.5041G>A	c.(5041-5043)GAA>AAA	p.E1681K	MYST4_uc001jwo.1_Missense_Mutation_p.E1389K|MYST4_uc001jwp.1_Missense_Mutation_p.E1498K	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	1681	Ser-rich.|Interaction with RUNX1 and RUNX2.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)							T	CREBBP	AML								---	---	---	---
F2	2147	broad.mit.edu	37	11	46749724	46749724	+	Intron	SNP	G	C	C	rs144587241	by1000genomes	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46749724G>C	uc001ndf.3	+						F2_uc001ndg.3_Intron	NM_000506	NP_000497			coagulation factor II preproprotein						activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)													---	---	---	---
F2	2147	broad.mit.edu	37	11	46749725	46749725	+	Intron	SNP	G	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46749725G>C	uc001ndf.3	+						F2_uc001ndg.3_Intron	NM_000506	NP_000497			coagulation factor II preproprotein						activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)													---	---	---	---
MTNR1B	4544	broad.mit.edu	37	11	92702951	92702951	+	Silent	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92702951G>A	uc001pdk.1	+	1	163	c.60G>A	c.(58-60)CCG>CCA	p.P20P		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	20	Extracellular (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)													---	---	---	---
C11orf87	399947	broad.mit.edu	37	11	109294681	109294681	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109294681G>A	uc001pkn.2	+	2	696	c.322G>A	c.(322-324)GGC>AGC	p.G108S	C11orf87_uc010rwb.1_5'Flank	NM_207645	NP_997528	Q6NUJ2	CK087_HUMAN	hypothetical protein LOC399947 precursor	108	Cytoplasmic (Potential).					integral to membrane				ovary(2)	2																		---	---	---	---
PRPH	5630	broad.mit.edu	37	12	49690240	49690240	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49690240G>T	uc001rtu.2	+	3	707	c.632G>T	c.(631-633)CGC>CTC	p.R211L		NM_006262	NP_006253	P41219	PERI_HUMAN	peripherin	211	Coil 1B.|Rod.						structural molecule activity				0																		---	---	---	---
ESPL1	9700	broad.mit.edu	37	12	53673625	53673625	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53673625C>T	uc001sck.2	+	12	2565	c.2474C>T	c.(2473-2475)ACC>ATC	p.T825I	ESPL1_uc001scj.2_Missense_Mutation_p.T500I|ESPL1_uc010soe.1_Missense_Mutation_p.T36I	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	825					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3																		---	---	---	---
ZFC3H1	196441	broad.mit.edu	37	12	72038074	72038074	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72038074T>A	uc001swo.2	-	5	1663	c.1304A>T	c.(1303-1305)CAA>CTA	p.Q435L		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	435	Potential.				RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
UTP20	27340	broad.mit.edu	37	12	101739354	101739354	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101739354C>T	uc001tia.1	+	37	4784	c.4628C>T	c.(4627-4629)ACA>ATA	p.T1543I		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	1543					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4																		---	---	---	---
POMP	51371	broad.mit.edu	37	13	29238647	29238647	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29238647T>G	uc001usf.2	+	3	184	c.103T>G	c.(103-105)TTT>GTT	p.F35V		NM_015932	NP_057016	Q9Y244	POMP_HUMAN	proteasome maturation protein	35					proteasome assembly	cytosol|endoplasmic reticulum|membrane|microsome|nucleus|proteasome complex					0		Lung SC(185;0.0367)		all cancers(112;0.141)|OV - Ovarian serous cystadenocarcinoma(117;0.216)														---	---	---	---
ESD	2098	broad.mit.edu	37	13	47351721	47351721	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47351721C>A	uc001vbn.2	-	9	821	c.638G>T	c.(637-639)GGA>GTA	p.G213V	ESD_uc001vbo.2_Missense_Mutation_p.G213V|ESD_uc001vbp.1_Missense_Mutation_p.G71V	NM_001984	NP_001975	P10768	ESTD_HUMAN	esterase D/formylglutathione hydrolase	213						cytoplasmic membrane-bounded vesicle	carboxylesterase activity|S-formylglutathione hydrolase activity			ovary(1)	1		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	22482993	22482993	+	IGR	SNP	T	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22482993T>C								OR4N3P (68608 upstream) : MIR1268 (30236 downstream)																																			---	---	---	---
RTF1	23168	broad.mit.edu	37	15	41766890	41766890	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41766890C>G	uc001zny.2	+	9	1288	c.1276C>G	c.(1276-1278)CTG>GTG	p.L426V		NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component	426	Plus3.				histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)														---	---	---	---
WDR72	256764	broad.mit.edu	37	15	53991938	53991938	+	Intron	SNP	T	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53991938T>A	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435			WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)														---	---	---	---
ACSM2A	123876	broad.mit.edu	37	16	20497944	20497944	+	Nonsense_Mutation	SNP	C	T	T	rs144468742	byFrequency	TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20497944C>T	uc010bwe.2	+	15	1917	c.1678C>T	c.(1678-1680)CGA>TGA	p.R560*	ACSM2A_uc002dhf.3_Nonsense_Mutation_p.R560*|ACSM2A_uc002dhg.3_Nonsense_Mutation_p.R560*|ACSM2A_uc010vay.1_Nonsense_Mutation_p.R481*|ACSM2A_uc002dhh.3_Nonsense_Mutation_p.R190*|uc002dhi.1_5'Flank	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	560					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3																		---	---	---	---
MYH3	4621	broad.mit.edu	37	17	10546195	10546195	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10546195G>A	uc002gmq.1	-	14	1606	c.1529C>T	c.(1528-1530)ACG>ATG	p.T510M		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	510	Myosin head-like.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7																		---	---	---	---
NGFR	4804	broad.mit.edu	37	17	47587929	47587929	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47587929G>A	uc002ioz.3	+	4	849	c.724G>A	c.(724-726)GTG>ATG	p.V242M		NM_002507	NP_002498	P08138	TNR16_HUMAN	nerve growth factor receptor precursor	242	Ser/Thr-rich.|Extracellular (Potential).				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|negative regulation of axonogenesis|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis	cell surface|cytosol|endosome|extracellular region|integral to plasma membrane|nucleoplasm				ovary(1)|lung(1)	2	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)																	---	---	---	---
LRRC37A3	374819	broad.mit.edu	37	17	62855907	62855907	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62855907C>T	uc002jey.2	-	11	4888	c.4357G>A	c.(4357-4359)GAC>AAC	p.D1453N	LRRC37A3_uc010wqg.1_Missense_Mutation_p.D571N|LRRC37A3_uc002jex.1_Missense_Mutation_p.D430N|LRRC37A3_uc010wqf.1_Missense_Mutation_p.D491N|LRRC37A3_uc010dek.1_Missense_Mutation_p.D459N	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1453	Extracellular (Potential).					integral to membrane					0																		---	---	---	---
KIAA1632	57724	broad.mit.edu	37	18	43464574	43464574	+	Intron	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43464574C>T	uc002lbm.2	-						KIAA1632_uc010xcq.1_Intron|KIAA1632_uc010xcr.1_Intron|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Intron	NM_020964	NP_066015			hypothetical protein LOC57724						autophagy						0																		---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17025586	17025586	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17025586G>A	uc002nfb.2	-	28	3840	c.3808C>T	c.(3808-3810)CGC>TGC	p.R1270C		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1223						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---
CAPN12	147968	broad.mit.edu	37	19	39228254	39228254	+	Silent	SNP	G	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39228254G>C	uc002ojd.1	-	9	1299	c.990C>G	c.(988-990)CTC>CTG	p.L330L	CAPN12_uc010egd.1_5'Flank|CAPN12_uc002ojc.1_5'Flank	NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12	330	Calpain catalytic.				proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)															---	---	---	---
ZNF283	284349	broad.mit.edu	37	19	44351768	44351768	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44351768A>G	uc002oxr.3	+	7	1283	c.1015A>G	c.(1015-1017)ATA>GTA	p.I339V	ZNF283_uc002oxp.3_Missense_Mutation_p.I200V	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	339	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)																---	---	---	---
ZNF530	348327	broad.mit.edu	37	19	58117777	58117777	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58117777A>C	uc002qpk.2	+	3	1104	c.884A>C	c.(883-885)TAT>TCT	p.Y295S	ZNF547_uc002qpm.3_Missense_Mutation_p.M278L|ZNF530_uc002qpl.2_RNA	NM_020880	NP_065931	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	295	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)														---	---	---	---
ZNF133	7692	broad.mit.edu	37	20	18297430	18297430	+	Silent	SNP	G	A	A			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18297430G>A	uc010gcq.2	+	5	2240	c.1935G>A	c.(1933-1935)GGG>GGA	p.G645G	ZNF133_uc010zrv.1_Silent_p.G648G|ZNF133_uc010zrw.1_Silent_p.G582G|ZNF133_uc010gcr.2_Silent_p.G645G|ZNF133_uc010zrx.1_Silent_p.G550G|ZNF133_uc002wql.3_Silent_p.G644G|ZNF133_uc010gcs.2_Silent_p.G644G|ZNF133_uc010zry.1_Silent_p.G550G|ZNF133_uc002wqm.2_Silent_p.G645G	NM_003434	NP_003425	P52736	ZN133_HUMAN	zinc finger protein 133	645						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)	2																		---	---	---	---
PROCR	10544	broad.mit.edu	37	20	33762727	33762727	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33762727G>T	uc002xbt.2	+	2	477	c.293G>T	c.(292-294)CGC>CTC	p.R98L	EDEM2_uc010zuv.1_Intron|PROCR_uc010zuw.1_Missense_Mutation_p.R135L	NM_006404	NP_006395	Q9UNN8	EPCR_HUMAN	endothelial protein C receptor precursor	98	Extracellular (Potential).				antigen processing and presentation|blood coagulation|immune response	integral to plasma membrane|MHC class I protein complex	receptor activity				0			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)													---	---	---	---
KIAA0406	9675	broad.mit.edu	37	20	36624824	36624824	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36624824A>C	uc002xhl.2	-	8	3248	c.3039T>G	c.(3037-3039)ATT>ATG	p.I1013M	KIAA0406_uc002xhm.2_Missense_Mutation_p.I1013M	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	1013							binding				0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
ZNF334	55713	broad.mit.edu	37	20	45133386	45133386	+	Intron	SNP	G	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45133386G>T	uc002xsc.2	-						ZNF334_uc002xsa.2_Intron|ZNF334_uc002xsb.2_Intron|ZNF334_uc002xsd.2_Intron|ZNF334_uc010ghl.2_Intron	NM_018102	NP_060572			zinc finger protein 334 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
DPM1	8813	broad.mit.edu	37	20	49565188	49565188	+	Silent	SNP	T	C	C			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49565188T>C	uc002xvw.1	-	3	273	c.273A>G	c.(271-273)CCA>CCG	p.P91P	DPM1_uc002xvv.1_5'Flank|DPM1_uc002xvx.1_RNA	NM_003859	NP_003850	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase 1	91					C-terminal protein lipidation|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|protein N-linked glycosylation via asparagine|protein O-linked mannosylation	dolichol-phosphate-mannose synthase complex|endoplasmic reticulum membrane|membrane fraction	dolichyl-phosphate beta-D-mannosyltransferase activity|dolichyl-phosphate-mannose-protein mannosyltransferase activity|protein binding			ovary(1)	1																		---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872838	51872838	+	Silent	SNP	T	G	G			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872838T>G	uc002xwo.2	+	2	3797	c.2841T>G	c.(2839-2841)TCT>TCG	p.S947S		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	947	C2H2-type 4.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
BACE2	25825	broad.mit.edu	37	21	42647386	42647386	+	Silent	SNP	C	T	T			TCGA-CG-4475-01A-01D-1158-08	TCGA-CG-4475-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42647386C>T	uc002yyw.2	+	9	1855	c.1392C>T	c.(1390-1392)AGC>AGT	p.S464S	BACE2_uc002yyx.2_Silent_p.S414S|BACE2_uc002yyy.2_3'UTR|BACE2_uc010goo.2_RNA	NM_012105	NP_036237	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2 isoform A	464	Extracellular (Potential).				membrane protein ectodomain proteolysis|negative regulation of amyloid precursor protein biosynthetic process|peptide hormone processing	cell surface|endoplasmic reticulum|endosome|Golgi apparatus|integral to membrane	aspartic-type endopeptidase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)																---	---	---	---
