Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
UBR4	23352	broad.mit.edu	37	1	19505691	19505691	+	Silent	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19505691T>C	uc001bbi.2	-	18	2212	c.2208A>G	c.(2206-2208)GGA>GGG	p.G736G	UBR4_uc001bbm.1_5'UTR	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	736					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AAGGAGCCACTCCTAGCTGCT	0.473													37	71	---	---	---	---	PASS
BTF3L4	91408	broad.mit.edu	37	1	52552415	52552415	+	Silent	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52552415G>A	uc001ctk.2	+	6	670	c.462G>A	c.(460-462)AAG>AAA	p.K154K	BTF3L4_uc001ctl.2_Silent_p.K96K|BTF3L4_uc010onh.1_RNA|BTF3L4_uc001ctm.2_Silent_p.K154K	NM_152265	NP_689478	Q96K17	BT3L4_HUMAN	basic transcription factor 3-like 4 isoform 1	154										large_intestine(1)	1						AGGCATCAAAGAATGAAGCTA	0.323													30	112	---	---	---	---	PASS
DCST2	127579	broad.mit.edu	37	1	154995893	154995893	+	Silent	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154995893G>A	uc001fgm.2	-	13	1991	c.1911C>T	c.(1909-1911)ACC>ACT	p.T637T	DCST2_uc009wpb.2_RNA	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	637	Cytoplasmic (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ACACGGAGCAGGTATTGTCCA	0.602													8	16	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155721637	155721637	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155721637G>C	uc001flz.2	-	31	6594	c.6497C>G	c.(6496-6498)ACC>AGC	p.T2166S	GON4L_uc001flx.1_5'UTR|GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Missense_Mutation_p.T2165S|GON4L_uc009wrh.1_Missense_Mutation_p.T2165S|GON4L_uc001fma.1_Missense_Mutation_p.T2166S	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	2166	Myb-like.				regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTGGCACATGGTGAGGATCAC	0.537													26	52	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157718409	157718409	+	Splice_Site	SNP	C	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157718409C>A	uc001fre.2	-	10	1453	c.1394_splice	c.e10-1	p.V465_splice	FCRL2_uc001frd.2_Splice_Site_p.V212_splice|FCRL2_uc010phz.1_Intron|FCRL2_uc009wsp.2_Intron	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor						cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ACAGAGCCCACTGCAGGGAGA	0.493													10	138	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176659299	176659299	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176659299T>C	uc001gkz.2	+	5	3328	c.2164T>C	c.(2164-2166)TAT>CAT	p.Y722H	PAPPA2_uc001gky.1_Missense_Mutation_p.Y722H|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	722	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CCCAGCATATTATGGGATGCC	0.443													64	181	---	---	---	---	PASS
PLA2R1	22925	broad.mit.edu	37	2	160798242	160798242	+	3'UTR	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160798242G>T	uc002ube.1	-	30					PLA2R1_uc010zcp.1_3'UTR	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor						endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						CTCCTGTTTAGTCTTCTTTAC	0.353													9	29	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179593688	179593688	+	Silent	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179593688A>G	uc010zfg.1	-	62	15569	c.15345T>C	c.(15343-15345)AGT>AGC	p.S5115S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.S1776S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6042							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATATCTCCCACTGTGTCCAT	0.378													24	42	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228176506	228176506	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228176506C>T	uc002vom.1	+	52	5095	c.4933C>T	c.(4933-4935)CCT>TCT	p.P1645S	COL4A3_uc002von.1_Missense_Mutation_p.A1587V|COL4A3_uc002voo.1_Silent_p.S1489S|COL4A3_uc002vop.1_Silent_p.S1419S|uc002voq.1_Intron|uc002vor.1_Intron|COL4A3_uc010fxf.1_Missense_Mutation_p.P61S	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	1645	Collagen IV NC1.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		TTTCAGAAAGCCTATTCCATC	0.299													20	87	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191475	10191475	+	Nonsense_Mutation	SNP	T	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191475T>A	uc003bvc.2	+	3	681	c.468T>A	c.(466-468)TAT>TAA	p.Y156*	VHL_uc003bvd.2_Nonsense_Mutation_p.Y115*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	156			Y -> D (in VHLD; type I).|Y -> N (in pheochromocytoma).|Y -> C (in pheochromocytoma and VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.Y156fs*3(4)|p.?(2)|p.Y156*(2)|p.V155fs*15(2)|p.Y156D(1)|p.Y156fs*1(1)|p.T157fs*16(1)|p.?fs(1)|p.T157*(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TTCCAGTGTATACTCTGAAAG	0.498		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				19	25	---	---	---	---	PASS
NGLY1	55768	broad.mit.edu	37	3	25824816	25824816	+	Silent	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25824816C>T	uc003cdl.2	-	1	174	c.66G>A	c.(64-66)CAG>CAA	p.Q22Q	NGLY1_uc010hfg.2_Silent_p.Q22Q|NGLY1_uc003cdm.2_Silent_p.Q22Q|NGLY1_uc011awo.1_Intron	NM_018297	NP_060767	Q96IV0	NGLY1_HUMAN	N-glycanase 1 isoform 1	22					glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding			breast(1)	1						CCGGGGTGTTCTGGCAGAGCT	0.706													7	4	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49690033	49690033	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49690033G>A	uc003cxe.3	+	5	3158	c.3044G>A	c.(3043-3045)CGT>CAT	p.R1015H		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	1015					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CGCAGGCAGCGTCTAGAAGAA	0.657													18	30	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53845230	53845230	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53845230A>G	uc003dgv.3	+	48	6446	c.6283A>G	c.(6283-6285)ACC>GCC	p.T2095A	CACNA1D_uc003dgu.3_Missense_Mutation_p.T2115A|CACNA1D_uc003dgy.3_Missense_Mutation_p.T2071A|CACNA1D_uc003dgw.3_Missense_Mutation_p.T1762A|CACNA1D_uc011bes.1_RNA	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	2095	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	CTGTGACCTCACCATCGACGA	0.562													7	110	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108205348	108205348	+	Silent	SNP	G	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108205348G>C	uc003dxa.1	-	11	1014	c.957C>G	c.(955-957)CCC>CCG	p.P319P		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	319	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						GGAAGTCTGAGGGATTTGCAG	0.433													17	49	---	---	---	---	PASS
KPNA1	3836	broad.mit.edu	37	3	122160886	122160886	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122160886T>C	uc003efd.1	-	10	1031	c.995A>G	c.(994-996)CAG>CGG	p.Q332R	KPNA1_uc003efb.1_Missense_Mutation_p.Q131R|KPNA1_uc003efc.1_Missense_Mutation_p.Q131R|KPNA1_uc011bjr.1_Missense_Mutation_p.Q131R|KPNA1_uc010hrh.2_Missense_Mutation_p.Q131R|KPNA1_uc003efe.2_Missense_Mutation_p.Q332R	NM_002264	NP_002255	P52294	IMA1_HUMAN	karyopherin alpha 1	332	Binding to RAG1.|NLS binding site (minor) (By similarity).|ARM 7.				DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)		TCTTCATACCTGTGTCTGAAT	0.333													111	303	---	---	---	---	PASS
FAIM	55179	broad.mit.edu	37	3	138348101	138348101	+	Intron	SNP	T	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138348101T>A	uc003esr.2	+						FAIM_uc003eso.1_3'UTR|FAIM_uc003esp.2_Intron|FAIM_uc003esq.2_Intron|FAIM_uc003ess.2_Intron	NM_001033032	NP_001028204	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule isoform c						apoptosis	cytoplasm					0						ATCAAGGCCCTCTTGATAAAA	0.378													12	30	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24491776	24491776	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24491776C>T	uc003jgr.1	-	11	2117	c.1785G>A	c.(1783-1785)ATG>ATA	p.M595I	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	595	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		TGCAGGATTGCATGTTGCCTT	0.532										HNSCC(23;0.051)			58	146	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	5	33162837	33162837	+	RNA	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33162837G>T	uc003jhx.2	+	1		c.572G>T								full-length cDNA clone CS0DI021YI22 of Placenta Cot 25-normalized of Homo sapiens (human).																		CAGTGTGGCCGAGCAGATGGC	0.493													3	46	---	---	---	---	PASS
KDM3B	51780	broad.mit.edu	37	5	137708520	137708520	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137708520G>T	uc003lcy.1	+	2	550	c.350G>T	c.(349-351)TGG>TTG	p.W117L	KDM3B_uc010jew.1_5'UTR	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	117					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						ATTGCACAATGGCCAGCCCTG	0.502													28	104	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150945790	150945790	+	Silent	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150945790T>C	uc003lue.3	-	1	2716	c.2703A>G	c.(2701-2703)AAA>AAG	p.K901K	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Silent_p.K901K	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	901	Extracellular (Potential).|Cadherin 7.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCTGGTGGCCTTTGCTGGGCT	0.542													14	114	---	---	---	---	PASS
TBCC	6903	broad.mit.edu	37	6	42713803	42713803	+	Silent	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42713803G>A	uc003osl.2	-	1	82	c.9C>T	c.(7-9)TCC>TCT	p.S3S		NM_003192	NP_003183	Q15814	TBCC_HUMAN	beta-tubulin cofactor C	3					'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|photoreceptor connecting cilium	chaperone binding|GTPase activity				0	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			AGCAACTGACGGACTCCATAT	0.617													23	66	---	---	---	---	PASS
ME1	4199	broad.mit.edu	37	6	83963360	83963360	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83963360C>T	uc003pjy.2	-	7	908	c.802G>A	c.(802-804)GAT>AAT	p.D268N	ME1_uc011dzb.1_Missense_Mutation_p.D193N|ME1_uc011dzc.1_Missense_Mutation_p.D102N	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1	268					carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)	TGAATATCATCATTGAATGTG	0.289													45	161	---	---	---	---	PASS
TMEM181	57583	broad.mit.edu	37	6	159029391	159029391	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159029391G>A	uc003qrm.3	+	9	1122	c.1111G>A	c.(1111-1113)GTC>ATC	p.V371I	TMEM181_uc010kjr.1_Missense_Mutation_p.V202I	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178	371	Helical; (Potential).				pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		CTCCTTCCTGGTCAACAGCTG	0.577													47	120	---	---	---	---	PASS
ZNF679	168417	broad.mit.edu	37	7	63726378	63726378	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63726378T>A	uc003tsx.2	+	5	636	c.367T>A	c.(367-369)TTA>ATA	p.L123I		NM_153363	NP_699194	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	123					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						ACATGACAATTTACAAGTAAA	0.368													17	44	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142572835	142572835	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142572835A>G	uc003wbx.1	-	9	1421	c.1205T>C	c.(1204-1206)GTA>GCA	p.V402A	TRPV6_uc003wbw.1_Missense_Mutation_p.V188A|TRPV6_uc010lou.1_Missense_Mutation_p.V273A	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	402	Helical; (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CCTCACCTCTACCAGCAGGAT	0.562													46	142	---	---	---	---	PASS
ZNF425	155054	broad.mit.edu	37	7	148801994	148801994	+	Silent	SNP	C	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148801994C>G	uc003wfj.2	-	4	1042	c.969G>C	c.(967-969)CTG>CTC	p.L323L		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	323	C2H2-type 4.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CTCCGCTGTGCAGCCGCAAGT	0.662													15	44	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150554284	150554284	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150554284C>A	uc003why.1	+	3	4944	c.726C>A	c.(724-726)TTC>TTA	p.F242L	ABP1_uc003whz.1_Missense_Mutation_p.F242L|ABP1_uc003wia.1_Missense_Mutation_p.F242L	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	242					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	ACGGGAAGTTCTATGGGAGCC	0.622													42	90	---	---	---	---	PASS
BLK	640	broad.mit.edu	37	8	11412944	11412944	+	Silent	SNP	C	G	G	rs149756811		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11412944C>G	uc003wty.2	+	8	1304	c.723C>G	c.(721-723)CTC>CTG	p.L241L	BLK_uc003wtz.2_Silent_p.L170L	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	241	Protein kinase.				intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		GGCAGTCTCTCAGGCTGGTCA	0.637													28	89	---	---	---	---	PASS
C8orf41	80185	broad.mit.edu	37	8	33370151	33370151	+	5'UTR	SNP	A	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33370151A>C	uc003xjl.3	-	1					C8orf41_uc003xjk.3_5'UTR|C8orf41_uc010lvv.2_5'UTR|C8orf41_uc003xjm.3_5'UTR|C8orf41_uc003xjn.1_5'UTR	NM_025115	NP_079391	Q6NXR4	CH041_HUMAN	hypothetical protein LOC80185								binding				0				KIRC - Kidney renal clear cell carcinoma(67;0.0923)|Kidney(114;0.111)		CAGCACCAGAAGGCTGGTCTC	0.517													29	79	---	---	---	---	PASS
OC90	729330	broad.mit.edu	37	8	133062109	133062109	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133062109G>T	uc003ytg.2	-	1	8	c.8C>A	c.(7-9)GCT>GAT	p.A3D	OC90_uc011lix.1_Intron	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	Error:Variant_position_missing_in_Q02509_after_alignment					lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			AACGTCTTCAGCTGCCATCTT	0.413													48	143	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139190851	139190851	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139190851G>T	uc003yuy.2	-	10	1127	c.956C>A	c.(955-957)ACC>AAC	p.T319N	FAM135B_uc003yux.2_Missense_Mutation_p.T220N|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	319										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CAGGAACTGGGTCCACAGAGT	0.532										HNSCC(54;0.14)			46	93	---	---	---	---	PASS
FAM122A	116224	broad.mit.edu	37	9	71396052	71396052	+	3'UTR	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71396052T>C	uc004agw.1	+	1					PIP5K1B_uc004agu.2_Intron|PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_138333	NP_612206	Q96E09	F122A_HUMAN	hypothetical protein LOC116224												0						ATTTGACCCCTTTTCTTTTTT	0.358													31	67	---	---	---	---	PASS
NR4A3	8013	broad.mit.edu	37	9	102626259	102626259	+	3'UTR	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102626259G>T	uc004baf.1	+	8					NR4A3_uc004bag.1_3'UTR|NR4A3_uc004bai.2_3'UTR	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				AAGAGGAAAAGCAGCTCCTGT	0.448			T	EWSR1	extraskeletal myxoid chondrosarcoma								4	55	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29843732	29843732	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29843732T>G	uc001iut.1	-	5	893	c.140A>C	c.(139-141)GAC>GCC	p.D47A	SVIL_uc001iuu.1_Missense_Mutation_p.D47A|SVIL_uc009xld.1_Missense_Mutation_p.D47A	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	47	Interaction with MYLK (By similarity).				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				GCTGGCAGGGTCGCTGGCTCT	0.587													5	34	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832426	42832426	+	RNA	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832426T>C	uc010qey.1	-	3		c.1549A>G				NR_024380				Homo sapiens noncoding mRNA sequence.												0						AATTCTCTTGTGTATAGTAAG	0.373													3	11	---	---	---	---	PASS
PPYR1	5540	broad.mit.edu	37	10	47088041	47088041	+	3'UTR	SNP	T	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47088041T>A	uc001jee.2	+	3					ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_3'UTR	NM_005972	NP_005963	P50391	NPY4R_HUMAN	pancreatic polypeptide receptor 1						blood circulation|digestion|feeding behavior	integral to plasma membrane				ovary(1)|skin(1)	2						TGGCAAGAGCTGTTTTTGCAT	0.517													3	31	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73472417	73472417	+	Intron	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73472417C>T	uc001jrx.3	+						CDH23_uc001jrz.2_Intron|C10orf105_uc001jsa.1_3'UTR|C10orf105_uc001jsb.1_3'UTR|CDH23_uc001jsc.1_5'UTR	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CTTCAACTCCCACAGACAACG	0.592													5	29	---	---	---	---	PASS
INSC	387755	broad.mit.edu	37	11	15170770	15170770	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15170770G>A	uc001mly.2	+	2	237	c.191G>A	c.(190-192)GGT>GAT	p.G64D	INSC_uc001mlz.2_Missense_Mutation_p.G17D|INSC_uc001mma.2_Missense_Mutation_p.G17D|INSC_uc010rcs.1_Missense_Mutation_p.G17D|INSC_uc001mmb.2_Missense_Mutation_p.G17D|INSC_uc001mmc.2_Missense_Mutation_p.G17D	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	64					cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						ACCCTGCCGGGTCAGCGGTAA	0.617													19	48	---	---	---	---	PASS
WT1	7490	broad.mit.edu	37	11	32421532	32421532	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32421532A>T	uc001mtn.1	-	6	1256	c.1060T>A	c.(1060-1062)TAC>AAC	p.Y354N	WT1_uc001mtl.1_Missense_Mutation_p.Y142N|WT1_uc001mtm.1_Missense_Mutation_p.Y125N|WT1_uc001mto.1_Missense_Mutation_p.Y354N|WT1_uc001mtp.1_Missense_Mutation_p.Y337N|WT1_uc001mtq.1_Missense_Mutation_p.Y337N|WT1_uc009yjs.1_RNA	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D	286					adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding		EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGTATTCTGTATTGGGCTCCG	0.577			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				24	68	---	---	---	---	PASS
ZFP91	80829	broad.mit.edu	37	11	58384897	58384897	+	Silent	SNP	C	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58384897C>A	uc001nmx.3	+	11	1599	c.1431C>A	c.(1429-1431)GGC>GGA	p.G477G	ZFP91_uc001nmy.3_Silent_p.G476G|ZFP91-CNTF_uc010rkm.1_RNA	NM_053023	NP_444251	Q96JP5	ZFP91_HUMAN	zinc finger protein 91	477					activation of NF-kappaB-inducing kinase activity|protein K63-linked ubiquitination	nucleus	nucleic acid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				ATATCTTGGGCACTAACCCAG	0.557													24	59	---	---	---	---	PASS
MS4A3	932	broad.mit.edu	37	11	59837676	59837676	+	Splice_Site	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59837676G>A	uc001nom.2	+	7	744	c.616_splice	c.e7-1	p.E206_splice	MS4A3_uc001non.2_Splice_Site_p.E160_splice|MS4A3_uc001noo.2_Splice_Site_p.E83_splice	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member							endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				TTATTTTCTAGGAAATTTCCT	0.348													29	114	---	---	---	---	PASS
ANKRD42	338699	broad.mit.edu	37	11	82935977	82935977	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82935977A>C	uc001ozz.1	+	6	1005	c.583A>C	c.(583-585)AAA>CAA	p.K195Q	ANKRD42_uc010rsv.1_Missense_Mutation_p.K223Q|ANKRD42_uc001paa.2_Missense_Mutation_p.K223Q|ANKRD42_uc001pab.1_Missense_Mutation_p.K222Q	NM_182603	NP_872409	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42	195										skin(1)	1						GCAAGTTTTAAAAGCTTTCAA	0.408													6	216	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	89774252	89774252	+	Missense_Mutation	SNP	G	A	A	rs145791878	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89774252G>A	uc010rua.1	+	7	1016	c.893G>A	c.(892-894)AGT>AAT	p.S298N		NM_020358	NP_065091			ring finger protein 18																		GAAGCCAACAGTGATATCTTT	0.323													4	48	---	---	---	---	PASS
C11orf63	79864	broad.mit.edu	37	11	122805156	122805156	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122805156A>T	uc001pym.2	+	5	1304	c.1007A>T	c.(1006-1008)GAA>GTA	p.E336V		NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1	336										ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		TCTCAATATGAAAGTACAAAA	0.358													6	71	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122930668	122930668	+	Silent	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122930668A>G	uc001pyo.2	-	5	711	c.633T>C	c.(631-633)ACT>ACC	p.T211T	HSPA8_uc009zbc.2_5'UTR|HSPA8_uc001pyp.2_Silent_p.T211T|HSPA8_uc010rzu.1_Silent_p.T134T|HSPA8_uc009zbd.1_Silent_p.T211T|HSPA8_uc010rzv.1_3'UTR	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	211	Interaction with BAG1.				cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CATCCTCAATAGTGAGGATTG	0.428													35	83	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128839969	128839969	+	Silent	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128839969C>T	uc009zcp.2	-	22	5097	c.5097G>A	c.(5095-5097)AAG>AAA	p.K1699K	ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Silent_p.K658K|ARHGAP32_uc001qez.2_Silent_p.K1350K	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	1699	Interaction with FYN.|Interaction with GAB2.				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						TGTACAAGCTCTTTCCTTGCA	0.537													49	157	---	---	---	---	PASS
TMEM106C	79022	broad.mit.edu	37	12	48358003	48358003	+	5'UTR	SNP	A	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48358003A>T	uc001rqp.2	+	2					TMEM106C_uc001rqo.2_5'UTR|TMEM106C_uc001rqr.2_5'UTR|TMEM106C_uc001rqq.2_5'UTR	NM_024056	NP_076961	Q9BVX2	T106C_HUMAN	transmembrane protein 106C isoform a							endoplasmic reticulum membrane|integral to membrane					0		Acute lymphoblastic leukemia(13;0.11)		GBM - Glioblastoma multiforme(48;0.241)		ACATGACACCAGTGGCATATC	0.507													11	19	---	---	---	---	PASS
AAAS	8086	broad.mit.edu	37	12	53708136	53708136	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53708136G>C	uc001scr.3	-	7	798	c.635C>G	c.(634-636)GCC>GGC	p.A212G	AAAS_uc001scs.3_Missense_Mutation_p.A179G	NM_015665	NP_056480	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency,	212	WD 2.				carbohydrate metabolic process|glucose transport|nucleocytoplasmic transport|regulation of glucose transport|regulation of nucleocytoplasmic transport|transmembrane transport|viral reproduction	nuclear pore				ovary(1)	1						GCTCTGGCAGGCCACAGCCAA	0.577													10	167	---	---	---	---	PASS
ESD	2098	broad.mit.edu	37	13	47345484	47345484	+	3'UTR	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47345484G>T	uc001vbn.2	-	10					ESD_uc001vbo.2_3'UTR	NM_001984	NP_001975	P10768	ESTD_HUMAN	esterase D/formylglutathione hydrolase							cytoplasmic membrane-bounded vesicle	carboxylesterase activity|S-formylglutathione hydrolase activity			ovary(1)	1		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	TTTTTTTTTTGCTCAGCAATA	0.294													7	73	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74336686	74336686	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74336686C>G	uc002awv.2	+	9	2126	c.1986C>G	c.(1984-1986)TTC>TTG	p.F662L	PML_uc002awu.2_Missense_Mutation_p.F614L|PML_uc010ule.1_Missense_Mutation_p.F223L	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	662					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						TGCAGCACTTCCTCAGCTTTC	0.602			T	RARA|PAX5	APL|ALL								39	117	---	---	---	---	PASS
NAT15	79903	broad.mit.edu	37	16	3533548	3533548	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3533548T>C	uc002cvh.3	+	6	769	c.523T>C	c.(523-525)TTC>CTC	p.F175L	NAT15_uc010uxb.1_Missense_Mutation_p.F182L|NAT15_uc010btk.1_Missense_Mutation_p.F110L|NAT15_uc010btl.2_Intron|NAT15_uc010btm.2_Missense_Mutation_p.F175L|NAT15_uc010uxc.1_Missense_Mutation_p.F175L|NAT15_uc010uxd.1_Intron|NAT15_uc010uxe.1_Intron|NAT15_uc002cvg.1_Missense_Mutation_p.F175L	NM_001083601	NP_001077070	Q9H7X0	NAT15_HUMAN	N-acetyltransferase 15	175	N-acetyltransferase.						N-acetyltransferase activity				0						CAAAGATGGCTTCACCTATGT	0.488													9	93	---	---	---	---	PASS
NAT15	79903	broad.mit.edu	37	16	3533549	3533549	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3533549T>A	uc002cvh.3	+	6	770	c.524T>A	c.(523-525)TTC>TAC	p.F175Y	NAT15_uc010uxb.1_Missense_Mutation_p.F182Y|NAT15_uc010btk.1_Missense_Mutation_p.F110Y|NAT15_uc010btl.2_Intron|NAT15_uc010btm.2_Missense_Mutation_p.F175Y|NAT15_uc010uxc.1_Missense_Mutation_p.F175Y|NAT15_uc010uxd.1_Intron|NAT15_uc010uxe.1_Intron|NAT15_uc002cvg.1_Missense_Mutation_p.F175Y	NM_001083601	NP_001077070	Q9H7X0	NAT15_HUMAN	N-acetyltransferase 15	175	N-acetyltransferase.						N-acetyltransferase activity				0						AAAGATGGCTTCACCTATGTC	0.488													9	92	---	---	---	---	PASS
ANKS4B	257629	broad.mit.edu	37	16	21261382	21261382	+	Nonsense_Mutation	SNP	C	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21261382C>G	uc010bwp.1	+	2	538	c.495C>G	c.(493-495)TAC>TAG	p.Y165*	CRYM_uc010bwq.1_Intron	NM_145865	NP_665872	Q8N8V4	ANS4B_HUMAN	harmonin-interacting ankyrin-repeat containing	165										ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0565)		CCCACACCTACAGCAAGGAGG	0.522													30	98	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27497454	27497454	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27497454C>A	uc002dov.1	-	24	3762	c.3722G>T	c.(3721-3723)AGC>ATC	p.S1241I	GTF3C1_uc002dou.2_Missense_Mutation_p.S1241I	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	1241						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						CAGCCTTTTGCTTTTTTCTCC	0.567													102	302	---	---	---	---	PASS
CHST4	10164	broad.mit.edu	37	16	71570851	71570851	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71570851C>T	uc002fan.2	+	2	452	c.271C>T	c.(271-273)CAC>TAC	p.H91Y	CHST4_uc002fao.2_Missense_Mutation_p.H91Y	NM_005769	NP_005760	Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	91	Lumenal (Potential).				cell-cell signaling|immune response|inflammatory response|N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity				0						CTGGATGCTGCACATGGCTGT	0.582													41	108	---	---	---	---	PASS
SMCR8	140775	broad.mit.edu	37	17	18219186	18219186	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18219186A>G	uc002gsy.3	+	1	593	c.83A>G	c.(82-84)GAG>GGG	p.E28G		NM_144775	NP_658988	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region,	28										central_nervous_system(1)	1						GCCCTGCCTGAGGAGTACTCG	0.527													62	118	---	---	---	---	PASS
CYTSB	92521	broad.mit.edu	37	17	20108270	20108270	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20108270A>G	uc002gwq.2	+	4	1053	c.908A>G	c.(907-909)AAC>AGC	p.N303S	CYTSB_uc010cqx.2_Missense_Mutation_p.N303S|CYTSB_uc002gwr.2_Missense_Mutation_p.N303S|CYTSB_uc002gws.2_Missense_Mutation_p.N303S|CYTSB_uc002gwv.2_Missense_Mutation_p.N222S|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Missense_Mutation_p.N79S|CYTSB_uc002gwt.2_Missense_Mutation_p.N222S|CYTSB_uc002gwu.2_Missense_Mutation_p.N222S	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b	303	Ser-rich.					nucleus					0						TATAAAAAAAACATACATGGA	0.453													21	244	---	---	---	---	PASS
BLMH	642	broad.mit.edu	37	17	28575967	28575967	+	3'UTR	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28575967A>G	uc002hez.1	-	12					BLMH_uc010wbn.1_3'UTR	NM_000386	NP_000377	Q13867	BLMH_HUMAN	bleomycin hydrolase						proteolysis	cytoplasm|nucleus	aminopeptidase activity|carboxypeptidase activity|cysteine-type endopeptidase activity|protein binding			ovary(1)	1						CTTTGGCTTCAGTCCCTGGAT	0.517													32	58	---	---	---	---	PASS
CNTNAP1	8506	broad.mit.edu	37	17	40836243	40836243	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40836243A>G	uc002iay.2	+	3	575	c.359A>G	c.(358-360)AAC>AGC	p.N120S	CCR10_uc002iax.3_5'Flank|CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	120	Extracellular (Potential).|F5/8 type C.				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CGAGGGCACAACTCGGTACTC	0.607													69	144	---	---	---	---	PASS
MKS1	54903	broad.mit.edu	37	17	56285343	56285343	+	Silent	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56285343A>G	uc002ivr.1	-	14	1260	c.1185T>C	c.(1183-1185)CCT>CCC	p.P395P	MKS1_uc010wnq.1_Silent_p.P192P|MKS1_uc002ivs.1_Silent_p.P395P	NM_017777	NP_060247	Q9NXB0	MKS1_HUMAN	Meckel syndrome type 1 protein isoform 1	395	B9.				cilium assembly	centrosome|cilium|microtubule basal body	protein binding			ovary(1)	1						AGTAGAGCACAGGCCACTCCG	0.622													12	46	---	---	---	---	PASS
TBC1D3P2	440452	broad.mit.edu	37	17	60342186	60342186	+	RNA	SNP	T	C	C	rs79096325		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60342186T>C	uc010woz.1	-	14		c.1943A>G				NR_027486				Homo sapiens cDNA FLJ60189 complete cds, highly similar to TBC1 domain family member 3.												0						GCTGGGGGTGTTGGGAGGGGC	0.493													3	12	---	---	---	---	PASS
CACNG4	27092	broad.mit.edu	37	17	65021007	65021007	+	Silent	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65021007C>T	uc002jft.1	+	3	351	c.336C>T	c.(334-336)ATC>ATT	p.I112I		NM_014405	NP_055220	Q9UBN1	CCG4_HUMAN	voltage-dependent calcium channel gamma-4	112	Helical; (Potential).				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			TCTTCCCCATCCTCAGCACCA	0.652													35	129	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6966196	6966196	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6966196T>A	uc002knm.2	-	49	7094	c.7000A>T	c.(7000-7002)AAT>TAT	p.N2334Y	LAMA1_uc002knl.2_5'Flank|LAMA1_uc010wzj.1_Missense_Mutation_p.N1810Y	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2334	Laminin G-like 2.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GAAAAGGTATTAAAAAGCATG	0.473													22	65	---	---	---	---	PASS
ME2	4200	broad.mit.edu	37	18	48439249	48439249	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48439249A>C	uc002ley.2	+	4	577	c.321A>C	c.(319-321)TTA>TTC	p.L107F	ME2_uc010dpd.2_Missense_Mutation_p.L107F	NM_002396	NP_002387	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	107					malate metabolic process	mitochondrial matrix	electron carrier activity|malate dehydrogenase (decarboxylating) activity|malate dehydrogenase (oxaloacetate-decarboxylating) activity|metal ion binding|NAD binding				0		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)	NADH(DB00157)	TTGAGAGTTTAATGCCAATTG	0.338													82	288	---	---	---	---	PASS
MAST3	23031	broad.mit.edu	37	19	18234143	18234143	+	Silent	SNP	C	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18234143C>A	uc002nhz.3	+	6	429	c.429C>A	c.(427-429)GGC>GGA	p.G143G		NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase	143							ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						ATGAGGAAGGCGGCCGGTCAC	0.687													3	33	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35827039	35827039	+	Silent	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35827039G>T	uc010edt.2	+	4	590	c.513G>T	c.(511-513)CCG>CCT	p.P171P	CD22_uc010xst.1_Intron|CD22_uc010edu.2_Silent_p.P171P|CD22_uc010edv.2_Silent_p.P171P|CD22_uc002nzb.3_Silent_p.P171P|CD22_uc010edx.2_5'Flank	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	171	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	ATGGGTATCCGATCCAATTGC	0.532													47	116	---	---	---	---	PASS
ZNF773	374928	broad.mit.edu	37	19	58018037	58018037	+	Nonsense_Mutation	SNP	A	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58018037A>T	uc002qox.2	+	4	714	c.574A>T	c.(574-576)AAA>TAA	p.K192*	ZNF547_uc002qpm.3_Intron|ZNF773_uc002qoy.2_Nonsense_Mutation_p.K191*|ZNF773_uc002qoz.2_Intron	NM_198542	NP_940944	Q6PK81	ZN773_HUMAN	zinc finger protein 773	192	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		AAGGCATTACAAATGCAGTGA	0.473													34	81	---	---	---	---	PASS
CTCFL	140690	broad.mit.edu	37	20	56099123	56099123	+	Silent	SNP	A	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56099123A>G	uc010gix.1	-	1	801	c.139T>C	c.(139-141)TTG>CTG	p.L47L	CTCFL_uc010giw.1_Silent_p.L47L|CTCFL_uc002xym.2_Silent_p.L47L|CTCFL_uc010giz.1_Intron|CTCFL_uc010giy.1_Intron|CTCFL_uc010gja.1_Silent_p.L47L|CTCFL_uc010gjb.1_Silent_p.L47L|CTCFL_uc010gjc.1_Silent_p.L47L|CTCFL_uc010gjd.1_Silent_p.L47L|CTCFL_uc010gje.2_Silent_p.L47L|CTCFL_uc010gjf.2_Intron|CTCFL_uc010gjg.2_Intron|CTCFL_uc010gjh.1_Silent_p.L47L|CTCFL_uc010gji.1_Intron|CTCFL_uc010gjj.1_Silent_p.L47L|CTCFL_uc010gjk.1_Silent_p.L47L|CTCFL_uc010gjl.1_Silent_p.L47L	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein	47					cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			TCGGCCTCCAACTCACTAGGG	0.572													138	375	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	11012923	11012923	+	RNA	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11012923T>C	uc002yis.1	-	9		c.1698A>G						P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTACCTAGCTTTTTTACTTTT	0.289													25	33	---	---	---	---	PASS
BACH1	571	broad.mit.edu	37	21	30714928	30714928	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30714928G>T	uc002ynj.2	+	5	2100	c.1985G>T	c.(1984-1986)GGT>GTT	p.G662V	BACH1_uc002ynk.2_Missense_Mutation_p.G662V|BACH1_uc002ynl.2_Intron	NM_001186	NP_001177	O14867	BACH1_HUMAN	BTB and CNC homology 1 transcription factor	662						nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|liver(1)	2						ACTCCTGATGGTGAACTGGCG	0.478													61	175	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18844763	18844763	+	RNA	SNP	T	C	C			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18844763T>C	uc002zoe.2	+	4		c.2017T>C			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		TCACAGCCTCTGAGGGCAGCA	0.562													3	25	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23006960	23006960	+	RNA	SNP	C	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23006960C>A	uc011aim.1	+	119		c.7563C>A								Parts of antibodies, mostly variable regions.												0						GGGCTCTGCTCCTCCTCACCC	0.627													7	15	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23006961	23006961	+	RNA	SNP	C	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23006961C>T	uc011aim.1	+	119		c.7564C>T								Parts of antibodies, mostly variable regions.												0						GGCTCTGCTCCTCCTCACCCT	0.627													7	15	---	---	---	---	PASS
CRYBB3	1417	broad.mit.edu	37	22	25597349	25597349	+	Translation_Start_Site	SNP	G	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25597349G>T	uc003abo.1	+	2	58	c.-14G>T	c.(-16--12)GAGGT>GATGT			NM_004076	NP_004067	P26998	CRBB3_HUMAN	crystallin, beta B3						visual perception		protein binding|structural constituent of eye lens				0						TGAAGCCAGAGGTGTTCCTGG	0.577													49	176	---	---	---	---	PASS
WNT7B	7477	broad.mit.edu	37	22	46372650	46372650	+	5'UTR	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46372650G>A	uc003bgo.2	-	1						NM_058238	NP_478679	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family,						activation of JUN kinase activity|anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|central nervous system vasculogenesis|chorio-allantoic fusion|developmental growth involved in morphogenesis|embryonic placenta morphogenesis|establishment or maintenance of polarity of embryonic epithelium|fibroblast proliferation|forebrain regionalization|inner medullary collecting duct development|lens fiber cell development|lobar bronchus development|lung epithelium development|lung morphogenesis|lung-associated mesenchyme development|mammary gland epithelium development|metanephric collecting duct development|metanephric loop of Henle development|metanephros morphogenesis|negative regulation of smoothened signaling pathway|outer medullary collecting duct development|oxygen homeostasis|positive regulation of JNK cascade|positive regulation of osteoblast differentiation|renal inner medulla development|renal outer medulla development|stem cell proliferation|synapse organization|trachea cartilage morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled binding|signal transducer activity			lung(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		AGGGAGGGGGGCTGCGCCATA	0.682													6	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	11922	11922	+	RNA	SNP	G	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:11922G>A	uc004cov.3	+	1		c.1345G>A			uc004cow.1_5'Flank|uc004cox.3_5'Flank|uc004coy.2_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		CACGTTCTCCTGATCAAATAT	0.458													9	32	---	---	---	---	PASS
ACOT7	11332	broad.mit.edu	37	1	6399799	6399800	+	Intron	INS	-	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6399799_6399800insT	uc001ams.2	-						ACOT7_uc010nzq.1_Intron|ACOT7_uc001amt.2_Intron|ACOT7_uc001amu.2_Intron|ACOT7_uc001amv.2_Intron|ACOT7_uc001amq.2_Intron|ACOT7_uc001amr.2_Intron	NM_181864	NP_863654	O00154	BACH_HUMAN	acyl-CoA thioesterase 7 isoform hBACHb							mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		TGGCACCGCGGttttttttttt	0.267													6	3	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21267791	21267791	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21267791delT	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_3'UTR|EIF4G3_uc010odk.1_3'UTR|EIF4G3_uc001beh.2_3'UTR	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CTCATTTGCATTTTTAGACAA	0.358													9	4	---	---	---	---	
SF3A3	10946	broad.mit.edu	37	1	38446097	38446098	+	Intron	INS	-	A	A	rs147744511		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38446097_38446098insA	uc001cci.2	-						SF3A3_uc010oik.1_Intron	NM_006802	NP_006793	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3						nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nuclear speck	nucleic acid binding|protein binding|zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				actccgtctccaaaaaaaaaaa	0.178													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	45996466	45996467	+	IGR	INS	-	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45996466_45996467insA								PRDX1 (8857 upstream) : AKR1A1 (20031 downstream)																							ggctctgtctcaaaaaaaaaaa	0.203													7	5	---	---	---	---	
STXBP3	6814	broad.mit.edu	37	1	109301020	109301020	+	Intron	DEL	C	-	-	rs3841723		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109301020delC	uc001dvy.2	+						STXBP3_uc001dvz.2_Intron	NM_007269	NP_009200	O00186	STXB3_HUMAN	syntaxin binding protein 3						negative regulation of calcium ion-dependent exocytosis|neutrophil degranulation|platelet aggregation|protein transport|vesicle docking involved in exocytosis	cytosol|nucleus|platelet alpha granule|specific granule|tertiary granule	syntaxin-2 binding			ovary(3)|central_nervous_system(1)	4		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		AAACTTTTAGCCAGTAAAGTT	0.234													1	5	---	---	---	---	
TTF2	8458	broad.mit.edu	37	1	117628869	117628870	+	Intron	INS	-	TG	TG	rs151081029	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117628869_117628870insTG	uc001egy.2	+							NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TACCTCCAAAAtgtgtgtgtgt	0.337													6	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	146009232	146009233	+	Intron	INS	-	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146009232_146009233insA	uc001emp.3	+							NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AACTTGCTAAGAAAAAAAAAAA	0.490													3	4	---	---	---	---	
ALDH9A1	223	broad.mit.edu	37	1	165649468	165649469	+	Intron	DEL	AC	-	-	rs142442065		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165649468_165649469delAC	uc001gdh.1	-						ALDH9A1_uc010pky.1_Intron|ALDH9A1_uc010pkz.1_Intron|ALDH9A1_uc010pla.1_Intron	NM_000696	NP_000687	P49189	AL9A1_HUMAN	aldehyde dehydrogenase 9A1						carnitine biosynthetic process|cellular aldehyde metabolic process|hormone metabolic process|neurotransmitter biosynthetic process	cytosol|plasma membrane	3-chloroallyl aldehyde dehydrogenase activity|4-trimethylammoniobutyraldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aminobutyraldehyde dehydrogenase activity				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				NADH(DB00157)	GTCCACTAAGACACATCCTCTC	0.446													4	2	---	---	---	---	
ARID4B	51742	broad.mit.edu	37	1	235394233	235394234	+	Intron	INS	-	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235394233_235394234insA	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron|ARID4B_uc001hwt.3_Intron	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			actctgtctccaaaaaaaaaaa	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90447339	90447342	+	Intron	DEL	TCTA	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90447339_90447342delTCTA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GTTTGTTACCTCTATCTACTGTCT	0.353													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139045439	139045439	+	3'UTR	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139045439delT	uc010zbk.1	-	1										SubName: Full=cDNA, FLJ79100, highly similar to 14-3-3 protein epsilon (14-3-3E);																		TTGAAAACTGtttttttaaaa	0.368													11	5	---	---	---	---	
NCKAP1	10787	broad.mit.edu	37	2	183853979	183853979	+	Intron	DEL	G	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183853979delG	uc002upc.2	-						NCKAP1_uc002upb.2_Intron	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1						apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TGGTGACAGTGTAGCTTTTGA	0.323													30	14	---	---	---	---	
DHX30	22907	broad.mit.edu	37	3	47852443	47852443	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47852443delT	uc003cru.2	+						DHX30_uc003crr.3_Intron|DHX30_uc003crs.2_Intron|DHX30_uc003crt.2_Intron	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30							mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		ATTAAAATCCttttttttttt	0.259													4	2	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52597379	52597379	+	Frame_Shift_Del	DEL	C	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52597379delC	uc003des.2	-	24	4018	c.4006delG	c.(4006-4008)GTCfs	p.V1336fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.V1336fs|PBRM1_uc003der.2_Frame_Shift_Del_p.V1304fs|PBRM1_uc003det.2_Frame_Shift_Del_p.V1351fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.V1351fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.V1336fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.V1311fs|PBRM1_uc003dey.2_Splice_Site_p.E1310_splice|PBRM1_uc003dez.1_Frame_Shift_Del_p.V1335fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1336					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GGTTCAATGACCTCACTATCT	0.498			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								69	52	---	---	---	---	
GABRR3	200959	broad.mit.edu	37	3	97711421	97711421	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97711421delT	uc011bgr.1	-							NM_001105580	NP_001099050	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 3						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity				0						TGTCAACCCCTTTTATTCAAA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156978684	156978688	+	IGR	DEL	TTTTA	-	-	rs71740874		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156978684_156978688delTTTTA								CCNL1 (100202 upstream) : VEPH1 (10 downstream)																							CTGTAGCTCCTTTTATTTTATTTTA	0.361													5	4	---	---	---	---	
SCLT1	132320	broad.mit.edu	37	4	129869491	129869491	+	Intron	DEL	A	-	-	rs145196324		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129869491delA	uc003igp.2	-						SCLT1_uc003ign.2_Intron|SCLT1_uc003igo.2_Intron|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						actccattgcaaaaaaaaaaa	0.124													5	4	---	---	---	---	
KLHL2	11275	broad.mit.edu	37	4	166198901	166198910	+	Intron	DEL	ACACACACAC	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166198901_166198910delACACACACAC	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		GATGTTAAAAacacacacacacacacacac	0.352													2	5	---	---	---	---	
RNASEN	29102	broad.mit.edu	37	5	31405874	31405874	+	Intron	DEL	C	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31405874delC	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						TTTCAAGAttctttttttttt	0.303													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163352857	163352870	+	IGR	DEL	ACACACACACACAT	-	-	rs144585615	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163352857_163352870delACACACACACACAT								MAT2B (406524 upstream) : None (None downstream)																							GTGCATGTacacacacacacacatacacacacac	0.159													4	2	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	178012719	178012720	+	Intron	INS	-	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178012719_178012720insG	uc003mje.2	-							NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TGGATGGCGCTGGGGTAACACT	0.386													4	2	---	---	---	---	
RPS10	6204	broad.mit.edu	37	6	34389797	34389797	+	Intron	DEL	A	-	-	rs34411335		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34389797delA	uc003ojm.2	-						RPS10_uc003ojn.2_Intron	NM_001014	NP_001005	P46783	RS10_HUMAN	ribosomal protein S10						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding				0						TGCAAATCTGAAAAAAAAAAA	0.323													4	3	---	---	---	---	
LRP11	84918	broad.mit.edu	37	6	150173960	150173961	+	Intron	DEL	CT	-	-	rs142047967		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150173960_150173961delCT	uc003qng.2	-						LRP11_uc003qnh.1_Intron	NM_032832	NP_116221	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein							integral to membrane	receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		TTGCTGCTCACTCTCAGCAGAA	0.421													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	6897157	6897158	+	IGR	INS	-	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6897157_6897158insA								C7orf28B (31296 upstream) : C1GALT1 (325088 downstream)																							AGAGACTGGCTAGGGAAGGGGT	0.634													4	2	---	---	---	---	
TMEM195	392636	broad.mit.edu	37	7	15405181	15405181	+	Frame_Shift_Del	DEL	A	-	-	rs76463825	byFrequency	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15405181delA	uc003stb.1	-	12	1391	c.1221delT	c.(1219-1221)GGTfs	p.G407fs		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	407					ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						GCTTCAGGTGACCAAATCGGT	0.393													44	19	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18957968	18957969	+	Intron	INS	-	G	G			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18957968_18957969insG	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc003suk.2_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	GGGGGGATGGAGGGGAAAGGGG	0.490													4	2	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76634275	76634280	+	Intron	DEL	TGCTGT	-	-	rs67390349		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76634275_76634280delTGCTGT	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						GTGCGGGGACTGCTGTGGGGCCTGGG	0.660													5	4	---	---	---	---	
TTC26	79989	broad.mit.edu	37	7	138853315	138853316	+	Intron	INS	-	A	A	rs112942380		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138853315_138853316insA	uc003vus.2	+						TTC26_uc003vur.3_3'UTR|TTC26_uc011kqn.1_Intron|TTC26_uc011kqo.1_Intron|TTC26_uc011kqp.1_Intron|TTC26_uc003vut.2_Intron|TTC26_uc011kqq.1_Intron	NM_024926	NP_079202	A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26 isoform 1								binding			ovary(1)	1						TATTTAGAGACAAAAAAAAAAA	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150311028	150311029	+	IGR	INS	-	CTCTAT	CTCTAT	rs141505392	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150311028_150311029insCTCTAT								GIMAP4 (39988 upstream) : GIMAP6 (11437 downstream)																							tctctatttacctctatctcta	0.094													6	5	---	---	---	---	
TACC1	6867	broad.mit.edu	37	8	38683083	38683083	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38683083delT	uc010lwp.2	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc011lbz.1_Intron|TACC1_uc003xmb.3_Intron|TACC1_uc003xme.1_Intron|TACC1_uc003xmd.1_Intron|TACC1_uc010lwo.1_Intron|TACC1_uc003xmf.3_Intron|TACC1_uc011lca.1_Intron|TACC1_uc011lcb.1_Intron|TACC1_uc011lcc.1_Intron|TACC1_uc011lcd.1_Intron|TACC1_uc003xmh.3_Intron|TACC1_uc010lwq.2_Intron	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			acaatgactcttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	46842305	46842306	+	IGR	INS	-	T	T	rs112878403		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:46842305_46842306insT								None (None upstream) : BEYLA (910202 downstream)																							tatgctgaaaaaggaaatatct	0.000													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	48144963	48144963	+	IGR	DEL	A	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48144963delA								BEYLA (377556 upstream) : KIAA0146 (28579 downstream)																							agcaagactcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
PLIN2	123	broad.mit.edu	37	9	19120062	19120063	+	Intron	INS	-	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19120062_19120063insT	uc003zno.2	-						PLIN2_uc011lna.1_Intron|PLIN2_uc011lnb.1_Intron	NM_001122	NP_001113	Q99541	PLIN2_HUMAN	adipose differentiation-related protein						cellular lipid metabolic process	endoplasmic reticulum|extracellular region|lipid particle				ovary(2)	2						GAGTAAACTGCttttttttttt	0.233													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	30774794	30774794	+	IGR	DEL	A	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30774794delA								None (None upstream) : None (None downstream)																							TTCAAAGGTCAAAAAAAAAAA	0.373													3	3	---	---	---	---	
PIP5K1B	8395	broad.mit.edu	37	9	71534251	71534252	+	Intron	INS	-	A	A			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71534251_71534252insA	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		aaggaacaaacaaaaaaaaaag	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93513767	93513768	+	IGR	INS	-	T	T	rs137945403	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93513767_93513768insT								DIRAS2 (108659 upstream) : SYK (50244 downstream)																							AGGCTTTATACTCCCATCTGAC	0.431													4	2	---	---	---	---	
FBP2	8789	broad.mit.edu	37	9	97349981	97349981	+	Intron	DEL	C	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97349981delC	uc004auv.2	-							NM_003837	NP_003828	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2						fructose metabolic process|gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)				AATGAGATGACCCAGGACTCA	0.498													4	3	---	---	---	---	
NEK6	10783	broad.mit.edu	37	9	127088493	127088493	+	Intron	DEL	G	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127088493delG	uc004bog.2	+						NEK6_uc004bof.2_Intron|NEK6_uc004boh.2_Intron|NEK6_uc010mwj.2_Intron|NEK6_uc010mwk.2_Intron|NEK6_uc004boi.2_Intron	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2						apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3						CCCCCCCCCCGCCCCTGCCAG	0.632													3	3	---	---	---	---	
OLFML2A	169611	broad.mit.edu	37	9	127571880	127571880	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127571880delT	uc004bov.2	+						OLFML2A_uc004bow.2_Intron	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor												0						cctctgagccttttttttttt	0.134													6	3	---	---	---	---	
SEC61A2	55176	broad.mit.edu	37	10	12210026	12210027	+	Intron	INS	-	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12210026_12210027insT	uc001ilg.3	+						SEC61A2_uc001ilf.3_Intron|SEC61A2_uc001ilh.3_Intron|uc001ili.1_5'Flank|NUDT5_uc001ilj.2_Intron|NUDT5_uc001ilk.2_Intron	NM_001142627	NP_001136099	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform c							endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				AGGGATAATGAttttttttttt	0.163													4	3	---	---	---	---	
MCM10	55388	broad.mit.edu	37	10	13233564	13233567	+	Intron	DEL	AAGC	-	-	rs112703555		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13233564_13233567delAAGC	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						ATAAATAAATaagcaagcaagcaa	0.137													10	5	---	---	---	---	
HERC4	26091	broad.mit.edu	37	10	69705574	69705578	+	Intron	DEL	AACAT	-	-	rs35496892		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69705574_69705578delAACAT	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						caaatcaaaaaacatacgacagata	0.000													4	2	---	---	---	---	
NRAP	4892	broad.mit.edu	37	10	115357132	115357132	+	Intron	DEL	A	-	-	rs113389465		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115357132delA	uc001laj.2	-						NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Intron|NRAP_uc001lal.3_Intron	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GATATGGAACATTTTACAGGT	0.383													5	7	---	---	---	---	
WDR11	55717	broad.mit.edu	37	10	122633698	122633699	+	Intron	INS	-	G	G	rs59566226		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122633698_122633699insG	uc010qtf.1	+						WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_Intron	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2							integral to membrane					0						gttttttttttttttttgttgt	0.163													4	2	---	---	---	---	
DENND5A	23258	broad.mit.edu	37	11	9200048	9200048	+	Intron	DEL	A	-	-	rs76387081		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9200048delA	uc001mhl.2	-						DENND5A_uc010rbw.1_Intron|DENND5A_uc010rbx.1_Intron	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1											liver(1)	1						TCTCTACATTAAAAAAAAAAA	0.393													4	2	---	---	---	---	
RTN3	10313	broad.mit.edu	37	11	63472093	63472093	+	Intron	DEL	A	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63472093delA	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						ATGTTTGACTAAAAAAAAAAA	0.323													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89771845	89771846	+	Intron	DEL	TT	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89771845_89771846delTT	uc010rua.1	+							NM_020358	NP_065091			ring finger protein 18																		ATCTTTCTTCTTTTTTTTTTTT	0.351													6	3	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178450	134178451	+	Intron	INS	-	CAC	CAC	rs140914654	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178450_134178451insCAC	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		accatcaccatcaccaccacca	0.000													4	2	---	---	---	---	
MIR1293	100302220	broad.mit.edu	37	12	50627995	50627995	+	RNA	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50627995delT	hsa-mir-1293|MI0006355	-			c.1delT			LIMA1_uc001rwj.3_Intron|LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron																	0						CAGAACAACCttttttttttt	0.229													4	3	---	---	---	---	
CELA1	1990	broad.mit.edu	37	12	51736597	51736597	+	Intron	DEL	T	-	-	rs5798169		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51736597delT	uc001ryi.1	-							NM_001971	NP_001962	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1						proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			breast(1)	1						ATTTAGGAAAttttttttttt	0.174													4	2	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120204681	120204681	+	Intron	DEL	A	-	-	rs36109532		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120204681delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GACCACATTTAAAAAAAAAAA	0.274													6	3	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124315343	124315343	+	Intron	DEL	T	-	-	rs7976816		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124315343delT	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		aaaaaaaaaattagctgagcg	0.100													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128181755	128181775	+	IGR	DEL	GTGATAGTGGTGATGATGGCA	-	-	rs114213243	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128181755_128181775delGTGATAGTGGTGATGATGGCA								None (None upstream) : TMEM132C (717516 downstream)																							ggtggtggtggtgatagtggtgatgatggcagtggtgatag	0.000													4	2	---	---	---	---	
EPSTI1	94240	broad.mit.edu	37	13	43543058	43543061	+	Intron	DEL	ACAC	-	-	rs71970864		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43543058_43543061delACAC	uc001uyw.1	-						EPSTI1_uc001uyx.1_Intron	NM_001002264	NP_001002264	Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 isoform 1											ovary(1)	1		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		AAAAAAAAATacacacacacacac	0.309													4	2	---	---	---	---	
KIAA1704	55425	broad.mit.edu	37	13	45594776	45594776	+	Intron	DEL	A	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45594776delA	uc001uzq.2	+						KIAA1704_uc001uzr.1_Intron|KIAA1704_uc001uzs.2_Intron|KIAA1704_uc001uzt.2_Intron	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425											pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		CTAATGTCTCAAAAAAAAAAA	0.264													4	3	---	---	---	---	
HAUS4	54930	broad.mit.edu	37	14	23419361	23419361	+	Intron	DEL	C	-	-	rs59423232	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23419361delC	uc001whp.2	-						HAUS4_uc001who.2_Intron|HAUS4_uc001whq.2_Intron|HAUS4_uc001whr.2_Intron|HAUS4_uc001whs.2_Intron|HAUS4_uc001wht.2_Intron|HAUS4_uc001whu.2_Intron|HAUS4_uc001whv.2_Intron|HAUS4_uc001whw.2_Intron|HAUS4_uc001whx.2_Intron	NM_017815	NP_060285	Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				ovary(1)	1						aacaaaaaaacaaaaaGTCCT	0.149													6	3	---	---	---	---	
ATG2B	55102	broad.mit.edu	37	14	96762064	96762065	+	Intron	INS	-	CACACACACACACACA	CACACACACACACACA	rs148889627	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96762064_96762065insCACACACACACACACA	uc001yfi.2	-							NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B											ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CTTCCCCCCACcacacacacac	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22118395	22118396	+	IGR	DEL	AC	-	-	rs139043886		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22118395_22118396delAC								CXADRP2 (101517 upstream) : LOC727924 (159636 downstream)																							ATAAATTATAACATTCTTTTTG	0.342													7	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22490731	22490731	+	IGR	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22490731delT								OR4N3P (76346 upstream) : MIR1268 (22498 downstream)																							ACGAGCTCACTTGTCCCCATC	0.468													4	2	---	---	---	---	
TUBGCP4	27229	broad.mit.edu	37	15	43693650	43693650	+	Intron	DEL	A	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43693650delA	uc001zro.2	+						TUBGCP4_uc001zrn.2_Intron|TUBGCP4_uc010bdh.2_Intron	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		actccgtctcaaaaaaaaaaa	0.204													4	2	---	---	---	---	
MYO5A	4644	broad.mit.edu	37	15	52635119	52635119	+	Intron	DEL	A	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52635119delA	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010ugd.1_Intron|MYO5A_uc002abz.1_5'Flank|MYO5A_uc002aca.1_Intron|MYO5A_uc002acb.1_Intron|MYO5A_uc002acc.1_Intron	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		tctaaaaaagaaaaaaaaaaa	0.144													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21469994	21469994	+	Intron	DEL	A	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21469994delA	uc002diq.3	+						LOC100271836_uc002diu.1_Intron|LOC100271836_uc002diz.1_5'Flank					Homo sapiens cDNA FLJ59829 complete cds.																		ACTGTACATTAAAAAAAAAAA	0.294													8	4	---	---	---	---	
STX1B	112755	broad.mit.edu	37	16	31004014	31004015	+	3'UTR	INS	-	GGGGTGGAGGA	GGGGTGGAGGA	rs143292802	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31004014_31004015insGGGGTGGAGGA	uc010cad.2	-	10						NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B						intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						GGTCTGCCGTGGGGGTGGGGCT	0.653													5	5	---	---	---	---	
CDH1	999	broad.mit.edu	37	16	68867611	68867612	+	3'UTR	INS	-	T	T	rs35942505		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68867611_68867612insT	uc002ewg.1	+	16					CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_3'UTR	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TTTCTTAAAGCTTTTTTTTTTT	0.337			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				4	3	---	---	---	---	
C17orf48	56985	broad.mit.edu	37	17	10609586	10609587	+	Intron	DEL	AT	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10609586_10609587delAT	uc002gmt.2	+						C17orf48_uc002gmu.2_Intron|C17orf48_uc002gmv.2_Intron|C17orf48_uc010vvg.1_Intron	NM_020233	NP_064618	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol pyrophosphatase								ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding				0						ATGCAGTGTGATATATATATAT	0.337													5	4	---	---	---	---	
C17orf53	78995	broad.mit.edu	37	17	42226623	42226623	+	Intron	DEL	T	-	-	rs68174578		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42226623delT	uc002ifi.1	+						C17orf53_uc010czq.1_Intron|C17orf53_uc002ifj.1_Intron|C17orf53_uc002ifk.1_Intron	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995												0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		tttcttctccttttttttttt	0.169													4	2	---	---	---	---	
CBX1	10951	broad.mit.edu	37	17	46154618	46154619	+	Intron	INS	-	T	T	rs57789313		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46154618_46154619insT	uc002ind.3	-						CBX1_uc002ine.3_Intron	NM_006807	NP_006798	P83916	CBX1_HUMAN	heterochromatin protein 1-beta							nuclear heterochromatin|nucleoplasm|spindle	chromatin binding|enzyme binding				0						TTACAGCAAACttttttttttt	0.188													3	3	---	---	---	---	
TGIF1	7050	broad.mit.edu	37	18	3412027	3412027	+	5'Flank	DEL	G	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3412027delG	uc002klu.2	+							NM_174886	NP_777480	Q15583	TGIF1_HUMAN	TG-interacting factor isoform d						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				TCTGTTACAAGGGGGAAAGAC	0.587													4	2	---	---	---	---	
CABLES1	91768	broad.mit.edu	37	18	20764273	20764274	+	Intron	DEL	GT	-	-	rs111324965		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20764273_20764274delGT	uc002kuc.2	+						CABLES1_uc002kub.2_Intron|CABLES1_uc002kud.2_Intron	NM_001100619	NP_001094089	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1 isoform 2						blood coagulation|cell cycle|cell division|regulation of cell cycle|regulation of cell division	cytosol|nucleus	cyclin-dependent protein kinase regulator activity|protein binding			breast(1)	1	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATACTGGCACgtgtgtgtgtgt	0.287													4	2	---	---	---	---	
ZNF540	163255	broad.mit.edu	37	19	38104307	38104308	+	3'UTR	DEL	AA	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38104307_38104308delAA	uc002ogq.2	+	5					ZNF540_uc002ogu.2_3'UTR|ZNF540_uc010efq.2_3'UTR	NM_152606	NP_689819	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGTTCTCATTAAATTTAGGAAA	0.257													6	3	---	---	---	---	
PAFAH1B3	5050	broad.mit.edu	37	19	42801728	42801728	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42801728delT	uc002otg.2	-						PAFAH1B3_uc010xwi.1_Intron|PAFAH1B3_uc010xwj.1_Intron	NM_002573	NP_002564	Q15102	PA1B3_HUMAN	platelet-activating factor acetylhydrolase,						lipid catabolic process|nervous system development	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity|protein binding				0		Prostate(69;0.0704)				tttcgttttcttttttttttt	0.224													4	2	---	---	---	---	
CACNG6	59285	broad.mit.edu	37	19	54515016	54515016	+	Intron	DEL	T	-	-	rs34372297		TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54515016delT	uc002qct.2	+						CACNG6_uc002qcu.2_Intron|CACNG6_uc002qcv.2_Intron	NM_145814	NP_665813	Q9BXT2	CCG6_HUMAN	voltage-dependent calcium channel gamma-6							voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(2)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		ttgtgtcttgttttttttttt	0.085													3	3	---	---	---	---	
PCK1	5105	broad.mit.edu	37	20	56138150	56138150	+	Frame_Shift_Del	DEL	G	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56138150delG	uc002xyn.3	+	5	840	c.677delG	c.(676-678)AGAfs	p.R226fs	PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	226					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CCTGACCGCAGAGAGATCATC	0.622													153	68	---	---	---	---	
TCFL5	10732	broad.mit.edu	37	20	61491080	61491080	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61491080delT	uc002ydp.2	-						TCFL5_uc002ydo.2_Intron|TCFL5_uc002ydq.2_Intron	NM_006602	NP_006593	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 protein						cell differentiation|multicellular organismal development|regulation of cell differentiation|regulation of cell proliferation|spermatogenesis|transcription from RNA polymerase II promoter		DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)	1	Breast(26;5.68e-08)					tgtttttttgttttttttttt	0.124													5	3	---	---	---	---	
CBR3	874	broad.mit.edu	37	21	37510401	37510402	+	Intron	INS	-	TTTAG	TTTAG			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37510401_37510402insTTTAG	uc002yve.2	+						uc002yvc.1_Intron|uc002yvd.1_Intron	NM_001236	NP_001227	O75828	CBR3_HUMAN	carbonyl reductase 3							cytosol|nucleus	carbonyl reductase (NADPH) activity|NADPH binding				0						CACTCCAACATtttagtttagt	0.287													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44757300	44757302	+	IGR	DEL	CAA	-	-	rs149666131	by1000genomes	TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44757300_44757302delCAA								CRYAA (164387 upstream) : SIK1 (77096 downstream)																							ccatcaccaccaacaccaccatc	0.000													4	2	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26402277	26402277	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26402277delT	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron|MYO18B_uc010gva.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ATTCCAATTCTTTTTTTTTTT	0.373													3	4	---	---	---	---	
ADM2	79924	broad.mit.edu	37	22	50920978	50920978	+	Intron	DEL	C	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50920978delC	uc003blj.2	+						ADM2_uc011ary.1_Intron	NM_024866	NP_079142	Q7Z4H4	ADM2_HUMAN	adrenomedullin 2 precursor						positive regulation of angiogenesis	extracellular region	hormone activity				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGTTGACATTCTCCATCTGCC	0.647													5	3	---	---	---	---	
MAP3K15	389840	broad.mit.edu	37	X	19413161	19413161	+	Intron	DEL	T	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19413161delT	uc004czk.1	-						MAP3K15_uc004czj.1_Intron	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase								ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					GTCGTAGTGATTTTCAGAATG	0.408													51	79	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	76226082	76226083	+	Intron	INS	-	CC	CC			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76226082_76226083insCC	uc010nlv.1	-						MIR325_hsa-mir-325|MI0000824_5'Flank					Homo sapiens cDNA FLJ25017 fis, clone CBL01605.																		GTCATTCAACATTTGTTGAATG	0.406													8	7	---	---	---	---	
IL9R	3581	broad.mit.edu	37	X	155238775	155238776	+	Intron	DEL	TA	-	-			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155238775_155238776delTA	uc004fnv.1	+						IL9R_uc004fnu.1_Intron	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					tgtgtgtgtttatgtgtctgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	22892087	22892088	+	IGR	INS	-	T	T			TCGA-A3-3326-01A-01D-0966-08	TCGA-A3-3326-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:22892087_22892088insT								EIF1AY (137048 upstream) : RPS4Y2 (25866 downstream)																							ACCTGGGGGGCTAGCCACAGAG	0.505													6	5	---	---	---	---	
