Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
FAM40A	85369	broad.mit.edu	37	1	110589317	110589317	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110589317A>C	uc001dza.1	+	13	1451	c.1432A>C	c.(1432-1434)ATT>CTT	p.I478L	FAM40A_uc001dyz.1_Missense_Mutation_p.I383L|FAM40A_uc009wfp.1_Missense_Mutation_p.I302L	NM_033088	NP_149079	Q5VSL9	FA40A_HUMAN	hypothetical protein LOC85369	478						nucleus	protein binding			ovary(3)|large_intestine(1)	4		all_cancers(81;8.51e-05)|all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0154)|all cancers(265;0.0732)|Epithelial(280;0.0781)|Colorectal(144;0.115)|LUSC - Lung squamous cell carcinoma(189;0.137)		GTACACGTCGATTGCAGAGGT	0.473													91	120	---	---	---	---	PASS
CTSK	1513	broad.mit.edu	37	1	150769266	150769266	+	3'UTR	SNP	T	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150769266T>C	uc001evp.1	-	8					CTSK_uc001evq.1_3'UTR	NM_000396	NP_000387	P43235	CATK_HUMAN	cathepsin K preproprotein						proteolysis	lysosome	cysteine-type endopeptidase activity|protein binding			skin(1)	1	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			TGGATTTGGCTGGCTGGAGTC	0.483													80	95	---	---	---	---	PASS
INTS3	65123	broad.mit.edu	37	1	153723568	153723568	+	Intron	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153723568C>A	uc009wom.2	+						INTS3_uc001fct.2_Intron|INTS3_uc001fcu.2_Intron|INTS3_uc001fcv.2_Intron|INTS3_uc010peb.1_5'UTR|INTS3_uc001fcw.2_5'Flank	NM_023015	NP_075391	Q68E01	INT3_HUMAN	integrator complex subunit 3						DNA repair|G2/M transition checkpoint|response to ionizing radiation|snRNA processing	integrator complex|SOSS complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTCCTCCCTGCAGGGAGTGGG	0.547													22	22	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155308160	155308160	+	Silent	SNP	G	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155308160G>C	uc009wqq.2	-	27	9018	c.8538C>G	c.(8536-8538)CGC>CGG	p.R2846R	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Silent_p.R2841R	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2846					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GTGGCTTTGAGCGCTCAGACT	0.498													41	84	---	---	---	---	PASS
TBX19	9095	broad.mit.edu	37	1	168269666	168269666	+	Silent	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168269666C>T	uc001gfl.2	+	5	723	c.672C>T	c.(670-672)CAC>CAT	p.H224H	TBX19_uc001gfj.3_Silent_p.H155H|TBX19_uc001gfm.2_5'UTR	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19	224					anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					TCAGAAATCACCTAAGAGACG	0.458													11	25	---	---	---	---	PASS
DDX59	83479	broad.mit.edu	37	1	200617572	200617572	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200617572G>A	uc009wzk.2	-	7	1834	c.1591C>T	c.(1591-1593)CAT>TAT	p.H531Y	DDX59_uc010ppl.1_Missense_Mutation_p.H531Y	NM_001031725	NP_001026895	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	531	Helicase C-terminal.					intracellular	ATP binding|ATP-dependent helicase activity|metal ion binding|RNA binding			ovary(2)|breast(1)|central_nervous_system(1)	4						CTTACCTGATGGACATACTCA	0.403													66	107	---	---	---	---	PASS
TIMM17A	10440	broad.mit.edu	37	1	201926640	201926640	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201926640G>T	uc001gxc.2	+	3	164	c.128G>T	c.(127-129)GGA>GTA	p.G43V		NM_006335	NP_006326	Q99595	TI17A_HUMAN	translocase of inner mitochondrial membrane 17	43					protein targeting to mitochondrion	integral to membrane|mitochondrial inner membrane presequence translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity				0						TTGTTATAGGGAGTAAACCAC	0.363													33	79	---	---	---	---	PASS
MSH2	4436	broad.mit.edu	37	2	47703619	47703619	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47703619T>C	uc002rvy.1	+	13	2187	c.2119T>C	c.(2119-2121)TGC>CGC	p.C707R	MSH2_uc010yoh.1_Missense_Mutation_p.C641R|MSH2_uc002rvz.2_Missense_Mutation_p.C707R|MSH2_uc010fbg.2_Missense_Mutation_p.C517R	NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2	707					B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	p.?(2)		large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CATTGTGGACTGCATCTTAGC	0.463			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				54	76	---	---	---	---	PASS
VPS54	51542	broad.mit.edu	37	2	64196097	64196097	+	Silent	SNP	T	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64196097T>A	uc002scq.2	-	5	649	c.486A>T	c.(484-486)GTA>GTT	p.V162V	VPS54_uc002scp.2_Silent_p.V150V|VPS54_uc010fct.2_Silent_p.V45V	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1	162					protein transport|retrograde transport, endosome to Golgi						0						TTACCTTAGGTACTTGCTCCA	0.269													45	68	---	---	---	---	PASS
TGFBRAP1	9392	broad.mit.edu	37	2	105914998	105914998	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105914998T>C	uc002tcq.2	-	3	937	c.853A>G	c.(853-855)AAG>GAG	p.K285E	TGFBRAP1_uc010fjc.2_Missense_Mutation_p.K55E|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.K285E	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	285	CNH.				regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						TGGCCCTCCTTAAAGGGCAGC	0.433													92	114	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116485484	116485484	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116485484T>A	uc002tla.1	+	8	1126	c.669T>A	c.(667-669)TTT>TTA	p.F223L	DPP10_uc002tlb.1_Missense_Mutation_p.F173L|DPP10_uc002tlc.1_Missense_Mutation_p.F219L|DPP10_uc002tle.2_Missense_Mutation_p.F227L|DPP10_uc002tlf.1_Missense_Mutation_p.F216L	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	223	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AAATAATTTTTAATGGGATTG	0.284													35	49	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116485485	116485485	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116485485A>C	uc002tla.1	+	8	1127	c.670A>C	c.(670-672)AAT>CAT	p.N224H	DPP10_uc002tlb.1_Missense_Mutation_p.N174H|DPP10_uc002tlc.1_Missense_Mutation_p.N220H|DPP10_uc002tle.2_Missense_Mutation_p.N228H|DPP10_uc002tlf.1_Missense_Mutation_p.N217H	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	224	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AATAATTTTTAATGGGATTGC	0.284													34	49	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145157350	145157350	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157350G>T	uc002tvu.2	-	8	1884	c.1404C>A	c.(1402-1404)GAC>GAA	p.D468E	ZEB2_uc002tvv.2_Missense_Mutation_p.D462E|ZEB2_uc010zbm.1_Missense_Mutation_p.D439E|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.D497E	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	468	SMAD-MH2 binding domain (By similarity).					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		AAACAGTATTGTCCACAATCT	0.418													75	133	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228881372	228881372	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228881372C>G	uc002vpq.2	-	7	4245	c.4198G>C	c.(4198-4200)GAT>CAT	p.D1400H	SPHKAP_uc002vpp.2_Missense_Mutation_p.D1400H|SPHKAP_uc010zlx.1_Missense_Mutation_p.D1400H	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1400						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTTTTAGAATCTAAAGGGCTG	0.453													76	127	---	---	---	---	PASS
AQP12B	653437	broad.mit.edu	37	2	241622318	241622318	+	Splice_Site	SNP	C	T	T	rs139037294	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241622318C>T	uc010fzj.2	-	1	1	c.-62_splice	c.e1-1		AQP12B_uc002vzt.2_RNA	NM_001102467	NP_001095937	A6NM10	AQ12B_HUMAN	aquaporin 12B							integral to membrane	transporter activity				0		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		AGGAGCTGGCCGGTTCCCACA	0.672													3	67	---	---	---	---	PASS
CAPN7	23473	broad.mit.edu	37	3	15292631	15292631	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15292631T>A	uc003bzn.2	+	21	2576	c.2306T>A	c.(2305-2307)TTT>TAT	p.F769Y		NM_014296	NP_055111	Q9Y6W3	CAN7_HUMAN	calpain 7	769	Domain N.				proteolysis	nucleus	calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1						AGGTGTGGGTTTTGCTACCTG	0.308													98	170	---	---	---	---	PASS
GLT8D1	55830	broad.mit.edu	37	3	52729309	52729309	+	Silent	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52729309C>T	uc003dfi.3	-	9	961	c.822G>A	c.(820-822)CTG>CTA	p.L274L	GLT8D1_uc003dfj.2_Silent_p.L274L|GLT8D1_uc003dfk.2_Silent_p.L274L|GLT8D1_uc003dfl.2_Silent_p.L274L|GLT8D1_uc003dfm.2_Silent_p.L274L|GLT8D1_uc003dfn.2_Silent_p.L274L|GLT8D1_uc003dfo.1_Silent_p.L274L	NM_152932	NP_690909	Q68CQ7	GL8D1_HUMAN	glycosyltransferase 8 domain containing 1	274	Lumenal (Potential).					integral to membrane|mitochondrion	transferase activity, transferring glycosyl groups				0				BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TTCTGCTATACAGTCCCTCTC	0.428													8	218	---	---	---	---	PASS
PTPRG	5793	broad.mit.edu	37	3	62267340	62267340	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62267340G>A	uc003dlb.2	+	27	4587	c.3868G>A	c.(3868-3870)GAA>AAA	p.E1290K	PTPRG_uc003dlc.2_Missense_Mutation_p.E1261K|PTPRG_uc011bfi.1_Missense_Mutation_p.E536K|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1290	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCTCTCTAATGAAGAACAAAT	0.438													5	194	---	---	---	---	PASS
ACAD11	84129	broad.mit.edu	37	3	132345803	132345803	+	Intron	SNP	A	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132345803A>G	uc003eov.3	-						ACAD11_uc011blr.1_5'UTR|ACAD11_uc003eoy.2_Intron	NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase							peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						attttaaaaaagtcttccata	0.030													7	0	---	---	---	---	PASS
UGT2B15	7366	broad.mit.edu	37	4	69536340	69536340	+	5'UTR	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69536340G>T	uc011cal.1	-	1						NM_001076	NP_001067	P54855	UDB15_HUMAN	UDP glycosyltransferase 2B15 precursor						steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0						GAGACATCCTGGTCTTATGCA	0.383													10	607	---	---	---	---	PASS
TPPP	11076	broad.mit.edu	37	5	678108	678108	+	Nonsense_Mutation	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:678108G>T	uc003jbg.3	-	1	786	c.68C>A	c.(67-69)TCG>TAG	p.S23*	TPPP_uc003jbh.3_Nonsense_Mutation_p.S23*	NM_007030	NP_008961	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	23	Mediates interaction with LIMK1.				microtubule bundle formation|microtubule polymerization|positive regulation of protein polymerization	nucleus|perinuclear region of cytoplasm|soluble fraction	calcium ion binding|microtubule binding				0		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CCGGTCCTTCGAGGGGTCCCC	0.657													6	10	---	---	---	---	PASS
LMBRD2	92255	broad.mit.edu	37	5	36117868	36117868	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36117868G>A	uc003jkb.1	-	10	1686	c.1271C>T	c.(1270-1272)GCA>GTA	p.A424V		NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	424	Extracellular (Potential).					integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGTTTTTTCTGCCAGCTGTAT	0.358													51	43	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37006527	37006527	+	Silent	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37006527G>A	uc003jkl.3	+	17	4423	c.3924G>A	c.(3922-3924)GCG>GCA	p.A1308A	NIPBL_uc003jkk.3_Silent_p.A1308A	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1308					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CAAAATCAGCGGATGCTTGTC	0.338													50	116	---	---	---	---	PASS
RICTOR	253260	broad.mit.edu	37	5	38955727	38955727	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38955727C>T	uc003jlp.2	-	26	2603	c.2579G>A	c.(2578-2580)GGT>GAT	p.G860D	RICTOR_uc003jlo.2_Missense_Mutation_p.G860D|RICTOR_uc010ivf.2_Missense_Mutation_p.G575D	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	860					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					ATAGTTATCACCATCAACAGG	0.338													181	131	---	---	---	---	PASS
C5orf44	80006	broad.mit.edu	37	5	64933559	64933559	+	Silent	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64933559C>T	uc003jtz.3	+	4	582	c.252C>T	c.(250-252)ATC>ATT	p.I84I	C5orf44_uc003jua.3_Silent_p.I84I|C5orf44_uc003juc.3_Silent_p.I84I|C5orf44_uc010iwv.2_Silent_p.I84I	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2	84										ovary(1)	1						CCAGTTATATCAGCGTTCATA	0.254													29	70	---	---	---	---	PASS
ACSL6	23305	broad.mit.edu	37	5	131283287	131283287	+	RNA	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131283287C>T	uc003kvv.1	-	20		c.2078G>A				NM_015256		Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTGGTTTTACCTCGGGTTttg	0.174													6	19	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140768184	140768184	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140768184G>C	uc003lkc.1	+	1	733	c.733G>C	c.(733-735)GAC>CAC	p.D245H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.D245H	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	245	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTCAGTCAAGACGTATACAG	0.522													115	306	---	---	---	---	PASS
BEND6	221336	broad.mit.edu	37	6	56883335	56883335	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56883335G>T	uc010kab.2	+	6	1415	c.829G>T	c.(829-831)GAT>TAT	p.D277Y	BEND6_uc003pdi.3_Missense_Mutation_p.D179Y	NM_152731	NP_689944	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	277											0						TAACTCTCAGGATATTAAATA	0.308													22	47	---	---	---	---	PASS
C6orf221	154288	broad.mit.edu	37	6	74073548	74073548	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74073548C>T	uc003pgt.3	+	3	672	c.619C>T	c.(619-621)CGC>TGC	p.R207C		NM_001017361	NP_001017361	Q587J8	ECAT1_HUMAN	hypothetical protein LOC154288	207										skin(2)	2						CCAGCGGTTTCGCGAGGATGC	0.622													21	33	---	---	---	---	PASS
LCA5	167691	broad.mit.edu	37	6	80203392	80203392	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80203392C>A	uc003pix.2	-	4	1231	c.796G>T	c.(796-798)GAG>TAG	p.E266*	LCA5_uc003piy.2_Nonsense_Mutation_p.E266*|LCA5_uc011dyq.1_RNA	NM_001122769	NP_001116241	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	266	Potential.				protein transport	cilium axoneme|microtubule basal body	protein binding				0		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		TCATGAGCCTCATATGCCCTT	0.333													55	70	---	---	---	---	PASS
RARS2	57038	broad.mit.edu	37	6	88234311	88234311	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88234311A>G	uc003pme.2	-	11	998	c.938T>C	c.(937-939)GTA>GCA	p.V313A	RARS2_uc003pmb.2_Missense_Mutation_p.V138A|RARS2_uc003pmc.2_Missense_Mutation_p.V138A|RARS2_uc003pmd.2_5'UTR|RARS2_uc003pmf.2_RNA	NM_020320	NP_064716	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	313					arginyl-tRNA aminoacylation	mitochondrial matrix	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|central_nervous_system(1)	3		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		ACTTCGCATTACAGTACAAAT	0.413													4	178	---	---	---	---	PASS
HACE1	57531	broad.mit.edu	37	6	105192486	105192486	+	Splice_Site	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105192486C>A	uc003pqu.1	-	21	2621	c.2344_splice	c.e21-1	p.E782_splice	HACE1_uc010kcy.1_Splice_Site_p.E264_splice|HACE1_uc010kcz.1_Splice_Site_p.E567_splice|HACE1_uc010kcx.1_Splice_Site_p.E191_splice|HACE1_uc003pqt.1_Splice_Site_p.E435_splice	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		GCAGTAGCTCCTTGGGGGAAG	0.323													39	59	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129663519	129663519	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129663519G>C	uc003qbn.2	+	30	4448	c.4343G>C	c.(4342-4344)TGT>TCT	p.C1448S	LAMA2_uc003qbo.2_Missense_Mutation_p.C1448S	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1448	Laminin EGF-like 15.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GGTGACTTCTGTGAACGATGT	0.378													64	127	---	---	---	---	PASS
EPB41L2	2037	broad.mit.edu	37	6	131190764	131190764	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131190764A>C	uc003qch.2	-	15	2728	c.2546T>G	c.(2545-2547)GTT>GGT	p.V849G	EPB41L2_uc003qce.1_Missense_Mutation_p.V227G|EPB41L2_uc003qcf.1_Intron|EPB41L2_uc003qcg.1_Intron|EPB41L2_uc011eby.1_Intron|EPB41L2_uc003qci.2_Intron|EPB41L2_uc010kfk.2_Intron|EPB41L2_uc003qcd.1_5'Flank|EPB41L2_uc003qcj.1_Missense_Mutation_p.V246G	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	849					cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		CTCTCCGTTAACTTTCTGTGG	0.468													78	126	---	---	---	---	PASS
IL20RA	53832	broad.mit.edu	37	6	137322646	137322646	+	3'UTR	SNP	T	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137322646T>G	uc003qhj.2	-	7					IL20RA_uc011edl.1_3'UTR|IL20RA_uc003qhk.2_3'UTR|IL20RA_uc003qhi.2_3'UTR	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha precursor							integral to membrane	receptor activity			ovary(2)|skin(2)	4	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		ATCAAAGGGGTGACTCACTTG	0.403													9	83	---	---	---	---	PASS
HERPUD2	64224	broad.mit.edu	37	7	35678058	35678058	+	Silent	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35678058C>A	uc003tet.2	-	5	1324	c.519G>T	c.(517-519)GGG>GGT	p.G173G	HERPUD2_uc003tes.3_Silent_p.G173G	NM_022373	NP_071768	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	173					response to unfolded protein	integral to membrane				ovary(3)	3						GAGCAGCTTGCCCAGGAAATT	0.403													38	80	---	---	---	---	PASS
AEBP1	165	broad.mit.edu	37	7	44152266	44152266	+	Missense_Mutation	SNP	C	T	T	rs144799697	byFrequency	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44152266C>T	uc003tkb.2	+	18	2632	c.2327C>T	c.(2326-2328)GCC>GTC	p.A776V	AEBP1_uc003tkc.3_Missense_Mutation_p.A351V|AEBP1_uc003tkd.2_Missense_Mutation_p.A26V	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	776	Interaction with PTEN (By similarity).				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TACGATATGGCCCGCACGCCT	0.652													3	32	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72892732	72892732	+	Silent	SNP	C	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72892732C>G	uc003tyc.2	-	7	1404	c.1059G>C	c.(1057-1059)GTG>GTC	p.V353V		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	353	Lys-rich.				ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTGAGTTCTTCACTTTGAGTG	0.393													100	97	---	---	---	---	PASS
TFEC	22797	broad.mit.edu	37	7	115624462	115624462	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115624462G>C	uc003vhj.1	-	2	218	c.34C>G	c.(34-36)CTT>GTT	p.L12V	TFEC_uc003vhk.1_Missense_Mutation_p.L12V|TFEC_uc003vhl.3_Missense_Mutation_p.L12V|TFEC_uc011kmw.1_Missense_Mutation_p.L102V	NM_012252	NP_036384	O14948	TFEC_HUMAN	transcription factor EC isoform a	12	Necessary for transcriptional transactivation.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			GACCATTTAAGAGTTGGATTG	0.493													113	265	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	152143843	152143843	+	IGR	SNP	A	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152143843A>G								FABP5L3 (3745 upstream) : LOC100128822 (17366 downstream)																							TGATAAAGGAAGCAGATTGGA	0.512													8	133	---	---	---	---	PASS
FGFR1	2260	broad.mit.edu	37	8	38314935	38314935	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38314935C>A	uc003xlp.2	-	2	972	c.30G>T	c.(28-30)TGG>TGT	p.W10C	FGFR1_uc011lbo.1_Missense_Mutation_p.W10C|FGFR1_uc011lbp.1_Missense_Mutation_p.W10C|FGFR1_uc011lbq.1_Missense_Mutation_p.W10C|FGFR1_uc010lwk.2_5'UTR|FGFR1_uc011lbs.1_5'UTR|FGFR1_uc011lbt.1_Missense_Mutation_p.W10C|FGFR1_uc011lbu.1_Missense_Mutation_p.W43C|FGFR1_uc011lbv.1_Missense_Mutation_p.W10C|FGFR1_uc011lbw.1_Missense_Mutation_p.W10C|FGFR1_uc011lbx.1_Missense_Mutation_p.W10C|FGFR1_uc003xlv.2_Missense_Mutation_p.W10C|FGFR1_uc003xlu.2_Missense_Mutation_p.W10C|FGFR1_uc003xlw.1_RNA	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1	10					axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	CCAGCACAGCCCAGAAGAGGA	0.602		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						19	47	---	---	---	---	PASS
PENK	5179	broad.mit.edu	37	8	57353861	57353861	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57353861T>G	uc003xsz.2	-	2	855	c.774A>C	c.(772-774)GAA>GAC	p.E258D	PENK_uc003xta.3_Missense_Mutation_p.E258D	NM_006211	NP_006202	P01210	PENK_HUMAN	proenkephalin	258					neuropeptide signaling pathway	extracellular region	neuropeptide hormone activity|opioid peptide activity	p.E258Q(1)		ovary(2)|central_nervous_system(1)|skin(1)	4		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			CGTATCTTTTTTCCATTTCAG	0.493													129	120	---	---	---	---	PASS
ZFAND1	79752	broad.mit.edu	37	8	82626242	82626242	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82626242A>G	uc003ycj.1	-	6	405	c.391T>C	c.(391-393)TGG>CGG	p.W131R	ZFAND1_uc010lzx.1_Missense_Mutation_p.W131R|ZFAND1_uc003yck.1_Missense_Mutation_p.W24R	NM_024699	NP_078975	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	131							zinc ion binding			ovary(1)	1						GCACCTTTCCATCGTTTACTT	0.348													54	82	---	---	---	---	PASS
COLEC10	10584	broad.mit.edu	37	8	120114630	120114630	+	Silent	SNP	A	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120114630A>G	uc003yoo.2	+	4	433	c.336A>G	c.(334-336)AAA>AAG	p.K112K		NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor	112	Collagen-like.					collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			CTGGAGAAAAAGGCAAAGCAG	0.274													3	115	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104324630	104324630	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104324630A>C	uc004bbn.2	+	20	2944	c.2854A>C	c.(2854-2856)ACC>CCC	p.T952P		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	952	RING-type.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		ACGCTATGACACCCGCCAGCG	0.448													7	63	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139396756	139396756	+	Silent	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139396756C>A	uc004chz.2	-	28	5352	c.5352G>T	c.(5350-5352)CGG>CGT	p.R1784R		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1784	Cytoplasmic (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	p.K1783_R1784ins31(2)		haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CGAGGGGCTCCCGCCGCTTCT	0.701			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			4	20	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071420	141071420	+	Missense_Mutation	SNP	G	A	A	rs147421666	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071420G>A	uc004com.2	+	4	1084	c.823G>A	c.(823-825)GAC>AAC	p.D275N	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						CTGGTTCCCCGACAACGTAAA	0.512													4	122	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29769552	29769552	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29769552T>C	uc001iut.1	-	29	6044	c.5291A>G	c.(5290-5292)TAT>TGT	p.Y1764C	LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Missense_Mutation_p.Y678C|SVIL_uc001iuu.1_Missense_Mutation_p.Y1338C|SVIL_uc009xlc.2_Missense_Mutation_p.Y556C	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1764	Gelsolin-like 3.				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				GAGCCTGCTATAGTCGAATTC	0.557													52	52	---	---	---	---	PASS
NDST2	8509	broad.mit.edu	37	10	75562102	75562102	+	3'UTR	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75562102G>T	uc001jvk.2	-	15					NDST2_uc010qks.1_3'UTR|NDST2_uc010qkt.1_3'UTR|NDST2_uc001jvl.1_3'UTR	NM_003635	NP_003626	P52849	NDST2_HUMAN	heparan glucosaminyl							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			ovary(1)	1	Prostate(51;0.0112)					GGGCTACTGAGGTAGAGGGGG	0.577													9	5	---	---	---	---	PASS
ADD3	120	broad.mit.edu	37	10	111892133	111892133	+	Silent	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111892133G>A	uc001kyt.3	+	15	2117	c.1803G>A	c.(1801-1803)CCG>CCA	p.P601P	ADD3_uc001kys.3_Intron|ADD3_uc001kyu.2_Silent_p.P601P|ADD3_uc001kyv.2_Silent_p.P601P|ADD3_uc001kyw.2_Intron|ADD3_uc001kyx.2_Silent_p.P174P	NM_016824	NP_058432	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma) isoform a	601						cytoskeleton	actin binding|calmodulin binding|metal ion binding|structural constituent of cytoskeleton			ovary(2)|skin(2)|large_intestine(1)	5		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		CTCAGTCACCGCAAAATGTCC	0.393													4	105	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													6	75	---	---	---	---	PASS
NLRP10	338322	broad.mit.edu	37	11	7981799	7981799	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7981799A>C	uc001mfv.1	-	2	1377	c.1360T>G	c.(1360-1362)TTG>GTG	p.L454V		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	454	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GCAAGTCCCAATTGGTAGTCG	0.483													104	154	---	---	---	---	PASS
CCDC81	60494	broad.mit.edu	37	11	86106349	86106349	+	Intron	SNP	T	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86106349T>C	uc001pbx.1	+						CCDC81_uc001pbw.1_Intron|CCDC81_uc010rtq.1_5'UTR|CCDC81_uc001pby.1_5'UTR	NM_001156474	NP_001149946	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81 isoform 1											skin(1)	1		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				AGCCTAGATGTAACCTTGCTC	0.498													32	40	---	---	---	---	PASS
HIST4H4	121504	broad.mit.edu	37	12	14924041	14924041	+	5'UTR	SNP	A	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14924041A>G	uc001rcf.3	-	1					HIST4H4_uc001rce.2_RNA	NM_175054	NP_778224	P62805	H4_HUMAN	histone cluster 4, H4						CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						GCGCCTACTCAGCAGAAAATC	0.567													12	34	---	---	---	---	PASS
DEPDC4	120863	broad.mit.edu	37	12	100660755	100660755	+	Silent	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100660755G>A	uc001thi.2	-	1	103	c.100C>T	c.(100-102)CTG>TTG	p.L34L	SCYL2_uc009ztw.1_5'Flank|SCYL2_uc001thm.1_5'Flank|SCYL2_uc001thn.2_5'Flank|DEPDC4_uc001thh.1_RNA|DEPDC4_uc001thj.1_Silent_p.L34L|DEPDC4_uc009ztv.1_Silent_p.L34L|DEPDC4_uc001thk.1_5'UTR|DEPDC4_uc001thl.1_RNA	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	34				L -> G (in Ref. 2; AAH15117).	intracellular signal transduction						0						GGCCCGTTCAGCCCTGGGCCC	0.577													79	103	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112165896	112165896	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112165896A>T	uc001tsq.2	+	9	1392	c.1192A>T	c.(1192-1194)ATT>TTT	p.I398F	ACAD10_uc001tsp.2_Missense_Mutation_p.I398F|ACAD10_uc009zvx.2_Missense_Mutation_p.I429F|ACAD10_uc001tss.1_Intron	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	398							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						CCTGTGCAAAATTCACAGTGT	0.537													7	222	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124858994	124858994	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124858994C>T	uc010tba.1	-	19	2300	c.2183G>A	c.(2182-2184)GGG>GAG	p.G728E	NCOR2_uc010tay.1_Missense_Mutation_p.G728E|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Missense_Mutation_p.G728E|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Missense_Mutation_p.G728E	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	728					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cacctcattcccagaggcatg	0.388													12	17	---	---	---	---	PASS
SCARB1	949	broad.mit.edu	37	12	125267275	125267275	+	Intron	SNP	A	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125267275A>G	uc001ugo.3	-						SCARB1_uc001ugn.3_Intron|SCARB1_uc001ugm.3_Missense_Mutation_p.M495T|SCARB1_uc010tbd.1_Missense_Mutation_p.M467T	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1						adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	AGCTGATGTCATCAGGGATTC	0.488													72	91	---	---	---	---	PASS
HS6ST3	266722	broad.mit.edu	37	13	96743104	96743104	+	5'UTR	SNP	T	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96743104T>A	uc001vmw.2	+	1						NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					CCTGCCGGCCTGAGAGCGGGA	0.567													7	7	---	---	---	---	PASS
NDRG2	57447	broad.mit.edu	37	14	21486946	21486946	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21486946G>T	uc001vyy.2	-	13	939	c.789C>A	c.(787-789)GAC>GAA	p.D263E	NDRG2_uc010tll.1_Missense_Mutation_p.D259E|NDRG2_uc001vyt.2_Missense_Mutation_p.D176E|NDRG2_uc001vyu.2_Missense_Mutation_p.D220E|NDRG2_uc001vyv.2_Missense_Mutation_p.D249E|NDRG2_uc001vyw.2_Missense_Mutation_p.D249E|NDRG2_uc001vzb.2_Missense_Mutation_p.D203E|NDRG2_uc001vyx.2_Missense_Mutation_p.D263E|NDRG2_uc001vza.2_Missense_Mutation_p.D249E|NDRG2_uc001vyz.2_Missense_Mutation_p.D249E|NDRG2_uc001vzc.2_Missense_Mutation_p.D249E|NDRG2_uc001vze.2_Missense_Mutation_p.D263E|NDRG2_uc001vzd.2_Missense_Mutation_p.D263E|NDRG2_uc001vzg.2_Missense_Mutation_p.D249E|NDRG2_uc001vzf.2_Missense_Mutation_p.D249E|NDRG2_uc010aig.2_Intron	NM_201540	NP_963834	Q9UN36	NDRG2_HUMAN	N-myc downstream-regulated gene 2 isoform a	263					cell differentiation|nervous system development	centrosome|cytosol|Golgi apparatus|nucleus|perinuclear region of cytoplasm				ovary(1)|breast(1)	2	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GAGGTGCTTGGTCTCCTACCA	0.552													43	42	---	---	---	---	PASS
GTF2A1	2957	broad.mit.edu	37	14	81659180	81659180	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81659180G>T	uc001xvf.1	-	7	1048	c.616C>A	c.(616-618)CTG>ATG	p.L206M	GTF2A1_uc010atb.1_Missense_Mutation_p.L156M|GTF2A1_uc001xvg.1_Missense_Mutation_p.L167M	NM_015859	NP_056943	P52655	TF2AA_HUMAN	TFIIA alpha, p55 isoform 1	206					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|transcription factor TFIIA complex	DNA binding|protein binding|protein heterodimerization activity|TBP-class protein binding|transcription coactivator activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0287)		AGAGGAGCCAGCACCTAAAGC	0.408													74	78	---	---	---	---	PASS
C15orf52	388115	broad.mit.edu	37	15	40628801	40628801	+	Silent	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40628801C>T	uc001zlh.3	-	9	1009	c.993G>A	c.(991-993)AAG>AAA	p.K331K	C15orf52_uc001zli.1_3'UTR|C15orf52_uc010ucn.1_Silent_p.K121K	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115	331										large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		TCAGCCTCTCCTTGCCCCGGG	0.642													45	66	---	---	---	---	PASS
NUP93	9688	broad.mit.edu	37	16	56872971	56872971	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56872971G>C	uc002eka.2	+	19	2247	c.2126G>C	c.(2125-2127)AGA>ACA	p.R709T	NUP93_uc002ekb.2_Missense_Mutation_p.R586T|NUP93_uc010vhi.1_Missense_Mutation_p.R586T	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	709					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						CATATTGATAGAGCTTTTGAT	0.363													4	222	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268081	70268081	+	RNA	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268081G>A	uc010cfp.1	-	3		c.334C>T								Homo sapiens cDNA, FLJ98908.																		TCTTACTGTTGGCTAAAAGGC	0.373													3	11	---	---	---	---	PASS
TNK1	8711	broad.mit.edu	37	17	7291994	7291994	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7291994G>A	uc002ggi.3	+	11	1922	c.1762G>A	c.(1762-1764)GAT>AAT	p.D588N	TNK1_uc002ggj.3_Missense_Mutation_p.D583N|TNK1_uc010cmf.2_RNA|TNK1_uc002ggk.3_Intron	NM_003985	NP_003976	Q13470	TNK1_HUMAN	tyrosine kinase, non-receptor, 1	588					protein autophosphorylation	membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(122;0.157)				CCTCTTGTCCGATCCTGAGTT	0.592													17	31	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10447217	10447217	+	Splice_Site	SNP	A	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10447217A>T	uc010coi.2	-	7	776	c.648_splice	c.e7+1	p.Q216_splice	uc002gml.1_Intron|MYH2_uc002gmp.3_Splice_Site_p.Q216_splice|MYH2_uc010coj.2_Splice_Site_p.Q216_splice	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						AATCAGACTCACCTGTATTTT	0.478													37	58	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10535182	10535182	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10535182G>A	uc002gmq.1	-	34	5185	c.5108C>T	c.(5107-5109)GCG>GTG	p.A1703V		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1703	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						CTCCTGTTCCGCCAGTTTCCG	0.647													30	70	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37876087	37876087	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37876087G>C	uc002hso.2	+	16	2184	c.1946G>C	c.(1945-1947)AGC>ACC	p.S649T	ERBB2_uc002hsm.2_Missense_Mutation_p.S619T|ERBB2_uc010cwa.2_Missense_Mutation_p.S634T|ERBB2_uc002hsp.2_Missense_Mutation_p.S452T|ERBB2_uc010cwb.2_Missense_Mutation_p.S649T|ERBB2_uc010wek.1_Missense_Mutation_p.S373T	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	649	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	CAGAGAGCCAGGTTGGCCTGG	0.597		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			39	62	---	---	---	---	PASS
NSF	4905	broad.mit.edu	37	17	44788459	44788459	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44788459C>A	uc002iku.2	+	14	1705	c.1601C>A	c.(1600-1602)ACA>AAA	p.T534K	NSF_uc010wke.1_Missense_Mutation_p.T440K|NSF_uc010wkf.1_Missense_Mutation_p.T440K|NSF_uc010wkg.1_Missense_Mutation_p.T529K	NM_006178	NP_006169	P46459	NSF_HUMAN	vesicle-fusing ATPase	534					protein transport|synaptic transmission	cytosol	ATP binding|metal ion binding			ovary(1)	1		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		AGTGACCGCACACCATTGGTC	0.443													3	85	---	---	---	---	PASS
MIDN	90007	broad.mit.edu	37	19	1257108	1257108	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1257108C>T	uc002lrp.2	+	8	1759	c.1244C>T	c.(1243-1245)CCG>CTG	p.P415L		NM_177401	NP_796375	Q504T8	MIDN_HUMAN	midnolin	415						nucleolus					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCGGGGTCCGTACCACTGG	0.706													6	16	---	---	---	---	PASS
NOTCH3	4854	broad.mit.edu	37	19	15298087	15298087	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15298087C>A	uc002nan.2	-	11	1745	c.1669G>T	c.(1669-1671)GGT>TGT	p.G557C	NOTCH3_uc002nao.1_Missense_Mutation_p.G557C	NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	557	Extracellular (Potential).|EGF-like 14; calcium-binding (Potential).				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			ACGCAGCGACCATGGTGGCAT	0.652													37	50	---	---	---	---	PASS
ZFP82	284406	broad.mit.edu	37	19	36884269	36884269	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36884269G>C	uc002ody.1	-	5	1208	c.973C>G	c.(973-975)CTT>GTT	p.L325V		NM_133466	NP_597723	Q8N141	ZFP82_HUMAN	zinc finger protein 82 homolog	325	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						TGTACTCTAAGACCAGAGCCA	0.458													78	115	---	---	---	---	PASS
ZNF260	339324	broad.mit.edu	37	19	37005751	37005751	+	Silent	SNP	A	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37005751A>G	uc002oee.1	-	4	1234	c.390T>C	c.(388-390)CAT>CAC	p.H130H	ZNF260_uc002oed.1_Silent_p.H127H|ZNF260_uc010eey.1_Silent_p.H127H|ZNF260_uc002oef.1_Silent_p.H127H	NM_001012756	NP_001012774	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	130					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)					TGGTTCCTGTATGATTTTTCT	0.388													166	232	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40900148	40900148	+	Silent	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40900148G>T	uc002onr.2	-	7	4380	c.4111C>A	c.(4111-4113)CGG>AGG	p.R1371R	PRX_uc002onq.2_Silent_p.R1232R|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	1371					axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACCCGGCCCCGGCGACCCGAG	0.612													3	33	---	---	---	---	PASS
GPR4	2828	broad.mit.edu	37	19	46094848	46094848	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46094848A>T	uc002pcm.2	-	2	1222	c.277T>A	c.(277-279)TTT>ATT	p.F93I	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	93	Helical; Name=3; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		ATGAACCCAAAGAGCTTGCAG	0.602													70	93	---	---	---	---	PASS
TUBB1	81027	broad.mit.edu	37	20	57598805	57598805	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57598805A>T	uc002yak.2	+	4	592	c.323A>T	c.(322-324)GAG>GTG	p.E108V		NM_030773	NP_110400	Q9H4B7	TBB1_HUMAN	beta tubulin 1, class VI	108					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity			ovary(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)		Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	CACTACACGGAGGGAGCCGAG	0.587													101	74	---	---	---	---	PASS
HSF2BP	11077	broad.mit.edu	37	21	44985172	44985172	+	Intron	SNP	C	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44985172C>G	uc002zdi.2	-						HSF2BP_uc011aey.1_Intron|uc002zdj.1_RNA	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding						spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)		TCGAAGAAAGCCGTGACTAAG	0.602													64	35	---	---	---	---	PASS
ZDHHC8	29801	broad.mit.edu	37	22	20127299	20127299	+	Silent	SNP	C	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20127299C>A	uc002zrq.2	+	4	547	c.441C>A	c.(439-441)CGC>CGA	p.R147R	ZDHHC8_uc002zrr.1_Silent_p.R147R|ZDHHC8_uc010gsa.2_Intron	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	147	Cytoplasmic (Potential).|DHHC-type.					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					GAAACTATCGCTACTTCTTCC	0.617													23	36	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22661756	22661756	+	Intron	SNP	T	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22661756T>G	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						CTCCTAAGATTTTTCTCTTTT	0.333													4	21	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22661762	22661762	+	Intron	SNP	C	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22661762C>G	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						AGATTTTTCTCTTTTCTGGGA	0.338													4	23	---	---	---	---	PASS
SEC14L3	266629	broad.mit.edu	37	22	30866207	30866207	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30866207G>T	uc003ahy.2	-	3	255	c.166C>A	c.(166-168)CTC>ATC	p.L56I	SEC14L3_uc003ahz.2_5'UTR|SEC14L3_uc003aia.2_5'UTR|SEC14L3_uc003aib.2_5'UTR	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	56						integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	ACCTTGCGGAGCAAAGCCTCC	0.527													3	53	---	---	---	---	PASS
PISD	23761	broad.mit.edu	37	22	32058198	32058198	+	5'UTR	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32058198G>T	uc003alm.3	-	1					PISD_uc003aln.3_5'UTR	NM_014338	NP_055153	Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						phospholipid biosynthetic process	mitochondrion	phosphatidylserine decarboxylase activity			central_nervous_system(2)|ovary(1)	3					Phosphatidylserine(DB00144)	TCGCCATCTTGTCTGCTCCTT	0.642											OREG0003531	type=REGULATORY REGION|Gene=PISD|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	72	117	---	---	---	---	PASS
CYP2D7P1	1564	broad.mit.edu	37	22	42538870	42538870	+	Missense_Mutation	SNP	A	C	C	rs2982057	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42538870A>C	uc003bci.2	-	3	475	c.94T>G	c.(94-96)TCG>GCG	p.S32A	CYP2D7P1_uc003bcg.2_5'Flank|CYP2D7P1_uc003bch.2_5'Flank|CYP2D7P1_uc010gyv.2_Intron|CYP2D7P1_uc010gyw.2_RNA|CYP2D7P1_uc010gyx.1_Missense_Mutation_p.S32A	NR_002570				SubName: Full=Cytochrome P450 2D6;          EC=1.14.14.1;												0						CCATAGCGCGACAGGAACACC	0.687													3	24	---	---	---	---	PASS
LDOC1L	84247	broad.mit.edu	37	22	44893405	44893405	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44893405C>T	uc003beu.1	-	2	369	c.32G>A	c.(31-33)AGC>AAC	p.S11N		NM_032287	NP_115663	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	11										ovary(1)	1		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		CAAGGCTGGGCTTTCAGCTTT	0.642													14	31	---	---	---	---	PASS
MAP7D2	256714	broad.mit.edu	37	X	20081684	20081684	+	Nonsense_Mutation	SNP	G	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20081684G>A	uc004czr.1	-	3	239	c.220C>T	c.(220-222)CAA>TAA	p.Q74*	MAP7D2_uc011mji.1_Nonsense_Mutation_p.Q30*|MAP7D2_uc010nfo.1_Nonsense_Mutation_p.Q74*|MAP7D2_uc011mjj.1_Nonsense_Mutation_p.Q74*|MAP7D2_uc004czs.1_Nonsense_Mutation_p.Q30*	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	74	Potential.									ovary(2)|breast(1)	3						AGGATCTGTTGCTCCCGAGCA	0.517													81	144	---	---	---	---	PASS
PTCHD1	139411	broad.mit.edu	37	X	23398416	23398416	+	Intron	SNP	A	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23398416A>C	uc004dal.3	+						PTCHD1_uc010nfu.1_Missense_Mutation_p.T354P	NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1						cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						GGTGGTGTTGACTAGGTTCCT	0.433													56	60	---	---	---	---	PASS
SLC7A3	84889	broad.mit.edu	37	X	70145508	70145508	+	3'UTR	SNP	A	C	C			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70145508A>C	uc004dyn.2	-	12					SLC7A3_uc004dyo.2_3'UTR	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid						cellular nitrogen compound metabolic process	integral to membrane|plasma membrane				ovary(1)|kidney(1)	2	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GACGGGTTAAAATAGACAAGA	0.388													8	15	---	---	---	---	PASS
ZCCHC12	170261	broad.mit.edu	37	X	117960298	117960298	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117960298G>T	uc004equ.2	+	4	1564	c.1091G>T	c.(1090-1092)AGT>ATT	p.S364I		NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	364					regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding			ovary(1)	1						GACAACGAGAGTGACAAGGCC	0.512													48	101	---	---	---	---	PASS
PRRG3	79057	broad.mit.edu	37	X	150868604	150868604	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150868604A>T	uc004few.1	+	3	534	c.144A>T	c.(142-144)GAA>GAT	p.E48D		NM_024082	NP_076987	Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3	48	Gla.|Extracellular (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					AGGTCAAGGAAGTGTTTGAGA	0.552													28	50	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19474752	19474752	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19474752delA	uc001bbi.2	-						UBR4_uc001bbk.1_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGCAAAGAGAAAAAAAAAAA	0.448													9	4	---	---	---	---	
RAP1GAP	5909	broad.mit.edu	37	1	21935610	21935610	+	Intron	DEL	G	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21935610delG	uc001bex.2	-						RAP1GAP_uc001bev.2_Intron|RAP1GAP_uc001bew.2_Intron|RAP1GAP_uc001bey.2_Intron	NM_002885	NP_002876	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein isoform c						regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GTACCTTCAAGGGGCCCCAGT	0.607													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	29460062	29460062	+	IGR	DEL	A	-	-	rs12034124		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29460062delA								TMEM200B (9655 upstream) : SFRS4 (14189 downstream)																							aaagaaaaagaaaaaaaaaag	0.000													5	3	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	43011397	43011398	+	Intron	DEL	CG	-	-	rs112575083		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43011397_43011398delCG	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						gcaggcagatcgcttgagctca	0.045													7	4	---	---	---	---	
SLC6A17	388662	broad.mit.edu	37	1	110709707	110709708	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110709707_110709708delGG	uc009wfq.2	+	2	617_618	c.156_157delGG	c.(154-159)GAGGAGfs	p.E52fs		NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17	52_53	Cytoplasmic (Potential).				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		AGGCGGTGGAGGAGGAGCTGGA	0.614													8	8	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162259063	162259070	+	Intron	DEL	CTTCCTTT	-	-	rs72439117	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162259063_162259070delCTTCCTTT	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			tccttccttccttcctttccttccttcc	0.029													10	5	---	---	---	---	
XPR1	9213	broad.mit.edu	37	1	180628518	180628537	+	Intron	DEL	TCCTTCCTTCCTTCCTTCCT	-	-	rs140833721	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180628518_180628537delTCCTTCCTTCCTTCCTTCCT	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0						cgtccttccgtccttccttccttccttccttccttccttc	0.000													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	227032866	227032869	+	IGR	DEL	AGGA	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227032866_227032869delAGGA								ITPKB (105990 upstream) : PSEN2 (25404 downstream)																							aaagaaaGACaggaaggaaggaag	0.010													5	3	---	---	---	---	
CCDC88A	55704	broad.mit.edu	37	2	55573493	55573493	+	Intron	DEL	T	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55573493delT	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc010ypb.1_Intron	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						taaaattatattttaattatt	0.209													21	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	82989651	82989664	+	IGR	DEL	ACACACACACACAC	-	-	rs35013779		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82989651_82989664delACACACACACACAC								None (None upstream) : None (None downstream)																							aagtaagaaAacacacacacacacacacacacac	0.112													4	2	---	---	---	---	
KDM3A	55818	broad.mit.edu	37	2	86682418	86682418	+	Intron	DEL	T	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86682418delT	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						TTCTTttttcttttttttttt	0.179													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241867838	241867839	+	IGR	DEL	TG	-	-	rs58145871		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241867838_241867839delTG								C2orf54 (32265 upstream) : SNED1 (70416 downstream)																							GTGCCTGTTTtgtgtgtgtgtg	0.391													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10183829	10183830	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183829_10183830delAC	uc003bvc.2	+	1	511_512	c.298_299delAC	c.(298-300)ACGfs	p.T100fs	VHL_uc003bvd.2_Frame_Shift_Del_p.T100fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	100	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.T100fs*32(1)|p.T100fs*33(1)|p.?(1)|p.P97fs*59(1)|p.T100_G106>S(1)|p.Y98fs*27(1)|p.T100A(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GCCCTACCCAACGCTGCCGCCT	0.688		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				3	3	---	---	---	---	
SCN10A	6336	broad.mit.edu	37	3	38835081	38835082	+	Intron	DEL	AG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38835081_38835082delAG	uc003ciq.2	-							NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	CAAATAAGTTAGAGatatatat	0.391													4	2	---	---	---	---	
CCDC36	339834	broad.mit.edu	37	3	49278972	49278973	+	Intron	DEL	AC	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49278972_49278973delAC	uc003cwk.2	+						CCDC36_uc003cwl.3_Intron|CCDC36_uc011bck.1_Intron	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36											ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		acacacacatacacacacacac	0.079													3	3	---	---	---	---	
GBE1	2632	broad.mit.edu	37	3	81541897	81541898	+	Intron	INS	-	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541897_81541898insT	uc003dqg.2	-							NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		ttctttctttcttttttttttt	0.000									Glycogen_Storage_Disease_type_IV				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116946061	116946062	+	IGR	DEL	GT	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116946061_116946062delGT								LOC285194 (510176 upstream) : None (None downstream)																							gtgtgtgtgcgtgtgtgtgtgt	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189295640	189295641	+	IGR	INS	-	TTCC	TTCC			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189295640_189295641insTTCC								TPRG1 (254370 upstream) : TP63 (53575 downstream)																							ccttccttcttttccttccttc	0.000													4	2	---	---	---	---	
TMEM207	131920	broad.mit.edu	37	3	190147698	190147698	+	Intron	DEL	G	-	-	rs5855335		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147698delG	uc003fsj.2	-							NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		AGTCACCACAGGGGGGAAAAA	0.363													4	2	---	---	---	---	
NAT8L	339983	broad.mit.edu	37	4	2065299	2065300	+	Intron	INS	-	G	G			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2065299_2065300insG	uc003geq.1	+							NM_178557	NP_848652	Q8N9F0	NAT8L_HUMAN	N-acetyltransferase 8-like (GCN5-related,							integral to membrane|microsome|mitochondrial membrane|rough endoplasmic reticulum membrane	aspartate N-acetyltransferase activity				0			OV - Ovarian serous cystadenocarcinoma(23;0.0315)			GAATAGTGGCTGCCCCCTCCCT	0.644													4	2	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39184298	39184299	+	Intron	DEL	AG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39184298_39184299delAG	uc003gtv.2	+						WDR19_uc010ifl.1_Intron|WDR19_uc003gtu.1_Intron|WDR19_uc011byi.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						GAAATgaggaagagagagagag	0.257													4	2	---	---	---	---	
PLAC8	51316	broad.mit.edu	37	4	84028773	84028774	+	Intron	INS	-	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84028773_84028774insT	uc003hoe.2	-						PLAC8_uc011cco.1_Intron|PLAC8_uc010ijy.2_Intron|PLAC8_uc010ijz.2_Intron|PLAC8_uc003hod.2_Intron	NM_001130716	NP_001124188	Q9NZF1	PLAC8_HUMAN	placenta-specific 8											ovary(1)	1		Hepatocellular(203;0.114)				CATACGGAGGCttttttttttt	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	182826808	182826809	+	IGR	INS	-	CTATTTAT	CTATTTAT	rs137929912	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182826808_182826809insCTATTTAT								None (None upstream) : MGC45800 (233350 downstream)																							CATATGATACACTATTTATTTA	0.183													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2140521	2140522	+	IGR	DEL	AC	-	-	rs72186180		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2140521_2140522delAC								IRX4 (257641 upstream) : IRX2 (605759 downstream)																							tactaaaaatacacacacacac	0.000													4	2	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35086663	35086664	+	Intron	DEL	GT	-	-	rs73767508	byFrequency	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35086663_35086664delGT	uc003jjm.2	-						PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_5'Flank	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CATTTTGCTGgtgtgtgtgtgt	0.386													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44451444	44451445	+	IGR	DEL	AC	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44451444_44451445delAC								FGF10 (62660 upstream) : MRPS30 (357582 downstream)																							gcacacacatacacacacacac	0.025													4	2	---	---	---	---	
RGNEF	64283	broad.mit.edu	37	5	73141989	73141989	+	Intron	DEL	C	-	-	rs72772523	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73141989delC	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		ACCTATTGCACCCCCCCCGCC	0.398													0	6	---	---	---	---	
MSH3	4437	broad.mit.edu	37	5	79950742	79950750	+	In_Frame_Del	DEL	CCCCCAGCT	-	-	rs3045983		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79950742_79950750delCCCCCAGCT	uc003kgz.2	+	1	449_457	c.196_204delCCCCCAGCT	c.(196-204)CCCCCAGCTdel	p.PPA66del	DHFR_uc011ctl.1_5'Flank|DHFR_uc011ctm.1_5'Flank|DHFR_uc010jap.1_5'Flank|DHFR_uc003kgx.1_In_Frame_Del_p.11_14GAGG>G|DHFR_uc003kgy.1_5'UTR	NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3	66_68					maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		gCCCCCAGCGCCCCCAGCTCCCGCCTTCC	0.598								MMR					9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	101389169	101389170	+	IGR	DEL	CA	-	-	rs71650126		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101389169_101389170delCA								None (None upstream) : SLCO4C1 (180524 downstream)																							TTGCCAGTACcacacacacaca	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126059990	126059991	+	IGR	INS	-	TGTG	TGTG	rs71573976		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126059990_126059991insTGTG								C5orf48 (88016 upstream) : LMNB1 (52842 downstream)																							TTCtgtgtgcttgtgtgtgtgt	0.193													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166471034	166471041	+	IGR	DEL	TAAGGACA	-	-	rs2910053		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166471034_166471041delTAAGGACA								None (None upstream) : ODZ2 (240802 downstream)																							aaataaaTAGTaaggacagaaggaagga	0.115													5	5	---	---	---	---	
SLC35B3	51000	broad.mit.edu	37	6	8417377	8417377	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8417377delA	uc010joe.2	-						SLC35B3_uc003mya.2_Intron|SLC35B3_uc003myc.2_Intron|SLC35B3_uc003myb.2_Intron|SLC35B3_uc011did.1_Intron|SLC35B3_uc003myd.2_Intron	NM_001142541	NP_001136013	Q9H1N7	S35B3_HUMAN	solute carrier family 35, member B3						transmembrane transport	Golgi membrane|integral to membrane					0	Ovarian(93;0.0569)					TGATTTAATGAAAAAAAAATG	0.259													3	3	---	---	---	---	
ABCF1	23	broad.mit.edu	37	6	30548124	30548124	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30548124delA	uc003nql.2	+						ABCF1_uc003nqk.2_Intron|ABCF1_uc003nqm.2_Intron|ABCF1_uc010jsb.2_Intron	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1						inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						actccgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
MRPS18B	28973	broad.mit.edu	37	6	30585855	30585855	+	Intron	DEL	C	-	-	rs3214308		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30585855delC	uc003nqo.2	+						PPP1R10_uc003nqn.1_5'Flank|PPP1R10_uc010jsc.1_5'Flank|MRPS18B_uc011dml.1_Intron|MRPS18B_uc010jsd.1_Intron	NM_014046	NP_054765	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B precursor						translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(1)	1						CTTCCTGCAACCCCCCCCCCA	0.512													4	2	---	---	---	---	
BCKDHB	594	broad.mit.edu	37	6	80878330	80878332	+	Intron	DEL	GAA	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80878330_80878332delGAA	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		agaaaggaaggaaggagggaggg	0.177													6	3	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	102498696	102498696	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102498696delA	uc003pqp.3	+						GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	ggaaggaaggaagcaaggaaa	0.144													4	2	---	---	---	---	
BRP44L	51660	broad.mit.edu	37	6	166778943	166778943	+	Intron	DEL	T	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166778943delT	uc011egn.1	-						BRP44L_uc003qva.2_Intron	NM_016098	NP_057182	Q9Y5U8	BR44L_HUMAN	brain protein 44-like							mitochondrion				central_nervous_system(1)	1		Breast(66;0.000148)|Prostate(117;0.109)|Ovarian(120;0.199)		OV - Ovarian serous cystadenocarcinoma(33;1.8e-19)|BRCA - Breast invasive adenocarcinoma(81;4.68e-06)|GBM - Glioblastoma multiforme(31;0.000122)		TTAGTCATCCTGGAAAGAAAC	0.368													21	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	9562620	9562621	+	IGR	DEL	TG	-	-	rs34742433		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9562620_9562621delTG								NXPH1 (770028 upstream) : PER4 (111279 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.094													4	2	---	---	---	---	
PHF14	9678	broad.mit.edu	37	7	11101394	11101395	+	Intron	INS	-	T	T	rs28631230		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11101394_11101395insT	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		tttgttttttgttttttttttt	0.282													4	2	---	---	---	---	
TMEM195	392636	broad.mit.edu	37	7	15290165	15290166	+	Intron	DEL	AC	-	-	rs113279590		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15290165_15290166delAC	uc003stb.1	-							NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						AAATTGAAGTacacacacacac	0.238													4	2	---	---	---	---	
STK31	56164	broad.mit.edu	37	7	23933223	23933224	+	Intron	DEL	GT	-	-	rs71931610		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23933223_23933224delGT	uc003swv.1	+									Q9BXU1	STK31_HUMAN	SubName: Full=Putative uncharacterized protein STK31;								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						CCCTGATGCAgtgtgtgtgtgt	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65082885	65082886	+	IGR	DEL	AT	-	-	rs67619741		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65082885_65082886delAT								ZNF92 (216888 upstream) : INTS4L2 (29891 downstream)																							ATGCatatgcatatatatatat	0.173													5	3	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	132319222	132319223	+	Intron	DEL	CA	-	-	rs71744552		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132319222_132319223delCA	uc003vrb.2	-							NM_181775	NP_861440	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 2							integral to membrane|intracellular|plasma membrane				ovary(1)	1						ACTGCCCCAGcacacacacaca	0.084													4	2	---	---	---	---	
KIF13B	23303	broad.mit.edu	37	8	29018370	29018370	+	Frame_Shift_Del	DEL	C	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29018370delC	uc003xhh.3	-	13	1343	c.1284delG	c.(1282-1284)CAGfs	p.Q428fs	KIF13B_uc003xhj.2_Frame_Shift_Del_p.Q325fs|KIF13B_uc010lvf.1_Frame_Shift_Del_p.Q364fs	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	428	Potential.				microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GACTCTCAAGCTGTTTCTGTC	0.388													44	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142359627	142359628	+	IGR	INS	-	AC	AC	rs148211915	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142359627_142359628insAC								LOC731779 (4908 upstream) : GPR20 (6961 downstream)																							agtagactgagacacacacaca	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144486115	144486116	+	IGR	DEL	AG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144486115_144486116delAG								RHPN1 (19726 upstream) : MAFA (25399 downstream)																							agaaagaaaaagaaagaaagaa	0.074													3	4	---	---	---	---	
MAFA	389692	broad.mit.edu	37	8	144511954	144511956	+	In_Frame_Del	DEL	TGG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144511954_144511956delTGG	uc003yyc.1	-	1	621_623	c.621_623delCCA	c.(619-624)CACCAT>CAT	p.207_208HH>H		NM_201589	NP_963883	Q8NHW3	MAFA_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	207_208	His-rich.				insulin secretion|nitric oxide mediated signal transduction|response to glucose stimulus	nucleus	protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			CGCGCCGCCAtggtggtggtggt	0.581										HNSCC(29;0.082)			4	2	---	---	---	---	
RABGAP1	23637	broad.mit.edu	37	9	125791833	125791833	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125791833delA	uc011lzh.1	+						RABGAP1_uc004bnl.3_Intron	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						CTGGAGTTATAAGTTTATAGT	0.423													48	27	---	---	---	---	
LHX3	8022	broad.mit.edu	37	9	139090465	139090466	+	Intron	INS	-	C	C	rs147905773	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139090465_139090466insC	uc004cha.2	-						LHX3_uc004cgz.2_Intron	NM_178138	NP_835258	Q9UBR4	LHX3_HUMAN	LIM homeobox protein 3 isoform a						inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CGCGCGCTCGTCCCCCCCCGAG	0.639													6	4	---	---	---	---	
WDR85	92715	broad.mit.edu	37	9	140459760	140459761	+	Intron	INS	-	CT	CT	rs71493674		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140459760_140459761insCT	uc004cnk.1	-						WDR85_uc004cnj.1_5'Flank|WDR85_uc004cnl.1_Intron|WDR85_uc004cnm.1_Intron|WDR85_uc004cnn.1_Intron|WDR85_uc010ncl.1_5'Flank	NM_138778	NP_620133	Q9BTV6	WDR85_HUMAN	WD repeat domain 85						peptidyl-diphthamide biosynthetic process from peptidyl-histidine						0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.00029)|Epithelial(140;0.000509)		CCCCTGGGTGACTGTCTGTGAG	0.604													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4734408	4734418	+	IGR	DEL	GGTAGGTGAAG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4734408_4734418delGGTAGGTGAAG								LOC100216001 (14146 upstream) : AKR1E2 (133984 downstream)																							aaggaaggaaggtaggtgaagggaaggaagg	0.071													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	35956230	35956232	+	IGR	DEL	CAC	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35956230_35956232delCAC								FZD8 (25868 upstream) : None (None downstream)																							ccaccatcatcaccaccaccacc	0.000													4	2	---	---	---	---	
SIRT1	23411	broad.mit.edu	37	10	69676090	69676091	+	Frame_Shift_Ins	INS	-	A	A			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69676090_69676091insA	uc001jnd.2	+	9	2037_2038	c.1984_1985insA	c.(1984-1986)GAAfs	p.E662fs	SIRT1_uc010qis.1_Frame_Shift_Ins_p.E367fs|SIRT1_uc009xpp.2_Frame_Shift_Ins_p.E470fs|SIRT1_uc001jne.2_Frame_Shift_Ins_p.E359fs	NM_012238	NP_036370	Q96EB6	SIRT1_HUMAN	sirtuin 1 isoform a	662					apoptosis|cell aging|cellular response to hydrogen peroxide|cellular response to starvation|chromatin silencing at rDNA|DNA repair|DNA replication|establishment of chromatin silencing|histone H3 deacetylation|interspecies interaction between organisms|maintenance of chromatin silencing|muscle organ development|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of fat cell differentiation|negative regulation of helicase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine acetylation|peptidyl-lysine deacetylation|positive regulation of anti-apoptosis|positive regulation of chromatin silencing|positive regulation of DNA repair|regulation of apoptosis|regulation of cell proliferation|regulation of endodeoxyribonuclease activity|regulation of protein import into nucleus, translocation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|rRNA processing|transcription, DNA-dependent|triglyceride mobilization|white fat cell differentiation	chromatin silencing complex|cytoplasm|nuclear euchromatin|nuclear heterochromatin|nuclear inner membrane|nucleolus|PML body|rDNA heterochromatin	bHLH transcription factor binding|histone binding|HLH domain binding|identical protein binding|mitogen-activated protein kinase binding|NAD+ binding|NAD-dependent histone deacetylase activity (H3-K9 specific)|p53 binding|protein C-terminus binding|transcription corepressor activity|zinc ion binding				0						TTCAGACTCTGAAGATGACGTC	0.391													129	75	---	---	---	---	
AMPD3	272	broad.mit.edu	37	11	10483005	10483005	+	Intron	DEL	C	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10483005delC	uc001mio.1	+						AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Intron|AMPD3_uc009yfw.1_Intron|AMPD3_uc009yfx.1_Intron|AMPD3_uc009yfz.2_Intron|AMPD3_uc001mip.1_Intron|AMPD3_uc009yfy.2_Intron	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B						AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		GCCTTCTCTTCCCCGGTGCTG	0.532													262	163	---	---	---	---	
SAPS3	55291	broad.mit.edu	37	11	68305521	68305522	+	Intron	INS	-	T	T	rs147520180	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68305521_68305522insT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			CATTCTAGCAGTAAGTCCAGGG	0.406													4	2	---	---	---	---	
TMTC3	160418	broad.mit.edu	37	12	88582872	88582872	+	Intron	DEL	T	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88582872delT	uc001tau.2	+							NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding			skin(1)	1						GCTTACTTAAttttttttttt	0.104													4	2	---	---	---	---	
SOCS2	8835	broad.mit.edu	37	12	93968379	93968379	+	Intron	DEL	T	-	-	rs35259505		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93968379delT	uc001tcw.1	+						uc001tcv.1_5'Flank|uc001tcu.2_5'Flank|SOCS2_uc001tcx.1_Intron|SOCS2_uc009zsu.2_3'UTR|SOCS2_uc001tcy.1_Intron|SOCS2_uc001tcz.2_3'UTR	NM_003877	NP_003868	O14508	SOCS2_HUMAN	suppressor of cytokine signaling-2						anti-apoptosis|growth hormone receptor signaling pathway|JAK-STAT cascade|negative regulation of signal transduction|regulation of cell growth|response to estradiol stimulus	cytoplasm	growth hormone receptor binding|insulin-like growth factor receptor binding|JAK pathway signal transduction adaptor activity|prolactin receptor binding|SH3/SH2 adaptor activity			lung(1)	1						ACACACCACCTTTTTTTTTTT	0.328													5	3	---	---	---	---	
HEATR5A	25938	broad.mit.edu	37	14	31819967	31819970	+	Intron	DEL	TTTG	-	-	rs72055697		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31819967_31819970delTTTG	uc001wrf.3	-						HEATR5A_uc010ami.2_Intron|HEATR5A_uc001wrg.1_Intron|HEATR5A_uc010tpk.1_Intron	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A								binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TAGGTAAGTTtttgtttgtttgtt	0.176													6	4	---	---	---	---	
SPATA5L1	79029	broad.mit.edu	37	15	45707100	45707100	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45707100delA	uc001zve.2	+						SPATA5L1_uc001zvf.2_Intron	NM_024063	NP_076968	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1							cytoplasm	ATP binding|nucleoside-triphosphatase activity			ovary(3)|skin(1)	4		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		acgtttattgaaaaatttaga	0.060													3	3	---	---	---	---	
MYO5A	4644	broad.mit.edu	37	15	52635119	52635119	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52635119delA	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010ugd.1_Intron|MYO5A_uc002abz.1_5'Flank|MYO5A_uc002aca.1_Intron|MYO5A_uc002acb.1_Intron|MYO5A_uc002acc.1_Intron	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		tctaaaaaagaaaaaaaaaaa	0.144													3	5	---	---	---	---	
AAGAB	79719	broad.mit.edu	37	15	67496495	67496495	+	Intron	DEL	G	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67496495delG	uc002aqk.3	-						AAGAB_uc002aql.2_Intron|AAGAB_uc010uju.1_Intron	NM_024666	NP_078942	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin-binding protein p34						protein transport	cytoplasm					0						ATCTGAAATAGGGATTTGTCA	0.393													45	45	---	---	---	---	
SCAMP2	10066	broad.mit.edu	37	15	75158292	75158319	+	Intron	DEL	GAAGGAAGGAAGGAAGGAAGGAAGGAAG	-	-	rs67717107		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75158292_75158319delGAAGGAAGGAAGGAAGGAAGGAAGGAAG	uc002azb.1	-						SCAMP2_uc010bkg.1_Intron	NM_005697	NP_005688	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|nucleus|recycling endosome membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						actctgtctcgaaggaaggaaggaaggaaggaaggaaggaaggaagga	0.009													4	2	---	---	---	---	
FSD2	123722	broad.mit.edu	37	15	83438317	83438318	+	Intron	INS	-	A	A	rs71455426		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83438317_83438318insA	uc002bjd.2	-						FSD2_uc010uol.1_Intron|FSD2_uc010uom.1_Intron	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing											central_nervous_system(1)	1						ggactcatctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	87757789	87757792	+	IGR	DEL	GGAA	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87757789_87757792delGGAA								AGBL1 (185506 upstream) : NCRNA00052 (362368 downstream)																							ggggaaggacggaaggaaggaagg	0.221													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10612763	10612766	+	IGR	DEL	TCCC	-	-	rs36095074		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10612763_10612766delTCCC								ATF7IP2 (35269 upstream) : EMP2 (9514 downstream)																							catccctccttccctccctccctc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73298978	73298979	+	IGR	DEL	GT	-	-	rs72075949		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73298978_73298979delGT								HTA (171308 upstream) : None (None downstream)																							gcatatatgcgtgtgtgtgtgt	0.040													3	4	---	---	---	---	
C17orf107	100130311	broad.mit.edu	37	17	4805072	4805072	+	3'UTR	DEL	C	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4805072delC	uc002fzl.3	+	3					CHRNE_uc002fzk.1_Intron	NM_001145536	NP_001139008	Q6ZR85	CQ107_HUMAN	hypothetical protein LOC100130311												0						CCCATCTGTACCTCCGGCCGC	0.736													6	5	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10424898	10424899	+	Intron	DEL	AT	-	-	rs147245930		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10424898_10424899delAT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TATTGATGTCATatatatatat	0.248													4	2	---	---	---	---	
SLC47A2	146802	broad.mit.edu	37	17	19608911	19608911	+	Intron	DEL	T	-	-	rs34629869		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19608911delT	uc002gwe.3	-						SLC47A2_uc002gwg.3_Intron|SLC47A2_uc002gwf.3_Intron|SLC47A2_uc002gwh.3_Intron|SLC47A2_uc002gwi.2_Intron|SLC47A2_uc010cqs.1_Intron|SLC47A2_uc010cqt.1_Intron	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN	solute carrier family 47, member 2 isoform 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)					ACTCAGGGGCttttttttttt	0.348													4	2	---	---	---	---	
PDK2	5164	broad.mit.edu	37	17	48174689	48174690	+	Intron	DEL	GA	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48174689_48174690delGA	uc002iqc.2	+						PDK2_uc002iqb.2_Intron	NM_002611	NP_002602	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase 2 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|nucleus	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			central_nervous_system(3)	3						cttgctctctgagccccctgtt	0.257									Autosomal_Dominant_Polycystic_Kidney_Disease				4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62740189	62740190	+	IGR	DEL	AG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62740189_62740190delAG								SMURF2 (81803 upstream) : LOC146880 (5591 downstream)																							gaagaaagaaagaaagaaagaa	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62740199	62740199	+	IGR	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62740199delA								SMURF2 (81813 upstream) : LOC146880 (5582 downstream)																							agaaagaaagaaagaaagaaa	0.124													3	3	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67210656	67210656	+	Intron	DEL	A	-	-	rs67751220		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67210656delA	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfb.1_Intron|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					actccgtctcaaaaaaaaaaa	0.114													4	4	---	---	---	---	
SLC16A5	9121	broad.mit.edu	37	17	73094496	73094496	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73094496delA	uc002jmr.2	+						SLC16A5_uc002jms.1_Intron|SLC16A5_uc002jmt.2_Intron|SLC16A5_uc002jmu.2_Intron|SLC16A5_uc010wrt.1_Intron	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5						organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	tgtctatactaaaaaaaatac	0.000													3	3	---	---	---	---	
ARHGAP28	79822	broad.mit.edu	37	18	6876368	6876368	+	Intron	DEL	T	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6876368delT	uc010wzi.1	+						ARHGAP28_uc002knc.2_Intron|ARHGAP28_uc002knd.2_Intron|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Intron			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				TGTTCCAGAGTTTTTTCATGA	0.328													4	12	---	---	---	---	
ZNF554	115196	broad.mit.edu	37	19	2822955	2822961	+	Intron	DEL	ATGGAGG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2822955_2822961delATGGAGG	uc002lwm.2	+						ZNF554_uc002lwl.2_Intron	NM_001102651	NP_001096121	Q86TJ5	ZN554_HUMAN	zinc finger protein 554						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCAAGCAAATGGAGGTTCTCCAGGC	0.507													23	24	---	---	---	---	
C19orf39	126074	broad.mit.edu	37	19	11485935	11485935	+	Intron	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11485935delA	uc002mrg.1	+							NM_175871	NP_787067	Q6NVH7	CS039_HUMAN	hypothetical protein LOC126074												0						TCAGACCGAGAATGCTGGGGG	0.512													2	4	---	---	---	---	
USF2	7392	broad.mit.edu	37	19	35770041	35770054	+	Intron	DEL	GCTCCCTTGACCTC	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35770041_35770054delGCTCCCTTGACCTC	uc002nyq.1	+						USF2_uc010xss.1_Frame_Shift_Del_p.A339fs|USF2_uc002nyr.1_Intron|USF2_uc002nys.1_Intron|USF2_uc002nyt.1_Intron|USF2_uc002nyu.1_Intron|USF2_uc002nyv.1_Intron	NM_003367	NP_003358	Q15853	USF2_HUMAN	upstream stimulatory factor 2 isoform 1						lipid homeostasis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter by glucose	nucleus	bHLH transcription factor binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity				0	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTGGCCCTCAGCTCCCTTGACCTCCGTCGTGTCC	0.678													18	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	39477045	39477060	+	IGR	DEL	TCTTTCCTTCTTTCTC	-	-	rs76176945		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39477045_39477060delTCTTTCCTTCTTTCTC								FBXO17 (10665 upstream) : FBXO27 (37604 downstream)																							ttcttttctttctttccttctttctctctttccttc	0.028													6	3	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													5	3	---	---	---	---	
RRBP1	6238	broad.mit.edu	37	20	17607832	17607833	+	Intron	INS	-	CT	CT	rs72533972	by1000genomes	TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17607832_17607833insCT	uc002wpv.1	-						RRBP1_uc002wpu.2_Intron|RRBP1_uc002wpw.1_Intron|RRBP1_uc010gcl.1_Intron|RRBP1_uc010gcm.1_Intron	NM_001042576	NP_001036041	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1						protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						AGGCCTGTCCCGTCCTCTAAAT	0.634													2	7	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0						ATGATGAAATACTAACTGTTTTAC	0.402													3	3	---	---	---	---	
MTMR3	8897	broad.mit.edu	37	22	30367191	30367195	+	Intron	DEL	TCTTT	-	-	rs67814292		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30367191_30367195delTCTTT	uc003agv.3	+						MTMR3_uc003agu.3_Intron|MTMR3_uc003agw.3_Intron	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c						phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			ATCTCTTGTGTCTTTTCTTTTCTTG	0.307													6	4	---	---	---	---	
HMGXB4	10042	broad.mit.edu	37	22	35659854	35659854	+	Frame_Shift_Del	DEL	T	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35659854delT	uc003anl.2	+	4	420	c.246delT	c.(244-246)GATfs	p.D82fs	HMGXB4_uc011amh.1_5'UTR|HMGXB4_uc003ank.2_5'UTR	NM_001003681	NP_001003681	Q9UGU5	HMGX4_HUMAN	high-mobility group protein 2-like 1	82					endosome to lysosome transport|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	NURF complex	DNA binding			breast(1)|skin(1)	2						CCTCTGATGATTACTACTATG	0.448													53	38	---	---	---	---	
P2RY8	286530	broad.mit.edu	37	X	1585603	1585604	+	Intron	INS	-	CCTC	CCTC			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1585603_1585604insCCTC	uc004cpz.2	-							NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCTGCTGTCtcctccctccct	0.356			T	CRLF2	B-ALL|Downs associated ALL								3	3	---	---	---	---	
PHKA2	5256	broad.mit.edu	37	X	18937100	18937101	+	Intron	INS	-	T	T			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18937100_18937101insT	uc004cyv.3	-						PHKA2_uc004cyu.3_Intron	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)						glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					AGATATCGATATTTGCACTCCC	0.396													16	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	23210484	23210485	+	IGR	DEL	AC	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23210484_23210485delAC								DDX53 (190280 upstream) : PTCHD1 (142500 downstream)																							CATTGTGTGTacacacacacac	0.312													6	3	---	---	---	---	
ACOT9	23597	broad.mit.edu	37	X	23725854	23725855	+	Intron	INS	-	A	A	rs28418558		TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23725854_23725855insA	uc004dap.2	-						ACOT9_uc004dan.2_5'Flank|ACOT9_uc004dao.2_Intron|ACOT9_uc004daq.2_Intron|ACOT9_uc004dar.2_Intron|ACOT9_uc011mjt.1_Intron|ACOT9_uc004das.2_Intron	NM_001033583	NP_001028755	Q9Y305	ACOT9_HUMAN	acyl-Coenzyme A thioesterase 2, mitochondrial						acyl-CoA metabolic process	mitochondrion	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(2)|pancreas(1)	3						gactccatttcaaaaaaaacaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	51666715	51666715	+	IGR	DEL	T	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51666715delT								MAGED1 (21267 upstream) : MAGED4 (138210 downstream)																							ACCTTCGCCCTCACCATCGCT	0.507													4	2	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53602867	53602892	+	Intron	DEL	TGGTGCTATTACAGATAATGTTAGAG	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53602867_53602892delTGGTGCTATTACAGATAATGTTAGAG	uc004dsp.2	-						HUWE1_uc004dsn.2_Intron	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						ACTGTTTACATGGTGCTATTACAGATAATGTTAGAGTGCCTCACCC	0.274													8	4	---	---	---	---	
GPR174	84636	broad.mit.edu	37	X	78427224	78427224	+	Frame_Shift_Del	DEL	A	-	-			TCGA-A3-3385-01A-02D-1421-08	TCGA-A3-3385-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78427224delA	uc004edg.1	+	1	756	c.720delA	c.(718-720)CTAfs	p.L240fs		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	240	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						GGGTATTCCTAATTTGCTTTG	0.393										HNSCC(63;0.18)			125	90	---	---	---	---	
