Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MFN2	9927	broad.mit.edu	37	1	12058831	12058831	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12058831G>T	uc001atn.3	+	7	1057	c.604G>T	c.(604-606)GGT>TGT	p.G202C	MFN2_uc009vni.2_Missense_Mutation_p.G202C	NM_014874	NP_055689	O95140	MFN2_HUMAN	mitofusin 2	202	Cytoplasmic (Potential).|GTP (Probable).				blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CTTTAGCCCTGGTATTGATGT	0.522													8	546	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22178190	22178190	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22178190G>T	uc001bfj.2	-	55	7047	c.7007C>A	c.(7006-7008)CCT>CAT	p.P2336H	HSPG2_uc009vqd.2_Missense_Mutation_p.P2337H	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	2336	Ig-like C2-type 8.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	GCTGCCGGCAGCTGAGGGATA	0.647													4	79	---	---	---	---	PASS
ZMYM4	9202	broad.mit.edu	37	1	35836039	35836039	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35836039C>A	uc001byt.2	+	7	1072	c.992C>A	c.(991-993)TCA>TAA	p.S331*	ZMYM4_uc009vuu.2_Nonsense_Mutation_p.S299*|ZMYM4_uc001byu.2_Nonsense_Mutation_p.S7*|ZMYM4_uc009vuv.2_Nonsense_Mutation_p.S70*|uc001byv.2_5'Flank	NM_005095	NP_005086	Q5VZL5	ZMYM4_HUMAN	zinc finger protein 262	331					multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ATGCTTCCTTCAGTTCCAGCC	0.398													30	85	---	---	---	---	PASS
ZMYM4	9202	broad.mit.edu	37	1	35836041	35836041	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35836041G>T	uc001byt.2	+	7	1074	c.994G>T	c.(994-996)GTT>TTT	p.V332F	ZMYM4_uc009vuu.2_Missense_Mutation_p.V300F|ZMYM4_uc001byu.2_Missense_Mutation_p.V8F|ZMYM4_uc009vuv.2_Missense_Mutation_p.V71F|uc001byv.2_5'Flank	NM_005095	NP_005086	Q5VZL5	ZMYM4_HUMAN	zinc finger protein 262	332					multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCTTCCTTCAGTTCCAGCCAC	0.403													30	83	---	---	---	---	PASS
THRAP3	9967	broad.mit.edu	37	1	36755101	36755101	+	Missense_Mutation	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36755101C>T	uc001cae.3	+	5	1705	c.1481C>T	c.(1480-1482)TCT>TTT	p.S494F	THRAP3_uc001caf.3_Missense_Mutation_p.S494F|THRAP3_uc001cag.1_Missense_Mutation_p.S494F	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	494					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(5)|lung(3)|breast(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAGGAGGAGTCTTTCCCAGAG	0.507			T	USP6	aneurysmal bone cysts								97	140	---	---	---	---	PASS
PODN	127435	broad.mit.edu	37	1	53540330	53540330	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53540330G>T	uc001cuv.2	+	4	610	c.603G>T	c.(601-603)TTG>TTT	p.L201F	PODN_uc001cuw.2_Missense_Mutation_p.L182F|PODN_uc010onr.1_Missense_Mutation_p.L182F|PODN_uc010ons.1_Intron	NM_153703	NP_714914	Q7Z5L7	PODN_HUMAN	podocan	153	LRR 3.				negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding			ovary(1)|pancreas(1)	2						ACCTGTACTTGGCCAATAACA	0.562													8	267	---	---	---	---	PASS
CLCA2	9635	broad.mit.edu	37	1	86905987	86905987	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86905987G>T	uc001dlr.3	+	8	1522	c.1360G>T	c.(1360-1362)GAG>TAG	p.E454*		NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor	454	VWFA.|Extracellular (Potential).				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		CCCAAATCTGGAGGAATTATC	0.413													6	178	---	---	---	---	PASS
SARS	6301	broad.mit.edu	37	1	109772058	109772058	+	Missense_Mutation	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109772058A>G	uc001dwu.1	+	4	386	c.311A>G	c.(310-312)AAA>AGA	p.K104R	SARS_uc001dwt.1_Missense_Mutation_p.K104R|SARS_uc001dwv.1_Missense_Mutation_p.K104R|SARS_uc001dww.1_Missense_Mutation_p.K37R|SARS_uc001dwx.1_Missense_Mutation_p.K104R|SARS_uc009wfa.1_Missense_Mutation_p.K104R|SARS_uc001dwy.1_5'UTR|SARS_uc001dwz.1_5'UTR	NM_006513	NP_006504	P49591	SYSC_HUMAN	seryl-tRNA synthetase	104					seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	TCACAAATCAAAAAAGTCCGA	0.502													100	438	---	---	---	---	PASS
BOLA1	51027	broad.mit.edu	37	1	149871795	149871795	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149871795G>T	uc001etf.2	+	2	304	c.183G>T	c.(181-183)CCG>CCT	p.P61P		NM_016074	NP_057158	Q9Y3E2	BOLA1_HUMAN	bolA-like 1	61						extracellular region	protein binding			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			ACGCGGTCCCGCCTGGCAGTG	0.677													6	63	---	---	---	---	PASS
RPTN	126638	broad.mit.edu	37	1	152128192	152128192	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152128192G>T	uc001ezs.1	-	3	1448	c.1383C>A	c.(1381-1383)TCC>TCA	p.S461S		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	461	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						GACCATAGTGGGAACTCTGGC	0.517													11	903	---	---	---	---	PASS
C1orf77	26097	broad.mit.edu	37	1	153617600	153617600	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153617600G>T	uc001fcm.1	+	6	914	c.602G>T	c.(601-603)CGA>CTA	p.R201L	C1orf77_uc001fcn.1_Missense_Mutation_p.R202L|C1orf77_uc001fco.1_Missense_Mutation_p.R176L|C1orf77_uc001fcp.2_RNA	NM_015607	NP_056422	Q9Y3Y2	CHTOP_HUMAN	small protein rich in arginine and glycine	201	Arg/Gly-rich.|Interaction with PRMT1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	protein binding|RNA binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGCCGTGGACGAGGGAGAGGT	0.537													5	174	---	---	---	---	PASS
GATAD2B	57459	broad.mit.edu	37	1	153785836	153785836	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153785836C>A	uc001fdb.3	-	8	1553	c.1309G>T	c.(1309-1311)GGT>TGT	p.G437C		NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	437	GATA-type.|CR2.					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGAATCTTACCATTCTTTTCT	0.468													6	224	---	---	---	---	PASS
C1orf189	388701	broad.mit.edu	37	1	154171879	154171879	+	3'UTR	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154171879G>T	uc001fee.1	-	4						NM_001010979	NP_001010979	Q5VU69	CA189_HUMAN	hypothetical protein LOC388701												0	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					TGTTGAGAATGGAAGAGCAGT	0.443													9	467	---	---	---	---	PASS
RUSC1	23623	broad.mit.edu	37	1	155300229	155300229	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155300229G>T	uc001fkj.2	+	10	2805	c.2576G>T	c.(2575-2577)AGA>ATA	p.R859I	RAG1AP1_uc010pey.1_Intron|RUSC1_uc001fkk.2_Missense_Mutation_p.R753I|RUSC1_uc009wqn.1_RNA|RUSC1_uc009wqo.1_Missense_Mutation_p.R390I|RUSC1_uc001fkl.2_Missense_Mutation_p.R449I|RUSC1_uc001fkp.2_Missense_Mutation_p.R390I|RUSC1_uc001fkq.2_Missense_Mutation_p.R284I|RUSC1_uc010pgb.1_Missense_Mutation_p.R357I|RUSC1_uc009wqp.1_Missense_Mutation_p.R384I|RUSC1_uc001fkn.2_Missense_Mutation_p.R168I|RUSC1_uc001fko.2_RNA|RUSC1_uc001fkr.2_Missense_Mutation_p.R390I|RUSC1_uc001fks.2_Missense_Mutation_p.R126I	NM_001105203	NP_001098673	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1 isoform a	859	SH3.					cytoplasm|nucleolus	SH3/SH2 adaptor activity			ovary(2)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			ACTGCTGCAAGACCTGACCAG	0.642													29	79	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155935510	155935510	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155935510C>A	uc001fmt.2	-	5	500	c.382G>T	c.(382-384)GAC>TAC	p.D128Y	ARHGEF2_uc001fmr.2_Missense_Mutation_p.D101Y|ARHGEF2_uc001fms.2_Missense_Mutation_p.D128Y|ARHGEF2_uc001fmu.2_Missense_Mutation_p.D173Y|ARHGEF2_uc010pgt.1_Missense_Mutation_p.D101Y|ARHGEF2_uc010pgu.1_Missense_Mutation_p.D173Y	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2	128					actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CGGAAGCTGTCGGAGGGGTAG	0.612													4	86	---	---	---	---	PASS
OLFML2B	25903	broad.mit.edu	37	1	161976166	161976166	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161976166G>T	uc001gbu.2	-	4	1068	c.644C>A	c.(643-645)TCT>TAT	p.S215Y	OLFML2B_uc010pkq.1_Missense_Mutation_p.S215Y	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	215										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			GATGTTTTCAGAGCAATTTTC	0.493													8	236	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169510090	169510090	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169510090G>T	uc001ggg.1	-	13	4383	c.4238C>A	c.(4237-4239)CCA>CAA	p.P1413Q		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	1413	2-26.|35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	ACCAAGGTCTGGAGAAAGTGT	0.522													5	125	---	---	---	---	PASS
QSOX1	5768	broad.mit.edu	37	1	180147975	180147975	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180147975C>A	uc001gnz.2	+	5	637	c.562C>A	c.(562-564)CTG>ATG	p.L188M	QSOX1_uc001gny.2_Missense_Mutation_p.L188M|QSOX1_uc001goa.2_Missense_Mutation_p.L188M|QSOX1_uc001gob.1_5'Flank	NM_002826	NP_002817	O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1 isoform a	188					cell redox homeostasis|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity			ovary(1)|central_nervous_system(1)	2						CGAAGAGTACCTGGCTCTGAT	0.498											OREG0014018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	268	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181764089	181764089	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181764089G>T	uc001gow.2	+	45	6153	c.5988G>T	c.(5986-5988)ATG>ATT	p.M1996I	CACNA1E_uc009wxs.2_Missense_Mutation_p.M1884I|CACNA1E_uc009wxt.2_Missense_Mutation_p.M1265I	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	2039	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						AATTCTCCATGGAGCGAAGCA	0.522													5	126	---	---	---	---	PASS
ZBTB41	360023	broad.mit.edu	37	1	197168567	197168567	+	Missense_Mutation	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197168567T>C	uc001gtx.1	-	1	1106	c.1037A>G	c.(1036-1038)GAG>GGG	p.E346G	ZBTB41_uc009wyz.1_RNA|CRB1_uc010poz.1_5'Flank	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	346					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						AGTTAACCCCTCATGAACATT	0.373													82	155	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204378920	204378920	+	Missense_Mutation	SNP	T	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204378920T>A	uc001hav.3	-	1	2025	c.1620A>T	c.(1618-1620)GAA>GAT	p.E540D		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	540					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			CCCAGTCATCTTCCTCCCCAG	0.458													44	79	---	---	---	---	PASS
ITPKB	3707	broad.mit.edu	37	1	226834969	226834969	+	Silent	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226834969G>A	uc010pvo.1	-	4	2485	c.2145C>T	c.(2143-2145)TAC>TAT	p.Y715Y		NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B	715							ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				CATCCCCATGGTAGGCAGGTA	0.597													12	97	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20138087	20138087	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20138087C>A	uc002rdi.2	-	19	2143	c.2035G>T	c.(2035-2037)GAG>TAG	p.E679*	WDR35_uc002rdj.2_Nonsense_Mutation_p.E668*|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Nonsense_Mutation_p.E244*|WDR35_uc002rdk.3_Nonsense_Mutation_p.E244*	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	679										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAACCTTCTCAATCAGTGCT	0.398													6	174	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27799568	27799568	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27799568G>T	uc002rkz.3	+	1	180	c.129G>T	c.(127-129)TTG>TTT	p.L43F		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	43										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					GACCACTGTTGACTAGTGTCA	0.398													5	132	---	---	---	---	PASS
EHD3	30845	broad.mit.edu	37	2	31484489	31484489	+	Silent	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31484489G>A	uc002rnu.2	+	5	1598	c.990G>A	c.(988-990)GAG>GAA	p.E330E	EHD3_uc010ymt.1_Intron	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	330					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					AGAAGAAGGAGCTGGTCAACA	0.572													95	183	---	---	---	---	PASS
MSH2	4436	broad.mit.edu	37	2	47705584	47705584	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47705584C>A	uc002rvy.1	+	14	2452	c.2384C>A	c.(2383-2385)CCA>CAA	p.P795Q	MSH2_uc010yoh.1_Missense_Mutation_p.P729Q|MSH2_uc002rvz.2_Missense_Mutation_p.P795Q|MSH2_uc010fbg.2_Missense_Mutation_p.P605Q	NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2	795					B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	p.?(2)		large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AATCAGATACCAACTGTTAAT	0.378			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				7	263	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80136837	80136837	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80136837C>A	uc010ysh.1	+	6	975	c.970C>A	c.(970-972)CGA>AGA	p.R324R	CTNNA2_uc010yse.1_Silent_p.R324R|CTNNA2_uc010ysf.1_Silent_p.R324R|CTNNA2_uc010ysg.1_Silent_p.R324R	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	324					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CTCCTGCACGCGAGACGACCG	0.647													66	109	---	---	---	---	PASS
POLR1A	25885	broad.mit.edu	37	2	86270175	86270175	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86270175G>T	uc002sqs.2	-	23	3658	c.3279C>A	c.(3277-3279)TCC>TCA	p.S1093S	POLR1A_uc010ytb.1_Silent_p.S459S|POLR1A_uc002sqt.1_Silent_p.S116S	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	1093					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						GAATTTTCTGGGAATAACTCA	0.517													7	276	---	---	---	---	PASS
MRPL35	51318	broad.mit.edu	37	2	86433368	86433368	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86433368C>A	uc002srg.3	+	2	241	c.183C>A	c.(181-183)ACC>ACA	p.T61T	MRPL35_uc002srf.3_Silent_p.T61T	NM_016622	NP_057706	Q9NZE8	RM35_HUMAN	mitochondrial ribosomal protein L35 isoform a	61					translation	mitochondrial ribosome	structural constituent of ribosome				0						CCAGACTTACCACATCTGAGA	0.383													7	333	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96593000	96593000	+	RNA	SNP	A	G	G	rs111976783		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96593000A>G	uc002sva.1	-	9		c.405T>C			uc010yug.1_RNA|uc002svc.1_RNA					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		TTCTGTGGCTATATTTGAAAC	0.338													7	118	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96593016	96593016	+	RNA	SNP	C	A	A	rs79307257	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96593016C>A	uc002sva.1	-	9		c.389G>T			uc010yug.1_RNA|uc002svc.1_RNA					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		GAAACAGAATCTTTCTCATCA	0.318													7	123	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96593025	96593025	+	RNA	SNP	C	T	T	rs75189823	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96593025C>T	uc002sva.1	-	9		c.380G>A			uc010yug.1_RNA|uc002svc.1_RNA					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		TCTTTCTCATCACTTGTAGCC	0.318													7	126	---	---	---	---	PASS
IL1R2	7850	broad.mit.edu	37	2	102625086	102625086	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102625086C>A	uc002tbm.2	+	2	278	c.49C>A	c.(49-51)CAG>AAG	p.Q17K	IL1R2_uc002tbn.2_Missense_Mutation_p.Q17K|IL1R2_uc002tbo.1_Missense_Mutation_p.Q17K	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor	17	Extracellular (Potential).				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	CTTCACCCTTCAGCCTGCGGC	0.498													6	224	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109388270	109388270	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109388270C>A	uc002tem.3	+	21	8089	c.7963C>A	c.(7963-7965)CCA>ACA	p.P2655T		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2655	Required for E3 SUMO-ligase activity.|1.|Interaction with UBE2I.|2 X 50 AA approximate repeats.			P->A: No effect on SUMO E3 ligase activity.	carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						TAAACTTCCTCCAACTTTCTT	0.388													10	435	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178534266	178534266	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178534266G>T	uc002ulq.2	-	18	2835	c.2517C>A	c.(2515-2517)TTC>TTA	p.F839L	PDE11A_uc010zfd.1_Missense_Mutation_p.F30L|PDE11A_uc002ulp.2_Missense_Mutation_p.F395L|PDE11A_uc002ulr.2_Missense_Mutation_p.F589L|PDE11A_uc002uls.1_Missense_Mutation_p.F481L|PDE11A_uc002ult.1_Missense_Mutation_p.F589L|PDE11A_uc002ulu.1_Missense_Mutation_p.F481L	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	839	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			CTCCTTGTTCGAAGAACTCAC	0.353									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				6	251	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179542440	179542440	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179542440G>T	uc010zfg.1	-	143	30691	c.30467C>A	c.(30466-30468)CCC>CAC	p.P10156H	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P6817H|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11083							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTTCTTCGGGAGGAACTTC	0.448													7	259	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196689021	196689021	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196689021G>T	uc002utj.3	-	49	9350	c.9249C>A	c.(9247-9249)ACC>ACA	p.T3083T		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3083	AAA 5 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TTCTTAACTTGGTAGTAATAT	0.353													6	224	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198540329	198540329	+	5'UTR	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198540329G>A	uc002uuo.3	-	1						NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2							plasma membrane					0						aaaaaaaaaagcaaaaaccaa	0.234													4	7	---	---	---	---	PASS
C2orf62	375307	broad.mit.edu	37	2	219229475	219229475	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219229475G>T	uc002vhr.2	+	7	784	c.755G>T	c.(754-756)GGG>GTG	p.G252V	C2orf62_uc002vhs.2_Intron	NM_198559	NP_940961	Q7Z7H3	CB062_HUMAN	hypothetical protein LOC375307	252											0		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCTCCGATGGGTGAGCTGCT	0.597													6	138	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230724243	230724243	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230724243G>T	uc002vpw.1	-	3	255	c.146C>A	c.(145-147)CCA>CAA	p.P49Q	TRIP12_uc002vpx.1_Missense_Mutation_p.P91Q|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_RNA|TRIP12_uc010fxh.1_Missense_Mutation_p.P49Q	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	49					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GGCTCTGTCTGGATCCTCTGG	0.438													8	374	---	---	---	---	PASS
UGT1A10	54575	broad.mit.edu	37	2	234545342	234545342	+	Silent	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234545342C>T	uc002vur.2	+	1	220	c.174C>T	c.(172-174)GTC>GTT	p.V58V	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Silent_p.V58V	NM_019075	NP_061948	Q9HAW8	UD110_HUMAN	UDP glycosyltransferase 1 family, polypeptide	58					flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding			ovary(2)|skin(1)	3		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGGTTGTAGTCATGCCAGAGG	0.517													16	191	---	---	---	---	PASS
XPC	7508	broad.mit.edu	37	3	14200007	14200007	+	Missense_Mutation	SNP	T	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14200007T>A	uc011ave.1	-	9	1480	c.1376A>T	c.(1375-1377)GAT>GTT	p.D459V	XPC_uc011avf.1_Missense_Mutation_p.D266V|XPC_uc011avg.1_Missense_Mutation_p.D422V	NM_004628	NP_004619	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	459	Asp/Glu-rich (acidic).				nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal	cytoplasm|nucleoplasm|XPC complex	bubble DNA binding|damaged DNA binding|loop DNA binding|protein binding|single-stranded DNA binding			ovary(2)|breast(1)	3						AGGTTCGGAATCCTCATCAGA	0.577			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		NER	Xeroderma_Pigmentosum				39	41	---	---	---	---	PASS
DCLK3	85443	broad.mit.edu	37	3	36778861	36778861	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36778861G>T	uc003cgi.2	-	2	1781	c.1290C>A	c.(1288-1290)ATC>ATA	p.I430I		NM_033403	NP_208382	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	430	Protein kinase.					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						CGTACTCCAGGATCAGGTAGA	0.488													5	94	---	---	---	---	PASS
ITGA9	3680	broad.mit.edu	37	3	37670844	37670844	+	Intron	SNP	T	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37670844T>G	uc003chd.2	+						ITGA9_uc003chc.2_Missense_Mutation_p.L619R	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		ACCTTAAAGCTCATACTCAGC	0.493													15	22	---	---	---	---	PASS
FILIP1L	11259	broad.mit.edu	37	3	99648769	99648769	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99648769G>T	uc003dtm.2	-	3	820	c.357C>A	c.(355-357)CTC>CTA	p.L119L	C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Silent_p.L119L	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1	119						cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1						CATCTCTCTGGAGAGCCTCTA	0.458													6	209	---	---	---	---	PASS
CD200R1	131450	broad.mit.edu	37	3	112693830	112693830	+	5'UTR	SNP	C	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112693830C>G	uc003dzk.1	-	1					CD200R1_uc003dzj.1_5'UTR|CD200R1_uc011bhx.1_5'UTR|CD200R1_uc003dzl.1_5'UTR|CD200R1_uc003dzm.1_5'UTR	NM_170780	NP_740750	Q8TD46	MO2R1_HUMAN	CD200 receptor 1 isoform d						interspecies interaction between organisms|regulation of immune response	extracellular region|integral to membrane|plasma membrane	receptor activity			ovary(2)|pancreas(1)	3						ACCCCATCAACAGTGGGGCAC	0.498													3	12	---	---	---	---	PASS
ZNF80	7634	broad.mit.edu	37	3	113955069	113955069	+	3'UTR	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113955069G>A	uc010hqo.2	-	1					ZNF80_uc003ebf.2_RNA	NM_007136	NP_009067	P51504	ZNF80_HUMAN	zinc finger protein 80							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(201;0.0233)|all_neural(597;0.0837)				AAAAAAAAAAGAAAACCCACA	0.428													8	118	---	---	---	---	PASS
RABL3	285282	broad.mit.edu	37	3	120417286	120417286	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120417286G>T	uc003edx.2	-	5	548	c.518C>A	c.(517-519)CCA>CAA	p.P173Q		NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	173	Small GTPase-like.				small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		AATTTCTTCTGGATTGAAATC	0.343													8	496	---	---	---	---	PASS
LOC100125556	100125556	broad.mit.edu	37	3	125647441	125647441	+	RNA	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125647441C>T	uc003eif.3	+	5		c.615C>T			LOC100125556_uc003eid.3_RNA|LOC100125556_uc003eie.3_RNA	NR_024251				Homo sapiens family with sequence similarity 86, member A pseudogene, mRNA (cDNA clone IMAGE:4425123).												0						CACTGTAGGACTCACACACGA	0.463													5	171	---	---	---	---	PASS
ATP2C1	27032	broad.mit.edu	37	3	130698199	130698199	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130698199C>A	uc003enl.2	+	19	1899	c.1677C>A	c.(1675-1677)CTC>CTA	p.L559L	ATP2C1_uc011blg.1_Silent_p.L593L|ATP2C1_uc011blh.1_Silent_p.L554L|ATP2C1_uc011bli.1_Silent_p.L593L|ATP2C1_uc003enk.2_Silent_p.L543L|ATP2C1_uc003enm.2_Silent_p.L559L|ATP2C1_uc003enn.2_Silent_p.L543L|ATP2C1_uc003eno.2_Silent_p.L559L|ATP2C1_uc003enp.2_Silent_p.L559L|ATP2C1_uc003enq.2_Silent_p.L559L|ATP2C1_uc003enr.2_Silent_p.L559L|ATP2C1_uc003ens.2_Silent_p.L559L|ATP2C1_uc003ent.2_Silent_p.L559L|ATP2C1_uc003enu.2_Silent_p.L237L	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	559	Cytoplasmic (By similarity).				actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	TTACAACACTCATTGCCTCAG	0.423									Hailey-Hailey_disease				6	256	---	---	---	---	PASS
RNF13	11342	broad.mit.edu	37	3	149677878	149677878	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149677878G>T	uc003exn.3	+	10	1520	c.736G>T	c.(736-738)GAG>TAG	p.E246*	RNF13_uc003exp.3_Nonsense_Mutation_p.E246*|RNF13_uc010hvh.2_Nonsense_Mutation_p.E127*	NM_007282	NP_009213	O43567	RNF13_HUMAN	ring finger protein 13	246	Cytoplasmic (Potential).|RING-type; atypical.				protein autoubiquitination	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane|nuclear inner membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TTGTTTGGATGAGTATGAAGA	0.333													8	374	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	150906147	150906147	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150906147G>T	uc003eyp.2	+	12	1671	c.1633G>T	c.(1633-1635)GGT>TGT	p.G545C	MED12L_uc011bnz.1_Missense_Mutation_p.G405C|MED12L_uc003eyn.2_Missense_Mutation_p.G545C|MED12L_uc003eyo.2_Missense_Mutation_p.G545C	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	545					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTAGAGATGTGGTGAATCAGA	0.323													5	136	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164786516	164786516	+	Silent	SNP	C	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164786516C>G	uc003fei.2	-	5	539	c.477G>C	c.(475-477)CGG>CGC	p.R159R		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	159	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	GAACCTTGAACCGGAAACGAT	0.279										HNSCC(35;0.089)			9	247	---	---	---	---	PASS
LOC100128164	100128164	broad.mit.edu	37	3	169663989	169663989	+	RNA	SNP	C	A	A	rs75868978	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169663989C>A	uc011bpp.1	-	2		c.3814G>T				NR_027622				Homo sapiens cDNA FLJ41016 fis, clone UTERU2018784.												0						ACAAAGCCCTCGGCATGCCAG	0.488													4	155	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	183976532	183976532	+	Intron	SNP	T	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183976532T>A	uc003fni.3	+						ECE2_uc003fnh.3_3'UTR	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A						brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACAGCCCAGCTCCAACTAGAT	0.537													8	10	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													2	8	---	---	---	---	PASS
CCDC96	257236	broad.mit.edu	37	4	7043392	7043392	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7043392C>A	uc003gjv.2	-	1	1337	c.1274G>T	c.(1273-1275)CGA>CTA	p.R425L	TADA2B_uc003gjw.3_5'Flank|TADA2B_uc010idi.2_5'Flank	NM_153376	NP_699207	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	425	Potential.										0						TTCCTCATTTCGTTCCTCAAT	0.458													7	554	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55968588	55968588	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55968588C>A	uc003has.2	-	14	2377	c.2075G>T	c.(2074-2076)GGG>GTG	p.G692V	KDR_uc003hat.1_Missense_Mutation_p.G692V	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	692	Ig-like C2-type 7.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	AGGGGGATTCCCAGATGCCGT	0.463			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			7	266	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186380370	186380370	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186380370G>T	uc003ixu.3	-	6	1447	c.1371C>A	c.(1369-1371)TCC>TCA	p.S457S	CCDC110_uc003ixv.3_Silent_p.S420S|CCDC110_uc011ckt.1_Silent_p.S457S	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	457	Potential.					nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		GTTTCATTTTGGACTTAAGGT	0.323													6	282	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	230997	230997	+	Nonsense_Mutation	SNP	C	A	A	rs140243793		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:230997C>A	uc003jao.3	+	7	892	c.777C>A	c.(775-777)TAC>TAA	p.Y259*	SDHA_uc003jan.2_Nonsense_Mutation_p.Y259*|SDHA_uc011clv.1_Nonsense_Mutation_p.Y259*|SDHA_uc011clw.1_Nonsense_Mutation_p.Y211*|SDHA_uc003jap.3_Nonsense_Mutation_p.Y259*|SDHA_uc003jaq.3_Nonsense_Mutation_p.Y34*|SDHA_uc003jar.3_5'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	259					nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CCAGAGGCTACGGGCGCACCT	0.602									Familial_Paragangliomas				6	93	---	---	---	---	PASS
MTRR	4552	broad.mit.edu	37	5	7889218	7889218	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7889218G>T	uc003jed.2	+	9	1268	c.1238G>T	c.(1237-1239)CGA>CTA	p.R413L	MTRR_uc003jee.3_Missense_Mutation_p.R386L|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2	413	FAD-binding FR-type.				methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	GCATTTTTGCGAGCCCTTGTG	0.473													4	77	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41149383	41149383	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41149383G>T	uc003jmk.2	-	17	2793	c.2583C>A	c.(2581-2583)TCC>TCA	p.S861S	C6_uc003jml.1_Silent_p.S861S	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	861	Complement control factor I module 2.|C5b-binding domain.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CATAGCCACAGGATTCTTTCT	0.433													10	582	---	---	---	---	PASS
IL31RA	133396	broad.mit.edu	37	5	55210730	55210730	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55210730G>T	uc003jql.2	+	14	1857	c.1792G>T	c.(1792-1794)GCC>TCC	p.A598S	IL31RA_uc003jqm.2_Missense_Mutation_p.A566S|IL31RA_uc003jqn.2_Missense_Mutation_p.A598S|IL31RA_uc003jqo.2_Missense_Mutation_p.A456S	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor	566	Cytoplasmic (Potential).				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				AAGTAGTATAGCCACATGGCA	0.438													5	174	---	---	---	---	PASS
TNPO1	3842	broad.mit.edu	37	5	72195908	72195908	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72195908G>T	uc003kck.3	+	21	2561	c.2414G>T	c.(2413-2415)TGG>TTG	p.W805L	TNPO1_uc011csj.1_Missense_Mutation_p.W755L|TNPO1_uc003kch.2_Missense_Mutation_p.W797L|TNPO1_uc003kci.3_Missense_Mutation_p.W797L|TNPO1_uc003kcg.3_Missense_Mutation_p.W797L	NM_002270	NP_002261	Q92973	TNPO1_HUMAN	transportin 1 isoform 1	805					interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity	p.W797*(1)		skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		ATAAGACCCTGGTGTGTATTA	0.348													7	204	---	---	---	---	PASS
RAD50	10111	broad.mit.edu	37	5	131939058	131939058	+	Silent	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131939058T>C	uc003kxi.2	+	14	2661	c.2274T>C	c.(2272-2274)AAT>AAC	p.N758N	RAD50_uc003kxh.2_Silent_p.N619N	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	758					DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGAATGTCAATAGAGACATAC	0.343								Homologous_recombination					6	75	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554161	140554161	+	Missense_Mutation	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554161C>T	uc003lit.2	+	1	1919	c.1745C>T	c.(1744-1746)CCG>CTG	p.P582L		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	582	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGCCGAGCCGGGCTACCTG	0.697													28	83	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140572990	140572990	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140572990C>A	uc003lix.2	+	1	1039	c.865C>A	c.(865-867)CGA>AGA	p.R289R		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	289	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAAAATATTCGAACAACCTT	0.358													5	204	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140736922	140736922	+	Missense_Mutation	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140736922T>C	uc003ljq.1	+	1	2155	c.2155T>C	c.(2155-2157)TGG>CGG	p.W719R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGB2_uc003ljs.1_5'Flank|PCDHGA4_uc003ljp.1_Missense_Mutation_p.W719R|PCDHGB2_uc011dar.1_5'Flank	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	719	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGAGACGCTGGCACAAGTC	0.622													3	61	---	---	---	---	PASS
ATP10B	23120	broad.mit.edu	37	5	160061334	160061334	+	Intron	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160061334G>T	uc003lym.1	-						ATP10B_uc003lyp.2_Missense_Mutation_p.P470T|ATP10B_uc011deg.1_Missense_Mutation_p.P514T|ATP10B_uc003lyn.2_Intron|ATP10B_uc003lyo.2_Missense_Mutation_p.P442T	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTAGAAAGAGGGATGGAGCCC	0.478													9	389	---	---	---	---	PASS
RANBP17	64901	broad.mit.edu	37	5	170725878	170725878	+	3'UTR	SNP	C	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170725878C>G	uc003mba.2	+	28					RANBP17_uc003mbb.2_3'UTR|RANBP17_uc010jjs.2_RNA	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTTTCTGACCATGTGCGGAG	0.498			T	TRD@	ALL								23	36	---	---	---	---	PASS
NPM1	4869	broad.mit.edu	37	5	170818768	170818768	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170818768C>A	uc011dex.1	+	5	452	c.317C>A	c.(316-318)TCA>TAA	p.S106*	NPM1_uc003mbh.2_Nonsense_Mutation_p.S106*|NPM1_uc003mbi.2_Nonsense_Mutation_p.S106*|NPM1_uc003mbj.2_Nonsense_Mutation_p.S106*	NM_002520	NP_002511	P06748	NPM_HUMAN	nucleophosmin 1 isoform 1	106	Necessary for interaction with APEX1.|Required for interaction with SENP3.				anti-apoptosis|cell aging|CenH3-containing nucleosome assembly at centromere|centrosome cycle|DNA repair|interspecies interaction between organisms|intracellular protein transport|negative regulation of cell proliferation|negative regulation of centrosome duplication|nucleocytoplasmic transport|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|regulation of endodeoxyribonuclease activity|regulation of endoribonuclease activity|ribosome assembly|signal transduction	nucleolus|nucleoplasm|ribonucleoprotein complex|spindle pole centrosome	histone binding|NF-kappaB binding|protein binding|protein heterodimerization activity|protein homodimerization activity|ribosomal large subunit binding|ribosomal small subunit binding|RNA binding|Tat protein binding|transcription coactivator activity|unfolded protein binding		NPM1/ALK(632)	haematopoietic_and_lymphoid_tissue(3109)|skin(1)	3110	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AAGTGTGGTTCAGGGCCAGTG	0.393			T|F 	ALK|RARA|MLF1	NHL|APL|AML								5	112	---	---	---	---	PASS
DCDC2	51473	broad.mit.edu	37	6	24178839	24178839	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24178839C>A	uc003ndx.2	-	9	1347	c.1045G>T	c.(1045-1047)GAG>TAG	p.E349*	DCDC2_uc003ndy.2_Nonsense_Mutation_p.E349*|DCDC2_uc003ndw.2_Nonsense_Mutation_p.E100*	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	349					cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				TCTTCTTCCTCGTCTACTATT	0.408													6	187	---	---	---	---	PASS
HLA-G	3135	broad.mit.edu	37	6	29976422	29976422	+	Intron	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29976422G>T	uc011dmb.1	+						NCRNA00171_uc011dme.1_Intron|HLA-J_uc003nou.3_Intron|HLA-J_uc003rtl.3_Intron|HLA-J_uc003nov.3_RNA	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						GTTCTCCTTGGAGCTGTGGTC	0.577													5	102	---	---	---	---	PASS
HSP90AB1	3326	broad.mit.edu	37	6	44217820	44217820	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44217820C>A	uc003oxa.1	+	5	661	c.577C>A	c.(577-579)CTA>ATA	p.L193I	HSP90AB1_uc011dvr.1_Missense_Mutation_p.L183I|HSP90AB1_uc003oxb.1_Missense_Mutation_p.L193I|HSP90AB1_uc011dvs.1_Missense_Mutation_p.L13I|HSP90AB1_uc003oxc.1_5'UTR	NM_007355	NP_031381	P08238	HS90B_HUMAN	heat shock 90kDa protein 1, beta	193					axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding			lung(3)|breast(1)	4	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GACAGAGTACCTAGAAGAGAG	0.423													6	156	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51935825	51935825	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51935825G>T	uc003pah.1	-	9	922	c.646C>A	c.(646-648)CAT>AAT	p.H216N	PKHD1_uc003pai.2_Missense_Mutation_p.H216N	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	216	IPT/TIG 2.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CCTTCCACATGGCACTGCAGA	0.413													52	128	---	---	---	---	PASS
FAM135A	57579	broad.mit.edu	37	6	71232215	71232215	+	Splice_Site	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71232215G>T	uc003pfj.2	+	11	1163	c.1030_splice	c.e11-1	p.V344_splice	FAM135A_uc003pfi.2_Splice_Site_p.V344_splice|FAM135A_uc003pfh.2_Splice_Site_p.V327_splice|FAM135A_uc003pfk.2_Splice_Site_p.V370_splice|FAM135A_uc003pfl.2_Splice_Site_p.V207_splice|FAM135A_uc003pfn.2_5'Flank|FAM135A_uc003pfo.1_5'Flank	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c											central_nervous_system(1)	1						GAATTTTTTAGGTACGCAGAT	0.373													7	309	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76591493	76591493	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76591493C>A	uc003pih.1	+	23	2653	c.2374C>A	c.(2374-2376)CGC>AGC	p.R792S	MYO6_uc003pig.1_Missense_Mutation_p.R792S|MYO6_uc003pii.1_Missense_Mutation_p.R792S	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	792	Required for binding calmodulin (By similarity).				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CACATGCAGTCGCTGGAAGAA	0.418													5	264	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85447027	85447027	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85447027G>T	uc003pkl.1	-	8	1200	c.1200C>A	c.(1198-1200)TTC>TTA	p.F400L	TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	400					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GCCCCAGATGGAAGGCAGGAG	0.582													18	128	---	---	---	---	PASS
SERINC1	57515	broad.mit.edu	37	6	122792938	122792938	+	5'UTR	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122792938C>A	uc003pyy.1	-	1					PKIB_uc003pyz.2_5'Flank	NM_020755	NP_065806	Q9NRX5	SERC1_HUMAN	serine incorporator 1						phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	L-serine transmembrane transporter activity|protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.126)		GCTTCTTTCTCGCCTTTCCGA	0.577													4	91	---	---	---	---	PASS
RAET1G	353091	broad.mit.edu	37	6	150240312	150240312	+	Missense_Mutation	SNP	T	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150240312T>A	uc010kii.1	-	3	566	c.498A>T	c.(496-498)AGA>AGT	p.R166S	uc003qni.1_Intron|RAET1G_uc003qnm.2_RNA	NM_001001788	NP_001001788	Q6H3X3	RET1G_HUMAN	retinoic acid early transcript 1G precursor	166	Extracellular (Potential).|MHC class I alpha-2 like.				antigen processing and presentation|immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		CTTTCATCTTTCTGGCTCCAG	0.473													102	221	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152711518	152711518	+	Missense_Mutation	SNP	A	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152711518A>T	uc010kiw.2	-	53	8676	c.8074T>A	c.(8074-8076)TTG>ATG	p.L2692M	SYNE1_uc003qot.3_Missense_Mutation_p.L2699M|SYNE1_uc003qou.3_Missense_Mutation_p.L2692M|SYNE1_uc010kjb.1_Missense_Mutation_p.L2675M	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2692	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTACTTCTCAAGGCCTGTTCC	0.473										HNSCC(10;0.0054)			20	97	---	---	---	---	PASS
MIOS	54468	broad.mit.edu	37	7	7636022	7636022	+	Silent	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7636022C>T	uc003srf.2	+	11	2639	c.2331C>T	c.(2329-2331)GGC>GGT	p.G777G	MIOS_uc003srg.2_Silent_p.G312G|MIOS_uc010ktq.2_Silent_p.G172G	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	777											0						GTTGTCCTGGCTGTCGAAAAC	0.433													99	212	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	34981390	34981390	+	Missense_Mutation	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34981390A>G	uc003tem.3	-	18	1602	c.1457T>C	c.(1456-1458)ATC>ACC	p.I486T	DPY19L1_uc003ten.1_5'Flank|MIR548N_hsa-mir-548n|MI0006399_5'Flank	NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	486						integral to membrane					0						TCTTGAGCAGATCAGTGATGC	0.343													63	158	---	---	---	---	PASS
ZNF273	10793	broad.mit.edu	37	7	64388822	64388822	+	Silent	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64388822A>G	uc003tto.2	+	4	1192	c.1116A>G	c.(1114-1116)AAA>AAG	p.K372K	ZNF273_uc003ttl.2_Silent_p.K307K|ZNF273_uc003ttn.2_Silent_p.K307K	NM_021148	NP_066971	Q14593	ZN273_HUMAN	zinc finger protein 273	372					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CTGGAGAGAAACCCTACAAAT	0.383													4	160	---	---	---	---	PASS
LOC493754	493754	broad.mit.edu	37	7	66038385	66038385	+	RNA	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66038385G>T	uc010lac.1	-	2		c.273C>A			LOC493754_uc010lad.2_RNA|LOC493754_uc011kdx.1_RNA|LOC493754_uc011kdy.1_RNA|LOC493754_uc011kdz.1_RNA|LOC493754_uc011kea.1_RNA|LOC493754_uc003tvc.3_RNA|LOC493754_uc011keb.1_RNA|LOC493754_uc011kec.1_RNA					Homo sapiens cDNA FLJ14309 fis, clone PLACE3000221.												0						TCTTTGATCCGACCCTGGAAG	0.443													5	71	---	---	---	---	PASS
RABGEF1	27342	broad.mit.edu	37	7	66262378	66262378	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66262378G>T	uc011kee.1	+	6	819	c.655G>T	c.(655-657)GAG>TAG	p.E219*	RABGEF1_uc003tvf.2_Nonsense_Mutation_p.E78*|RABGEF1_uc003tvg.2_Nonsense_Mutation_p.E13*|RABGEF1_uc010lag.2_Nonsense_Mutation_p.E205*|RABGEF1_uc003tvh.2_Nonsense_Mutation_p.E205*|RABGEF1_uc003tvi.2_Nonsense_Mutation_p.E39*	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	422					endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						AGAAAGAGTCGAGAAGATAAT	0.274													4	112	---	---	---	---	PASS
CDK14	5218	broad.mit.edu	37	7	90585051	90585051	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90585051C>A	uc003uky.2	+	9	1088	c.866C>A	c.(865-867)TCC>TAC	p.S289Y	CDK14_uc003ukz.1_Missense_Mutation_p.S271Y|CDK14_uc010les.1_Missense_Mutation_p.S243Y|CDK14_uc011khl.1_Missense_Mutation_p.S160Y	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1	289	Protein kinase.				cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						CACACATACTCCAACGAAGTG	0.423													7	298	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92978032	92978032	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92978032G>T	uc003umo.2	+	24	2345	c.2217G>T	c.(2215-2217)TTG>TTT	p.L739F	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.L709F|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.L459F	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	739											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GGGTATTCTTGGCTGAACAGT	0.403													6	157	---	---	---	---	PASS
ZKSCAN1	7586	broad.mit.edu	37	7	99621415	99621415	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99621415C>A	uc003usk.1	+	2	505	c.286C>A	c.(286-288)CTG>ATG	p.L96M	ZKSCAN1_uc003usj.2_Missense_Mutation_p.L95M|ZKSCAN1_uc003usl.1_Missense_Mutation_p.L60M|ZKSCAN1_uc003usm.1_Intron	NM_003439	NP_003430	P17029	ZKSC1_HUMAN	zinc finger protein 36	96	SCAN box.				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GGAACAGATCCTGGAGCTTCT	0.557													6	167	---	---	---	---	PASS
ZCWPW1	55063	broad.mit.edu	37	7	100016651	100016651	+	Intron	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100016651G>T	uc003uut.2	-						ZCWPW1_uc011kjq.1_5'Flank|ZCWPW1_uc003uur.2_5'Flank|ZCWPW1_uc003uus.2_5'UTR|ZCWPW1_uc011kjr.1_Intron|ZCWPW1_uc003uuu.1_Intron|ZCWPW1_uc011kjs.1_5'Flank|ZCWPW1_uc011kjt.1_3'UTR|ZCWPW1_uc011kju.1_3'UTR	NM_017984	NP_060454	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1								zinc ion binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGAGAAAGAGAGAAGCTGTC	0.393													5	114	---	---	---	---	PASS
C7orf60	154743	broad.mit.edu	37	7	112461675	112461675	+	3'UTR	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112461675C>A	uc003vgo.1	-	5					C7orf60_uc011kms.1_3'UTR	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743											ovary(2)|skin(1)	3						ATAGCAAACTCTGTAAACCTC	0.328													5	80	---	---	---	---	PASS
FOXP2	93986	broad.mit.edu	37	7	114282634	114282634	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114282634C>A	uc003vhb.2	+	7	1319	c.945C>A	c.(943-945)TCC>TCA	p.S315S	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Silent_p.S340S|FOXP2_uc003vha.2_Silent_p.S223S|FOXP2_uc011kmu.1_Silent_p.S332S|FOXP2_uc011kmv.1_Silent_p.S314S|FOXP2_uc010ljz.1_Silent_p.S223S|FOXP2_uc003vgx.2_Silent_p.S315S|FOXP2_uc003vhd.2_Silent_p.S315S|FOXP2_uc003vhc.2_Silent_p.S340S	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	315					camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						CTCATCATTCCATAGTGAATG	0.388													8	222	---	---	---	---	PASS
LMOD2	442721	broad.mit.edu	37	7	123302309	123302309	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123302309C>A	uc003vky.2	+	2	826	c.669C>A	c.(667-669)AAC>AAA	p.N223K		NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	223						cytoskeleton	actin binding|tropomyosin binding				0						ACATTGAGAACATCACAACAC	0.483													7	54	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128475472	128475472	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128475472G>T	uc003vnz.3	+	2	654	c.445G>T	c.(445-447)GAG>TAG	p.E149*	FLNC_uc003voa.3_Nonsense_Mutation_p.E149*	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	149	Actin-binding.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GCCCATGTGGGAGGATGAAGA	0.577													6	149	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128481583	128481583	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128481583C>A	uc003vnz.3	+	13	2292	c.2083C>A	c.(2083-2085)CGT>AGT	p.R695S	FLNC_uc003voa.3_Missense_Mutation_p.R695S	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	695	Filamin 5.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						CATTGATGCTCGTGCAGCTGG	0.607													6	346	---	---	---	---	PASS
NOS3	4846	broad.mit.edu	37	7	150693876	150693876	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150693876C>A	uc003wif.2	+	5	741	c.445C>A	c.(445-447)CGG>AGG	p.R149R	NOS3_uc011kuy.1_Intron|NOS3_uc011kuz.1_Silent_p.R149R|NOS3_uc011kva.1_Silent_p.R149R|NOS3_uc011kvb.1_Silent_p.R149R	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	149	Interaction with NOSIP.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	CCACGAACAGCGGCTTCAAGA	0.657													3	5	---	---	---	---	PASS
MTDH	92140	broad.mit.edu	37	8	98718887	98718887	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98718887G>T	uc003yhz.2	+	8	1509	c.1181G>T	c.(1180-1182)TGG>TTG	p.W394L	MTDH_uc010mbf.2_RNA	NM_178812	NP_848927	Q86UE4	LYRIC_HUMAN	metadherin	394	Lung-homing for mammary tumors (By similarity).|Cytoplasmic (Potential).				lipopolysaccharide-mediated signaling pathway|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein kinase B signaling cascade	apical plasma membrane|endoplasmic reticulum membrane|integral to membrane|intercellular canaliculus|nuclear body|nuclear membrane|nucleolus|perinuclear region of cytoplasm|tight junction	NF-kappaB binding|RNA polymerase II transcription factor binding|transcription coactivator activity			liver(1)|central_nervous_system(1)	2	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			AACTCTGATTGGAATGCACCA	0.393													6	239	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100887766	100887766	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100887766G>T	uc003yiv.2	+	62	12052	c.11941G>T	c.(11941-11943)GTG>TTG	p.V3981L	VPS13B_uc003yiw.2_Missense_Mutation_p.V3956L	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3981					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATGCCCTGTGGTGGCTGCAGA	0.468													40	139	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361229	105361229	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361229G>T	uc003ylx.1	+	2	498	c.449G>T	c.(448-450)TGG>TTG	p.W150L		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	150					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GCAATTCAGTGGATTTATGGC	0.423													7	248	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110441591	110441591	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110441591G>T	uc003yne.2	+	26	3127	c.3023G>T	c.(3022-3024)GGA>GTA	p.G1008V		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1008	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AACATTATTGGAGAAAAGGCT	0.338										HNSCC(38;0.096)			4	33	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110534477	110534477	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110534477G>T	uc003yne.2	+	74	12198	c.12094G>T	c.(12094-12096)GGA>TGA	p.G4032*		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	4032	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGTAATTTTAGGAAACATCAG	0.393										HNSCC(38;0.096)			5	101	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	114448936	114448936	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114448936C>A	uc003ynu.2	-	1	307	c.148G>T	c.(148-150)GTC>TTC	p.V50F	CSMD3_uc011lhx.1_Missense_Mutation_p.V50F|CSMD3_uc010mcx.1_Missense_Mutation_p.V50F|CSMD3_uc003ynx.3_Missense_Mutation_p.V50F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	50	Helical; (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AATAAAAAGACGAGGTTCCAA	0.507										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			144	294	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134024158	134024158	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134024158C>A	uc003ytw.2	+	36	6316	c.6275C>A	c.(6274-6276)TCG>TAG	p.S2092*	TG_uc010mdw.2_Nonsense_Mutation_p.S851*|TG_uc011ljb.1_Nonsense_Mutation_p.S461*|TG_uc011ljc.1_Nonsense_Mutation_p.S225*	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2092	Type IIIB.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TCTCTGGACTCGTGGCAGTCC	0.517													9	770	---	---	---	---	PASS
PSIP1	11168	broad.mit.edu	37	9	15474134	15474134	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15474134G>T	uc003zlv.3	-	9	1061	c.731C>A	c.(730-732)CCA>CAA	p.P244Q	PSIP1_uc003zlw.3_Missense_Mutation_p.P244Q|PSIP1_uc003zlz.3_Missense_Mutation_p.P244Q|PSIP1_uc003zma.3_Missense_Mutation_p.P235Q|PSIP1_uc003zly.2_Missense_Mutation_p.P244Q	NM_033222	NP_150091	O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1 isoform 2	244					initiation of viral infection|interspecies interaction between organisms|nuclear mRNA 5'-splice site recognition|provirus integration|regulation of transcription, DNA-dependent|response to heat|response to oxidative stress|transcription, DNA-dependent	cytosol|nuclear heterochromatin|nuclear periphery|nucleoplasm|nucleoplasm|transcriptionally active chromatin	activating transcription factor binding|chromatin binding|DNA secondary structure binding|RNA polymerase II transcription coactivator activity			breast(1)	1				GBM - Glioblastoma multiforme(50;2.38e-06)		CTCTTTTCTTGGCTTATCTTC	0.388													8	535	---	---	---	---	PASS
IFNA21	3452	broad.mit.edu	37	9	21166225	21166225	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21166225C>A	uc003zom.2	-	1	435	c.387G>T	c.(385-387)GTG>GTT	p.V129V		NM_002175	NP_002166	P01568	IFN21_HUMAN	interferon, alpha 21 precursor	129					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding			central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(5;1.93e-187)|Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GAGTCTCTTCCACCCCAACCT	0.468													8	450	---	---	---	---	PASS
MTAP	4507	broad.mit.edu	37	9	21854722	21854722	+	Silent	SNP	A	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21854722A>C	uc003zph.2	+	6	656	c.543A>C	c.(541-543)GCA>GCC	p.A181A	MTAP_uc003zpi.1_Intron|MTAP_uc010mit.2_RNA|MTAP_uc011lnk.1_Silent_p.A198A|MTAP_uc011lnl.1_Silent_p.A114A	NM_002451	NP_002442	Q13126	MTAP_HUMAN	5'-methylthioadenosine phosphorylase	181					nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity			central_nervous_system(1)	1		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	Adenine(DB00173)	GCTCCCGGGCAGAAAGCTTCA	0.502													10	146	---	---	---	---	PASS
UBAP2	55833	broad.mit.edu	37	9	33989029	33989029	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33989029C>A	uc003ztq.1	-	5	497	c.384G>T	c.(382-384)TCG>TCT	p.S128S	UBAP2_uc011loc.1_Silent_p.S90S|UBAP2_uc011lod.1_5'UTR|UBAP2_uc011loe.1_Intron|UBAP2_uc011lof.1_Silent_p.S53S|UBAP2_uc011log.1_Silent_p.S127S|UBAP2_uc003ztr.2_Silent_p.S53S	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2	128	Potential.									ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		GTCCACGACTCGATTCTTTCT	0.398													6	302	---	---	---	---	PASS
KGFLP2	654466	broad.mit.edu	37	9	41963927	41963927	+	3'UTR	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:41963927C>A	uc011lqu.1	-	3					KGFLP2_uc004aca.3_RNA					RecName: Full=Uncharacterized protein FLJ76381;												0						TGCTACTGTCCTGATTTCCAT	0.398													6	235	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127733950	127733950	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127733950C>A	uc004bpe.2	-	16	1654	c.1573G>T	c.(1573-1575)GAT>TAT	p.D525Y	SCAI_uc004bpd.2_Missense_Mutation_p.D548Y|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	525					negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						AGGAGGGTACCTATTGAACGT	0.368													8	308	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135203105	135203105	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135203105G>T	uc004cbk.2	-	10	4063	c.3880C>A	c.(3880-3882)CGT>AGT	p.R1294S	SETX_uc004cbj.2_Missense_Mutation_p.R913S|SETX_uc010mzt.2_Missense_Mutation_p.R913S	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1294			R -> C (in SCAR1).		cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TATGCCTTACGAGGACCCTTT	0.438													6	283	---	---	---	---	PASS
AKR1C3	8644	broad.mit.edu	37	10	5139882	5139882	+	Intron	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5139882T>C	uc001ihr.2	+						AKR1C3_uc010qap.1_Intron|AKR1C3_uc010qaq.1_3'UTR|AKR1C3_uc001ihu.2_Intron	NM_003739	NP_003730	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3						prostaglandin metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (A-specific) activity|indanol dehydrogenase activity|prostaglandin-F synthase activity|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			skin(1)	1					Dimethyl sulfoxide(DB01093)|NADH(DB00157)	GAACACCTAATTTCCTTTCTT	0.363													12	24	---	---	---	---	PASS
VIM	7431	broad.mit.edu	37	10	17277234	17277234	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17277234C>A	uc001iou.2	+	7	1488	c.1075C>A	c.(1075-1077)CAA>AAA	p.Q359K	VIM_uc001iov.1_Missense_Mutation_p.Q359K|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Missense_Mutation_p.Q359K|VIM_uc001ioy.1_Intron|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Missense_Mutation_p.Q317K|VIM_uc001ipc.1_Missense_Mutation_p.Q359K	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	359	Rod.|Coil 2.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						TGCTAACTACCAAGACACTAT	0.478													6	152	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30318693	30318693	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30318693C>A	uc001iux.2	-	2	443	c.384G>T	c.(382-384)CCG>CCT	p.P128P	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_5'UTR|KIAA1462_uc009xle.1_Silent_p.P128P	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	128										ovary(4)	4						CGTGCTCCCTCGGCTTCTGGC	0.602													6	354	---	---	---	---	PASS
HSD17B7P2	158160	broad.mit.edu	37	10	38645403	38645403	+	Silent	SNP	T	C	C	rs72639552	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38645403T>C	uc010qex.1	+	1	96	c.21T>C	c.(19-21)ATT>ATC	p.I7I	HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc010qew.1_Silent_p.I7I|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Silent_p.I7I					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0						TGGTTTTGATTACCGGGGCTA	0.617													3	21	---	---	---	---	PASS
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	Missense_Mutation	SNP	A	G	G	rs2257765		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38654432A>G	uc010qex.1	+	5	599	c.524A>G	c.(523-525)AAT>AGT	p.N175S	HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N173S					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0						TCATCTCGCAATGCAAGGAAA	0.453													7	116	---	---	---	---	PASS
SLC18A3	6572	broad.mit.edu	37	10	50820231	50820231	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50820231G>T	uc001jhw.2	+	1	1885	c.1445G>T	c.(1444-1446)CGC>CTC	p.R482L	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	482	Cytoplasmic (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						CGTTCCGAGCGCGATGTGCTG	0.667													4	148	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104814185	104814185	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104814185C>A	uc001kwm.2	+	3	1989	c.1865C>A	c.(1864-1866)CCA>CAA	p.P622Q	CNNM2_uc001kwn.2_Missense_Mutation_p.P622Q	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	622					ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		AAAATATCACCACAGCTCCTC	0.478											OREG0020489	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	92	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112356197	112356197	+	Missense_Mutation	SNP	T	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112356197T>G	uc001kze.2	+	19	2131	c.2005T>G	c.(2005-2007)TAT>GAT	p.Y669D		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	669	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TGGGGGTTATTATGACACAAG	0.383													81	178	---	---	---	---	PASS
C10orf84	63877	broad.mit.edu	37	10	120085671	120085671	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120085671G>T	uc001ldo.2	-	7	805	c.538C>A	c.(538-540)CGA>AGA	p.R180R	C10orf84_uc010qss.1_Silent_p.R180R	NM_022063	NP_071346	Q9H8W3	F204A_HUMAN	hypothetical protein LOC63877	180											0		Colorectal(252;0.101)		all cancers(201;0.0244)		CTCACCTCTCGAGTAGCTAGC	0.348													5	216	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127738137	127738137	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127738137C>A	uc001ljk.2	-	15	2133	c.1720G>T	c.(1720-1722)GAG>TAG	p.E574*	ADAM12_uc010qul.1_Nonsense_Mutation_p.E525*|ADAM12_uc001ljm.2_Nonsense_Mutation_p.E574*|ADAM12_uc001ljn.2_Nonsense_Mutation_p.E571*|ADAM12_uc001ljl.3_Nonsense_Mutation_p.E571*	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	574	Extracellular (Potential).|Cys-rich.				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TACCTCATCTCGCATTTGGCA	0.473													6	248	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129914206	129914206	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129914206G>T	uc001lke.2	-	7	661	c.466C>A	c.(466-468)CAG>AAG	p.Q156K	MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	156					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ATATGTACCTGAGGATTTCCT	0.383													7	313	---	---	---	---	PASS
IFITM3	10410	broad.mit.edu	37	11	320616	320616	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:320616G>T	uc001lpa.2	-	1	299	c.198C>A	c.(196-198)CTC>CTA	p.L66L	uc001loz.2_Intron	NM_021034	NP_066362	Q01628	IFM3_HUMAN	interferon-induced transmembrane protein 3	66	Interaction with SPP1.|Helical; (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane				central_nervous_system(7)	7		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGTTCATGAAGAGGGTGTTGA	0.642													7	231	---	---	---	---	PASS
KCNC1	3746	broad.mit.edu	37	11	17793714	17793714	+	Missense_Mutation	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17793714T>C	uc001mnk.3	+	2	1128	c.1073T>C	c.(1072-1074)ATC>ACC	p.I358T	KCNC1_uc009yhc.1_Missense_Mutation_p.I358T	NM_004976	NP_004967	P48547	KCNC1_HUMAN	Shaw-related voltage-gated potassium channel	358	Helical; Name=Segment S5; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)	1						GGCGTGCTGATCTTCGCCACC	0.612													31	47	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47738988	47738988	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47738988C>A	uc009ylv.2	-	17	3193	c.3040G>T	c.(3040-3042)GCT>TCT	p.A1014S	AGBL2_uc001ngg.2_5'Flank|AGBL2_uc010rhq.1_5'Flank|AGBL2_uc001ngh.1_5'Flank|FNBP4_uc001ngi.2_Missense_Mutation_p.A328S|FNBP4_uc001ngj.2_Missense_Mutation_p.A921S	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	1014										ovary(1)	1						GTGTTTGGAGCCATTTTCCTT	0.333													18	120	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47738989	47738989	+	Missense_Mutation	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47738989C>T	uc009ylv.2	-	17	3192	c.3039G>A	c.(3037-3039)ATG>ATA	p.M1013I	AGBL2_uc001ngg.2_5'Flank|AGBL2_uc010rhq.1_5'Flank|AGBL2_uc001ngh.1_5'Flank|FNBP4_uc001ngi.2_Missense_Mutation_p.M327I|FNBP4_uc001ngj.2_Missense_Mutation_p.M920I	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	1013										ovary(1)	1						TGTTTGGAGCCATTTTCCTTC	0.333													19	122	---	---	---	---	PASS
OR10W1	81341	broad.mit.edu	37	11	58035214	58035214	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58035214G>T	uc001nmq.1	-	1	519	c.117C>A	c.(115-117)TCC>TCA	p.S39S		NM_207374	NP_997257	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W,	39	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.0589)				CTGTGTGAATGGACACCACAA	0.488													5	107	---	---	---	---	PASS
GANAB	23193	broad.mit.edu	37	11	62400922	62400922	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62400922C>A	uc001nub.2	-	6	658	c.625G>T	c.(625-627)GAC>TAC	p.D209Y	GANAB_uc001nua.2_Missense_Mutation_p.D231Y|GANAB_uc001nuc.2_Missense_Mutation_p.D112Y|GANAB_uc010rma.1_Missense_Mutation_p.D117Y|GANAB_uc010rmb.1_Missense_Mutation_p.D95Y	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	209					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						CTTGCCTTGTCGCCATCCCTG	0.597													6	165	---	---	---	---	PASS
RASGRP2	10235	broad.mit.edu	37	11	64507132	64507132	+	Missense_Mutation	SNP	G	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64507132G>C	uc009ypu.2	-	7	899	c.672C>G	c.(670-672)ATC>ATG	p.I224M	RASGRP2_uc001oat.2_Missense_Mutation_p.I126M|RASGRP2_uc001oau.2_Missense_Mutation_p.I79M|RASGRP2_uc009ypv.2_Missense_Mutation_p.I224M|RASGRP2_uc009ypw.2_Missense_Mutation_p.I224M	NM_001098671	NP_001092141	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2	224	Ras-GEF.				platelet activation|Ras protein signal transduction|regulation of cell growth|regulation of small GTPase mediated signal transduction	cell junction|cytosol|ruffle membrane|synapse|synaptosome	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity				0						CAAAGTGTGTGATGACCAGGG	0.637													55	162	---	---	---	---	PASS
PCNXL3	399909	broad.mit.edu	37	11	65392741	65392741	+	Missense_Mutation	SNP	A	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65392741A>T	uc001oey.2	+	17	3019	c.3019A>T	c.(3019-3021)ACC>TCC	p.T1007S	PCNXL3_uc009yqn.2_5'UTR|PCNXL3_uc001oez.2_5'Flank	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	1007						integral to membrane					0						CAGCGACCCCACCGTGCTCTG	0.647													14	27	---	---	---	---	PASS
MYEOV	26579	broad.mit.edu	37	11	69063305	69063305	+	Missense_Mutation	SNP	G	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69063305G>C	uc001oov.2	+	3	838	c.388G>C	c.(388-390)GTG>CTG	p.V130L	MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Missense_Mutation_p.V130L|MYEOV_uc001oow.2_Missense_Mutation_p.V72L	NM_138768	NP_620123	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	130											0	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		AGACGTGGACGTGTCCCGGGC	0.617													8	273	---	---	---	---	PASS
ACER3	55331	broad.mit.edu	37	11	76637707	76637707	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76637707C>A	uc009yum.1	+	2	314	c.210C>A	c.(208-210)CTC>CTA	p.L70L	ACER3_uc010rsg.1_Silent_p.L28L|ACER3_uc009yul.1_RNA|ACER3_uc001oxu.2_RNA|ACER3_uc009yun.1_Silent_p.L28L|ACER3_uc009yuo.1_5'UTR|ACER3_uc010rsh.1_Intron|ACER3_uc010rsi.1_5'UTR|ACER3_uc010rsj.1_5'UTR	NM_018367	NP_060837	Q9NUN7	ACER3_HUMAN	phytoceramidase, alkaline	70	Helical; (Potential).				ceramide metabolic process|phytosphingosine biosynthetic process|positive regulation of cell proliferation|sphingosine biosynthetic process	integral to endoplasmic reticulum membrane|integral to Golgi membrane	phytoceramidase activity				0						ATTTAGCACTCACAGGTATGT	0.373													5	141	---	---	---	---	PASS
SLC36A4	120103	broad.mit.edu	37	11	92918870	92918870	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92918870G>T	uc001pdn.2	-	2	263	c.166C>A	c.(166-168)CAA>AAA	p.Q56K	SLC36A4_uc001pdm.2_5'UTR	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid	56					L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ATGCCCTCTTGATCATCAAGT	0.363													5	172	---	---	---	---	PASS
PGR	5241	broad.mit.edu	37	11	100912798	100912798	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100912798C>A	uc001pgh.2	-	7	3267	c.2524G>T	c.(2524-2526)GAG>TAG	p.E842*	PGR_uc001pgg.2_Nonsense_Mutation_p.E223*|PGR_uc001pgi.2_Nonsense_Mutation_p.E740*|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	842	Steroid-binding.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	CTCATCTCCTCAAACTGGGTT	0.383													5	113	---	---	---	---	PASS
IFT46	56912	broad.mit.edu	37	11	118425729	118425729	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118425729G>T	uc001ptp.1	-	6	708	c.330C>A	c.(328-330)GTC>GTA	p.V110V	IFT46_uc001pto.1_Silent_p.V161V|IFT46_uc009zaf.1_Silent_p.V161V	NM_020153	NP_064538	Q9NQC8	IFT46_HUMAN	IFT46	110					flagellum assembly|intraflagellar transport|protein stabilization	microtubule basal body|microtubule-based flagellum|nucleus	protein C-terminus binding				0						CAATATCCCCGACAGCTGGGA	0.433													4	194	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122929868	122929868	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122929868C>A	uc001pyo.2	-	6	1300	c.1222G>T	c.(1222-1224)GGA>TGA	p.G408*	HSPA8_uc009zbc.2_Nonsense_Mutation_p.G172*|HSPA8_uc001pyp.2_Nonsense_Mutation_p.G408*|HSPA8_uc010rzu.1_Nonsense_Mutation_p.G331*	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	408					cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GTCATGACTCCACCAGCAGTT	0.473													5	123	---	---	---	---	PASS
ETS1	2113	broad.mit.edu	37	11	128354870	128354870	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128354870G>T	uc010sbs.1	-	5	894	c.578C>A	c.(577-579)TCG>TAG	p.S193*	ETS1_uc001qej.2_Nonsense_Mutation_p.S237*|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Nonsense_Mutation_p.S193*	NM_005238	NP_005229	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene	193					cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GAGCTCTTCCGAGCTGATGGG	0.527													6	251	---	---	---	---	PASS
PTMS	5763	broad.mit.edu	37	12	6879676	6879676	+	3'UTR	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6879676T>C	uc001qqq.2	+	5					PTMS_uc001qqr.2_RNA|LAG3_uc001qqs.2_5'Flank|LAG3_uc001qqt.3_5'Flank|LAG3_uc001qqu.2_5'Flank	NM_002824	NP_002815	P20962	PTMS_HUMAN	parathymosin						DNA replication	nucleus				liver(1)	1						GGCAGCCAAGTCCAGCCACTC	0.647													5	8	---	---	---	---	PASS
PRB3	5544	broad.mit.edu	37	12	11420272	11420272	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11420272G>T	uc001qzs.2	-	4	822	c.784C>A	c.(784-786)CCT>ACT	p.P262T	PRB4_uc001qzf.1_Intron	NM_006249	NP_006240	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	262	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|10.|Pro-rich.					extracellular region	Gram-negative bacterial cell surface binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CTTCCTGGAGGAGGGGGACGT	0.617													9	475	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	33030851	33030851	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33030851G>T	uc001rlj.3	-	3	1078	c.963C>A	c.(961-963)GTC>GTA	p.V321V	PKP2_uc001rlk.3_Silent_p.V321V|PKP2_uc010skj.1_Silent_p.V321V	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	321					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CCGCCTGGCCGACAGTCAAGT	0.632													4	77	---	---	---	---	PASS
ZNF641	121274	broad.mit.edu	37	12	48736927	48736927	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48736927G>T	uc001rrn.1	-	6	1311	c.1146C>A	c.(1144-1146)GGC>GGA	p.G382G	ZNF641_uc001rro.1_Silent_p.G368G|ZNF641_uc010sls.1_Silent_p.G359G	NM_152320	NP_689533	Q96N77	ZN641_HUMAN	zinc finger protein 641	382	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2						GGTGCCTTCGGCCAAAGCTCT	0.587													5	229	---	---	---	---	PASS
KRT76	51350	broad.mit.edu	37	12	53162498	53162498	+	Silent	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53162498C>T	uc001sax.2	-	9	1970	c.1916G>A	c.(1915-1917)TGA>TAA	p.*639*		NM_015848	NP_056932	Q01546	K22O_HUMAN	keratin 76	639					cytoskeleton organization	keratin filament	structural molecule activity			breast(1)|skin(1)	2						AACAGTAGATCACTTGGTGGA	0.517													78	132	---	---	---	---	PASS
KRT4	3851	broad.mit.edu	37	12	53207418	53207418	+	Missense_Mutation	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53207418T>C	uc001saz.2	-	1	918	c.647A>G	c.(646-648)AAG>AGG	p.K216R		NM_002272	NP_002263	B4DRS2	B4DRS2_HUMAN	keratin 4	142						keratin filament	structural molecule activity			ovary(4)|skin(2)	6						GTTGAGGAGCTTGATCTGTTC	0.562													98	187	---	---	---	---	PASS
ATF7	11016	broad.mit.edu	37	12	53917072	53917072	+	Missense_Mutation	SNP	G	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53917072G>C	uc001sdy.2	-	10	1276	c.1255C>G	c.(1255-1257)CAA>GAA	p.Q419E	ATF7_uc010sok.1_RNA|ATF7_uc001sdz.2_Missense_Mutation_p.Q408E|ATF7_uc010sol.1_Missense_Mutation_p.Q387E	NM_001130059	NP_001123531	P17544	ATF7_HUMAN	activating transcription factor 7 isoform 1	419	Essential for binding adenovirus 2 E1A.				interspecies interaction between organisms	cytoplasm|nuclear periphery|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						AAATAGCCTTGAGTCTTTTTC	0.418													6	156	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64827305	64827305	+	Nonsense_Mutation	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64827305C>T	uc001ssb.2	+	19	2800	c.2374C>T	c.(2374-2376)CAG>TAG	p.Q792*		NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	792	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		TTTAGAGAAGCAGATGTTGCG	0.468													102	194	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	73056887	73056887	+	Missense_Mutation	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73056887C>T	uc001sxa.2	+	19	3017	c.2987C>T	c.(2986-2988)GCT>GTT	p.A996V		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	996	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TTCTCACGAGCTGTGGAAACT	0.388													37	86	---	---	---	---	PASS
CCDC41	51134	broad.mit.edu	37	12	94703713	94703713	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94703713G>T	uc001tdd.2	-	16	2568	c.1982C>A	c.(1981-1983)CCA>CAA	p.P661Q	CCDC41_uc001tde.2_Missense_Mutation_p.P661Q|CCDC41_uc009zsw.1_RNA	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen	653											0						AGGAGGAAATGGTAGTTCCAT	0.363													6	175	---	---	---	---	PASS
GLTP	51228	broad.mit.edu	37	12	110290404	110290404	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110290404C>A	uc001tpm.2	-	5	700	c.586G>T	c.(586-588)GAG>TAG	p.E196*	GLTP_uc010sxt.1_RNA	NM_016433	NP_057517	Q9NZD2	GLTP_HUMAN	glycolipid transfer protein	196						cytoplasm	glycolipid binding|glycolipid transporter activity				0		Lung NSC(355;2.38e-06)|Breast(359;0.00354)|Myeloproliferative disorder(1001;0.0122)		BRCA - Breast invasive adenocarcinoma(302;0.0025)		GTGTACATCTCGTAGATGACA	0.547											OREG0022112	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	577	---	---	---	---	PASS
IFT81	28981	broad.mit.edu	37	12	110655877	110655877	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110655877G>T	uc001tqi.2	+	19	2007	c.1877G>T	c.(1876-1878)CGA>CTA	p.R626L	IFT81_uc001tqh.2_Missense_Mutation_p.R626L|IFT81_uc001tqj.2_RNA	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1	626					cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1						AAAGTTATACGAGAAAGTCAT	0.323													5	132	---	---	---	---	PASS
RASAL1	8437	broad.mit.edu	37	12	113559416	113559416	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113559416C>A	uc001tum.1	-	6	619	c.326G>T	c.(325-327)CGA>CTA	p.R109L	RASAL1_uc010syp.1_Missense_Mutation_p.R109L|RASAL1_uc001tul.2_Missense_Mutation_p.R109L|RASAL1_uc001tun.1_Missense_Mutation_p.R109L|RASAL1_uc010syq.1_Missense_Mutation_p.R109L|RASAL1_uc001tuo.3_Missense_Mutation_p.R109L|RASAL1_uc010syr.1_Missense_Mutation_p.R109L	NM_004658	NP_004649	O95294	RASL1_HUMAN	RAS protein activator like 1	109					intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity			ovary(2)|skin(2)	4						TGGGTCCACTCGGCTCAAGTT	0.428													5	114	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117681127	117681127	+	Silent	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117681127C>T	uc001twm.1	-	19	3623	c.2937G>A	c.(2935-2937)GTG>GTA	p.V979V		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	979					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	GAGCTTCGGCCACAAAGGTGA	0.517													28	138	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124968161	124968161	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124968161C>A	uc010tba.1	-	3	509	c.392G>T	c.(391-393)GGA>GTA	p.G131V	NCOR2_uc010tay.1_Missense_Mutation_p.G131V|NCOR2_uc010taz.1_Missense_Mutation_p.G131V|NCOR2_uc010tbb.1_Missense_Mutation_p.G131V|NCOR2_uc010tbc.1_Missense_Mutation_p.G131V|NCOR2_uc001ugj.1_Missense_Mutation_p.G131V|NCOR2_uc001ugk.1_Missense_Mutation_p.G131V|uc001ugl.2_5'Flank	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	131					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GTCTTCAGATCCCGCAGGCTG	0.647													4	17	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133219900	133219900	+	Missense_Mutation	SNP	G	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133219900G>C	uc001uks.1	-	35	4505	c.4461C>G	c.(4459-4461)ATC>ATG	p.I1487M	POLE_uc001ukq.1_5'Flank|POLE_uc001ukr.1_Missense_Mutation_p.I291M|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Missense_Mutation_p.I1460M	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1487					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		GGTACAGGTAGATATGGCGGA	0.592								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					36	72	---	---	---	---	PASS
XPO4	64328	broad.mit.edu	37	13	21396412	21396412	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21396412C>A	uc001unq.3	-	8	893	c.857G>T	c.(856-858)AGA>ATA	p.R286I		NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4	286					protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		TGAATCTTCTCTGATTTTTCG	0.398													5	139	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88328367	88328367	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88328367G>T	uc001vln.2	+	2	943	c.724G>T	c.(724-726)GAG>TAG	p.E242*	SLITRK5_uc010tic.1_Intron	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	242	LRRCT 1.|Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TTGTTCTTGTGAGCTGATCTC	0.522													7	317	---	---	---	---	PASS
FARP1	10160	broad.mit.edu	37	13	99063043	99063043	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99063043G>T	uc001vnj.2	+	15	1994	c.1658G>T	c.(1657-1659)CGA>CTA	p.R553L	FARP1_uc001vnh.2_Missense_Mutation_p.R553L	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	553	DH.				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			ACCACCGAGCGAACATATCTG	0.393													4	48	---	---	---	---	PASS
GPR183	1880	broad.mit.edu	37	13	99947532	99947532	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99947532G>T	uc001vog.2	-	2	1042	c.868C>A	c.(868-870)CTG>ATG	p.L290M	UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_004951	NP_004942	P32249	GP183_HUMAN	EBV-induced G protein-coupled receptor 2	290	Helical; Name=7; (Potential).				humoral immune response|mature B cell differentiation involved in immune response	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0						GTAAAGTGCAGAGAAATCTGG	0.373													7	258	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101763540	101763540	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101763540C>A	uc001vox.1	-	19	2419	c.2230G>T	c.(2230-2232)GAG>TAG	p.E744*		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	744	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGCTGCCCCTCAAATGATCCG	0.493													7	326	---	---	---	---	PASS
RNASE9	390443	broad.mit.edu	37	14	21025051	21025051	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21025051G>T	uc010aho.2	-	4	337	c.178C>A	c.(178-180)CCT>ACT	p.P60T	RNASE9_uc001vxq.3_Missense_Mutation_p.P65T|RNASE9_uc010ahp.2_Missense_Mutation_p.P65T|RNASE9_uc010ahq.2_Missense_Mutation_p.P65T|RNASE9_uc010ahr.2_Missense_Mutation_p.P65T|RNASE9_uc010ahs.2_Missense_Mutation_p.P60T|RNASE9_uc010aht.2_Missense_Mutation_p.P60T|RNASE9_uc010ahu.2_Missense_Mutation_p.P60T	NM_001110357	NP_001103827	P60153	RNAS9_HUMAN	ribonuclease, RNase A family, 9 (non-active)	60						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			ovary(2)	2	all_cancers(95;0.00238)		Epithelial(56;3.32e-06)|all cancers(55;2.46e-05)	GBM - Glioblastoma multiforme(265;0.0141)		TCTTTGGTAGGTGGTCTGGCG	0.358													19	290	---	---	---	---	PASS
AP1G2	8906	broad.mit.edu	37	14	24033844	24033844	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24033844C>A	uc001wkl.2	-	9	1185	c.848G>T	c.(847-849)CGA>CTA	p.R283L	AP1G2_uc001wkj.2_5'UTR|AP1G2_uc001wkk.3_Missense_Mutation_p.R211L|AP1G2_uc001wkn.2_5'UTR|uc001wko.1_Intron|AP1G2_uc001wkp.1_RNA|AP1G2_uc010tnp.1_Missense_Mutation_p.R283L	NM_003917	NP_003908	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2	283					interspecies interaction between organisms|intracellular protein transport|vesicle-mediated transport	AP-1 adaptor complex|endosome membrane	protein binding|protein transporter activity			ovary(1)	1	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		TCCGGCATTTCGGCTGGTGTC	0.478													4	94	---	---	---	---	PASS
HECTD1	25831	broad.mit.edu	37	14	31585597	31585597	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31585597C>A	uc001wrc.1	-	30	5952	c.5463G>T	c.(5461-5463)TTG>TTT	p.L1821F	HECTD1_uc001wra.1_5'UTR|HECTD1_uc001wrb.1_5'UTR|HECTD1_uc001wrd.1_Missense_Mutation_p.L1289F	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	1821					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CTGTTACTTTCAAAGTGAGAG	0.393													6	212	---	---	---	---	PASS
NPAS3	64067	broad.mit.edu	37	14	34263185	34263185	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34263185C>A	uc001wru.2	+	10	1300	c.1236C>A	c.(1234-1236)GCC>GCA	p.A412A	NPAS3_uc001wrs.2_Silent_p.A399A|NPAS3_uc001wrt.2_Silent_p.A380A|NPAS3_uc001wrv.2_Silent_p.A382A	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3	412					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		AGTCCAGTGCCACCATAGCTA	0.383													6	221	---	---	---	---	PASS
RPS29	6235	broad.mit.edu	37	14	50053045	50053045	+	Missense_Mutation	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50053045T>C	uc001wwm.2	-	1	50	c.20A>G	c.(19-21)TAC>TGC	p.Y7C	SDCCAG1_uc010anj.1_Intron|RPS29_uc001wwl.2_Missense_Mutation_p.Y7C	NM_001032	NP_001023	P62273	RS29_HUMAN	ribosomal protein S29 isoform 1	7					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|structural constituent of ribosome|zinc ion binding				0	all_epithelial(31;0.00214)|Breast(41;0.0124)					GTGGCTCCAGTACAGCTGCTG	0.522													49	95	---	---	---	---	PASS
DLGAP5	9787	broad.mit.edu	37	14	55625310	55625310	+	Silent	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55625310T>C	uc001xbs.2	-	14	2020	c.1803A>G	c.(1801-1803)CCA>CCG	p.P601P	DLGAP5_uc001xbt.2_Silent_p.P601P	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	601					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						CAACTTCCTTTGGTATCACAG	0.348													65	130	---	---	---	---	PASS
DAAM1	23002	broad.mit.edu	37	14	59792408	59792408	+	Missense_Mutation	SNP	G	T	T	rs61755339		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59792408G>T	uc001xdz.1	+	9	1141	c.1016G>T	c.(1015-1017)CGA>CTA	p.R339L	DAAM1_uc001xea.1_Missense_Mutation_p.R339L|DAAM1_uc001xeb.1_Missense_Mutation_p.R339L	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	339	GBD/FH3.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GAAATGCTCCGAAATGAAGAT	0.313													4	141	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102453076	102453076	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102453076G>T	uc001yks.2	+	8	2678	c.2514G>T	c.(2512-2514)GAG>GAT	p.E838D		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	838	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GCTTAGCAGAGACTGTCTTCA	0.473													8	135	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102466737	102466737	+	Splice_Site	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102466737G>A	uc001yks.2	+	18	4238	c.4074_splice	c.e18+1	p.K1358_splice		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GCCTCGAAAGGTATATCATGA	0.403													35	72	---	---	---	---	PASS
RPUSD2	27079	broad.mit.edu	37	15	40866017	40866017	+	Missense_Mutation	SNP	G	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40866017G>C	uc001zmd.1	+	3	1195	c.1195G>C	c.(1195-1197)GGC>CGC	p.G399R		NM_152260	NP_689473	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing	399					pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding			skin(1)	1		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		TCCTTCTCGAGGCCGGGGCGG	0.572													29	80	---	---	---	---	PASS
GCOM1	145781	broad.mit.edu	37	15	57913819	57913819	+	Missense_Mutation	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57913819T>C	uc002aei.2	+	4	451	c.332T>C	c.(331-333)TTG>TCG	p.L111S	GCOM1_uc002aej.2_Missense_Mutation_p.L111S|GCOM1_uc002aek.2_Intron|GCOM1_uc002ael.2_Intron|GCOM1_uc002aem.2_Missense_Mutation_p.L111S|GCOM1_uc002aeq.2_RNA|GCOM1_uc002aen.2_RNA|GCOM1_uc010bfy.2_RNA|GCOM1_uc002aeo.2_Missense_Mutation_p.L111S|GCOM1_uc002aep.2_RNA|GCOM1_uc010bfx.2_RNA	NM_001018100	NP_001018110	P0CAP1	GCOM1_HUMAN	GRINL1A upstream protein isoform 7	111	Potential.				intracellular signal transduction	extrinsic to internal side of plasma membrane|I band				ovary(1)	1						AGAGCCACTTTGGAAAAGGTG	0.383													43	91	---	---	---	---	PASS
GTF2A2	2958	broad.mit.edu	37	15	59934369	59934369	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59934369C>A	uc002agg.2	-	4	452	c.270G>T	c.(268-270)GTG>GTT	p.V90V		NM_004492	NP_004483	P52657	T2AG_HUMAN	general transcription factor IIA, 2, 12kDa	90					interspecies interaction between organisms|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	transcription factor TFIIA complex	protein heterodimerization activity|protein homodimerization activity|TBP-class protein binding|transcription coactivator activity			central_nervous_system(2)	2						TCACTTTATCCACTTTAATAA	0.353													6	205	---	---	---	---	PASS
NARG2	79664	broad.mit.edu	37	15	60734582	60734582	+	Intron	SNP	A	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60734582A>T	uc002agp.2	-						NARG2_uc002ago.2_Intron|NARG2_uc002agq.3_3'UTR	NM_024611	NP_078887	Q659A1	NARG2_HUMAN	NMDA receptor regulated 2 isoform a							nucleus				ovary(1)|lung(1)	2						CAAGAAAATTAAAAAGGAGAA	0.264													38	67	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63030443	63030443	+	Missense_Mutation	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63030443A>G	uc002alb.3	+	27	3598	c.3598A>G	c.(3598-3600)AAC>GAC	p.N1200D	TLN2_uc002alc.3_5'Flank	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1200					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						CTCCTTGAATAACTGCGTAAA	0.502													82	154	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63991107	63991107	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63991107G>T	uc002amp.2	-	26	4873	c.4725C>A	c.(4723-4725)TCC>TCA	p.S1575S	HERC1_uc010uil.1_Silent_p.S559S	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	1575					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CTGACTCAAAGGAATAGGAGG	0.438													7	254	---	---	---	---	PASS
LOC645752	645752	broad.mit.edu	37	15	78211548	78211548	+	Silent	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78211548T>C	uc010bky.2	-	11	983	c.219A>G	c.(217-219)CAA>CAG	p.Q73Q		NR_027024				SubName: Full=GOLGA6 protein; Flags: Fragment;												0						CCACCTGGGATTGGAGCTTTC	0.562													4	210	---	---	---	---	PASS
ARNT2	9915	broad.mit.edu	37	15	80886042	80886042	+	3'UTR	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80886042G>T	uc002bfr.2	+	19					ARNT2_uc010unm.1_3'UTR|ARNT2_uc002bfs.2_3'UTR	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			CTGAGTAGCTGCGGCCAGAGT	0.587													6	30	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86198765	86198765	+	Missense_Mutation	SNP	A	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86198765A>C	uc002blv.1	+	11	4662	c.4492A>C	c.(4492-4494)AAG>CAG	p.K1498Q	AKAP13_uc002blt.1_Missense_Mutation_p.K1498Q|AKAP13_uc002blu.1_Missense_Mutation_p.K1498Q|AKAP13_uc010bnf.1_Missense_Mutation_p.K138Q|AKAP13_uc002blw.1_5'UTR|AKAP13_uc010bne.1_Missense_Mutation_p.K151Q	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1498					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						CCAGATTTTAAAGCCAAACAG	0.527													3	105	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102292820	102292820	+	Silent	SNP	G	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102292820G>C	uc010usj.1	+	4	467	c.408G>C	c.(406-408)ACG>ACC	p.T136T	uc002bxo.2_RNA|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		GCGTGGGAACGAGAAGACACT	0.592													3	16	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652													6	30	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15100330	15100330	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15100330C>A	uc002dda.3	+	6	693	c.469C>A	c.(469-471)CGA>AGA	p.R157R	PDXDC1_uc010uzl.1_Silent_p.R142R|PDXDC1_uc010uzm.1_Silent_p.R66R|PDXDC1_uc010bvc.1_Silent_p.R98R|PDXDC1_uc002dcz.2_Silent_p.R157R|PDXDC1_uc002ddb.3_Silent_p.R130R|PDXDC1_uc010uzn.1_Silent_p.R129R|PDXDC1_uc002ddc.2_Silent_p.R157R	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	157					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	CATTCATTCTCGATATGAAGA	0.403													7	399	---	---	---	---	PASS
RRN3P1	730092	broad.mit.edu	37	16	21817482	21817482	+	Silent	SNP	C	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21817482C>T	uc010vbl.1	-	7	578	c.81G>A	c.(79-81)GAG>GAA	p.E27E	uc002diq.3_Intron	NR_003370				SubName: Full=Putative uncharacterized protein ENSP00000219758;												0						CAATAATAAGCTCCAGAATTT	0.254													11	33	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71682850	71682850	+	Silent	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71682850A>G	uc002fax.2	-	18	3921	c.3915T>C	c.(3913-3915)CCT>CCC	p.P1305P	PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Silent_p.P1238P	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	1305						cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						CATGGGGCTCAGGCTCGAGCC	0.582													62	146	---	---	---	---	PASS
HPR	3250	broad.mit.edu	37	16	72108239	72108239	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72108239C>A	uc002fby.2	+	3	178	c.148C>A	c.(148-150)CGC>AGC	p.R50S	TXNL4B_uc010cgl.2_Intron	NM_020995	NP_066275	P00739	HPTR_HUMAN	haptoglobin-related protein precursor	50	Sushi.				proteolysis	spherical high-density lipoprotein particle	hemoglobin binding|serine-type endopeptidase activity			central_nervous_system(1)	1		Ovarian(137;0.125)				GCACTTGTTTCGCTACCAGTG	0.478													5	155	---	---	---	---	PASS
ATP2C2	9914	broad.mit.edu	37	16	84449123	84449123	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84449123C>A	uc002fhx.2	+	7	639	c.550C>A	c.(550-552)CGA>AGA	p.R184R	ATP2C2_uc010chj.2_Silent_p.R184R|ATP2C2_uc002fhy.2_Silent_p.R201R|ATP2C2_uc002fhz.2_Silent_p.R33R	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	184	Cytoplasmic (Potential).				ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2						CCTGCTTGCTCGAGAACTGGT	0.473													5	147	---	---	---	---	PASS
CHRNE	1145	broad.mit.edu	37	17	4804298	4804298	+	Silent	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4804298G>A	uc002fzk.1	-	7	800	c.789C>T	c.(787-789)TTC>TTT	p.F263F	C17orf107_uc002fzl.3_3'UTR	NM_000080	NP_000071	Q04844	ACHE_HUMAN	nicotinic acetylcholine receptor epsilon	263	Helical; (Potential).				muscle contraction|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						GCGCCGGCAGGAAGTAGGCGA	0.657													57	125	---	---	---	---	PASS
PLSCR3	57048	broad.mit.edu	37	17	7297337	7297337	+	Intron	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7297337G>T	uc002ggm.1	-						PLSCR3_uc002ggl.2_Intron|PLSCR3_uc002ggq.1_5'UTR|PLSCR3_uc002ggn.1_Intron|PLSCR3_uc002ggo.1_Intron|PLSCR3_uc002ggp.1_Intron|PLSCR3_uc002ggr.1_Intron|PLSCR3_uc010cmg.1_Intron	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				CAGCCAGTCCGAGCACATTCC	0.642													4	63	---	---	---	---	PASS
SAT2	112483	broad.mit.edu	37	17	7529909	7529909	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7529909G>T	uc002gic.2	-	6	610	c.369C>A	c.(367-369)TCC>TCA	p.S123S	SHBG_uc010cmo.2_Intron|SHBG_uc010cmp.2_Intron|SHBG_uc010cmq.2_Intron|SHBG_uc010cmr.2_Intron|SHBG_uc010cms.2_Intron|SHBG_uc010cmt.2_Intron|SHBG_uc010cmu.2_Intron|SAT2_uc002gib.1_RNA|SHBG_uc010cmz.2_5'Flank|SHBG_uc010cmv.2_5'Flank|SHBG_uc010cmw.2_5'Flank|SHBG_uc010cmx.2_5'Flank|SHBG_uc010cmy.2_5'Flank|SHBG_uc002gid.3_5'Flank	NM_133491	NP_597998	Q96F10	SAT2_HUMAN	diamine N-acetyltransferase 2	123	N-acetyltransferase.					cytoplasm	diamine N-acetyltransferase activity	p.?(1)			0				READ - Rectum adenocarcinoma(115;0.166)	Spermine(DB00127)	GGCGGAATTGGGAGCAGCCCT	0.542													7	161	---	---	---	---	PASS
GUCY2D	3000	broad.mit.edu	37	17	7909785	7909785	+	Silent	SNP	T	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7909785T>A	uc002gjt.2	+	4	1205	c.1131T>A	c.(1129-1131)GCT>GCA	p.A377A		NM_000180	NP_000171	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	377	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			skin(1)	1		Prostate(122;0.157)				CCGGAGCAGCTGTGGCCCGCC	0.677													11	34	---	---	---	---	PASS
ALOX15B	247	broad.mit.edu	37	17	7945772	7945772	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7945772G>T	uc002gju.2	+	4	651	c.535G>T	c.(535-537)GCC>TCC	p.A179S	ALOX15B_uc002gjv.2_Missense_Mutation_p.A179S|ALOX15B_uc002gjw.2_Missense_Mutation_p.A179S|ALOX15B_uc010vun.1_Missense_Mutation_p.A179S|ALOX15B_uc010cnp.2_5'UTR	NM_001141	NP_001132	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, second type	179	Lipoxygenase.				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)	1						ATACTCCACAGCCAAGAATGC	0.547													5	171	---	---	---	---	PASS
TMEM107	84314	broad.mit.edu	37	17	8078990	8078990	+	Intron	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8078990C>A	uc002gkg.3	-						TMEM107_uc002gkh.3_Intron|TMEM107_uc002gki.3_Intron|TMEM107_uc002gkj.3_Intron|TMEM107_uc002gkk.2_3'UTR	NM_183065	NP_898888	Q6UX40	TM107_HUMAN	transmembrane protein 107 isoform 2							integral to membrane					0						GGATTGGCTACAGCAGACACT	0.438													4	10	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17700886	17700886	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17700886C>A	uc002grm.2	+	3	5093	c.4624C>A	c.(4624-4626)CGG>AGG	p.R1542R	RAI1_uc002grn.1_Silent_p.R1542R	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1542						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		GCGCCTCACTCGGGGCCGGGC	0.652													5	178	---	---	---	---	PASS
SRCIN1	80725	broad.mit.edu	37	17	36708271	36708271	+	Missense_Mutation	SNP	A	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36708271A>C	uc002hqd.2	-	14	2803	c.2578T>G	c.(2578-2580)TTC>GTC	p.F860V	SRCIN1_uc002hqf.1_Missense_Mutation_p.F732V|SRCIN1_uc002hqe.2_Missense_Mutation_p.F714V|SRCIN1_uc002hqg.2_Missense_Mutation_p.F166V	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	732					exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						GGCATTTCGAAGTCCACGCTC	0.617													45	96	---	---	---	---	PASS
THRA	7067	broad.mit.edu	37	17	38245524	38245524	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38245524G>T	uc002htw.2	+	9	1531	c.1048G>T	c.(1048-1050)GAG>TAG	p.E350*	THRA_uc010cwp.1_Nonsense_Mutation_p.E350*|THRA_uc002htv.2_Nonsense_Mutation_p.E350*|THRA_uc002htx.2_Nonsense_Mutation_p.E350*	NM_003250	NP_003241	P10827	THA_HUMAN	thyroid hormone receptor, alpha isoform 2	350	Ligand-binding.				negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding				0	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Levothyroxine(DB00451)|Liothyronine(DB00279)	GCTGGCGTTCGAGCACTACGT	0.507													6	213	---	---	---	---	PASS
KRT20	54474	broad.mit.edu	37	17	39032535	39032535	+	3'UTR	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39032535A>G	uc002hvl.2	-	8						NM_019010	NP_061883	P35900	K1C20_HUMAN	keratin 20						apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton			large_intestine(1)|kidney(1)|skin(1)	3		Breast(137;0.000301)|Ovarian(249;0.15)				CTTATGGCTGATTTCTTGCAG	0.373													11	48	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587569	43587569	+	Intron	SNP	G	C	C	rs149697015	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587569G>C	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						aactccgtctgaaaagaaaag	0.144													4	43	---	---	---	---	PASS
UTP18	51096	broad.mit.edu	37	17	49340732	49340732	+	Missense_Mutation	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49340732A>G	uc002its.2	+	2	489	c.440A>G	c.(439-441)GAT>GGT	p.D147G		NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component	147					rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			GATGAAGAAGATGAAGATGAG	0.358													28	68	---	---	---	---	PASS
C17orf47	284083	broad.mit.edu	37	17	56619226	56619226	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56619226C>A	uc002iwq.1	-	2	1799	c.1663G>T	c.(1663-1665)GGT>TGT	p.G555C	SEPT4_uc010wnx.1_5'Flank|SEPT4_uc010wny.1_5'Flank	NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN	hypothetical protein LOC284083	555										breast(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CACTCCTCACCTGTCCTCCCA	0.493													7	296	---	---	---	---	PASS
GPRC5C	55890	broad.mit.edu	37	17	72443292	72443292	+	3'UTR	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72443292A>G	uc002jks.2	+	3					GPRC5C_uc002jkp.2_3'UTR|GPRC5C_uc002jkq.2_3'UTR|GPRC5C_uc002jkr.2_3'UTR|GPRC5C_uc002jkt.2_Intron|GPRC5C_uc002jku.2_Intron	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						CAGATCTGGAAGGGCCTCCCT	0.662													9	12	---	---	---	---	PASS
SLC26A11	284129	broad.mit.edu	37	17	78196561	78196561	+	Missense_Mutation	SNP	C	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78196561C>G	uc002jyb.1	+	4	611	c.342C>G	c.(340-342)TTC>TTG	p.F114L	SGSH_uc002jxz.3_5'Flank|SGSH_uc002jya.3_5'Flank|SGSH_uc002jxy.2_5'Flank|SGSH_uc010wue.1_5'Flank|SLC26A11_uc002jyc.1_Missense_Mutation_p.F114L|SLC26A11_uc002jyd.1_Missense_Mutation_p.F114L|SLC26A11_uc010dhv.1_Missense_Mutation_p.F114L	NM_173626	NP_775897	Q86WA9	S2611_HUMAN	solute carrier family 26, member 11	114	Helical; (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TGGTCTCCTTCTACACCTTCC	0.607													100	196	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8069776	8069776	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8069776C>A	uc002knn.3	+	8	1728	c.1225C>A	c.(1225-1227)CGT>AGT	p.R409S	PTPRM_uc010dkv.2_Missense_Mutation_p.R409S|PTPRM_uc010wzl.1_Missense_Mutation_p.R196S	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	409	Fibronectin type-III 2.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				TAATGTAACTCGTTGCCACAG	0.448													4	81	---	---	---	---	PASS
WBP11P1	441818	broad.mit.edu	37	18	30093455	30093455	+	RNA	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30093455G>T	uc010dmc.2	+	1		c.1830G>T				NR_003558				Homo sapiens cDNA clone IMAGE:5265376, partial cds.												0						TTGATTCAGCGATCCAAGGTA	0.532													5	336	---	---	---	---	PASS
ZNF516	9658	broad.mit.edu	37	18	74154244	74154244	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74154244G>T	uc010dqx.1	-	2	1002	c.767C>A	c.(766-768)GCC>GAC	p.A256D	ZNF516_uc002lme.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	256	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTGGCTGAAGGCCTGGCCACA	0.687													6	53	---	---	---	---	PASS
KDM4B	23030	broad.mit.edu	37	19	5039866	5039866	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5039866G>T	uc002mbq.3	+	4	387	c.161G>T	c.(160-162)TGG>TTG	p.W54L	KDM4B_uc010xil.1_Missense_Mutation_p.W54L|KDM4B_uc010xim.1_Missense_Mutation_p.W54L	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	54	JmjN.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						CCGAAGGAGTGGAAGCCGCGG	0.637													5	93	---	---	---	---	PASS
ZNF439	90594	broad.mit.edu	37	19	11976951	11976951	+	5'UTR	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11976951G>T	uc002mss.2	+	1					ZNF439_uc002msr.2_Intron	NM_152262	NP_689475	Q8NDP4	ZN439_HUMAN	zinc finger protein 439						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						GAACTTCTTGGGAATAGAGTC	0.463													6	186	---	---	---	---	PASS
CASP14	23581	broad.mit.edu	37	19	15164766	15164766	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15164766G>T	uc010dzv.1	+	4	708	c.400G>T	c.(400-402)GGA>TGA	p.G134*	CASP14_uc002naf.2_Nonsense_Mutation_p.G134*	NM_012114	NP_036246	P31944	CASPE_HUMAN	caspase 14 precursor	134					apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity			skin(2)|ovary(1)|lung(1)	4						GGCCTGTCGAGGAGGTGGGGA	0.383													29	52	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155223	22155223	+	Silent	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155223T>C	uc002nqp.2	-	5	2462	c.2313A>G	c.(2311-2313)AAA>AAG	p.K771K	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTGAGGGCCATTTATAGGCTT	0.373													4	178	---	---	---	---	PASS
SLC7A10	56301	broad.mit.edu	37	19	33702235	33702235	+	Splice_Site	SNP	C	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33702235C>G	uc002num.2	-	7	1060	c.913_splice	c.e7-1	p.T305_splice	SLC7A10_uc002nul.2_Missense_Mutation_p.D43H	NM_019849	NP_062823	Q9NS82	AAA1_HUMAN	solute carrier family 7, member 10						blood coagulation|cellular nitrogen compound metabolic process|ion transport|leukocyte migration	integral to plasma membrane	L-serine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(110;0.137)					CCCCGAAGGTCTGGGTGGGCA	0.617													27	53	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39051932	39051932	+	Silent	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39051932G>A	uc002oit.2	+	90	12592	c.12462G>A	c.(12460-12462)CCG>CCA	p.P4154P	RYR1_uc002oiu.2_Silent_p.P4149P|RYR1_uc002oiv.1_Silent_p.P1063P	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	4154					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	AGCATGTGCCGCATGACCCTC	0.627													40	94	---	---	---	---	PASS
CEACAM4	1089	broad.mit.edu	37	19	42125683	42125683	+	3'UTR	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42125683A>G	uc002orh.1	-	7						NM_001817	NP_001808	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to plasma membrane|membrane fraction					0						TCAACCCACAAGAGCAGCTCC	0.532													8	151	---	---	---	---	PASS
PSG7	5676	broad.mit.edu	37	19	43433789	43433789	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43433789C>A	uc002ovl.3	-	4	616	c.514G>T	c.(514-516)GAG>TAG	p.E172*	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_5'Flank|PSG7_uc002out.1_5'UTR|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Nonsense_Mutation_p.E50*	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	172	Ig-like C2-type 1.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				TCTGGAGTCTCAGGATCACAG	0.527													9	477	---	---	---	---	PASS
BCAM	4059	broad.mit.edu	37	19	45321843	45321843	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45321843C>A	uc002ozu.2	+	9	1187	c.1143C>A	c.(1141-1143)GTC>GTA	p.V381V	BCAM_uc002ozt.1_Silent_p.V381V	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	381	Extracellular (Potential).|Ig-like C2-type 2.				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GCAGTGCAGTCGTGAACTGCT	0.647													4	89	---	---	---	---	PASS
EML2	24139	broad.mit.edu	37	19	46112932	46112932	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46112932G>T	uc002pcn.2	-	19	1974	c.1939C>A	c.(1939-1941)CGG>AGG	p.R647R	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Silent_p.R531R|EML2_uc010xxl.1_Silent_p.R794R|EML2_uc010xxm.1_Silent_p.R848R	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	647	WD 11.				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CAGACCACCCGCCACTGTAGC	0.537													4	115	---	---	---	---	PASS
CYTH2	9266	broad.mit.edu	37	19	48977501	48977501	+	Missense_Mutation	SNP	G	A	A	rs1804728		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48977501G>A	uc002pjj.3	+	7	910	c.610G>A	c.(610-612)GTC>ATC	p.V204I	CYTH2_uc002pji.2_RNA	NM_017457	NP_059431	Q99418	CYH2_HUMAN	cytohesin 2 isoform 1	204					actin cytoskeleton organization|endocytosis|regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|membrane fraction|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						CAATCCCAATGTCCGGGACAA	0.632													41	83	---	---	---	---	PASS
CD37	951	broad.mit.edu	37	19	49842724	49842724	+	Intron	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49842724G>T	uc002pnd.2	+						uc002pnb.1_Intron|CD37_uc002pnc.2_Intron|CD37_uc010yam.1_3'UTR|CD37_uc010yan.1_3'UTR|CD37_uc002pnf.3_3'UTR|CD37_uc002pne.2_Intron	NM_001774	NP_001765	P11049	CD37_HUMAN	CD37 antigen isoform A							integral to membrane					0		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		AGATGGCCCTGCCCTTCATTT	0.672													7	97	---	---	---	---	PASS
ZNF816A	125893	broad.mit.edu	37	19	53454493	53454493	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53454493G>T	uc002qal.1	-	5	836	c.535C>A	c.(535-537)CAA>AAA	p.Q179K	ZNF321_uc010eqj.2_Intron|ZNF321_uc002qak.1_Intron|ZNF816A_uc002qam.1_Missense_Mutation_p.Q163K	NM_001031665	NP_001026835	Q0VGE8	ZN816_HUMAN	zinc finger protein 816A	179					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0313)		TTGTCCAATTGGTTACTAATT	0.388													8	340	---	---	---	---	PASS
LENG8	114823	broad.mit.edu	37	19	54968995	54968995	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54968995G>T	uc002qfv.1	+	11	1834	c.1690G>T	c.(1690-1692)GAG>TAG	p.E564*	LENG8_uc002qfw.2_Nonsense_Mutation_p.E601*			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;	564							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GTTTGCCTGCGAGCAGATGAA	0.562													5	171	---	---	---	---	PASS
ZNF606	80095	broad.mit.edu	37	19	58489652	58489652	+	3'UTR	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58489652G>T	uc002qqw.2	-	7					ZNF606_uc010yhp.1_3'UTR	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN	zinc finger protein 606						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		TACAAGAAACGAAAAACTCGC	0.373													4	146	---	---	---	---	PASS
UBOX5	22888	broad.mit.edu	37	20	3102697	3102697	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3102697C>A	uc002whw.2	-	3	758	c.588G>T	c.(586-588)CAG>CAT	p.Q196H	uc002whv.1_Intron|UBOX5_uc002whx.2_Missense_Mutation_p.Q196H|UBOX5_uc002why.1_Missense_Mutation_p.Q196H	NM_014948	NP_055763	O94941	RNF37_HUMAN	U-box domain containing 5 isoform a	196						nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2						TCTTGGCCGGCTGACCCCACA	0.587													5	118	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628236	29628236	+	Missense_Mutation	SNP	G	C	C	rs145412486	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628236G>C	uc010ztl.1	+	3	180	c.148G>C	c.(148-150)GCT>CCT	p.A50P	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.A2P					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GGGGAAAATGGCTTTGTTGGC	0.333													9	236	---	---	---	---	PASS
TTLL9	164395	broad.mit.edu	37	20	30522569	30522569	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30522569C>A	uc010gdx.1	+	12	1135	c.882C>A	c.(880-882)CTC>CTA	p.L294L	TTLL9_uc002wwy.1_RNA|TTLL9_uc002wwz.1_Intron|TTLL9_uc002wxa.1_RNA|TTLL9_uc002wxb.1_RNA|TTLL9_uc010zto.1_RNA|TTLL9_uc002wxc.2_Silent_p.L196L|TTLL9_uc010ztp.1_RNA|TTLL9_uc010ztq.1_RNA	NM_001008409	NP_001008409	Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	294	TTL.				protein modification process	cilium|microtubule|microtubule basal body	ATP binding|tubulin-tyrosine ligase activity			ovary(2)	2			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGGAGACACTCTTCAGGGACA	0.597													6	131	---	---	---	---	PASS
KIF3B	9371	broad.mit.edu	37	20	30918079	30918079	+	Missense_Mutation	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30918079G>A	uc002wxq.2	+	8	2271	c.2104G>A	c.(2104-2106)GCA>ACA	p.A702T	KIF3B_uc010ztw.1_Missense_Mutation_p.A640T	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	702	Globular.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ACAGGTGGATGCATCATCATT	0.493													45	98	---	---	---	---	PASS
RBM39	9584	broad.mit.edu	37	20	34302204	34302204	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34302204C>A	uc002xeb.2	-	11	1343	c.999G>T	c.(997-999)TCG>TCT	p.S333S	RBM39_uc002xdz.2_Silent_p.S309S|RBM39_uc002xea.2_Silent_p.S176S|RBM39_uc010gfn.2_Silent_p.S176S|RBM39_uc010zvm.1_Silent_p.S311S|RBM39_uc002xeg.2_Silent_p.S311S|RBM39_uc002xec.2_Silent_p.S333S|RBM39_uc002xed.2_Silent_p.S51S|RBM39_uc002xee.2_Silent_p.S176S|RBM39_uc002xef.2_Silent_p.S176S|RBM39_uc010zvn.1_Silent_p.S176S	NM_184234	NP_909122	Q14498	RBM39_HUMAN	RNA binding motif protein 39 isoform a	333	Activating domain (By similarity).|Interaction with JUN (By similarity).				mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	centrosome|nuclear speck	nucleotide binding|protein binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					AACTAGCACTCGAAGCATCAG	0.418													4	178	---	---	---	---	PASS
PKIG	11142	broad.mit.edu	37	20	43247019	43247019	+	3'UTR	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43247019C>A	uc002xmg.2	+	6					PKIG_uc002xmh.2_3'UTR|PKIG_uc002xmi.2_3'UTR	NM_181805	NP_861521	Q9Y2B9	IPKG_HUMAN	cAMP-dependent protein kinase inhibitor gamma								cAMP-dependent protein kinase inhibitor activity|protein binding				0		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.001)|COAD - Colon adenocarcinoma(18;0.00189)			TGACCTTGTCCAAGAAGGCTG	0.602													6	240	---	---	---	---	PASS
SEMG1	6406	broad.mit.edu	37	20	43836817	43836817	+	Silent	SNP	A	G	G	rs17850164		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43836817A>G	uc002xni.2	+	2	936	c.879A>G	c.(877-879)ACA>ACG	p.T293T	SEMG1_uc002xnj.2_Intron|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Silent_p.T293T	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	293	58 AA repeat 1.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				CTTCAAGTACAGAAGAAAGAC	0.383													5	130	---	---	---	---	PASS
NCOA5	57727	broad.mit.edu	37	20	44691418	44691418	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44691418G>T	uc002xrd.2	-	7	1789	c.1261C>A	c.(1261-1263)CCA>ACA	p.P421T	NCOA5_uc002xrc.2_3'UTR|NCOA5_uc002xre.2_Missense_Mutation_p.P421T	NM_020967	NP_066018	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	421					regulation of transcription, DNA-dependent|transcription, DNA-dependent|translation	nucleus	aminoacyl-tRNA ligase activity|ATP binding			central_nervous_system(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				GGTGCAGATGGAGTGGGTGTA	0.627													7	289	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62038115	62038115	+	Missense_Mutation	SNP	A	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62038115A>G	uc002yey.1	-	17	2678	c.2501T>C	c.(2500-2502)ATT>ACT	p.I834T	KCNQ2_uc002yez.1_Missense_Mutation_p.I803T|KCNQ2_uc002yfa.1_Missense_Mutation_p.I816T|KCNQ2_uc002yfb.1_Missense_Mutation_p.I806T	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	834	Cytoplasmic (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	TCCCTCCGCAATGTAGGGCCT	0.657													11	33	---	---	---	---	PASS
PRDM15	63977	broad.mit.edu	37	21	43256707	43256707	+	Silent	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43256707G>T	uc002yzq.1	-	16	2262	c.2151C>A	c.(2149-2151)CTC>CTA	p.L717L	PRDM15_uc002yzo.2_Silent_p.L388L|PRDM15_uc002yzp.2_Silent_p.L388L|PRDM15_uc002yzr.1_Silent_p.L388L	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	717					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTCTGCTTGAGAGAATTAAGC	0.498													6	168	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21174143	21174143	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21174143C>A	uc002zsz.3	-	6	632	c.401G>T	c.(400-402)CGA>CTA	p.R134L	PI4KA_uc010gsq.1_Missense_Mutation_p.R192L	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	134					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CCCAAATGCTCGCGAGATTCC	0.438													9	343	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21174827	21174827	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21174827C>A	uc002zsz.3	-	5	586	c.355G>T	c.(355-357)GAA>TAA	p.E119*	PI4KA_uc010gsq.1_Nonsense_Mutation_p.E177*	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	119					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ATACTCGTACCTTTGTCTTGA	0.388													6	117	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31838999	31838999	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31838999C>A	uc003akz.1	-	16	2319	c.2155G>T	c.(2155-2157)GGA>TGA	p.G719*	EIF4ENIF1_uc003akx.1_Nonsense_Mutation_p.G374*|EIF4ENIF1_uc003aky.1_Nonsense_Mutation_p.G399*|EIF4ENIF1_uc003ala.1_Nonsense_Mutation_p.G719*|EIF4ENIF1_uc003alb.1_Nonsense_Mutation_p.G545*|EIF4ENIF1_uc003akw.1_Nonsense_Mutation_p.G209*	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	719						nucleus	protein binding|protein transporter activity			ovary(1)	1						GCTGCTTTTCCAGATGCTGGC	0.463													6	263	---	---	---	---	PASS
PLA2G6	8398	broad.mit.edu	37	22	38536025	38536025	+	Missense_Mutation	SNP	T	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38536025T>G	uc003auy.1	-	5	897	c.761A>C	c.(760-762)TAC>TCC	p.Y254S	PLA2G6_uc003auz.1_Missense_Mutation_p.Y254S|PLA2G6_uc003ava.1_Missense_Mutation_p.Y254S|PLA2G6_uc003avb.2_Missense_Mutation_p.Y254S|PLA2G6_uc010gxk.1_RNA|PLA2G6_uc011ano.1_Intron	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a	254	ANK 4.				cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	GTGGATGGGGTAGCCGTTGGG	0.642													4	16	---	---	---	---	PASS
CSNK1E	1454	broad.mit.edu	37	22	38696945	38696945	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38696945C>A	uc003avj.2	-	5	610	c.349G>T	c.(349-351)GAG>TAG	p.E117*	CSNK1E_uc003avk.2_Nonsense_Mutation_p.E117*|CSNK1E_uc003avl.1_RNA|CSNK1E_uc003avm.1_Nonsense_Mutation_p.E117*|CSNK1E_uc003avo.2_Nonsense_Mutation_p.E117*|CSNK1E_uc003avp.1_Nonsense_Mutation_p.E117*|CSNK1E_uc003avq.1_Nonsense_Mutation_p.E117*	NM_152221	NP_689407	P49674	KC1E_HUMAN	casein kinase 1 epsilon	117	Protein kinase.				DNA repair|G2/M transition of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|signal transduction	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Melanoma(58;0.045)					TGGATATACTCGATGCGGCTG	0.373													5	171	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	44079544	44079544	+	Intron	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44079544G>T	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzk.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_3'UTR	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				GAACGAATATGGAGTTGTTAT	0.189													5	90	---	---	---	---	PASS
PIGA	5277	broad.mit.edu	37	X	15343172	15343172	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15343172C>A	uc004cwr.2	-	4	1051	c.951G>T	c.(949-951)GCG>GCT	p.A317A	PIGA_uc010neu.2_Silent_p.A2A|PIGA_uc004cwq.2_Silent_p.A2A|PIGA_uc010nev.2_Silent_p.A148A|PIGA_uc004cws.2_Silent_p.A2A|PIGA_uc011miq.1_Silent_p.A83A	NM_002641	NP_002632	P37287	PIGA_HUMAN	phosphatidylinositol	317	Cytoplasmic (Potential).				C-terminal protein lipidation|positive regulation of metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity|protein binding				0	Hepatocellular(33;0.183)					CTTCCACGATCGCCATGCAGA	0.398													5	155	---	---	---	---	PASS
GNL3L	54552	broad.mit.edu	37	X	54567804	54567804	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54567804G>T	uc004dth.1	+	5	427	c.288G>T	c.(286-288)CAG>CAT	p.Q96H	GNL3L_uc004dti.2_RNA	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3	96					ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						TAAGACGCCAGGAGGAGTTTG	0.512													5	75	---	---	---	---	PASS
ACRC	93953	broad.mit.edu	37	X	70823930	70823930	+	Missense_Mutation	SNP	G	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70823930G>A	uc004eae.2	+	8	1304	c.803G>A	c.(802-804)AGC>AAC	p.S268N	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	268	Asp/Ser-rich.					nucleus				ovary(3)	3	Renal(35;0.156)					CCCGACGACAGCAGTGATGAT	0.557													6	193	---	---	---	---	PASS
DRP2	1821	broad.mit.edu	37	X	100515688	100515688	+	3'UTR	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100515688C>A	uc004egz.2	+	24					DRP2_uc011mrh.1_3'UTR	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2						central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						TTCACCCAACCTTTCCAGTTT	0.542													5	79	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108718555	108718555	+	Missense_Mutation	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108718555C>A	uc004eod.3	-	2	887	c.611G>T	c.(610-612)CGA>CTA	p.R204L	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	204	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						ACTTGCGACTCGATTGGCTGT	0.527											OREG0019905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	123	---	---	---	---	PASS
CT47B1	643311	broad.mit.edu	37	X	120009111	120009111	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120009111G>T	uc011muc.1	-	1	669	c.414C>A	c.(412-414)AAC>AAA	p.N138K		NM_001145718	NP_001139190	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 147, member B1	138											0						GGATGTGGTCGTTGTGATAGA	0.647													3	34	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123517916	123517916	+	Missense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123517916G>T	uc004euj.2	-	29	6908	c.6844C>A	c.(6844-6846)CAT>AAT	p.H2282N	ODZ1_uc011muj.1_Missense_Mutation_p.H2288N|ODZ1_uc010nqy.2_Missense_Mutation_p.H2289N	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2282	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TTGTACAAATGAGTAACTCTT	0.448													6	213	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135430942	135430942	+	Missense_Mutation	SNP	A	G	G	rs147083468		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135430942A>G	uc004ezu.1	+	6	5368	c.5077A>G	c.(5077-5079)AAG>GAG	p.K1693E	GPR112_uc010nsb.1_Missense_Mutation_p.K1488E|GPR112_uc010nsc.1_Missense_Mutation_p.K1460E	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1693	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					CTCCATTCCAAAGACCACATT	0.458													6	195	---	---	---	---	PASS
SPANXN1	494118	broad.mit.edu	37	X	144337224	144337224	+	Missense_Mutation	SNP	G	A	A	rs143004346	byFrequency	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144337224G>A	uc004fcb.2	+	2	109	c.109G>A	c.(109-111)GAA>AAA	p.E37K		NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein	37											0	Acute lymphoblastic leukemia(192;6.56e-05)					CTTAGCCCCCGAACCGAGTTT	0.403													5	98	---	---	---	---	PASS
DUSP9	1852	broad.mit.edu	37	X	152914980	152914980	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152914980G>T	uc004fhx.3	+	3	871	c.667G>T	c.(667-669)GAG>TAG	p.E223*	DUSP9_uc004fhy.3_Nonsense_Mutation_p.E223*	NM_001395	NP_001386	Q99956	DUS9_HUMAN	dual specificity phosphatase 9	223	Tyrosine-protein phosphatase.				inactivation of MAPK activity|JNK cascade	cytosol|endoplasmic reticulum|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			ovary(2)	2	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCCAATTTGGAGAGCCTGGC	0.587													5	125	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	4967779	4967779	+	Silent	SNP	C	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:4967779C>A	uc004fqo.2	+	2	2894	c.2160C>A	c.(2158-2160)TCC>TCA	p.S720S	PCDH11Y_uc010nwg.1_Silent_p.S709S|PCDH11Y_uc004fql.1_Silent_p.S709S|PCDH11Y_uc004fqm.1_Silent_p.S709S|PCDH11Y_uc004fqn.1_Silent_p.S720S|PCDH11Y_uc004fqp.1_Silent_p.S491S	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	720	Cadherin 7.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						TTCTACCGTCCACTAATCCAG	0.418													5	143	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13214	13214	+	RNA	SNP	T	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13214T>C	uc004cox.3	+	1		c.878T>C			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		AGTCTGCGCCCTTACACAAAA	0.453													2	0	---	---	---	---	PASS
ATAD3A	55210	broad.mit.edu	37	1	1453450	1453451	+	Intron	DEL	CA	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1453450_1453451delCA	uc001afz.1	+						ATAD3A_uc001aga.1_Intron|ATAD3A_uc001agb.1_Intron	NM_018188	NP_060658	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A								ATP binding|nucleoside-triphosphatase activity|protein binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		cacacacgggcacacacacacc	0.000													5	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17272607	17272607	+	Intron	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17272607delT	uc001azt.2	+						CROCC_uc009voz.1_Intron|CROCC_uc001azu.2_Intron	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TCTGCGGTGATTTTTTTTTTT	0.522													4	4	---	---	---	---	
NBPF3	84224	broad.mit.edu	37	1	21795575	21795575	+	Intron	DEL	C	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21795575delC	uc001ber.2	+						NBPF3_uc001bes.2_Intron|NBPF3_uc009vqb.2_Intron|NBPF3_uc010odm.1_Intron	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3							cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TAGCAACTTTCCATGTTTGCA	0.413													4	2	---	---	---	---	
TRIT1	54802	broad.mit.edu	37	1	40312702	40312703	+	Intron	INS	-	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40312702_40312703insT	uc010oiz.1	-						TRIT1_uc001cec.3_Intron|TRIT1_uc001ced.3_Intron|TRIT1_uc001cee.3_Intron|TRIT1_uc001cef.3_Intron|TRIT1_uc001ceg.3_Intron|TRIT1_uc001ceh.3_Intron|TRIT1_uc009vvv.2_Intron|TRIT1_uc001cei.3_Intron|TRIT1_uc001ceq.2_Intron|TRIT1_uc001cek.2_Intron|TRIT1_uc009vvx.2_Intron|TRIT1_uc001cel.2_Intron|TRIT1_uc001cem.2_Intron|TRIT1_uc001cen.2_Intron|TRIT1_uc001ceo.2_Intron|TRIT1_uc001cep.2_Intron	NM_017646	NP_060116	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1 precursor						tRNA processing	mitochondrion	ATP binding|metal ion binding|tRNA dimethylallyltransferase activity			ovary(1)	1	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AATGCAAATAATTTTTTTTTTT	0.386													5	3	---	---	---	---	
SGIP1	84251	broad.mit.edu	37	1	67160939	67160939	+	Intron	DEL	A	-	-	rs36093512		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67160939delA	uc001dcr.2	+						SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Intron|SGIP1_uc001dcu.2_5'UTR	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting						positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TTCCTGAACTAAAAAAAAAAA	0.443													4	2	---	---	---	---	
LRIG2	9860	broad.mit.edu	37	1	113666345	113666346	+	Intron	INS	-	TTTTTT	TTTTTT	rs139220276	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113666345_113666346insTTTTTT	uc001edf.1	+						LRIG2_uc009wgn.1_Intron	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TCTGGTGGTGGTTTTtgtgtgt	0.287													3	6	---	---	---	---	
CSDE1	7812	broad.mit.edu	37	1	115276153	115276154	+	Intron	INS	-	A	A	rs77643456		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115276153_115276154insA	uc001efk.2	-						CSDE1_uc001efi.2_Intron|CSDE1_uc001efj.2_Intron|CSDE1_uc001efl.2_Intron|CSDE1_uc001efm.2_Intron|CSDE1_uc009wgv.2_Intron|CSDE1_uc001efn.2_Intron	NM_001007553	NP_001007554	O75534	CSDE1_HUMAN	upstream of NRAS isoform 1						male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding			ovary(1)	1	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		cacaaaaaaagaaaaaaaaaaa	0.129													2	4	---	---	---	---	
CACNA1S	779	broad.mit.edu	37	1	201038394	201038395	+	Intron	INS	-	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201038394_201038395insC	uc001gvv.2	-							NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CAGCAGCAGCAGCATAAAGCAG	0.569													25	14	---	---	---	---	
FOXN2	3344	broad.mit.edu	37	2	48586020	48586023	+	Intron	DEL	ATCC	-	-	rs138339553		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48586020_48586023delATCC	uc002rwh.1	+							NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			CATAGGATGAATCCCTTTTAGTCA	0.333													5	4	---	---	---	---	
TTL	150465	broad.mit.edu	37	2	113278192	113278193	+	Intron	INS	-	TA	TA	rs138859384	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113278192_113278193insTA	uc002thu.2	+						TTL_uc010fkm.1_Intron	NM_153712	NP_714923	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase						protein modification process		ATP binding|tubulin-tyrosine ligase activity				0		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		CCCGTGTATAGGCCAGATAggc	0.292			T	ETV6	ALL								4	3	---	---	---	---	
PRPF40A	55660	broad.mit.edu	37	2	153572284	153572312	+	Intron	DEL	TAAATTTCTCAGAAGACTTTTTCATTATT	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153572284_153572312delTAAATTTCTCAGAAGACTTTTTCATTATT	uc002tyi.2	-						ARL6IP6_uc002tyn.2_5'Flank|ARL6IP6_uc002tym.2_5'Flank|PRPF40A_uc002tyh.3_Intron|PRPF40A_uc010zcd.1_Intron|PRPF40A_uc002tyj.2_Intron|PRPF40A_uc002tyl.1_Intron	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3						mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						AGGTCATCAGTAAATTTCTCAGAAGACTTTTTCATTATTTAAATTTCTC	0.253													4	5	---	---	---	---	
ZSWIM2	151112	broad.mit.edu	37	2	187712685	187712686	+	Intron	INS	-	TGATTTTTCAT	TGATTTTTCAT	rs140128829	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187712685_187712686insTGATTTTTCAT	uc002upu.1	-							NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2						apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			AGTCTCTAGGCTTCATTATTTA	0.312													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201967218	201967218	+	IGR	DEL	G	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201967218delG								NDUFB3 (16747 upstream) : CFLAR (13598 downstream)																							aaaaaaaaaagaaTTTGTTCT	0.229													3	3	---	---	---	---	
ARPC2	10109	broad.mit.edu	37	2	219118832	219118832	+	3'UTR	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219118832delA	uc002vhd.2	+	11					ARPC2_uc002vhe.2_3'UTR|ARPC2_uc002vhf.2_3'UTR	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCCAAGAATTAAAAAAAAAAA	0.368													6	3	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188268	10188269	+	Frame_Shift_Ins	INS	-	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188268_10188269insC	uc003bvc.2	+	2	624_625	c.411_412insC	c.(409-414)GTGCCAfs	p.V137fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	137_138	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V137fs*7(5)|p.V137fs*22(2)|p.V137fs*23(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AATTATTTGTGCCATCTCTCAA	0.421		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				114	120	---	---	---	---	
PLCH1	23007	broad.mit.edu	37	3	155285995	155285995	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155285995delA	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AAGAAATGAGAAATAAAGAAT	0.279													31	14	---	---	---	---	
SMC4	10051	broad.mit.edu	37	3	160131534	160131534	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160131534delA	uc003fdh.2	+						IFT80_uc003fda.2_Intron|SMC4_uc003fdf.1_Intron|SMC4_uc003fdg.1_Intron|SMC4_uc010hwc.1_Intron|SMC4_uc003fdi.2_Intron|SMC4_uc003fdj.2_Intron|SMC4_uc010hwd.2_Intron|SMC4_uc003fdl.2_5'Flank	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CCCCTTAGTGAAAAAAAAAAA	0.398													4	2	---	---	---	---	
ATP8A1	10396	broad.mit.edu	37	4	42557859	42557860	+	Intron	INS	-	TAAA	TAAA	rs145505019	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42557859_42557860insTAAA	uc003gwr.2	-						ATP8A1_uc003gws.2_Intron|ATP8A1_uc011byz.1_Intron	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),						ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	aactaactaactaaataaataa	0.104													11	5	---	---	---	---	
CCDC158	339965	broad.mit.edu	37	4	77272457	77272457	+	Intron	DEL	A	-	-	rs112268994		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77272457delA	uc003hkb.3	-							NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6						TGTACGATTTAAAAAAAAAAC	0.174													2	13	---	---	---	---	
CLGN	1047	broad.mit.edu	37	4	141331100	141331101	+	Intron	INS	-	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141331100_141331101insT	uc011chi.1	-						CLGN_uc003iii.2_Intron	NM_001130675	NP_001124147	O14967	CLGN_HUMAN	calmegin precursor						protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding			ovary(2)|skin(1)	3	all_hematologic(180;0.162)					AAAAGCAGCAATTTATAGATAT	0.302													65	38	---	---	---	---	
SLC6A19	340024	broad.mit.edu	37	5	1209151	1209152	+	Intron	INS	-	CTC	CTC	rs144844205	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1209151_1209152insCTC	uc003jbw.3	+							NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19						cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCCAGCTTCATCTCCTGGAGGC	0.658													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3323909	3323909	+	IGR	DEL	G	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3323909delG								C5orf38 (568397 upstream) : IRX1 (272259 downstream)																							tgtgtgtggtgtattgtgtat	0.000													4	2	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10424068	10424069	+	Intron	INS	-	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10424068_10424069insT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						CATATATAACCTTTTTTTTTTT	0.213													4	3	---	---	---	---	
RAB3C	115827	broad.mit.edu	37	5	57911812	57911813	+	Intron	INS	-	AC	AC	rs151246652	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57911812_57911813insAC	uc003jrp.2	+							NM_138453	NP_612462	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		cacacacacagacacacacaca	0.322													4	2	---	---	---	---	
PAM	5066	broad.mit.edu	37	5	102342889	102342896	+	Intron	DEL	ATATACAT	-	-	rs113747381		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102342889_102342896delATATACAT	uc003knw.2	+						PAM_uc003kns.2_Intron|PAM_uc003knt.2_Intron|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Intron|PAM_uc003knz.2_5'Flank	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase						peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	acacacacacatatacatacacacacac	0.274													7	4	---	---	---	---	
DDX46	9879	broad.mit.edu	37	5	134124538	134124539	+	Intron	INS	-	A	A	rs74589578		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134124538_134124539insA	uc003kzw.2	+						DDX46_uc003kzv.1_Intron	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46						mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			gactccgtctcaaaaaaaaaaa	0.094													4	2	---	---	---	---	
COL11A2	1302	broad.mit.edu	37	6	33149147	33149147	+	Intron	DEL	C	-	-	rs141158785		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33149147delC	uc003ocx.1	-						COL11A2_uc003ocy.1_Intron|COL11A2_uc003ocz.1_Intron	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1						cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						GGGTTCCCTGCCCCCCCAGTT	0.552													4	2	---	---	---	---	
KIAA0240	23506	broad.mit.edu	37	6	42790382	42790382	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42790382delA	uc003osn.1	+						KIAA0240_uc003osm.1_Intron|KIAA0240_uc011duw.1_Intron|KIAA0240_uc003oso.1_Intron|KIAA0240_uc003osp.1_Intron	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			AAACAAGATTAAAAAAAAAAA	0.234													5	4	---	---	---	---	
CRISP3	10321	broad.mit.edu	37	6	49703788	49703789	+	Intron	INS	-	AA	AA	rs143846456	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49703788_49703789insAA	uc003ozs.2	-							NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3 precursor						innate immune response	proteinaceous extracellular matrix|specific granule				skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			ATCTTAAAAGGAAAAGGTCTTT	0.391													4	4	---	---	---	---	
RIMS1	22999	broad.mit.edu	37	6	72947379	72947379	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72947379delA	uc003pga.2	+						RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgb.3_Intron|RIMS1_uc010kas.1_Intron	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				atcccatctcaaaaaaaaaaa	0.124													3	3	---	---	---	---	
NT5E	4907	broad.mit.edu	37	6	86200914	86200915	+	Intron	INS	-	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86200914_86200915insC	uc003pko.3	+						NT5E_uc010kbr.2_Intron	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor						DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	tgtttatctcatggactgcagt	0.074													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	142790745	142790746	+	IGR	DEL	AC	-	-	rs150002640		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142790745_142790746delAC								GPR126 (23344 upstream) : LOC153910 (56846 downstream)																							gCTTCTTGATacacacacacac	0.045													3	3	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151253910	151253910	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151253910delA	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		atgtgtctccaaaaaaaaaag	0.030													4	2	---	---	---	---	
FGFR1OP	11116	broad.mit.edu	37	6	167435748	167435749	+	Intron	DEL	AC	-	-	rs35327997		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167435748_167435749delAC	uc003qvj.2	+						CCR6_uc003qvl.2_Intron|FGFR1OP_uc011egp.1_Intron|FGFR1OP_uc003qvk.2_Intron	NM_007045	NP_008976	O95684	FR1OP_HUMAN	FGFR1 oncogene partner isoform a						G2/M transition of mitotic cell cycle|microtubule anchoring|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell proliferation	centrosome|cytosol|nucleus|perinuclear region of cytoplasm	protein homodimerization activity|protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(1)	1		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		AGCTGCCCCAacacacacacac	0.342			T	FGFR1	MPD|NHL								5	3	---	---	---	---	
THBS2	7058	broad.mit.edu	37	6	169621350	169621353	+	Intron	DEL	TACT	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169621350_169621353delTACT	uc003qwt.2	-							NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor						cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TTTTTAAAAATACTTAATATTTAG	0.333													6	7	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34193010	34193011	+	3'UTR	INS	-	TA	TA	rs140714031	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34193010_34193011insTA	uc011kap.1	+	15						NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						Gtatatatgtgtatatatatat	0.307													6	3	---	---	---	---	
YWHAG	7532	broad.mit.edu	37	7	75990616	75990617	+	5'Flank	INS	-	AAAAAAAAAAA	AAAAAAAAAAA			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75990616_75990617insAAAAAAAAAAA	uc011kgj.1	-							NM_012479	NP_036611	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan						G2/M transition of mitotic cell cycle|regulation of neuron differentiation|regulation of signal transduction|regulation of synaptic plasticity	cytosol	insulin-like growth factor receptor binding|protein kinase C binding|protein kinase C inhibitor activity			ovary(1)|lung(1)	2						gactccgtctcaaaaaaaaaaa	0.243													6	10	---	---	---	---	
RASA4	10156	broad.mit.edu	37	7	102246649	102246649	+	Intron	DEL	C	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102246649delC	uc003vae.2	-						UPK3BL_uc003uzy.2_Intron|RASA4_uc011kla.1_Intron|RASA4_uc010lig.2_Intron|RASA4_uc003vaf.2_Intron|RASA4_uc011klb.1_Intron|RASA4_uc010lih.2_Intron|RASA4_uc011kld.1_Intron	NM_006989	NP_008920	O43374	RASL2_HUMAN	RAS p21 protein activator 4 isoform 1						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0						aagtcagtgacctggggcctg	0.090													2	4	---	---	---	---	
WASL	8976	broad.mit.edu	37	7	123336466	123336467	+	Intron	INS	-	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123336466_123336467insA	uc003vkz.2	-							NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein						actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						GCAGCTGCCTTAAAAAAAAAAA	0.287													7	8	---	---	---	---	
ZNF786	136051	broad.mit.edu	37	7	148771739	148771740	+	Intron	INS	-	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148771739_148771740insA	uc003wfh.2	-						ZNF786_uc011kuk.1_Intron|ZNF786_uc003wfi.2_Intron	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			AACAACATGTCAAAAAAAAAAA	0.376													9	5	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157462118	157462119	+	Intron	DEL	CA	-	-	rs35351893		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157462118_157462119delCA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TTTGCACGCGCACACACACACA	0.614													4	2	---	---	---	---	
ARMC1	55156	broad.mit.edu	37	8	66539237	66539238	+	Intron	INS	-	A	A	rs76882301		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66539237_66539238insA	uc003xvl.2	-						ARMC1_uc011leo.1_Intron	NM_018120	NP_060590	Q9NVT9	ARMC1_HUMAN	armadillo repeat-containing protein						metal ion transport		metal ion binding			skin(1)	1			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			ctagatgactcaaaaaaaaaaa	0.139													3	3	---	---	---	---	
MED30	90390	broad.mit.edu	37	8	118535435	118535435	+	Intron	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118535435delT	uc003yoj.2	+						MED30_uc011lib.1_Intron	NM_080651	NP_542382	Q96HR3	MED30_HUMAN	TRAP/Mediator complex component TRAP25						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding				0	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			CAAAGCCAACTTTTTTTTTTT	0.303													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	140797781	140797784	+	Intron	DEL	ACAC	-	-	rs34501334		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140797781_140797784delACAC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						tctctactaaacacacacacacac	0.000													4	2	---	---	---	---	
C9orf82	79886	broad.mit.edu	37	9	26842275	26842275	+	3'UTR	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26842275delA	uc003zqc.2	-	6					C9orf82_uc003zqb.2_3'UTR	NM_024828	NP_079104	Q9H8G2	CI082_HUMAN	hypothetical protein LOC79886												0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(42;1.39e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		AAACATACCTAAAATTCAAAA	0.328													59	26	---	---	---	---	
DNAI1	27019	broad.mit.edu	37	9	34489848	34489849	+	Intron	INS	-	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34489848_34489849insA	uc003zum.2	+							NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1						cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		gactctgtctcaaaaaaaaaaG	0.243									Kartagener_syndrome				4	2	---	---	---	---	
TMC1	117531	broad.mit.edu	37	9	75193182	75193183	+	Intron	DEL	GT	-	-	rs71855970		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75193182_75193183delGT	uc004aiz.1	+						TMC1_uc010moz.1_Intron	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1						GCGCGCACGCgtgtgtgtgtgt	0.337													3	4	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	94985153	94985154	+	Intron	INS	-	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94985153_94985154insA	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron|IARS_uc010mqt.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	AGGGGAAAAAGAAAAAAAAAAA	0.436													8	4	---	---	---	---	
GAPVD1	26130	broad.mit.edu	37	9	128069547	128069548	+	Intron	INS	-	A	A	rs139935181		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128069547_128069548insA	uc010mwx.2	+						GAPVD1_uc004bpo.2_Intron|GAPVD1_uc011lzs.1_Intron|GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc010mwy.1_Intron	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						aactttgtctcaaaaaaaaaaa	0.104													4	3	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131598582	131598582	+	Intron	DEL	T	-	-	rs71497420		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131598582delT	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	tctttctttgttttttttttt	0.090													5	3	---	---	---	---	
TTF1	7270	broad.mit.edu	37	9	135273373	135273373	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135273373delA	uc004cbl.2	-						TTF1_uc011mcp.1_Intron|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase						negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		actccgtctcaaaaaaaaaaa	0.119													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3705265	3705266	+	Intron	DEL	TT	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3705265_3705266delTT	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																		tctttctttctttttctttctt	0.000													3	3	---	---	---	---	
C11orf49	79096	broad.mit.edu	37	11	47009041	47009042	+	Intron	INS	-	T	T	rs139839679	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47009041_47009042insT	uc001ndp.2	+						C11orf49_uc001nds.2_Intron|C11orf49_uc001ndq.2_Intron|C11orf49_uc001ndr.2_Intron|C11orf49_uc010rgx.1_Intron|C11orf49_uc010rgy.1_Intron|C11orf49_uc010rgz.1_Intron	NM_024113	NP_077018	Q9H6J7	CK049_HUMAN	hypothetical protein LOC79096 isoform 3												0						GGTGCAGCTAGTTTGTCCAGTG	0.401													5	8	---	---	---	---	
C11orf9	745	broad.mit.edu	37	11	61541709	61541714	+	Intron	DEL	AGCGTT	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61541709_61541714delAGCGTT	uc001nsc.1	+						C11orf9_uc001nse.1_Intron	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2						central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						AGAAAAAGCAAGCGTTggctggatgc	0.291													11	5	---	---	---	---	
DNAJB13	374407	broad.mit.edu	37	11	73676290	73676291	+	Intron	INS	-	T	T	rs146551571	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73676290_73676291insT	uc001ouo.2	+							NM_153614	NP_705842	P59910	DJB13_HUMAN	testis spermatogenesis apoptosis-related protein						apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding				0	Breast(11;7.42e-05)					tagtgcaggagtgccctctgca	0.282													4	5	---	---	---	---	
ATM	472	broad.mit.edu	37	11	108206869	108206869	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108206869delA	uc001pkb.1	+						ATM_uc009yxr.1_Intron|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		acaaaaagttaaaaaaaaaaa	0.000			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			5	3	---	---	---	---	
UBASH3B	84959	broad.mit.edu	37	11	122680263	122680264	+	Intron	DEL	AT	-	-	rs146476661		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122680263_122680264delAT	uc001pyi.3	+							NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,							cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		TGCAATGTAAATACTCTTCTAA	0.351													5	6	---	---	---	---	
SLC2A14	144195	broad.mit.edu	37	12	7970348	7970351	+	Intron	DEL	ATAG	-	-	rs57468924		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7970348_7970351delATAG	uc001qtk.2	-						SLC2A14_uc001qtl.2_Intron|SLC2A14_uc001qtm.2_Intron|SLC2A14_uc010sgg.1_Intron|SLC2A14_uc001qtn.2_Intron|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Intron	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		atatatatatatagatagatagat	0.103													9	4	---	---	---	---	
FAM90A1	55138	broad.mit.edu	37	12	8377054	8377056	+	Intron	DEL	GTC	-	-	rs146185264		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8377054_8377056delGTC	uc001qui.2	-						FAM90A1_uc001quh.2_Intron	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138								nucleic acid binding|zinc ion binding			ovary(1)	1				Kidney(36;0.0866)		TGAACCCGATGTCAACAACACAG	0.567													3	5	---	---	---	---	
GPRC5A	9052	broad.mit.edu	37	12	13065679	13065680	+	3'UTR	INS	-	T	T	rs111900693		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13065679_13065680insT	uc001rba.2	+	4					uc001rbb.3_5'Flank	NM_003979	NP_003970	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, family C, group 5,							cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	GCGCTGTAGTATTTTTTTTTTT	0.401													6	4	---	---	---	---	
GLIPR1	11010	broad.mit.edu	37	12	75884364	75884364	+	Intron	DEL	A	-	-	rs146756328		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75884364delA	uc001sxs.2	+						GLIPR1_uc009zsb.1_Intron	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor						cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3						AAACAACAACAAAAAAAAACA	0.274													8	4	---	---	---	---	
MAP1LC3B2	643246	broad.mit.edu	37	12	117014397	117014397	+	3'UTR	DEL	A	-	-	rs143046138		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117014397delA	uc009zwk.1	+	2						NM_001085481	NP_001078950	A6NCE7	MP3B2_HUMAN	microtubule-associated protein 1 light chain 3						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule					0						TTTGCATTCTAAAAAAAAAAA	0.139													4	2	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965154	117965157	+	Intron	DEL	ACAC	-	-	rs7309204		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965154_117965157delACAC	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					acacacacagacacacacacacac	0.230													4	2	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50299782	50299783	+	Intron	INS	-	T	T	rs35089210		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50299782_50299783insT	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GCCAACCCTACttttttttttt	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79668173	79668173	+	IGR	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79668173delA								RNF219 (433473 upstream) : RBM26 (225927 downstream)																							gtatagtaataaaaaaaaaaG	0.154													4	2	---	---	---	---	
SLC15A1	6564	broad.mit.edu	37	13	99336799	99336800	+	3'UTR	INS	-	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99336799_99336800insA	uc001vno.2	-	23						NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide						digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	aactctgtctcaaaaaaaaaaa	0.124													5	3	---	---	---	---	
EFNB2	1948	broad.mit.edu	37	13	107147819	107147820	+	Intron	INS	-	TATC	TATC			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107147819_107147820insTATC	uc001vqi.2	-							NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor						cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TTAAAAAGAAAtatctatctat	0.238													6	6	---	---	---	---	
PNN	5411	broad.mit.edu	37	14	39645407	39645408	+	Intron	INS	-	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39645407_39645408insA	uc001wuw.3	+							NM_002687	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein						cell adhesion|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|desmosome|intermediate filament|nuclear speck	DNA binding|protein binding|structural molecule activity			ovary(1)	1	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		CTTTACTAAATATGTTGGTTTG	0.347													32	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20448530	20448531	+	IGR	INS	-	A	A	rs147102561	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20448530_20448531insA								None (None upstream) : GOLGA6L6 (288563 downstream)																							tccAGGGGGGGAAAAAAGAAAG	0.243													4	3	---	---	---	---	
EIF2AK4	440275	broad.mit.edu	37	15	40314942	40314943	+	Intron	INS	-	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40314942_40314943insT	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Intron|EIF2AK4_uc001zko.1_Intron|EIF2AK4_uc010bbk.1_Intron	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TGTTGGGtttcttttttttttt	0.272													7	4	---	---	---	---	
MAP2K5	5607	broad.mit.edu	37	15	67872870	67872875	+	Intron	DEL	TTACTC	-	-	rs66514950		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67872870_67872875delTTACTC	uc002aqu.2	+						MAP2K5_uc002aqt.1_Intron|MAP2K5_uc002aqv.2_Intron|MAP2K5_uc010ujw.1_Intron	NM_145160	NP_660143	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2						ATCAACACTTTTACTCTTAAAGATAA	0.306													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78271437	78271437	+	IGR	DEL	A	-	-	rs66482923		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78271437delA								LOC645752 (52249 upstream) : LOC91450 (14139 downstream)																							TGCGAGCAGGAAGGCCCAGTC	0.642													6	3	---	---	---	---	
MEF2A	4205	broad.mit.edu	37	15	100252892	100252892	+	Frame_Shift_Del	DEL	A	-	-	rs34851361	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100252892delA	uc010urw.1	+	11	1799	c.1440delA	c.(1438-1440)CCAfs	p.P480fs	MEF2A_uc010urv.1_Frame_Shift_Del_p.P410fs|MEF2A_uc010bos.2_Frame_Shift_Del_p.P470fs|MEF2A_uc002bvf.2_Frame_Shift_Del_p.P472fs|MEF2A_uc002bve.2_Frame_Shift_Del_p.P478fs|MEF2A_uc002bvg.2_Frame_Shift_Del_p.P470fs|MEF2A_uc002bvi.2_Frame_Shift_Del_p.P470fs|MEF2A_uc010bot.2_Frame_Shift_Del_p.P402fs	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1	480					apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			TCCATTCTCCAATTGTGCTTG	0.562													4	2	---	---	---	---	
MLST8	64223	broad.mit.edu	37	16	2255805	2255805	+	Intron	DEL	G	-	-	rs3214648		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2255805delG	uc002coz.2	+						MLST8_uc002coy.2_Intron|MLST8_uc002cpa.2_Intron|MLST8_uc002cpb.2_Intron|MLST8_uc010uvx.1_Intron|MLST8_uc002cpc.2_Intron|MLST8_uc002cpd.2_Intron|MLST8_uc002cpe.2_5'UTR|MLST8_uc010uvy.1_5'UTR|MLST8_uc002cpg.2_5'UTR|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_5'UTR	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0						CTGCGGAGGTGGGGGGGGGAC	0.512													7	4	---	---	---	---	
NOMO1	23420	broad.mit.edu	37	16	14973616	14973616	+	Intron	DEL	G	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14973616delG	uc002dcv.2	+							NM_014287	NP_055102	Q15155	NOMO1_HUMAN	nodal modulator 1 precursor							integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			ovary(1)	1						aaaaaaaaaagaaaagaaaaa	0.149													4	2	---	---	---	---	
SYT17	51760	broad.mit.edu	37	16	19195719	19195719	+	Intron	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19195719delT	uc002dfw.2	+						SYT17_uc002dfx.2_Intron|SYT17_uc002dfy.2_Intron|SYT17_uc002dfv.1_Intron	NM_016524	NP_057608	Q9BSW7	SYT17_HUMAN	B/K protein							membrane|synaptic vesicle	transporter activity			ovary(1)	1						atttcagtagttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	20605022	20605023	+	IGR	INS	-	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20605022_20605023insT								ACSM2B (17327 upstream) : ACSM1 (29536 downstream)																							TTGTTATCGGCTTCTCCCCTGG	0.406													6	3	---	---	---	---	
OTOA	146183	broad.mit.edu	37	16	21739913	21739913	+	Intron	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21739913delT	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron|OTOA_uc002dji.2_Intron|OTOA_uc010vbk.1_Intron	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		tggcttcagattttttttttt	0.144													4	2	---	---	---	---	
SPNS1	83985	broad.mit.edu	37	16	28992631	28992632	+	Intron	INS	-	G	G			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28992631_28992632insG	uc010vdi.1	+						uc010vct.1_Intron|SPNS1_uc002drx.2_Intron|SPNS1_uc002dsa.2_Intron|SPNS1_uc002drz.2_Intron|SPNS1_uc010byp.2_Intron|SPNS1_uc010byq.1_Intron	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1						lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						CCCTAGTGGCAGCCCCCTTCCC	0.342											OREG0023712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	10	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2703722	2703743	+	Intron	DEL	GGCTGTCCCGGGGACTCCTCCA	-	-	rs72122107		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2703722_2703743delGGCTGTCCCGGGGACTCCTCCA	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						TGGTGGTTTGGGCTGTCCCGGGGACTCCTCCATACAGATGCT	0.595													4	6	---	---	---	---	
SHPK	23729	broad.mit.edu	37	17	3524895	3524896	+	Intron	INS	-	TCCC	TCCC			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3524895_3524896insTCCC	uc002fvz.1	-							NM_013276	NP_037408	Q9UHJ6	SHPK_HUMAN	carbohydrate kinase-like						carbohydrate metabolic process	cytoplasm	ATP binding|sedoheptulokinase activity			ovary(1)	1				COAD - Colon adenocarcinoma(5;0.0828)		tctccattccttccctccctcc	0.000													6	3	---	---	---	---	
ELAC2	60528	broad.mit.edu	37	17	12901544	12901545	+	Intron	INS	-	A	A	rs140011002	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12901544_12901545insA	uc002gnz.3	-						ELAC2_uc002gnu.3_Intron|ELAC2_uc002gnv.3_Intron|ELAC2_uc002gnw.3_Intron|ELAC2_uc002gnx.3_Intron|ELAC2_uc010vvo.1_Intron|ELAC2_uc010vvp.1_Intron|ELAC2_uc010vvq.1_Intron|ELAC2_uc010vvr.1_Intron	NM_018127	NP_060597	Q9BQ52	RNZ2_HUMAN	elaC homolog 2 isoform 1						tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0						ATTCCCAGGGTAAAGTTTGCTA	0.337									Hereditary_Prostate_Cancer				3	3	---	---	---	---	
DHRS7B	25979	broad.mit.edu	37	17	21081454	21081454	+	Intron	DEL	G	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21081454delG	uc002gyo.2	+							NM_015510	NP_056325	Q6IAN0	DRS7B_HUMAN	dehydrogenase/reductase (SDR family) member 7B							integral to membrane|peroxisomal membrane	binding|oxidoreductase activity			pancreas(1)	1						GACCTGTGAAGGGTGTGAAGC	0.547													15	10	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36361522	36361522	+	Intron	DEL	A	-	-	rs67811849		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36361522delA	uc010wdn.1	-									Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		aactctacagaaaaaaaaaaa	0.035													4	2	---	---	---	---	
PTRF	284119	broad.mit.edu	37	17	40571901	40571902	+	Intron	DEL	GT	-	-	rs35990055		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40571901_40571902delGT	uc002hzo.2	-						PTRF_uc010wgi.1_Intron	NM_012232	NP_036364	Q6NZI2	PTRF_HUMAN	polymerase I and transcript release factor						regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription initiation from RNA polymerase I promoter	caveola|cytosol|endoplasmic reticulum|microsome|mitochondrion|nucleoplasm	protein binding|rRNA primary transcript binding			breast(1)	1		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		GCTGAATTTCgtgtgtgtgtgt	0.381													4	2	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57733326	57733327	+	Frame_Shift_Ins	INS	-	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57733326_57733327insT	uc002ixq.1	+	6	1350_1351	c.907_908insT	c.(907-909)ATTfs	p.I303fs	CLTC_uc002ixp.2_Frame_Shift_Ins_p.I303fs|CLTC_uc002ixr.1_Frame_Shift_Ins_p.I307fs	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	303	Globular terminal domain.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TGGAGAAACAATTTTTGTTACT	0.371			T	ALK|TFE3	ALCL|renal 								175	92	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60129744	60129744	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60129744delA	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						AAAGTGGTTTAAAAAAAAAAA	0.323													6	4	---	---	---	---	
SRP68	6730	broad.mit.edu	37	17	74066303	74066304	+	Intron	INS	-	AAAA	AAAA	rs146327490		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74066303_74066304insAAAA	uc002jqk.1	-						SRP68_uc010wsu.1_Intron|SRP68_uc002jql.1_Intron	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa						response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						gactccatctcaaaaaaaaaaa	0.094													4	2	---	---	---	---	
LPIN2	9663	broad.mit.edu	37	18	2960970	2960975	+	Intron	DEL	TATTAA	-	-	rs17881253		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2960970_2960975delTATTAA	uc002klo.2	-							NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2						fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		TCATTAGCCTTATTAATTTTCAACCT	0.388													6	7	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3741135	3741136	+	Intron	INS	-	C	C			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3741135_3741136insC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				caccaccaccacatcaccatca	0.000													3	3	---	---	---	---	
ANKRD29	147463	broad.mit.edu	37	18	21214243	21214255	+	Intron	DEL	TTTTTTTTTTTTT	-	-	rs2914965		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21214243_21214255delTTTTTTTTTTTTT	uc002kun.2	-						ANKRD29_uc002kuo.2_Intron	NM_173505	NP_775776	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29											ovary(3)|breast(1)	4	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ACTTTCCCTGttttttttttttttttttttttt	0.197													6	3	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67748165	67748174	+	Intron	DEL	CACACACACA	-	-	rs112615894		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67748165_67748174delCACACACACA	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				tgtgtggtatcacacacacacacacacaca	0.000													4	2	---	---	---	---	
POLR2E	5434	broad.mit.edu	37	19	1093794	1093795	+	Intron	DEL	AG	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1093794_1093795delAG	uc002lre.3	-						POLR2E_uc010xgf.1_RNA	NM_002695	NP_002686	P19388	RPAB1_HUMAN	DNA directed RNA polymerase II polypeptide E						interspecies interaction between organisms|mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGACTGGGCAGAGAGACAAAT	0.624													12	6	---	---	---	---	
MUM1	84939	broad.mit.edu	37	19	1358189	1358189	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1358189delA	uc010xgm.1	+						MUM1_uc010dsi.2_Intron|MUM1_uc002lrz.2_Intron|MUM1_uc002lsb.2_Intron|MUM1_uc002lsc.1_5'UTR			Q2TAK8	MUM1_HUMAN	SubName: Full=MUM1 protein;						chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTTAAAAGGAAAAAAAAAAA	0.368													12	7	---	---	---	---	
EIF3G	8666	broad.mit.edu	37	19	10229098	10229099	+	Intron	INS	-	G	G	rs34849604		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10229098_10229099insG	uc002mnd.2	-						EIF3G_uc010dxa.2_3'UTR	NM_003755	NP_003746	O75821	EIF3G_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex|nucleus|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			aaaaattagctggcgtggtggc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14991021	14991022	+	IGR	INS	-	AA	AA			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14991021_14991022insAA								OR7A10 (38332 upstream) : OR7A17 (218 downstream)																							AGGAAAATGACaaaaaaaaaaa	0.337													6	3	---	---	---	---	
ARRDC2	27106	broad.mit.edu	37	19	18111475	18111476	+	5'Flank	INS	-	GGAA	GGAA	rs141584055	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18111475_18111476insGGAA	uc002nhu.2	+							NM_001025604	NP_001020775	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 2											pancreas(1)	1						agaggaaggagggaaggaagga	0.223													4	3	---	---	---	---	
ZNF430	80264	broad.mit.edu	37	19	21239293	21239294	+	Intron	INS	-	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21239293_21239294insA	uc002npj.2	+						ZNF430_uc002npk.2_Intron	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						agactctgtctaaaaaaaaaaa	0.124													4	2	---	---	---	---	
DMRTC2	63946	broad.mit.edu	37	19	42352413	42352414	+	Intron	INS	-	A	A	rs79959130		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42352413_42352414insA	uc002ors.2	+						DMRTC2_uc002orr.1_Intron|DMRTC2_uc010xwe.1_Intron	NM_001040283	NP_001035373	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2						cell differentiation|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0						gactccatctcaaaaaaaaaaa	0.243													4	2	---	---	---	---	
C19orf63	284361	broad.mit.edu	37	19	50982161	50982177	+	Intron	DEL	GGGTTGAAGGGTGGGCG	-	-	rs140941718	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50982161_50982177delGGGTTGAAGGGTGGGCG	uc002psl.2	+						FAM71E1_uc002psg.2_5'Flank|FAM71E1_uc002psh.2_5'Flank|FAM71E1_uc002psi.2_5'Flank|C19orf63_uc002psj.2_Intron|C19orf63_uc002psk.2_Intron	NM_206538	NP_996261	Q5UCC4	INM02_HUMAN	hematopoietic signal peptide-containing isoform							extracellular region|integral to membrane					0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00733)|GBM - Glioblastoma multiforme(134;0.0252)		gccccTGCCTGGGTTGAAGGGTGGGCGGGGGAGGGGG	0.350													3	3	---	---	---	---	
TNNT1	7138	broad.mit.edu	37	19	55645049	55645049	+	Intron	DEL	A	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55645049delA	uc002qjb.3	-						TNNT1_uc002qiz.3_Intron|TNNT1_uc002qja.3_Intron|TNNT1_uc002qjc.3_Intron|TNNT1_uc002qje.3_Intron|TNNT1_uc002qjd.3_Intron	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a						muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		cagtctcaataaaaaaaaaaa	0.189													4	2	---	---	---	---	
C20orf26	26074	broad.mit.edu	37	20	20243445	20243446	+	Intron	DEL	TG	-	-	rs79559760	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243445_20243446delTG	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CACCTGTTTTTGTGTTTTTTTT	0.223													4	2	---	---	---	---	
ACSS1	84532	broad.mit.edu	37	20	25038626	25038633	+	Frame_Shift_Del	DEL	GCCGCCCT	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25038626_25038633delGCCGCCCT	uc002wub.2	-	1	984_991	c.106_113delAGGGCGGC	c.(106-114)AGGGCGGCCfs	p.R36fs	ACSS1_uc002wuc.2_Frame_Shift_Del_p.R36fs|ACSS1_uc010gdc.2_Frame_Shift_Del_p.R36fs	NM_032501	NP_115890	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	36_38					acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGGTCCCGAGGCCGCCCTGCGCGGCGCG	0.798													5	3	---	---	---	---	
DNMT3B	1789	broad.mit.edu	37	20	31387738	31387741	+	Intron	DEL	TAGT	-	-	rs145092112		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31387738_31387741delTAGT	uc002wyc.2	+						DNMT3B_uc010zty.1_Intron|DNMT3B_uc002wyd.2_Intron|DNMT3B_uc002wye.2_Intron|DNMT3B_uc010gee.2_Intron|DNMT3B_uc010gef.2_Intron|DNMT3B_uc010ztz.1_Intron|DNMT3B_uc010zua.1_Intron|DNMT3B_uc002wyf.2_Intron|DNMT3B_uc002wyg.2_Intron|DNMT3B_uc010geg.2_5'Flank|DNMT3B_uc010geh.2_5'Flank	NM_006892	NP_008823	Q9UBC3	DNM3B_HUMAN	DNA cytosine-5 methyltransferase 3 beta isoform						negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5						GGAGATAAACTAGTTAACAACTAC	0.363													4	5	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32376885	32376885	+	Intron	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32376885delT	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron|ZNF341_uc002wzz.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						AGGCCTCTCCttttttttttt	0.328													13	6	---	---	---	---	
TGIF2	60436	broad.mit.edu	37	20	35218943	35218962	+	Intron	DEL	AGACATAGTAAGTGCTTCAT	-	-	rs151000021		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35218943_35218962delAGACATAGTAAGTGCTTCAT	uc002xfn.2	+						C20orf24_uc002xfo.2_Intron	NM_021809	NP_068581	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)|skin(1)	2	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				TGGGGTCCTGAGACATAGTAAGTGCTTCATAGCTGtttgt	0.182													4	2	---	---	---	---	
CHRNA4	1137	broad.mit.edu	37	20	61991236	61991237	+	Intron	INS	-	GC	GC	rs142257166	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61991236_61991237insGC	uc002yes.2	-						CHRNA4_uc002yet.1_Intron|CHRNA4_uc011aaw.1_Intron|CHRNA4_uc010gke.1_5'Flank|CHRNA4_uc002yev.1_Intron|CHRNA4_uc010gkf.1_Intron	NM_000744	NP_000735	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 subunit						B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)	tgtgtgtgtgtgccgggcgtgt	0.485													6	4	---	---	---	---	
PRPF6	24148	broad.mit.edu	37	20	62626968	62626969	+	Intron	INS	-	T	T	rs113295997		TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62626968_62626969insT	uc002yho.2	+						PRPF6_uc002yhp.2_Intron	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					tctccttctccttttttttttt	0.099													5	3	---	---	---	---	
C21orf91	54149	broad.mit.edu	37	21	19167321	19167322	+	Intron	INS	-	A	A			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19167321_19167322insA	uc002yko.3	-						C21orf91_uc002ykm.2_5'Flank|C21orf91_uc002ykn.2_5'Flank|C21orf91_uc002ykq.3_Intron|C21orf91_uc002ykp.3_Intron	NM_001100420	NP_001093890	Q9NYK6	EURL_HUMAN	early undifferentiated retina and lens isoform											ovary(1)	1				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		gattctgtcgcaaaaaaaaaaa	0.139													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	30274390	30274390	+	IGR	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30274390delT								N6AMT1 (16697 upstream) : RNF160 (26076 downstream)																							ttttttttccttttttttttt	0.184													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499414	40499415	+	IGR	INS	-	T	T	rs147438953	by1000genomes	TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499414_40499415insT								ETS2 (302538 upstream) : PSMG1 (47975 downstream)																							Ttttttttttgttttgttttgt	0.307													3	3	---	---	---	---	
CYTSA	23384	broad.mit.edu	37	22	24761815	24761815	+	Intron	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24761815delT	uc002zzw.2	+						CYTSA_uc002zzv.3_Intron|CYTSA_uc011ajq.1_Intron	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A						cell cycle|cell division						0						CAGCTGTATCTTTTTTTTTTT	0.343													7	4	---	---	---	---	
CD99	4267	broad.mit.edu	37	X	2658620	2658621	+	Intron	INS	-	T	T			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2658620_2658621insT	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						TGCAGCATCCATTTTTTTTAAT	0.366													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	24447607	24447607	+	IGR	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24447607delT								FAM48B1 (64067 upstream) : PDK3 (35737 downstream)																							attaaacctcttttttttTTT	0.164													7	5	---	---	---	---	
MED12	9968	broad.mit.edu	37	X	70353187	70353187	+	Intron	DEL	T	-	-			TCGA-AS-3778-01A-01D-0966-08	TCGA-AS-3778-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70353187delT	uc004dyy.2	+						MED12_uc011mpq.1_Intron|MED12_uc004dyz.2_Intron|MED12_uc004dza.2_Intron|MED12_uc010nla.2_Intron	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12						androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					TCTTGAAGGGttttttttttt	0.269													4	3	---	---	---	---	
