Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TEKT2	27285	broad.mit.edu	37	1	36553613	36553613	+	Silent	SNP	G	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36553613G>T	uc001bzr.2	+	10	1246	c.1119G>T	c.(1117-1119)CTG>CTT	p.L373L	TEKT2_uc001bzs.2_Silent_p.L279L|ADPRHL2_uc001bzt.2_5'Flank|ADPRHL2_uc001bzu.2_5'Flank	NM_014466	NP_055281	Q9UIF3	TEKT2_HUMAN	tektin 2	373	Potential.				cell projection organization|microtubule cytoskeleton organization	actin cytoskeleton|cilium axoneme|flagellar axoneme|focal adhesion|microtubule|nucleolus					0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGGCCCGGCTGCAGGCTGACA	0.652													3	20	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152277134	152277134	+	Nonsense_Mutation	SNP	T	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152277134T>A	uc001ezu.1	-	3	10264	c.10228A>T	c.(10228-10230)AGA>TGA	p.R3410*		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3410	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATCCTTGTCTTCGTCCAGTG	0.602									Ichthyosis				20	294	---	---	---	---	PASS
CD34	947	broad.mit.edu	37	1	208062095	208062095	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208062095C>A	uc001hgw.1	-	7	1162	c.904G>T	c.(904-906)GCT>TCT	p.A302S	CD34_uc001hgv.1_Missense_Mutation_p.A144S|CD34_uc001hgx.1_Missense_Mutation_p.A302S|CD34_uc010psj.1_Missense_Mutation_p.A167S	NM_001025109	NP_001020280	P28906	CD34_HUMAN	CD34 antigen isoform a	302	Helical; (Potential).				cell-cell adhesion|leukocyte migration|regulation of immune response	integral to membrane	carbohydrate binding			ovary(1)	1						CCCAAGACAGCCAGCAGGGCT	0.552													42	406	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216405369	216405369	+	Silent	SNP	T	C	C	rs138484134	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216405369T>C	uc001hku.1	-	14	3306	c.2919A>G	c.(2917-2919)CAA>CAG	p.Q973Q	USH2A_uc001hkv.2_Silent_p.Q973Q	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	973	Extracellular (Potential).|Laminin EGF-like 9.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGAAGCATCTTGGCAAACAC	0.443										HNSCC(13;0.011)			21	224	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32754720	32754720	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32754720C>T	uc010ezu.2	+	60	12057	c.11923C>T	c.(11923-11925)CAG>TAG	p.Q3975*	MIR558_hsa-mir-558|MI0003564_5'Flank	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3975					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CATTTTAGGCCAGCCATTGCC	0.363													16	111	---	---	---	---	PASS
GPR45	11250	broad.mit.edu	37	2	105859407	105859407	+	Silent	SNP	G	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105859407G>A	uc002tco.1	+	1	1208	c.1092G>A	c.(1090-1092)GTG>GTA	p.V364V		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	364	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						CAGTCTACGTGTGCAATGAAA	0.597													7	102	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179395676	179395676	+	Silent	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179395676C>T	uc010zfg.1	-	307	98186	c.97962G>A	c.(97960-97962)AGG>AGA	p.R32654R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.R26349R|TTN_uc010zfi.1_Silent_p.R26282R|TTN_uc010zfj.1_Silent_p.R26157R|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33581							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCAGTTACCCTGGCCTTTT	0.483													33	303	---	---	---	---	PASS
AQP12A	375318	broad.mit.edu	37	2	241631447	241631447	+	Silent	SNP	G	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241631447G>C	uc002vzu.2	+	1	186	c.117G>C	c.(115-117)CGG>CGC	p.R39R	AQP12A_uc002vzv.2_Intron	NM_198998	NP_945349	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	39						integral to membrane	transporter activity				0		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		TCTTCGCCCGGGAGGCGGTGG	0.692													6	46	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191513	10191513	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191513T>C	uc003bvc.2	+	3	719	c.506T>C	c.(505-507)CTA>CCA	p.L169P	VHL_uc003bvd.2_Missense_Mutation_p.L128P	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	169					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L169P(5)|p.L169L(2)|p.S168fs*3(1)|p.L169_V170del(1)|p.L169*(1)|p.L169fs*33(1)|p.V170fs*31(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCCGGAGCCTAGTCAAGCCT	0.517		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				9	34	---	---	---	---	PASS
UBE2E2	7325	broad.mit.edu	37	3	23541185	23541185	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23541185T>C	uc003ccg.2	+	4	494	c.314T>C	c.(313-315)TTT>TCT	p.F105S	UBE2E2_uc010hfc.2_Intron	NM_152653	NP_689866	Q96LR5	UB2E2_HUMAN	ubiquitin-conjugating enzyme E2E 2	105					ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0						GGGGTGTTCTTTCTTGACATT	0.388													12	104	---	---	---	---	PASS
SUSD5	26032	broad.mit.edu	37	3	33194429	33194429	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33194429G>T	uc003cfo.1	-	5	2113	c.1695C>A	c.(1693-1695)GAC>GAA	p.D565E		NM_015551	NP_056366	O60279	SUSD5_HUMAN	sushi domain containing 5 precursor	565	Extracellular (Potential).				cell adhesion	integral to membrane	hyaluronic acid binding			ovary(1)|central_nervous_system(1)	2						CAGGACATCCGTCCCCCACAC	0.617													6	29	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47163945	47163945	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47163945G>T	uc003cqs.2	-	3	2234	c.2181C>A	c.(2179-2181)TGC>TGA	p.C727*	SETD2_uc003cqv.2_Nonsense_Mutation_p.C716*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	727					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTTTTTCTTTGCACCTACTAA	0.393			N|F|S|Mis		clear cell renal carcinoma								17	216	---	---	---	---	PASS
CCDC51	79714	broad.mit.edu	37	3	48475152	48475152	+	Silent	SNP	A	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48475152A>G	uc003csz.2	-	3	563	c.442T>C	c.(442-444)TTG>CTG	p.L148L	CCDC51_uc003cta.2_Silent_p.L39L|CCDC51_uc003ctb.2_Silent_p.L39L|CCDC51_uc003ctc.2_Silent_p.L148L|CCDC51_uc003ctd.2_Silent_p.L39L	NM_024661	NP_078937	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	148	Potential.					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GCCAGTTCCAAGTACTGACTG	0.602													10	89	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112357811	112357811	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112357811G>C	uc003dzf.2	-	2	1160	c.942C>G	c.(940-942)GAC>GAG	p.D314E	CCDC80_uc011bhv.1_Missense_Mutation_p.D314E|CCDC80_uc003dzg.2_Missense_Mutation_p.D314E|CCDC80_uc003dzh.1_Missense_Mutation_p.D314E	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	314										ovary(2)	2						CTCTCCTTGGGTCCTCTTTCT	0.617													9	97	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130300741	130300741	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130300741G>A	uc010htl.2	+	8	3915	c.3884G>A	c.(3883-3885)CGA>CAA	p.R1295Q	COL6A6_uc003eni.3_5'Flank	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1295	VWFA 7.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TCAGCTGCTCGAGGAAAGGTA	0.343													27	276	---	---	---	---	PASS
PYDC2	152138	broad.mit.edu	37	3	191178998	191178998	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191178998A>G	uc011bso.1	+	1	47	c.47A>G	c.(46-48)GAG>GGG	p.E16G		NM_001083308	NP_001076777	Q56P42	PYDC2_HUMAN	pyrin domain containing 2	16	DAPIN.					cytoplasm|nucleus					0						GCTCTTCTGGAGCAGCTCAGC	0.537													16	128	---	---	---	---	PASS
POLN	353497	broad.mit.edu	37	4	2073957	2073957	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2073957C>A	uc003ger.2	-	24	2587	c.2587G>T	c.(2587-2589)GGC>TGC	p.G863C	POLN_uc010icg.1_Missense_Mutation_p.G302C	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu	863					DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			GGCGGAGGGCCCCAGGCCTCC	0.697								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					5	30	---	---	---	---	PASS
C4orf41	60684	broad.mit.edu	37	4	184600619	184600619	+	Silent	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184600619T>C	uc003ivx.2	+	9	1121	c.945T>C	c.(943-945)CAT>CAC	p.H315H	C4orf41_uc003ivw.2_Silent_p.H315H|C4orf41_uc010isc.2_Intron	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	315											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		CTTTTGAGCATGATGCATGGA	0.353													13	128	---	---	---	---	PASS
IRX2	153572	broad.mit.edu	37	5	2748714	2748714	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2748714A>T	uc003jda.2	-	3	1350	c.1108T>A	c.(1108-1110)TCG>ACG	p.S370T	IRX2_uc003jdb.2_Missense_Mutation_p.S370T	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	370						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1				GBM - Glioblastoma multiforme(108;0.204)		GGGTAGGGCGAGCCTCCTGGC	0.502													4	21	---	---	---	---	PASS
PELO	53918	broad.mit.edu	37	5	52096856	52096856	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52096856C>G	uc003jos.2	+	2	1613	c.628C>G	c.(628-630)CCA>GCA	p.P210A	ITGA1_uc003jov.2_Intron|ITGA1_uc003jou.2_Intron|PELO_uc003jot.1_Intron	NM_015946	NP_057030	Q9BRX2	PELO_HUMAN	pelota homolog	210					cell cycle|cell division|translation	cytoplasm|nucleus	endonuclease activity|metal ion binding|protein binding				0		Lung NSC(810;4.94e-05)|Breast(144;0.0848)				GGTGGCCAGCCCAGGATTTGT	0.517													13	103	---	---	---	---	PASS
IL6ST	3572	broad.mit.edu	37	5	55247810	55247810	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55247810C>A	uc003jqq.2	-	13	1901	c.1646G>T	c.(1645-1647)GGA>GTA	p.G549V	IL6ST_uc010iwb.2_Missense_Mutation_p.G488V|IL6ST_uc010iwc.2_Intron|IL6ST_uc010iwd.2_Intron|IL6ST_uc011cqk.1_Missense_Mutation_p.G260V|IL6ST_uc003jqr.2_3'UTR|IL6ST_uc010iwe.1_5'Flank	NM_002184	NP_002175	P40189	IL6RB_HUMAN	interleukin 6 signal transducer isoform 1	549	Extracellular (Potential).|Fibronectin type-III 5.				interleukin-6-mediated signaling pathway|leukemia inhibitory factor signaling pathway|negative regulation of interleukin-6-mediated signaling pathway|positive regulation of anti-apoptosis|positive regulation of cardiac muscle hypertrophy|positive regulation of osteoblast differentiation|positive regulation of T cell proliferation|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation vascular endothelial growth factor production	ciliary neurotrophic factor receptor complex|extracellular region|extracellular space|interleukin-6 receptor complex|oncostatin-M receptor complex	ciliary neurotrophic factor receptor activity|ciliary neurotrophic factor receptor binding|growth factor binding|protein homodimerization activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TCTGATAAATCCATTCTGAAC	0.333			O		hepatocellular ca								8	67	---	---	---	---	PASS
TTC37	9652	broad.mit.edu	37	5	94803695	94803695	+	Splice_Site	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94803695T>C	uc003klb.2	-	42	4767	c.4497_splice	c.e42-1	p.R1499_splice		NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						CGTGTCTCTCTGGAAAAAAAA	0.368													7	77	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127782119	127782119	+	Intron	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127782119T>C	uc003kuu.2	-						FBN2_uc003kuv.2_Intron|FBN2_uc003kuw.3_Intron|FBN2_uc003kux.1_3'UTR	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGAAGTCCTGTTTTTCTTGCA	0.378													9	97	---	---	---	---	PASS
KLHL3	26249	broad.mit.edu	37	5	136974757	136974757	+	Silent	SNP	G	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136974757G>A	uc010jek.2	-	10	1548	c.1104C>T	c.(1102-1104)GAC>GAT	p.D368D	KLHL3_uc011cyc.1_Silent_p.D137D|KLHL3_uc003lbr.3_Silent_p.D286D|KLHL3_uc011cyd.1_Intron|KLHL3_uc010jel.1_Silent_p.D137D|KLHL3_uc010jem.1_Silent_p.D328D	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3	368	Kelch 2.					cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		CCTTCACGCCGTCATACACAT	0.607													5	25	---	---	---	---	PASS
C5orf25	375484	broad.mit.edu	37	5	175716594	175716594	+	Intron	SNP	G	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175716594G>A	uc003mdt.3	+						C5orf25_uc003mds.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Intron|uc003mdu.1_5'UTR	NM_198567	NP_940969	Q8NDZ2	CE025_HUMAN	hypothetical protein LOC375484												0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		TAAGACTTAAGTCATCTCAGA	0.373													3	12	---	---	---	---	PASS
C5orf25	375484	broad.mit.edu	37	5	175716597	175716597	+	Intron	SNP	A	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175716597A>G	uc003mdt.3	+						C5orf25_uc003mds.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Intron|uc003mdu.1_5'UTR	NM_198567	NP_940969	Q8NDZ2	CE025_HUMAN	hypothetical protein LOC375484												0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		GACTTAAGTCATCTCAGATAA	0.368													3	12	---	---	---	---	PASS
ZNF346	23567	broad.mit.edu	37	5	176471418	176471418	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176471418A>C	uc003mfi.2	+	4	444	c.401A>C	c.(400-402)CAG>CCG	p.Q134P	ZNF346_uc011dfr.1_Missense_Mutation_p.Q102P|ZNF346_uc011dfs.1_Intron|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Missense_Mutation_p.Q159P|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411	Q9UL40	ZN346_HUMAN	zinc finger protein 346	134	Matrin-type 2.					cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACAAGAACCAGTGCTGCCCC	0.383													11	192	---	---	---	---	PASS
AACSL	729522	broad.mit.edu	37	5	178194326	178194326	+	RNA	SNP	C	T	T	rs34080101	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178194326C>T	uc011dgk.1	-	6		c.665G>A			AACSL_uc011dgl.1_RNA|AACSL_uc003mjk.2_RNA	NR_024035				Homo sapiens acetoacetyl-CoA synthetase-like, mRNA (cDNA clone IMAGE:3945810), partial cds.												0						TTTATTGCCACTGAGCGTGTA	0.522													4	14	---	---	---	---	PASS
BAT4	7918	broad.mit.edu	37	6	31629995	31629995	+	3'UTR	SNP	G	A	A	rs1062309		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31629995G>A	uc003nvn.2	-	3					C6orf47_uc003nvm.1_5'Flank|BAT4_uc003nvo.3_3'UTR|BAT4_uc003nvp.3_3'UTR|BAT4_uc003nvq.2_3'UTR	NM_033177	NP_149417	O95872	GPAN1_HUMAN	HLA-B associated transcript 4							intracellular	nucleic acid binding				0						CAGGTCAGAGGCCCAAGTTCA	0.522													5	54	---	---	---	---	PASS
FAM83B	222584	broad.mit.edu	37	6	54791297	54791297	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54791297G>T	uc003pck.2	+	3	689	c.573G>T	c.(571-573)ATG>ATT	p.M191I		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	191										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					TTCTAAATATGACTGAGAAAC	0.343													13	173	---	---	---	---	PASS
CCR6	1235	broad.mit.edu	37	6	167550763	167550763	+	Missense_Mutation	SNP	G	A	A	rs113115632		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167550763G>A	uc003qvl.2	+	13	3521	c.1045G>A	c.(1045-1047)GCC>ACC	p.A349T	CCR6_uc010kkm.2_Missense_Mutation_p.A349T|CCR6_uc003qvn.3_Missense_Mutation_p.A349T|CCR6_uc003qvm.3_Missense_Mutation_p.A349T	NM_031409	NP_113597	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	349	Cytoplasmic (Potential).				cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|humoral immune response	integral to plasma membrane	C-C chemokine receptor activity			ovary(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		CTTCTCCTGTGCCGGGAGGTA	0.478													16	98	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2953040	2953040	+	Missense_Mutation	SNP	C	G	G	rs141751925	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2953040C>G	uc003smv.2	-	22	3304	c.2900G>C	c.(2899-2901)CGC>CCC	p.R967P		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	967					positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GTAGAAGGCGCGTACCAGGCT	0.677			Mis		DLBCL								10	69	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66499716	66499716	+	Missense_Mutation	SNP	A	G	G	rs141617852	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66499716A>G	uc004aee.1	+	1	526	c.526A>G	c.(526-528)AAT>GAT	p.N176D	LOC442421_uc004aed.1_RNA					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						CCTGGAGCCCAATCTGCTGGA	0.607													13	103	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101824283	101824283	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101824283C>A	uc004azb.1	+	37	3639	c.3433C>A	c.(3433-3435)CTG>ATG	p.L1145M		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	1145	Nonhelical region 10 (NC10).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GGATGACATGCTGCAGAAAGC	0.423													18	219	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101824284	101824284	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101824284T>A	uc004azb.1	+	37	3640	c.3434T>A	c.(3433-3435)CTG>CAG	p.L1145Q		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	1145	Nonhelical region 10 (NC10).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GATGACATGCTGCAGAAAGCG	0.418													18	219	---	---	---	---	PASS
IKBKAP	8518	broad.mit.edu	37	9	111674608	111674608	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111674608C>A	uc004bdm.3	-	11	1645	c.1125G>T	c.(1123-1125)TGG>TGT	p.W375C	IKBKAP_uc004bdl.2_Missense_Mutation_p.W26C|IKBKAP_uc011lwc.1_Missense_Mutation_p.W261C|IKBKAP_uc010mtq.2_Missense_Mutation_p.W26C	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	375					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						GGTCAGTCGTCCAGTGCCAAT	0.532													8	103	---	---	---	---	PASS
IKBKAP	8518	broad.mit.edu	37	9	111674609	111674609	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111674609C>A	uc004bdm.3	-	11	1644	c.1124G>T	c.(1123-1125)TGG>TTG	p.W375L	IKBKAP_uc004bdl.2_Missense_Mutation_p.W26L|IKBKAP_uc011lwc.1_Missense_Mutation_p.W261L|IKBKAP_uc010mtq.2_Missense_Mutation_p.W26L	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	375					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						GTCAGTCGTCCAGTGCCAATC	0.532													8	104	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113265449	113265449	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113265449C>A	uc010mtz.2	-	6	1689	c.1352G>T	c.(1351-1353)TGT>TTT	p.C451F	SVEP1_uc010mua.1_Missense_Mutation_p.C451F|SVEP1_uc004beu.2_Missense_Mutation_p.C451F	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	451	Sushi 2.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						CCTTGTAGAACAGCTGATGTG	0.388													15	154	---	---	---	---	PASS
CACNA1B	774	broad.mit.edu	37	9	141015984	141015984	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141015984G>A	uc004cog.2	+	46	6698	c.6553G>A	c.(6553-6555)GGT>AGT	p.G2185S	CACNA1B_uc004coi.2_Missense_Mutation_p.G1397S	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	2185	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	CCCCGGCCGCGGTGGGCGGAG	0.617													6	46	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30316404	30316404	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30316404C>A	uc001iux.2	-	2	2732	c.2673G>T	c.(2671-2673)GAG>GAT	p.E891D	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.E753D|KIAA1462_uc009xle.1_Missense_Mutation_p.E891D	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	891										ovary(4)	4						TCGGCTGTGGCTCAACCCTCA	0.612													8	89	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11964635	11964635	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11964635G>A	uc001mjq.1	+	21	3890	c.3127G>A	c.(3127-3129)GAA>AAA	p.E1043K	USP47_uc001mjr.2_Missense_Mutation_p.E955K|USP47_uc001mjs.2_Missense_Mutation_p.E1023K|USP47_uc001mjt.1_Missense_Mutation_p.E329K	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	1043					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		TGCTGCAGATGAAGGTTCTGG	0.373													15	116	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904779	55904779	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904779C>A	uc010riz.1	-	1	416	c.416G>T	c.(415-417)CGG>CTG	p.R139L		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					GAGGCAGAGCCGCCGAGACAC	0.473													15	136	---	---	---	---	PASS
GLYATL1	92292	broad.mit.edu	37	11	58723525	58723525	+	3'UTR	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58723525T>C	uc001nnf.2	+	8					uc001nng.1_Intron|GLYATL1_uc001nnh.1_3'UTR|GLYATL1_uc001nni.1_3'UTR|GLYATL1_uc001nnj.1_3'UTR			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;							mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	TAGTAATCTCTGCCAAGCCAT	0.308													14	70	---	---	---	---	PASS
MRGPRD	116512	broad.mit.edu	37	11	68748065	68748065	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68748065T>C	uc010rqf.1	-	1	391	c.391A>G	c.(391-393)ATC>GTC	p.I131V		NM_198923	NP_944605	Q8TDS7	MRGRD_HUMAN	MAS-related GPR, member D	131	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(1)	1			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TTGAACCAGATAGGGAAGAGG	0.582													4	42	---	---	---	---	PASS
OR8B8	26493	broad.mit.edu	37	11	124310503	124310503	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124310503G>T	uc010sal.1	-	1	479	c.479C>A	c.(478-480)ACA>AAA	p.T160K		NM_012378	NP_036510	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B,	160	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CATGCACGCTGTGTGGGCCAT	0.517													8	46	---	---	---	---	PASS
CLEC9A	283420	broad.mit.edu	37	12	10205346	10205346	+	Nonsense_Mutation	SNP	C	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10205346C>G	uc001qxa.2	+	4	673	c.60C>G	c.(58-60)TAC>TAG	p.Y20*		NM_207345	NP_997228	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	20	Cytoplasmic (Potential).				positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding			ovary(1)	1						CAGACACTTACCAGAAATGTC	0.408													7	102	---	---	---	---	PASS
CSAD	51380	broad.mit.edu	37	12	53566220	53566220	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53566220C>T	uc001sby.2	-	5	380	c.254G>A	c.(253-255)GGT>GAT	p.G85D	CSAD_uc001sbw.2_Intron|CSAD_uc009zmt.2_5'UTR|CSAD_uc010snx.1_Missense_Mutation_p.G112D|CSAD_uc001sbz.2_Missense_Mutation_p.G85D|CSAD_uc009zmu.2_Intron|CSAD_uc001sca.3_RNA|CSAD_uc010sny.1_Missense_Mutation_p.G85D	NM_015989	NP_057073	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	85					carboxylic acid metabolic process		pyridoxal phosphate binding|sulfinoalanine decarboxylase activity			ovary(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	CCGAGGGTGACCTGGAGAAGG	0.577									Hereditary_Prostate_Cancer				11	77	---	---	---	---	PASS
MMAB	326625	broad.mit.edu	37	12	110006594	110006594	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110006594C>T	uc001tou.2	-	3	344	c.271G>A	c.(271-273)GAA>AAA	p.E91K	MMAB_uc001tov.2_RNA|MMAB_uc001tow.2_RNA|MMAB_uc010sxq.1_5'UTR|MMAB_uc001tox.2_Intron	NM_052845	NP_443077	Q96EY8	MMAB_HUMAN	cob(I)alamin adenosyltransferase precursor	91					cobalamin biosynthetic process	mitochondrion	ATP binding|cob(I)yrinic acid a,c-diamide adenosyltransferase activity				0					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAACTTAATTCATCTGTAGTT	0.453													26	136	---	---	---	---	PASS
TM9SF1	10548	broad.mit.edu	37	14	24661324	24661324	+	Intron	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24661324T>C	uc001wnb.1	-						IPO4_uc001wmx.1_5'Flank|IPO4_uc001wmy.1_5'Flank|IPO4_uc010tnz.1_5'Flank|IPO4_uc001wmw.1_5'Flank|IPO4_uc001wmz.1_5'Flank|TM9SF1_uc010toa.1_Intron|TM9SF1_uc001wna.1_Intron|TM9SF1_uc010tob.1_Intron|TM9SF1_uc001wnc.2_Intron|TM9SF1_uc001wnd.2_3'UTR	NM_006405	NP_006396	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1 isoform a						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0183)		agccACAATGTGTTCTTCATT	0.269													16	131	---	---	---	---	PASS
C14orf181	400223	broad.mit.edu	37	14	69262441	69262441	+	3'UTR	SNP	A	G	G	rs3742887	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69262441A>G	uc001xkj.1	-	1					ZFP36L1_uc001xkh.1_5'Flank|ZFP36L1_uc001xki.1_5'Flank	NM_207442	NP_997325			hypothetical protein LOC400223												0				all cancers(60;0.002)|BRCA - Breast invasive adenocarcinoma(234;0.00204)|OV - Ovarian serous cystadenocarcinoma(108;0.0399)		CCCGCCGACCAAGGGTTTGTT	0.607													5	38	---	---	---	---	PASS
C14orf145	145508	broad.mit.edu	37	14	81297385	81297385	+	Intron	SNP	G	A	A	rs7156572	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81297385G>A	uc001xux.2	-						C14orf145_uc010asz.1_Intron|C14orf145_uc001xuz.2_Intron|C14orf145_uc001xuy.1_3'UTR	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		TGCTCACACTGGAGTTCATAA	0.274													4	41	---	---	---	---	PASS
NIPA1	123606	broad.mit.edu	37	15	23048907	23048907	+	Silent	SNP	C	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23048907C>G	uc001yvc.2	-	5	937	c.912G>C	c.(910-912)GGG>GGC	p.G304G	NIPA1_uc001yvd.2_Silent_p.G134G|NIPA1_uc001yve.2_Silent_p.G229G	NM_144599	NP_653200	Q7RTP0	NIPA1_HUMAN	non-imprinted in Prader-Willi/Angelman syndrome	304	Helical; (Potential).				cell death	early endosome|integral to membrane|plasma membrane					0		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		TAAGGACAATCCCCACGGAGA	0.507													20	88	---	---	---	---	PASS
RHOT2	89941	broad.mit.edu	37	16	720686	720686	+	Silent	SNP	G	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:720686G>A	uc002cip.2	+	9	619	c.552G>A	c.(550-552)GCG>GCA	p.A184A	RHOT2_uc002ciq.2_Silent_p.A77A|RHOT2_uc010bqy.2_5'Flank	NM_138769	NP_620124	Q8IXI1	MIRO2_HUMAN	ras homolog gene family, member T2	184	EF-hand 1.|Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			pancreas(1)	1		Hepatocellular(780;0.0218)				TGAGGCCCGCGTGCGCCCAGG	0.682													9	99	---	---	---	---	PASS
NPW	283869	broad.mit.edu	37	16	2070178	2070178	+	Silent	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2070178C>A	uc002coh.3	+	1	658	c.276C>A	c.(274-276)CCC>CCA	p.P92P		NM_001099456	NP_001092926	Q8N729	NPW_HUMAN	neuropeptide W preproprotein	92					feeding behavior|neuropeptide signaling pathway	extracellular region					0						TCCTGCTGCCCTCGTGGGTTC	0.612													4	23	---	---	---	---	PASS
ZNF668	79759	broad.mit.edu	37	16	31073518	31073518	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31073518C>T	uc010caf.2	-	3	1088	c.731G>A	c.(730-732)CGC>CAC	p.R244H	ZNF668_uc002eao.2_Missense_Mutation_p.R244H	NM_024706	NP_078982	Q96K58	ZN668_HUMAN	zinc finger protein 668	244	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(4)	4						CGCGTGGATGCGCTGGTGGCA	0.697													9	32	---	---	---	---	PASS
EDC4	23644	broad.mit.edu	37	16	67909957	67909957	+	Silent	SNP	T	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67909957T>A	uc002eur.2	+	2	358	c.192T>A	c.(190-192)ACT>ACA	p.T64T	EDC4_uc010cer.2_5'UTR|EDC4_uc010vkg.1_5'UTR|EDC4_uc010ces.1_5'Flank|EDC4_uc002eus.2_5'Flank	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	64					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CAAACAAGACTGGTCTTCGGA	0.537													26	183	---	---	---	---	PASS
LLGL1	3996	broad.mit.edu	37	17	18137246	18137246	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18137246C>T	uc002gsp.2	+	5	608	c.547C>T	c.(547-549)CGC>TGC	p.R183C		NM_004140	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1	183					cortical actin cytoskeleton organization|exocytosis|protein complex assembly	cortical actin cytoskeleton	protein kinase binding|structural molecule activity			breast(2)|skin(2)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)	6	all_neural(463;0.228)					CGAGGTTCTGCGCAGGTAAGA	0.642													9	76	---	---	---	---	PASS
C18orf34	374864	broad.mit.edu	37	18	30795588	30795588	+	Silent	SNP	T	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30795588T>A	uc002kxn.2	-	18	2146	c.2004A>T	c.(2002-2004)ATA>ATT	p.I668I	C18orf34_uc010dme.1_Silent_p.I182I|C18orf34_uc010xbr.1_Silent_p.I668I|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Silent_p.I630I|C18orf34_uc002kxp.2_Silent_p.I668I	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	668	Potential.									ovary(1)	1						TCAATTCATTTATTTTTGCAT	0.244													9	57	---	---	---	---	PASS
ISYNA1	51477	broad.mit.edu	37	19	18547305	18547305	+	Intron	SNP	T	A	A	rs4595905	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18547305T>A	uc002njd.1	-						ISYNA1_uc002nja.1_Intron|ISYNA1_uc002njb.1_Silent_p.S116S|ISYNA1_uc002njc.1_Intron|ISYNA1_uc010xqh.1_Intron|ISYNA1_uc002nje.1_Intron|ISYNA1_uc002njf.1_Intron	NM_016368	NP_057452	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1						inositol biosynthetic process|phospholipid biosynthetic process	cytoplasm	binding|inositol-3-phosphate synthase activity			ovary(1)|pancreas(1)	2						GGTTGGATGGTGAGGGTGTGG	0.597													8	107	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533022	41533022	+	Intron	SNP	G	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533022G>C	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CCTTTGAAGAGCCAGTCGAAG	0.662													4	35	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533038	41533038	+	Intron	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533038C>T	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CGAAGGTGGCCTGCTCGCCTC	0.667													4	37	---	---	---	---	PASS
IDH3B	3420	broad.mit.edu	37	20	2644813	2644813	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2644813G>A	uc002wgp.2	-	1	31	c.22C>T	c.(22-24)CGC>TGC	p.R8C	IDH3B_uc002wgq.2_Missense_Mutation_p.R8C|IDH3B_uc002wgr.2_5'UTR|IDH3B_uc010zpz.1_Missense_Mutation_p.R8C	NM_006899	NP_008830	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3, beta subunit isoform	8					isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	electron carrier activity|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	GTCAGCCAGCGGACTCCGCTC	0.647													4	21	---	---	---	---	PASS
PCNA	5111	broad.mit.edu	37	20	5099100	5099100	+	Intron	SNP	C	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5099100C>G	uc002wlp.2	-						PCNA_uc002wlq.2_Intron|PCNA_uc010zqs.1_3'UTR	NM_182649	NP_872590	P12004	PCNA_HUMAN	proliferating cell nuclear antigen						cell proliferation|DNA strand elongation involved in DNA replication|mismatch repair|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|positive regulation of deoxyribonuclease activity|regulation of DNA replication|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair|translesion synthesis	cytoplasm|DNA replication factor C complex|microtubule cytoskeleton|nuclear replication fork|nucleoplasm|PCNA complex|PCNA-p21 complex	dinucleotide insertion or deletion binding|DNA polymerase processivity factor activity|MutLalpha complex binding|purine-specific mismatch base pair DNA N-glycosylase activity			lung(1)	1						actgcttgagcccaggaatcc	0.015								DNA_polymerases_(catalytic_subunits)					2	7	---	---	---	---	PASS
DEFB119	245932	broad.mit.edu	37	20	29965014	29965014	+	3'UTR	SNP	T	C	C	rs709045	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29965014T>C	uc002wvt.2	-	2					DEFB119_uc002wvs.2_3'UTR	NM_153289	NP_695021	Q8N690	DB119_HUMAN	defensin, beta 119 isoform a precursor						defense response to bacterium	extracellular region					0	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CAGGTCTCTGTGCCCAGAGAG	0.483													10	141	---	---	---	---	PASS
ZNF280B	140883	broad.mit.edu	37	22	22842186	22842186	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22842186C>T	uc002zwc.1	-	4	2314	c.1538G>A	c.(1537-1539)GGA>GAA	p.G513E	LOC96610_uc011aim.1_Intron	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B	513					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		ATCCACTGATCCTGGCTGAAG	0.408													19	251	---	---	---	---	PASS
LIF	3976	broad.mit.edu	37	22	30639581	30639581	+	3'UTR	SNP	C	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30639581C>G	uc003agz.2	-	3					LIF_uc011aks.1_3'UTR|uc003aha.2_5'Flank	NM_002309	NP_002300	P15018	LIF_HUMAN	leukemia inhibitory factor (cholinergic						immune response|leukemia inhibitory factor signaling pathway|negative regulation of hormone secretion|positive regulation of cell proliferation|positive regulation of macrophage differentiation|positive regulation of MAPKKK cascade|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of metanephric nephron tubule epithelial cell differentiation		cytokine activity|growth factor activity|leukemia inhibitory factor receptor binding				0			Epithelial(10;0.171)			GGACAGGCCCCCACATCTGGA	0.617													12	72	---	---	---	---	PASS
RFPL2	10739	broad.mit.edu	37	22	32586632	32586632	+	3'UTR	SNP	C	T	T	rs136466	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32586632C>T	uc003amg.3	-	5					RFPL2_uc003ame.3_3'UTR|RFPL2_uc003amf.3_3'UTR|RFPL2_uc003amh.3_3'UTR	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2								zinc ion binding			skin(1)	1						AGATTAAGTACAATCAAGAAA	0.343													3	21	---	---	---	---	PASS
ARSF	416	broad.mit.edu	37	X	2990179	2990179	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2990179A>T	uc004cre.1	+	3	345	c.124A>T	c.(124-126)ATT>TTT	p.I42F	ARSF_uc004crf.1_Missense_Mutation_p.I42F	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	42						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGACCTGGGTATTGGAGATCT	0.507													56	203	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31187596	31187596	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31187596A>T	uc004dda.1	-	74	10761	c.10517T>A	c.(10516-10518)CTA>CAA	p.L3506Q	DMD_uc004dcq.1_Missense_Mutation_p.L777Q|DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Missense_Mutation_p.L1046Q|DMD_uc004dcu.1_Missense_Mutation_p.L1046Q|DMD_uc004dcv.1_Missense_Mutation_p.L1033Q|DMD_uc004dcw.2_Missense_Mutation_p.L2162Q|DMD_uc004dcx.2_Missense_Mutation_p.L2165Q|DMD_uc004dcz.2_Missense_Mutation_p.L3383Q|DMD_uc004dcy.1_Missense_Mutation_p.L3502Q|DMD_uc004ddb.1_Missense_Mutation_p.L3498Q|DMD_uc004dcm.1_Missense_Mutation_p.L438Q|DMD_uc004dcn.1_Missense_Mutation_p.L425Q|DMD_uc004dco.1_Missense_Mutation_p.L438Q|DMD_uc004dcp.1_Missense_Mutation_p.L425Q|DMD_uc011mkb.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	3506	Binds to SNTB1.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GATTCTCTCTAGCTCCCCTCT	0.468													8	41	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	40982835	40982835	+	5'UTR	SNP	C	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40982835C>A	uc004dfb.2	+	2					USP9X_uc004dfc.2_5'UTR	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						TTTCTCAAGACAACTACATAA	0.438													4	12	---	---	---	---	PASS
TAF9B	51616	broad.mit.edu	37	X	77387029	77387029	+	3'UTR	SNP	T	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77387029T>C	uc004eda.2	-	7						NM_015975	NP_057059	Q9HBM6	TAF9B_HUMAN	transcription associated factor 9B						negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding				0						TAAAACAAGATCTAGAATATT	0.308													31	80	---	---	---	---	PASS
NOX1	27035	broad.mit.edu	37	X	100117451	100117451	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100117451A>C	uc004egj.2	-	6	807	c.601T>G	c.(601-603)TTT>GTT	p.F201V	uc010nnf.2_Intron|NOX1_uc004egl.3_Missense_Mutation_p.F201V|NOX1_uc010nne.2_Missense_Mutation_p.F164V	NM_007052	NP_008983	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1 isoform long	201	Cytoplasmic (Potential).|Ferric oxidoreductase.				angiogenesis|cell migration|electron transport chain|FADH2 metabolic process|hydrogen peroxide metabolic process|inflammatory response|intracellular pH elevation|positive regulation of integrin biosynthetic process|positive regulation of smooth muscle cell proliferation|positive regulation vascular endothelial growth factor production|respiratory burst|response to pH|signal transduction|superoxide anion generation	cell junction|early endosome|invadopodium membrane|NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|Rac GTPase binding|superoxide-generating NADPH oxidase activity|voltage-gated proton channel activity			ovary(1)	1						AAGACTTCAAAATAACTCCTC	0.443													38	407	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107431882	107431882	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107431882G>T	uc004enw.3	-	21	1558	c.1455C>A	c.(1453-1455)GAC>GAA	p.D485E	COL4A6_uc004env.3_Missense_Mutation_p.D484E|COL4A6_uc011msn.1_Missense_Mutation_p.D484E|COL4A6_uc010npk.2_Missense_Mutation_p.D484E	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	485	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						GAACACCACCGTCACAAGCAC	0.498									Alport_syndrome_with_Diffuse_Leiomyomatosis				7	97	---	---	---	---	PASS
SLC25A5	292	broad.mit.edu	37	X	118605114	118605114	+	3'UTR	SNP	C	A	A	rs75063279	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118605114C>A	uc004erh.3	+	4					LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_5'Flank	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2						chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)	CTGTCAGTTTCTCAGTGGCAA	0.378													4	44	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128721003	128721003	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128721003C>T	uc004euq.2	+	20	2329	c.2164C>T	c.(2164-2166)CCT>TCT	p.P722S	OCRL_uc004eur.2_Missense_Mutation_p.P714S|OCRL_uc010nrb.2_5'Flank	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	722	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						GCAAATGGTTCCTTTGGATGA	0.423													39	559	---	---	---	---	PASS
PRAMEF9	343070	broad.mit.edu	37	1	13645585	13645586	+	Intron	INS	-	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13645585_13645586insA	uc001ava.1	+							NM_001010890	NP_001010890	Q5VWM5	PRAM9_HUMAN	PRAME family member 9												0	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		gacttggtctcaaaaaaaaaaa	0.208													4	3	---	---	---	---	
SGIP1	84251	broad.mit.edu	37	1	67160938	67160939	+	Intron	INS	-	A	A	rs5774833		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67160938_67160939insA	uc001dcr.2	+						SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Intron|SGIP1_uc001dcu.2_5'UTR	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting						positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TTTCCTGAACTAAAAAAAAAAA	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	90776663	90776664	+	IGR	INS	-	T	T	rs149151862		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90776663_90776664insT								ZNF326 (282569 upstream) : BARHL2 (400916 downstream)																							atctttctttcttttttttttt	0.000													4	4	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120612224	120612226	+	5'UTR	DEL	GCC	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612224_120612226delGCC	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGCCGCCTCAGCCGCCGCCCGAA	0.695			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	2	---	---	---	---	
BAT2L2	23215	broad.mit.edu	37	1	171519129	171519129	+	Intron	DEL	T	-	-	rs67131565		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171519129delT	uc010pmg.1	+						BAT2L2_uc010pmh.1_Intron	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2								protein C-terminus binding				0						CTTTGGCTAGTTTTTTTTTTT	0.299													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34041837	34041838	+	IGR	INS	-	CCTCC	CCTCC	rs141683394	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34041837_34041838insCCTCC								MYADML (88553 upstream) : None (None downstream)																							tcttctcttctcctcccctccc	0.000													8	5	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37284748	37284748	+	Intron	DEL	A	-	-	rs11317436		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37284748delA	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				TCTCTTCTTTAAAAAAAATCT	0.244													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91764886	91764893	+	IGR	DEL	TATGTGTG	-	-	rs4005074		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764886_91764893delTATGTGTG								None (None upstream) : LOC654342 (40299 downstream)																							gatgtacgtatatgtgtgtgtgtgtgtg	0.000													5	3	---	---	---	---	
IL1B	3553	broad.mit.edu	37	2	113596315	113596316	+	5'Flank	INS	-	TC	TC			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113596315_113596316insTC	uc002tii.1	-							NM_000576	NP_000567	P01584	IL1B_HUMAN	interleukin 1, beta proprotein						activation of MAPK activity|anti-apoptosis|apoptosis|cell-cell signaling|cellular response to drug|cellular response to mechanical stimulus|cytokine-mediated signaling pathway|embryo implantation|fever generation|negative regulation of adiponectin secretion|negative regulation of cell proliferation|negative regulation of glucose transport|negative regulation of insulin receptor signaling pathway|negative regulation of lipid catabolic process|negative regulation of MAP kinase activity|positive regulation of angiogenesis|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of cell adhesion molecule production|positive regulation of cell division|positive regulation of fever generation|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of heterotypic cell-cell adhesion|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of interferon-gamma production|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of lipid catabolic process|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mitosis|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myosin light chain kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|positive regulation of protein export from nucleus|positive regulation of T cell proliferation|positive regulation vascular endothelial growth factor production|regulation of insulin secretion|sequestering of triglyceride|smooth muscle adaptation	cytosol|extracellular space	cytokine activity|growth factor activity|interleukin-1 receptor binding|protein domain specific binding			lung(3)|breast(1)	4					Anakinra(DB00026)|Minocycline(DB01017)|Procaterol(DB01366)	tttctttctttctttctttctt	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	190155444	190155445	+	IGR	DEL	AC	-	-	rs71948287		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190155444_190155445delAC								COL5A2 (110839 upstream) : WDR75 (150714 downstream)																							ttttgttAATacacacacacac	0.094													4	2	---	---	---	---	
PRSS45	377047	broad.mit.edu	37	3	46783664	46783665	+	3'UTR	INS	-	CCAAGG	CCAAGG	rs139246885	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46783664_46783665insCCAAGG	uc010hjl.2	-	4					PRSS45_uc011bam.1_RNA	NM_199183	NP_954652	Q7RTY3	PRS45_HUMAN	testis serine protease 5						proteolysis		serine-type endopeptidase activity				0						CTCCTGCTCACCCAAGGCCTAG	0.515													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75449683	75449718	+	IGR	DEL	CCTTCCTTCCTTCCTTTCTTCCTTCCTTCCTTTCTT	-	-	rs72135851	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75449683_75449718delCCTTCCTTCCTTCCTTTCTTCCTTCCTTCCTTTCTT								CNTN3 (879340 upstream) : FAM86D (20987 downstream)																							tttccttttcccttccttccttcctttcttccttccttcctttcttccttccttcc	0.000													5	5	---	---	---	---	
GBE1	2632	broad.mit.edu	37	3	81541828	81541829	+	Intron	INS	-	TTCTCCCT	TTCTCCCT	rs149554537	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541828_81541829insTTCTCCCT	uc003dqg.2	-							NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		cccttctcccattctccctttc	0.045									Glycogen_Storage_Disease_type_IV				5	5	---	---	---	---	
ZPLD1	131368	broad.mit.edu	37	3	102171604	102171608	+	Intron	DEL	TACTT	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102171604_102171608delTACTT	uc003dvs.1	+						ZPLD1_uc003dvt.1_Intron|ZPLD1_uc011bhg.1_Intron	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						TTTTCTTGTCTACTTTACTTAATAG	0.317													3	4	---	---	---	---	
ALDH1L1	10840	broad.mit.edu	37	3	125878066	125878067	+	Intron	DEL	CA	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125878066_125878067delCA	uc003eim.1	-						ALDH1L1_uc010hse.1_Intron|ALDH1L1_uc011bki.1_Intron|ALDH1L1_uc003eio.2_5'Flank|ALDH1L1_uc010hsf.1_Intron|ALDH1L1_uc003eip.1_5'Flank|ALDH1L1_uc011bkj.1_Intron	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	cacatgcgtgcacacacacaca	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148999032	148999033	+	IGR	INS	-	GAA	GAA	rs149952686	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148999032_148999033insGAA								CP (59200 upstream) : TM4SF18 (39823 downstream)																							GGGAAGACACTGAACAGtaaga	0.243													4	4	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160958626	160958626	+	Intron	DEL	T	-	-	rs141601797		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160958626delT	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			tcagccAGGATTTTTTTTTTT	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	5550718	5550721	+	IGR	DEL	TCCC	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5550718_5550721delTCCC								C4orf6 (21193 upstream) : EVC2 (13433 downstream)																							ctttcttccgtccctccctccctc	0.157													7	4	---	---	---	---	
DAPP1	27071	broad.mit.edu	37	4	100787921	100787923	+	Intron	DEL	CTA	-	-	rs11315402		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100787921_100787923delCTA	uc003hvf.3	+						DAPP1_uc010ilh.2_Intron	NM_014395	NP_055210	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		TTCTttttttctatttttttttt	0.148													8	4	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21344713	21344713	+	Intron	DEL	T	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21344713delT	uc011cnn.1	+											Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						ccttccttcctttccttcctt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	74436059	74436060	+	IGR	INS	-	GAAG	GAAG	rs146909283	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74436059_74436060insGAAG								GCNT4 (109335 upstream) : ANKRD31 (7002 downstream)																							aaagaaagaaagaaggaaggaa	0.000													4	4	---	---	---	---	
HIST1H2BM	8342	broad.mit.edu	37	6	27781951	27781952	+	5'Flank	INS	-	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27781951_27781952insG	uc003njo.2	+							NM_003521	NP_003512	Q99879	H2B1M_HUMAN	histone cluster 1, H2bm						nucleosome assembly	nucleosome|nucleus	DNA binding			large_intestine(1)	1						ATTaagaaaaaaaaaaaaaaaa	0.243													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	50864684	50864687	+	IGR	DEL	CTTC	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50864684_50864687delCTTC								TFAP2B (49359 upstream) : PKHD1 (615458 downstream)																							tccttcctttcttccttccttcct	0.025													9	6	---	---	---	---	
KHDRBS2	202559	broad.mit.edu	37	6	62604848	62604849	+	Intron	INS	-	TC	TC			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62604848_62604849insTC	uc003peg.2	-							NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		AAATACAAATTTCTCTCTCTCT	0.322													8	6	---	---	---	---	
C6orf204	387119	broad.mit.edu	37	6	118801233	118801234	+	Intron	DEL	CA	-	-	rs143503840		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118801233_118801234delCA	uc003pxz.1	-							NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		TGATTTGGGTCACACACGTATA	0.252													4	2	---	---	---	---	
USP42	84132	broad.mit.edu	37	7	6175634	6175635	+	Intron	DEL	TT	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6175634_6175635delTT	uc011jwo.1	+						USP42_uc011jwn.1_Intron|USP42_uc010kth.1_Intron|USP42_uc011jwp.1_Intron|USP42_uc011jwq.1_Intron|USP42_uc011jwr.1_Intron	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42						cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CTAGTTATACtttttttttttt	0.153													6	3	---	---	---	---	
HIBADH	11112	broad.mit.edu	37	7	27672200	27672200	+	Intron	DEL	A	-	-	rs143191859		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27672200delA	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron|HIBADH_uc003szi.2_Intron	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)	GCAAATGACCAAAAAAAAAAA	0.313													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	73681291	73681292	+	IGR	DEL	TG	-	-	rs111645563		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73681291_73681292delTG								RFC2 (12553 upstream) : CLIP2 (22513 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.153													4	2	---	---	---	---	
CPA5	93979	broad.mit.edu	37	7	129989560	129989592	+	Intron	DEL	CAAAAATTAAAAATTACAAAAAAACCTGTATCC	-	-	rs11272432	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129989560_129989592delCAAAAATTAAAAATTACAAAAAAACCTGTATCC	uc010lmd.1	+						CPA5_uc003vps.2_Intron|CPA5_uc003vpt.2_Intron|CPA5_uc010lme.1_Intron|CPA5_uc003vpu.1_Intron	NM_001127441	NP_001120913	Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5 isoform 1						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)					tacgtacccacaaaaattaaaaattacaaaaaaacctgtatcccaaatctgtt	0.017													6	4	---	---	---	---	
GALNT11	63917	broad.mit.edu	37	7	151800067	151800067	+	Intron	DEL	A	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151800067delA	uc010lqg.1	+						GALNT11_uc011kvm.1_Intron|GALNT11_uc003wku.2_Intron|GALNT11_uc003wkv.1_Intron|GALNT11_uc011kvn.1_Intron	NM_022087	NP_071370	Q8NCW6	GLT11_HUMAN	N-acetylgalactosaminyltransferase 11							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		actccgtctcaaaaaaaaaaa	0.194													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6981232	6981234	+	IGR	DEL	AAC	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6981232_6981234delAAC								DEFA5 (66973 upstream) : LOC349196 (136908 downstream)																							ACAAACAAGAAACAACAATGAAA	0.202													4	2	---	---	---	---	
FAM49B	51571	broad.mit.edu	37	8	130867637	130867637	+	Intron	DEL	A	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130867637delA	uc003yss.2	-						FAM49B_uc003yst.2_Intron|FAM49B_uc003ysu.2_Intron|FAM49B_uc003ysv.2_Intron|FAM49B_uc003ysw.2_Intron|FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			gctctgcctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	65762390	65762391	+	IGR	DEL	AA	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:65762390_65762391delAA								FAM74A4 (268004 upstream) : LOC442421 (734079 downstream)																							ggaaggaaggaaaaaaaaaaaa	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68728773	68728775	+	Intron	DEL	ATG	-	-	rs62554276		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68728773_68728775delATG	uc004aez.1	+						uc004afa.1_Intron|uc010mnp.1_Intron					Homo sapiens cDNA, FLJ18209.																		TTTCAATCTTATGATATTTTTTT	0.202													4	4	---	---	---	---	
MED27	9442	broad.mit.edu	37	9	134953129	134953129	+	Intron	DEL	A	-	-	rs76460072		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134953129delA	uc004cbe.1	-						MED27_uc004cbf.1_Intron|MED27_uc011mco.1_Intron|MED27_uc004cbg.3_Intron	NM_004269	NP_004260	Q6P2C8	MED27_HUMAN	mediator complex subunit 27						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		TGGGACACTTAAAAAAAAAAA	0.368													4	2	---	---	---	---	
ARID5B	84159	broad.mit.edu	37	10	63661716	63661717	+	Intron	INS	-	G	G	rs147126849	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63661716_63661717insG	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)					GTAGAAGTGGCGGTGGGGGGCC	0.396													9	5	---	---	---	---	
COPB1	1315	broad.mit.edu	37	11	14512339	14512339	+	Intron	DEL	T	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14512339delT	uc001mli.2	-						COPB1_uc001mlg.2_Intron|COPB1_uc001mlh.2_Intron	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						ATACttttgcttttttttttt	0.119													4	2	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99072082	99072082	+	Intron	DEL	T	-	-	rs151051937	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99072082delT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		cttcctttcctttccttcctt	0.000													4	3	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99072082	99072083	+	Intron	INS	-	TCC	TCC	rs151051937	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99072082_99072083insTCC	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		cttcctttcctttccttccttc	0.000													4	3	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42693022	42693024	+	Intron	DEL	AAG	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42693022_42693024delAAG	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		aaaaaagaaaaagaaggaaggaa	0.000													5	6	---	---	---	---	
SOAT2	8435	broad.mit.edu	37	12	53514402	53514403	+	Intron	INS	-	A	A	rs35658019		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53514402_53514403insA	uc001sbv.2	+						SOAT2_uc009zms.2_Intron	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						cagcctgtctcaaaaaaaaaaa	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124719639	124719641	+	IGR	DEL	CCT	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124719639_124719641delCCT								ZNF664 (219672 upstream) : FAM101A (54069 downstream)																							accaccatcacctccatcatcac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	66497767	66497767	+	IGR	DEL	A	-	-	rs36178381		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66497767delA								None (None upstream) : PCDH9 (379200 downstream)																							tctgtcaaagaaaaaaaaaaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112850045	112850048	+	IGR	DEL	CCCC	-	-	rs112803567		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850045_112850048delCCCC								SOX1 (124025 upstream) : C13orf28 (180621 downstream)																							tctttcctttcccccttcctccct	0.020													3	4	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79694131	79694138	+	Intron	DEL	TCCTCCCT	-	-	rs61995409		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79694131_79694138delTCCTCCCT	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		cttccttccctcctcccttcctcccttc	0.048													2	4	---	---	---	---	
SMEK1	55671	broad.mit.edu	37	14	91931475	91931475	+	Intron	DEL	T	-	-	rs35820513		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91931475delT	uc001xzn.2	-						SMEK1_uc001xzm.2_Intron|SMEK1_uc001xzo.2_Intron|SMEK1_uc010atz.2_Intron|SMEK1_uc001xzp.1_Intron	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1							microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		CTTTTAGTACTTTTTTTTTTT	0.244													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480465	98480470	+	IGR	DEL	TCTTTC	-	-	rs72290183		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480465_98480470delTCTTTC								C14orf64 (36004 upstream) : C14orf177 (697480 downstream)																							ttccttcctttctttctctttctttc	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98483367	98483367	+	IGR	DEL	A	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98483367delA								C14orf64 (38906 upstream) : C14orf177 (694583 downstream)																							agagagagagaaggaaggaag	0.015													4	2	---	---	---	---	
SMAD6	4091	broad.mit.edu	37	15	67073877	67073878	+	3'UTR	INS	-	G	G			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67073877_67073878insG	uc002aqf.2	+	4					SMAD6_uc010bhx.2_RNA|SMAD6_uc002aqg.2_3'UTR	NM_005585	NP_005576	O43541	SMAD6_HUMAN	SMAD family member 6 isoform 1						BMP signaling pathway|immune response|negative regulation of apoptosis|negative regulation of BMP signaling pathway|negative regulation of caspase activity|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of SMAD protein complex assembly|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of S phase of mitotic cell cycle|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	cytosol|transcription factor complex	co-SMAD binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I activin receptor binding|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			skin(1)	1						CAGATAGTGGCGGCCCCGGCGG	0.708													9	7	---	---	---	---	
ATF7IP2	80063	broad.mit.edu	37	16	10532277	10532277	+	Intron	DEL	T	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10532277delT	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						aatttttgggttttttttttt	0.000													4	3	---	---	---	---	
CDH8	1006	broad.mit.edu	37	16	61689778	61689778	+	Intron	DEL	T	-	-	rs66728481		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61689778delT	uc002eog.1	-							NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GTCTCCGCACttttttttttt	0.224													4	2	---	---	---	---	
TNFSF12-TNFSF13	407977	broad.mit.edu	37	17	7451454	7451455	+	5'Flank	INS	-	TCCTTCCTTCCT	TCCTTCCTTCCT			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7451454_7451455insTCCTTCCTTCCT	uc002ghi.1	+						TNFSF12_uc002ghg.2_5'Flank|TNFSF12_uc002ghh.2_5'Flank	NM_172089	NP_742086	Q8IZK7	Q8IZK7_HUMAN	TNFSF12-TNFSF13 protein						immune response	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0		Prostate(122;0.157)				gccAATTTTGGtccttccttcc	0.010													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	30424185	30424189	+	IGR	DEL	CTTTC	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30424185_30424189delCTTTC								LRRC37B (43668 upstream) : RHOT1 (45284 downstream)																							Attttcttttctttctttttttttt	0.132													4	2	---	---	---	---	
B4GALNT2	124872	broad.mit.edu	37	17	47218385	47218386	+	Intron	INS	-	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47218385_47218386insT	uc002ion.2	+						B4GALNT2_uc010wlt.1_Intron|B4GALNT2_uc010wlu.1_Intron	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2						lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)			agcctctaaccttttttttttt	0.074													3	3	---	---	---	---	
AATK	9625	broad.mit.edu	37	17	79115754	79115761	+	Intron	DEL	TTCCTTCC	-	-	rs72270675		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79115754_79115761delTTCCTTCC	uc010dia.2	-							NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase							integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			cttccttcctttccttccttccttcctt	0.053													5	3	---	---	---	---	
FSCN2	25794	broad.mit.edu	37	17	79498342	79498344	+	Intron	DEL	TGA	-	-	rs142557936	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79498342_79498344delTGA	uc010wup.1	+						FSCN2_uc010wuo.1_Intron	NM_012418	NP_036550	O14926	FSCN2_HUMAN	fascin 2 isoform 1						actin filament bundle assembly|anatomical structure morphogenesis|visual perception	actin cytoskeleton|cytoplasm|stereocilium	actin filament binding|protein binding, bridging				0	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			gtggtggtggtgatgatggtggt	0.000													4	2	---	---	---	---	
PNPLA6	10908	broad.mit.edu	37	19	7623621	7623622	+	Intron	INS	-	TCTC	TCTC	rs147968677	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7623621_7623622insTCTC	uc010xjq.1	+						PNPLA6_uc002mgq.1_Intron|PNPLA6_uc010xjp.1_Intron|PNPLA6_uc002mgr.1_Intron|PNPLA6_uc002mgs.2_Intron|PNPLA6_uc002mgt.1_Intron	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b						cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						TGTGTGGGTATTCTCTCTTTTT	0.515													4	2	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8188250	8188250	+	Intron	DEL	G	-	-	rs10419582	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8188250delG	uc002mjf.2	-							NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						aaaaaaaaaagaagaagaaaa	0.239													6	3	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14762192	14762192	+	Intron	DEL	A	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14762192delA	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						tgctgcctctaaaaaaaaaaT	0.025													4	2	---	---	---	---	
NCAN	1463	broad.mit.edu	37	19	19348850	19348851	+	Intron	INS	-	A	A			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19348850_19348851insA	uc002nlz.2	+						NCAN_uc010ecc.1_Intron|NCAN_uc002nma.2_5'Flank	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor						axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			agaccctgtccaaaaaaaaaag	0.238													4	2	---	---	---	---	
ZNF626	199777	broad.mit.edu	37	19	20806648	20806649	+	3'UTR	DEL	CA	-	-	rs71893877		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20806648_20806649delCA	uc002npb.1	-	4					ZNF626_uc002npc.1_3'UTR	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TATGCTTTGCCACATTCTTCAC	0.203													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107427	42107428	+	IGR	INS	-	CA	CA	rs71928647		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107427_42107428insCA								CEACAM21 (14231 upstream) : CEACAM4 (17916 downstream)																							gcgcgcgcgcgcacacacacac	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54843564	54843565	+	IGR	INS	-	C	C	rs144647366	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54843564_54843565insC								LILRA5 (19155 upstream) : LILRA4 (1128 downstream)																							CGGCTGCTCCTCCCCAGGCTGC	0.723													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61398985	61398985	+	IGR	DEL	A	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61398985delA								NTSR1 (4863 upstream) : C20orf20 (28820 downstream)																							agaaagaaagaaagaaagaaa	0.035													4	2	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36708400	36708401	+	Intron	INS	-	A	A	rs143290016	by1000genomes	TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36708400_36708401insA	uc003apg.2	-						MYH9_uc003aph.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						CCAGGAGAAGCAAAGCACTGTT	0.574			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				4	2	---	---	---	---	
ARHGEF9	23229	broad.mit.edu	37	X	62864048	62864048	+	Intron	DEL	A	-	-			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62864048delA	uc004dvl.2	-						ARHGEF9_uc004dvj.1_Intron|ARHGEF9_uc004dvk.1_Intron|ARHGEF9_uc011mos.1_Intron|ARHGEF9_uc004dvm.1_Intron|ARHGEF9_uc011mot.1_Intron|ARHGEF9_uc004dvn.2_Intron	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9						apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						cttgaaatacaaaaaaaaaaa	0.015													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	83996003	83996004	+	IGR	INS	-	T	T			TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83996003_83996004insT								HDX (238545 upstream) : UBE2DNL (193153 downstream)																							aggccagtatgttttttttttt	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	152871884	152871904	+	IGR	DEL	GTAAAGGGATTTTGTTCACCA	-	-	rs139494223		TCGA-B0-5081-01A-01D-1462-08	TCGA-B0-5081-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152871884_152871904delGTAAAGGGATTTTGTTCACCA								FAM58A (7252 upstream) : DUSP9 (35993 downstream)																							ttaaaattaggtaaagggatttTGTTCACCAGTAAAGGGAT	0.271													4	2	---	---	---	---	
