Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PDE4DIP	9659	broad.mit.edu	37	1	145039633	145039633	+	5'UTR	SNP	C	T	T	rs2762750		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145039633C>T	uc001elx.3	-	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_5'UTR|PDE4DIP_uc001eln.3_5'UTR|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCCTTAGTCTCAGGACGCTCC	0.597			T	PDGFRB	MPD								8	31	---	---	---	---	PASS
POLR3GL	84265	broad.mit.edu	37	1	145456635	145456635	+	3'UTR	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145456635C>T	uc001enp.1	-	8					NBPF10_uc001emp.3_Intron	NM_032305	NP_115681	Q9BT43	RPC7L_HUMAN	polymerase (RNA) III (DNA directed) polypeptide												0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CAGAGTCCTTCTTCAGTATAT	0.383													74	241	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160287116	160287116	+	Intron	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160287116G>T	uc009wti.2	-						COPA_uc001fvv.3_Intron|COPA_uc009wtj.1_Intron|SUMO1P3_uc001fvw.2_RNA	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform						COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGAAGGATTTGTAAACCCCGG	0.458													3	47	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186056587	186056587	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186056587T>G	uc001grq.1	+	60	9402	c.9173T>G	c.(9172-9174)ATT>AGT	p.I3058S		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3058	Ig-like C2-type 29.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CCCCCAAGCATTAAAGACCAT	0.383													32	79	---	---	---	---	PASS
NAV1	89796	broad.mit.edu	37	1	201779747	201779747	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201779747G>A	uc001gwu.2	+	23	4996	c.4649G>A	c.(4648-4650)CGC>CAC	p.R1550H	NAV1_uc001gwx.2_Missense_Mutation_p.R1159H	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1553					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						AAGCACCGGCGCCTCGTCCTC	0.627													8	21	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214705793	214705793	+	Intron	SNP	A	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214705793A>G	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|PTPN14_uc001hkl.1_RNA	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CTGAAAGACCACCTGGCCTCC	0.622													3	40	---	---	---	---	PASS
PARP1	142	broad.mit.edu	37	1	226551746	226551746	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226551746A>G	uc001hqd.3	-	20	2855	c.2684T>C	c.(2683-2685)ATC>ACC	p.I895T		NM_001618	NP_001609	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase family, member 1	895	PARP catalytic.				cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		AGCGAAATAGATCCCTTTACC	0.418								Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					28	86	---	---	---	---	PASS
LCLAT1	253558	broad.mit.edu	37	2	30785088	30785088	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30785088G>A	uc002rnj.2	+	5	764	c.555G>A	c.(553-555)ATG>ATA	p.M185I	LCLAT1_uc010ymp.1_Missense_Mutation_p.M23I|LCLAT1_uc002rnk.1_Missense_Mutation_p.M185I|LCLAT1_uc002rnl.2_Missense_Mutation_p.M147I|LCLAT1_uc010ymq.1_Missense_Mutation_p.M147I	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1	185					multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2						TCGAAGACATGATTGATTACT	0.398													34	80	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32673959	32673959	+	Silent	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32673959C>A	uc010ezu.2	+	22	4715	c.4581C>A	c.(4579-4581)GTC>GTA	p.V1527V		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	1527					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GCATTGGTGTCCAGTCAGATG	0.343													22	94	---	---	---	---	PASS
LBX2	85474	broad.mit.edu	37	2	74725150	74725150	+	Silent	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74725150C>T	uc002slv.3	-	2	506	c.501G>A	c.(499-501)CTG>CTA	p.L167L	LBX2_uc002slw.2_Silent_p.L163L	NM_001009812	NP_001009812	Q6XYB7	LBX2_HUMAN	ladybird homeobox 2	167						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CGCCTTCGGGCAGTGCTAAGC	0.667													27	49	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128378008	128378008	+	Silent	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128378008C>A	uc002top.2	+	26	3467	c.3414C>A	c.(3412-3414)CTC>CTA	p.L1138L	MYO7B_uc002toq.1_5'UTR|MYO7B_uc002tor.1_5'UTR	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1138	MyTH4 1.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GCCTCTGCCTCGGCTGCTTCC	0.607													3	36	---	---	---	---	PASS
DARS	1615	broad.mit.edu	37	2	136678172	136678172	+	Splice_Site	SNP	T	C	C			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136678172T>C	uc002tux.1	-	10	996	c.812_splice	c.e10-1	p.V271_splice	DARS_uc010fnj.1_Splice_Site_p.V171_splice	NM_001349	NP_001340	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase						aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	CTCTGAATACTGTGAAGTTAA	0.323													23	68	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186669998	186669998	+	Intron	SNP	A	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186669998A>T	uc002upm.2	+						uc010zfu.1_5'Flank					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		CTGATAAGGGAATTTAAGAAA	0.299													35	190	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215818763	215818763	+	Silent	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215818763G>A	uc002vew.2	-	44	6682	c.6462C>T	c.(6460-6462)TAC>TAT	p.Y2154Y	ABCA12_uc002vev.2_Silent_p.Y1836Y|ABCA12_uc010zjn.1_Silent_p.Y1081Y	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	2154					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CAATCAAACCGTAGCCAAAAC	0.353													92	109	---	---	---	---	PASS
ACCN4	55515	broad.mit.edu	37	2	220402366	220402366	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220402366C>T	uc002vma.2	+	8	1752	c.1738C>T	c.(1738-1740)CGA>TGA	p.R580*	ACCN4_uc002vlz.2_Nonsense_Mutation_p.R599*|ACCN4_uc002vmb.2_3'UTR	NM_182847	NP_878267	Q96FT7	ACCN4_HUMAN	amiloride-sensitive cation channel 4 isoform 2	580	Cytoplasmic (Potential).					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity			ovary(2)	2		Renal(207;0.0183)		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)		GTCCTGGGATCGACTGAAGCG	0.617													3	44	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227660084	227660084	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227660084G>A	uc002voh.3	-	1	3423	c.3371C>T	c.(3370-3372)GCA>GTA	p.A1124V		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	1124					fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GCCCCCTACTGCTGCCCCCGC	0.642													12	47	---	---	---	---	PASS
ALPP	250	broad.mit.edu	37	2	233246013	233246013	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233246013C>A	uc002vsq.2	+	10	1410	c.1245C>A	c.(1243-1245)TAC>TAA	p.Y415*	ALPP_uc002vsr.2_RNA	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein	415						anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TCCTCCTATACGGAAACGGTC	0.632													17	80	---	---	---	---	PASS
ROBO1	6091	broad.mit.edu	37	3	79067688	79067688	+	Intron	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79067688C>T	uc003dqe.2	-						ROBO1_uc003dqb.2_5'UTR|ROBO1_uc003dqc.2_5'UTR|ROBO1_uc003dqd.2_5'UTR	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGTATGAAGCCACACACCACA	0.493													5	9	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	121138013	121138013	+	3'UTR	SNP	T	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121138013T>A	uc003eec.3	+	28					STXBP5L_uc011bji.1_3'UTR	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		CCAGCATCACTACTCAACTGC	0.363													12	35	---	---	---	---	PASS
TMPRSS11B	132724	broad.mit.edu	37	4	69111338	69111338	+	5'UTR	SNP	C	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69111338C>G	uc003hdw.3	-	1						NM_182502	NP_872308	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B						proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						acgaagataacgataacgatg	0.289													23	78	---	---	---	---	PASS
HSD17B11	51170	broad.mit.edu	37	4	88303419	88303419	+	Silent	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88303419G>A	uc003hqp.2	-	2	539	c.306C>T	c.(304-306)AGC>AGT	p.S102S		NM_016245	NP_057329	Q8NBQ5	DHB11_HUMAN	estradiol 17-beta-dehydrogenase 11	102					androgen catabolic process|steroid biosynthetic process	cytoplasm|extracellular region	binding|estradiol 17-beta-dehydrogenase activity			ovary(2)	2		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		TCTTTGCAGAGCTGTAAATAT	0.303													89	229	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160264133	160264133	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160264133G>C	uc003iqg.3	+	15	2748	c.2438G>C	c.(2437-2439)GGC>GCC	p.G813A		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	813	Ras-GEF.				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CCTCTCAGTGGCCTAAACCTG	0.368													10	17	---	---	---	---	PASS
CARD6	84674	broad.mit.edu	37	5	40852478	40852478	+	Silent	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40852478G>A	uc003jmg.2	+	3	1119	c.1044G>A	c.(1042-1044)AAG>AAA	p.K348K		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	348					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						TCAGTCACAAGGTTCTGGATG	0.473													12	34	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153077687	153077687	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153077687C>A	uc003lva.3	+	9	1583	c.1218C>A	c.(1216-1218)AAC>AAA	p.N406K	GRIA1_uc003luy.3_Missense_Mutation_p.N406K|GRIA1_uc003luz.3_Missense_Mutation_p.N311K|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.N326K|GRIA1_uc011dcx.1_Missense_Mutation_p.N337K|GRIA1_uc011dcy.1_Missense_Mutation_p.N416K|GRIA1_uc011dcz.1_Missense_Mutation_p.N416K|GRIA1_uc010jia.1_Missense_Mutation_p.N386K	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	406	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTGTTCAGAACAGAACATACA	0.458													15	49	---	---	---	---	PASS
C6orf10	10665	broad.mit.edu	37	6	32304391	32304391	+	Intron	SNP	C	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32304391C>G	uc011dpy.1	-							NM_006781	NP_006772	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10							integral to membrane				skin(1)	1						TTGATACTTACGAATAGGGGC	0.343													10	42	---	---	---	---	PASS
C6orf57	135154	broad.mit.edu	37	6	71289120	71289120	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71289120C>T	uc003pfq.1	+	2	88	c.68C>T	c.(67-69)TCA>TTA	p.S23L		NM_145267	NP_660310	Q5VUM1	CF057_HUMAN	hypothetical protein LOC135154 precursor	23						extracellular region					0						CTTCTAGGATCACCCCTTCTG	0.338													22	153	---	---	---	---	PASS
RTN4IP1	84816	broad.mit.edu	37	6	107019903	107019903	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107019903C>T	uc003prj.2	-	9	1636	c.1159G>A	c.(1159-1161)GCA>ACA	p.A387T	RTN4IP1_uc010kdd.2_3'UTR|RTN4IP1_uc003prk.2_Missense_Mutation_p.A287T	NM_032730	NP_116119	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1 precursor	387						mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		TTTCCTCGTGCGTGTCCTCTT	0.393													10	145	---	---	---	---	PASS
EIF2AK1	27102	broad.mit.edu	37	7	6094303	6094303	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6094303T>C	uc003spp.2	-	2	297	c.151A>G	c.(151-153)AAA>GAA	p.K51E	EIF2AK1_uc003spq.2_Missense_Mutation_p.K51E|EIF2AK1_uc011jwm.1_5'UTR	NM_014413	NP_055228	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha	51					negative regulation of hemoglobin biosynthetic process|negative regulation of translational initiation by iron|protein autophosphorylation|response to external stimulus|response to stress	cytoplasm	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|heme binding|protein homodimerization activity			upper_aerodigestive_tract(1)|stomach(1)|lung(1)|central_nervous_system(1)	4		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		AGGGGTTCTTTTAACACCTGG	0.388													45	146	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18688092	18688092	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18688092G>T	uc003suh.2	+	10	1285	c.1244G>T	c.(1243-1245)GGA>GTA	p.G415V	HDAC9_uc003sue.2_Missense_Mutation_p.G415V|HDAC9_uc011jyd.1_Missense_Mutation_p.G415V|HDAC9_uc003sui.2_Missense_Mutation_p.G418V|HDAC9_uc003suj.2_Missense_Mutation_p.G374V|HDAC9_uc011jya.1_Missense_Mutation_p.G412V|HDAC9_uc003sua.1_Missense_Mutation_p.G393V|HDAC9_uc011jyb.1_Missense_Mutation_p.G371V|HDAC9_uc003sud.1_Missense_Mutation_p.G415V|HDAC9_uc011jyc.1_Missense_Mutation_p.G374V|HDAC9_uc003suf.1_Missense_Mutation_p.G446V|HDAC9_uc010kud.1_Missense_Mutation_p.G418V|HDAC9_uc011jye.1_Missense_Mutation_p.G387V|HDAC9_uc011jyf.1_Missense_Mutation_p.G338V|HDAC9_uc010kue.1_Missense_Mutation_p.G158V	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	415					B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	TTTTCAGGTGGAGTTCCCTTA	0.333													18	58	---	---	---	---	PASS
SPDYE7P	441251	broad.mit.edu	37	7	72333538	72333538	+	RNA	SNP	G	A	A	rs146152373	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72333538G>A	uc010lal.1	-	1		c.6118C>T				NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0						AGTTCCTGCTGAAAATCCACA	0.488													3	31	---	---	---	---	PASS
ZKSCAN1	7586	broad.mit.edu	37	7	99631582	99631582	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99631582G>T	uc003usk.1	+	6	1673	c.1454G>T	c.(1453-1455)GGG>GTG	p.G485V	ZKSCAN1_uc003usl.1_Missense_Mutation_p.G449V|ZKSCAN1_uc003usm.1_Missense_Mutation_p.G272V	NM_003439	NP_003430	P17029	ZKSC1_HUMAN	zinc finger protein 36	485					viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			ATTCACACGGGGGAGAAACCC	0.478													20	85	---	---	---	---	PASS
CSGALNACT1	55790	broad.mit.edu	37	8	19297429	19297429	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19297429C>A	uc011kyn.1	-	6	1929	c.865G>T	c.(865-867)GAG>TAG	p.E289*	CSGALNACT1_uc011kyo.1_Nonsense_Mutation_p.E289*|CSGALNACT1_uc003wzg.2_RNA|CSGALNACT1_uc011kyp.1_Nonsense_Mutation_p.E288*|CSGALNACT1_uc003wzh.2_RNA	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate	289	Lumenal (Potential).				anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)		CCATCCTGCTCAATGCACATC	0.398													31	56	---	---	---	---	PASS
EBAG9	9166	broad.mit.edu	37	8	110576820	110576820	+	3'UTR	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110576820G>A	uc003ynf.2	+	7					EBAG9_uc003yng.2_3'UTR	NM_198120	NP_936056	O00559	RCAS1_HUMAN	estrogen receptor binding site associated						apoptosis|regulation of cell growth	focal adhesion|Golgi membrane|integral to membrane|soluble fraction	apoptotic protease activator activity				0			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			GCCAGTAGGAGAAATCTCAGC	0.353													40	122	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113358405	113358405	+	Silent	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113358405C>A	uc003ynu.2	-	41	6522	c.6363G>T	c.(6361-6363)GTG>GTT	p.V2121V	CSMD3_uc003yns.2_Silent_p.V1323V|CSMD3_uc003ynt.2_Silent_p.V2081V|CSMD3_uc011lhx.1_Silent_p.V2017V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2121	Extracellular (Potential).|CUB 12.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GACTGAGGATCACACCACTGA	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			23	113	---	---	---	---	PASS
ZC3H3	23144	broad.mit.edu	37	8	144620458	144620458	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144620458T>G	uc003yyd.2	-	2	1108	c.1079A>C	c.(1078-1080)AAG>ACG	p.K360T		NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	360					mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CTTCCTGGGCTTGGGCTCTGG	0.622													29	66	---	---	---	---	PASS
ANKRD20A3	441425	broad.mit.edu	37	9	67938633	67938633	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67938633G>T	uc004aeu.2	+	6	880	c.768G>T	c.(766-768)AAG>AAT	p.K256N	ANKRD20A3_uc010mnn.2_Missense_Mutation_p.K256N	NM_001012419	NP_001012419	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3	256											0						AACATAAAAAGAAGATACTTA	0.234													4	32	---	---	---	---	PASS
AKR1C3	8644	broad.mit.edu	37	10	5139815	5139815	+	Intron	SNP	C	A	A	rs2245191	byFrequency	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5139815C>A	uc001ihr.2	+						AKR1C3_uc010qap.1_Intron|AKR1C3_uc010qaq.1_3'UTR|AKR1C3_uc001ihu.2_Intron	NM_003739	NP_003730	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3						prostaglandin metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (A-specific) activity|indanol dehydrogenase activity|prostaglandin-F synthase activity|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			skin(1)	1					Dimethyl sulfoxide(DB01093)|NADH(DB00157)	GATAGTTGAACAGAGCTTTTT	0.348													3	51	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16911671	16911671	+	Missense_Mutation	SNP	C	G	G	rs148491916		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16911671C>G	uc001ioo.2	-	59	9470	c.9418G>C	c.(9418-9420)GCA>CCA	p.A3140P	CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_Missense_Mutation_p.A496P	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3140	CUB 23.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGCCTTTTGCTGTCTGAAAT	0.423													99	253	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43292488	43292488	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43292488C>T	uc001jaj.2	+	10	2154	c.1796C>T	c.(1795-1797)TCA>TTA	p.S599L		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	599					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						GAAAGCTCCTCACTCAGTGCA	0.458													37	103	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115356916	115356916	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115356916T>G	uc001laj.2	-	37	4524	c.4360A>C	c.(4360-4362)ATC>CTC	p.I1454L	NRAP_uc009xyb.2_Missense_Mutation_p.I243L|NRAP_uc001lak.2_Missense_Mutation_p.I1419L|NRAP_uc001lal.3_Missense_Mutation_p.I1454L	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	1454						fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GTGAACTTGATACTGTCTGGT	0.453													44	106	---	---	---	---	PASS
ZNF215	7762	broad.mit.edu	37	11	6977426	6977426	+	Silent	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6977426C>A	uc001mey.2	+	7	1806	c.1218C>A	c.(1216-1218)CCC>CCA	p.P406P	ZNF215_uc010raw.1_3'UTR|ZNF215_uc010rax.1_Silent_p.P168P|ZNF215_uc001mez.1_Intron	NM_013250	NP_037382	Q9UL58	ZN215_HUMAN	zinc finger protein 215	406					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		GAGAGAAACCCTATAAATGCA	0.398													32	61	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76256949	76256949	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76256949C>G	uc001oxl.2	+	20	3525	c.3382C>G	c.(3382-3384)CTG>GTG	p.L1128V	C11orf30_uc001oxm.2_Missense_Mutation_p.L1030V|C11orf30_uc010rsb.1_Missense_Mutation_p.L1143V|C11orf30_uc010rsc.1_Missense_Mutation_p.L1129V|C11orf30_uc001oxn.2_Missense_Mutation_p.L1129V|C11orf30_uc010rsd.1_Missense_Mutation_p.L1037V|C11orf30_uc010rse.1_Missense_Mutation_p.L375V|C11orf30_uc001oxp.2_Intron	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	1128					chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						TGTGCCTAAGCTGACATCACC	0.448													22	67	---	---	---	---	PASS
DLAT	1737	broad.mit.edu	37	11	111915861	111915861	+	Splice_Site	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111915861G>A	uc001pmo.2	+	9	1857	c.1198_splice	c.e9-1	p.A400_splice	DLAT_uc009yyk.1_Splice_Site_p.A295_splice|DLAT_uc010rwr.1_Splice_Site_p.A273_splice	NM_001931	NP_001922	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase precursor						glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial pyruvate dehydrogenase complex	dihydrolipoyllysine-residue acetyltransferase activity|protein binding				0		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)	NADH(DB00157)	TCCTCCCATAGGCTCCGGCAG	0.453													51	224	---	---	---	---	PASS
DLAT	1737	broad.mit.edu	37	11	111915865	111915865	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111915865C>G	uc001pmo.2	+	9	1860	c.1201C>G	c.(1201-1203)CCG>GCG	p.P401A	DLAT_uc009yyk.1_Missense_Mutation_p.P296A|DLAT_uc010rwr.1_Missense_Mutation_p.P274A	NM_001931	NP_001922	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase precursor	401					glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial pyruvate dehydrogenase complex	dihydrolipoyllysine-residue acetyltransferase activity|protein binding				0		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)	NADH(DB00157)	CCCATAGGCTCCGGCAGCTGT	0.453													49	229	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6127762	6127762	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6127762T>C	uc001qnn.1	-	28	5072	c.4822A>G	c.(4822-4824)ACC>GCC	p.T1608A	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1608	VWFA 2.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	GGATTTCCGGTGACCATGTAG	0.463													17	51	---	---	---	---	PASS
OVCH1	341350	broad.mit.edu	37	12	29604380	29604380	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29604380C>T	uc001rix.1	-	22	2653	c.2653G>A	c.(2653-2655)GCA>ACA	p.A885T		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	885	CUB 3.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GTAAATTTTGCCATACTGCTT	0.428													3	56	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43771275	43771275	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43771275G>A	uc010skx.1	-	32	4888	c.4888C>T	c.(4888-4890)CGG>TGG	p.R1630W		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1630	TSP type-1 14.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACTATAGGCCGAAGTCGATGG	0.408													20	50	---	---	---	---	PASS
RND1	27289	broad.mit.edu	37	12	49251928	49251928	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49251928A>T	uc001rsn.2	-	5	653	c.550T>A	c.(550-552)TCC>ACC	p.S184T		NM_014470	NP_055285	Q92730	RND1_HUMAN	GTP-binding protein RHO6 precursor	184					actin filament organization|axon guidance|negative regulation of cell adhesion|neuron remodeling|small GTPase mediated signal transduction	adherens junction|cytoskeleton|cytosol	GTP binding|GTPase activity|receptor binding			ovary(1)	1						CACAGCATGGATGCCGTCCGA	0.552													20	51	---	---	---	---	PASS
SCYL2	55681	broad.mit.edu	37	12	100704845	100704845	+	Silent	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100704845G>A	uc001thn.2	+	5	554	c.504G>A	c.(502-504)TTG>TTA	p.L168L	SCYL2_uc009ztw.1_5'UTR|SCYL2_uc001thm.1_Silent_p.L168L	NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 protein	168	Protein kinase.				endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6						TGTCATTCTTGCATAGCAGTG	0.284													28	129	---	---	---	---	PASS
SDSL	113675	broad.mit.edu	37	12	113865886	113865886	+	Silent	SNP	T	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113865886T>A	uc001tvi.2	+	3	309	c.99T>A	c.(97-99)CCT>CCA	p.P33P	SDSL_uc009zwh.2_Silent_p.P33P	NM_138432	NP_612441	Q96GA7	SDSL_HUMAN	serine dehydratase-like	33					cellular amino acid metabolic process		L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	CGGGCATGCCTGTCTTCCTCA	0.517													9	34	---	---	---	---	PASS
POSTN	10631	broad.mit.edu	37	13	38137418	38137418	+	3'UTR	SNP	T	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38137418T>A	uc001uwo.3	-	23					POSTN_uc010tet.1_3'UTR|POSTN_uc001uwp.3_3'UTR|POSTN_uc001uwr.2_3'UTR|POSTN_uc001uwq.2_3'UTR	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1						cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TTTTCTAAGGTCAGGTTATTG	0.323													16	43	---	---	---	---	PASS
DHRS4	10901	broad.mit.edu	37	14	24424292	24424292	+	Silent	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24424292G>T	uc001wla.2	+	2	210	c.177G>T	c.(175-177)GTG>GTT	p.V59V	C14orf167_uc001wkz.2_5'Flank|C14orf167_uc001wky.2_5'Flank|C14orf167_uc001wkx.2_5'Flank|C14orf167_uc010akx.1_RNA|DHRS4_uc010aky.2_Silent_p.V59V|DHRS4_uc001wlb.2_Silent_p.V59V|DHRS4_uc010akz.2_Silent_p.V59V|DHRS4_uc001wlc.3_Silent_p.V59V|DHRS4L2_uc001wld.3_Silent_p.V59V|DHRS4L2_uc001wle.3_Silent_p.V59V	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN	peroxisomal short-chain alcohol dehydrogenase	59	NADP (By similarity).					mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	GGGCCCATGTGGTCGTCAGCA	0.602													23	63	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59112841	59112841	+	Silent	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59112841C>T	uc001xdw.2	+	4	1664	c.1500C>T	c.(1498-1500)AAC>AAT	p.N500N	DACT1_uc010trv.1_Silent_p.N219N|DACT1_uc001xdx.2_Silent_p.N463N|DACT1_uc010trw.1_Silent_p.N219N	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	500					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						CGCAGGAGAACAAAGTTGTAC	0.607													20	84	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68054035	68054035	+	3'UTR	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68054035C>T	uc001xjl.1	+	29					PLEKHH1_uc010tsw.1_3'UTR|PLEKHH1_uc001xjn.1_3'UTR|PLEKHH1_uc010tsx.1_3'UTR|PLEKHH1_uc001xjo.1_3'UTR|PLEKHH1_uc001xjp.1_3'UTR	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H							cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		ACTACTGTGACGGGTCTAACA	0.453													3	36	---	---	---	---	PASS
PSMC1	5700	broad.mit.edu	37	14	90730104	90730104	+	Silent	SNP	T	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90730104T>G	uc001xyf.2	+	5	426	c.378T>G	c.(376-378)TCT>TCG	p.S126S	PSMC1_uc001xyg.2_Silent_p.S53S|PSMC1_uc001xyh.2_Silent_p.S53S|PSMC1_uc010twh.1_Silent_p.S53S	NM_002802	NP_002793	P62191	PRS4_HUMAN	proteasome 26S ATPase subunit 1	126					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0		all_cancers(154;0.142)		COAD - Colon adenocarcinoma(157;0.21)		TGTCTACATCTGTGGGCTCAG	0.488													19	67	---	---	---	---	PASS
TGM5	9333	broad.mit.edu	37	15	43525807	43525807	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43525807C>G	uc001zrd.1	-	12	1962	c.1954G>C	c.(1954-1956)GAC>CAC	p.D652H	TGM5_uc001zrc.1_Missense_Mutation_p.D309H|TGM5_uc001zre.1_Missense_Mutation_p.D570H	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	652					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	AGCACACAGTCCTCAACCTGC	0.517													8	59	---	---	---	---	PASS
CGNL1	84952	broad.mit.edu	37	15	57816796	57816796	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57816796G>T	uc002aeg.2	+	12	2962	c.2886G>T	c.(2884-2886)GAG>GAT	p.E962D	CGNL1_uc010bfw.2_Missense_Mutation_p.E962D	NM_032866	NP_116255	Q0VF96	CGNL1_HUMAN	cingulin-like 1	962	Potential.					myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		ACATTGTTGAGGCCTCCCGTA	0.537													35	134	---	---	---	---	PASS
ADAM10	102	broad.mit.edu	37	15	58938360	58938360	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58938360C>T	uc002afd.1	-	6	1073	c.629G>A	c.(628-630)AGG>AAG	p.R210K	ADAM10_uc010bgc.1_RNA|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor	210	Extracellular (Potential).				cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		ACGTTTTTTCCTCAGAAGTTC	0.328													7	77	---	---	---	---	PASS
CCNB2	9133	broad.mit.edu	37	15	59409521	59409521	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59409521C>T	uc002afz.2	+	7	1077	c.929C>T	c.(928-930)GCA>GTA	p.A310V	CCNB2_uc010bge.2_Intron	NM_004701	NP_004692	O95067	CCNB2_HUMAN	cyclin B2	310					cell cycle checkpoint|cell division|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	centrosome|cytosol|nucleus	protein kinase binding				0						AAGGTAGCAGCAGCTGCTTCC	0.408													33	93	---	---	---	---	PASS
WDR24	84219	broad.mit.edu	37	16	739435	739435	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:739435C>T	uc002ciz.1	-	1	966	c.206G>A	c.(205-207)CGC>CAC	p.R69H		NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24	131										ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)				CGAAGGCTTGCGCCCCACACG	0.602													3	37	---	---	---	---	PASS
UBN1	29855	broad.mit.edu	37	16	4924865	4924865	+	Silent	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4924865G>A	uc002cyb.2	+	15	2793	c.2454G>A	c.(2452-2454)ACG>ACA	p.T818T	UBN1_uc010uxw.1_Silent_p.T818T|UBN1_uc002cyc.2_Silent_p.T818T	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1	818					chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						AAAACTTCACGCCCCCATCTC	0.582													29	105	---	---	---	---	PASS
SH2B1	25970	broad.mit.edu	37	16	28878735	28878735	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28878735G>T	uc002dri.2	+	5	1462	c.1023G>T	c.(1021-1023)GAG>GAT	p.E341D	uc010vct.1_Intron|SH2B1_uc010vdc.1_Missense_Mutation_p.E31D|SH2B1_uc002drj.2_Missense_Mutation_p.E341D|SH2B1_uc002drk.2_Missense_Mutation_p.E341D|SH2B1_uc002drl.2_Missense_Mutation_p.E341D|SH2B1_uc010vdd.1_Missense_Mutation_p.E5D|SH2B1_uc010vde.1_Missense_Mutation_p.E341D|SH2B1_uc002drm.2_Missense_Mutation_p.E341D	NM_001145795	NP_001139267	Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1 isoform 1	341	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation) (By similarity).|PH.				blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity			ovary(2)	2						CTGACCGGGAGAACACGTTTG	0.567													36	187	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268158	70268158	+	RNA	SNP	A	C	C			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268158A>C	uc010cfp.1	-	3		c.257T>G								Homo sapiens cDNA, FLJ98908.																		TTCTTCATTAAAACAGCTACT	0.333													3	16	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10225010	10225010	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10225010C>A	uc002gmk.1	-	24	3040	c.2950G>T	c.(2950-2952)GAA>TAA	p.E984*	MYH13_uc010vve.1_Nonsense_Mutation_p.E82*	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	984	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						GTCATTTCTTCGGAAAGATTC	0.383													13	54	---	---	---	---	PASS
HS3ST3A1	9955	broad.mit.edu	37	17	13400032	13400032	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13400032C>T	uc002gob.1	-	2	1501	c.703G>A	c.(703-705)GAC>AAC	p.D235N		NM_006042	NP_006033	Q9Y663	HS3SA_HUMAN	heparan sulfate D-glucosaminyl	235	Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity			ovary(1)|central_nervous_system(1)	2		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AGCTTGGTGTCCTTGGACATG	0.652													6	119	---	---	---	---	PASS
MMP28	79148	broad.mit.edu	37	17	34093633	34093633	+	Silent	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34093633G>A	uc002hjy.1	-	10	1708	c.1449C>T	c.(1447-1449)GAC>GAT	p.D483D	MMP28_uc002hjw.1_RNA|MMP28_uc002hjz.1_RNA	NM_024302	NP_077278	Q9H239	MMP28_HUMAN	matrix metalloproteinase 28 isoform 1	483	Hemopexin-like 4.				proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GCCAGTAGCGGTCATCTCGGA	0.672													5	19	---	---	---	---	PASS
G6PC	2538	broad.mit.edu	37	17	41052960	41052960	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41052960T>A	uc002icb.1	+	1	146	c.67T>A	c.(67-69)TAC>AAC	p.Y23N	LOC388387_uc002ibz.2_5'Flank|LOC388387_uc002iby.2_5'Flank|LOC388387_uc002ica.2_5'Flank|LOC388387_uc010whe.1_5'Flank|G6PC_uc010whf.1_Missense_Mutation_p.Y25N	NM_000151	NP_000142	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	23	Lumenal (Potential).				gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCAGGTGAATTACCAAGACTC	0.502									Glycogen_Storage_Disease_type_Ia				37	79	---	---	---	---	PASS
PPM1E	22843	broad.mit.edu	37	17	57058007	57058007	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57058007C>T	uc002iwx.2	+	7	2010	c.1883C>T	c.(1882-1884)ACT>ATT	p.T628I	PPM1E_uc010ddd.2_Missense_Mutation_p.T391I	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E	637					protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GAGTTTCCCACTGCTTTCAAT	0.433													78	185	---	---	---	---	PASS
RAB37	326624	broad.mit.edu	37	17	72739479	72739479	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72739479G>T	uc002jlk.2	+	5	422	c.366G>T	c.(364-366)AGG>AGT	p.R122S	RAB37_uc002jlc.2_Missense_Mutation_p.R115S|RAB37_uc010dfu.2_Missense_Mutation_p.R115S|RAB37_uc002jld.2_Missense_Mutation_p.R115S|RAB37_uc010wrb.1_Missense_Mutation_p.R90S|RAB37_uc010wrc.1_Missense_Mutation_p.R127S|RAB37_uc010wrd.1_Missense_Mutation_p.R90S|RAB37_uc010wre.1_Missense_Mutation_p.R85S|RAB37_uc002jll.3_RNA	NM_001006638	NP_001006639	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family isoform 2	122					protein transport|small GTPase mediated signal transduction	ER-Golgi intermediate compartment	GTP binding			ovary(1)	1						ACAACATCAGGGTAGGTCCTC	0.572													40	147	---	---	---	---	PASS
TSEN54	283989	broad.mit.edu	37	17	73518055	73518055	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73518055T>G	uc002jof.1	+	8	926	c.893T>G	c.(892-894)TTC>TGC	p.F298C		NM_207346	NP_997229	Q7Z6J9	SEN54_HUMAN	tRNA splicing endonuclease 54 homolog	298					mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	nucleolus				ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGCTGGAACTTCGAGCAGATC	0.706													2	8	---	---	---	---	PASS
DSG3	1830	broad.mit.edu	37	18	29046612	29046612	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29046612G>T	uc002kws.2	+	11	1640	c.1531G>T	c.(1531-1533)GTC>TTC	p.V511F		NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	511	Extracellular (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTCCGTGGTTGTCTCCGCTAG	0.448													59	165	---	---	---	---	PASS
GIPC3	126326	broad.mit.edu	37	19	3586520	3586520	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3586520A>T	uc002lyd.3	+	2	280	c.253A>T	c.(253-255)AAA>TAA	p.K85*		NM_133261	NP_573568	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	85										breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		CAACAGCCACAAAGTGGACAT	0.592											OREG0025154	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	64	---	---	---	---	PASS
ZNF560	147741	broad.mit.edu	37	19	9577235	9577235	+	3'UTR	SNP	C	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9577235C>G	uc002mlp.1	-	10					ZNF560_uc010dwr.1_3'UTR	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						TTCTTCACATCCACAGGGCTT	0.413													31	73	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10475698	10475698	+	Silent	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10475698G>A	uc002moc.3	-	8	1416	c.1038C>T	c.(1036-1038)AAC>AAT	p.N346N	TYK2_uc010dxe.2_Silent_p.N161N|TYK2_uc002mod.2_Silent_p.N346N	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	346	FERM.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TGGCTTGGGGGTTCCTGCCAC	0.622													5	1	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45862051	45862051	+	Intron	SNP	A	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45862051A>T	uc002pbj.2	-						ERCC2_uc002pbh.2_5'UTR|ERCC2_uc002pbi.2_Intron|ERCC2_uc010ejz.2_Intron|ERCC2_uc002pbk.2_Intron|ERCC2_uc002pbl.3_3'UTR	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		ttctggaattatttccttgtt	0.000			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				12	29	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45862052	45862052	+	Intron	SNP	T	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45862052T>G	uc002pbj.2	-						ERCC2_uc002pbh.2_5'UTR|ERCC2_uc002pbi.2_Intron|ERCC2_uc010ejz.2_Intron|ERCC2_uc002pbk.2_Intron|ERCC2_uc002pbl.3_3'UTR	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		tctggaattatttccttgttt	0.000			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				12	29	---	---	---	---	PASS
SLC1A5	6510	broad.mit.edu	37	19	47290655	47290655	+	Intron	SNP	A	C	C			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47290655A>C	uc002pfs.2	-						SLC1A5_uc010xyh.1_5'Flank|SLC1A5_uc002pfq.2_5'Flank|SLC1A5_uc002pfr.2_5'Flank	NM_005628	NP_005619	Q15758	AAAT_HUMAN	solute carrier family 1 member 5 isoform 1						cellular nitrogen compound metabolic process	integral to plasma membrane|melanosome|membrane fraction	neutral amino acid transmembrane transporter activity|protein binding|receptor activity|sodium:dicarboxylate symporter activity				0		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	GCGGGAGCTGACCTCGCAAGA	0.677													3	7	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55147219	55147219	+	Intron	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55147219C>T	uc002qgj.2	+						LILRB1_uc010erp.1_Silent_p.L218L|LILRB1_uc002qgl.2_Intron|LILRB1_uc002qgk.2_Intron|LILRB1_uc002qgm.2_Intron|LILRB1_uc010erq.2_Intron|LILRB1_uc010err.2_Intron	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,						regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		CTCACTCTCTCCTGCTGTCCT	0.647										HNSCC(37;0.09)			3	16	---	---	---	---	PASS
XRN2	22803	broad.mit.edu	37	20	21336744	21336744	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21336744G>C	uc002wsf.1	+	22	2142	c.2047G>C	c.(2047-2049)GTC>CTC	p.V683L	XRN2_uc002wsg.1_Missense_Mutation_p.V607L|XRN2_uc010zsk.1_Missense_Mutation_p.V629L	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	683					cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						TGGAGGTGATGTCTTATTTGT	0.383													37	79	---	---	---	---	PASS
TFAP2C	7022	broad.mit.edu	37	20	55206674	55206674	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55206674C>A	uc002xya.2	+	2	705	c.462C>A	c.(460-462)CAC>CAA	p.H154Q	TFAP2C_uc010zzi.1_5'UTR	NM_003222	NP_003213	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma	154					cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Colorectal(105;0.229)			CCCACGCACACGCCCTGGATG	0.741													3	1	---	---	---	---	PASS
SLC17A9	63910	broad.mit.edu	37	20	61594983	61594983	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61594983T>A	uc002yea.3	+	7	957	c.773T>A	c.(772-774)CTC>CAC	p.L258H	SLC17A9_uc002ydz.3_Missense_Mutation_p.L252H|SLC17A9_uc011aap.1_Missense_Mutation_p.L278H	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9	258	Helical; (Potential).				exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2						TTCTTCATCCTCCTCTCCTGG	0.682													5	7	---	---	---	---	PASS
KCNJ15	3772	broad.mit.edu	37	21	39671523	39671523	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39671523C>G	uc002ywv.2	+	4	642	c.340C>G	c.(340-342)CTC>GTC	p.L114V	KCNJ15_uc002yww.2_Missense_Mutation_p.L114V|KCNJ15_uc002ywx.2_Missense_Mutation_p.L114V	NM_002243	NP_002234	Q99712	IRK15_HUMAN	potassium inwardly-rectifying channel J15	114					synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity			ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6						AGTGGACTCTCTCACTGGGGC	0.488													42	138	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22663086	22663086	+	RNA	SNP	T	G	G	rs1054157	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22663086T>G	uc011aim.1	+	29		c.1859T>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						AGCTGCCACATAAGTTGTCCT	0.299													3	44	---	---	---	---	PASS
SLC16A8	23539	broad.mit.edu	37	22	38476983	38476983	+	Silent	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38476983G>A	uc003auu.2	-	4	1192	c.1062C>T	c.(1060-1062)GGC>GGT	p.G354G		NM_013356	NP_037488	O95907	MOT3_HUMAN	solute carrier family 16, member 8	354	Helical; (Potential).				blood coagulation|leukocyte migration|pyruvate metabolic process	integral to plasma membrane|membrane fraction	lactate transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity				0	Melanoma(58;0.045)				Pyruvic acid(DB00119)	CGTAGGAGAGGCCGAAGGCGA	0.701													6	6	---	---	---	---	PASS
SPANXN5	494197	broad.mit.edu	37	X	52825196	52825196	+	3'UTR	SNP	A	G	G	rs144412302	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52825196A>G	uc004drc.1	-	2						NM_001009616	NP_001009616	Q5MJ07	SPXN5_HUMAN	SPANX family, member N5												0	Ovarian(276;0.236)					AGCTTCTCAAACTTGATTTTA	0.448													2	18	---	---	---	---	PASS
OPHN1	4983	broad.mit.edu	37	X	67273543	67273543	+	Silent	SNP	C	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67273543C>T	uc004dww.3	-	22	2562	c.2268G>A	c.(2266-2268)AAG>AAA	p.K756K	OPHN1_uc011mpg.1_Silent_p.K648K	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1	756	Pro-rich.				axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						TTGGTTCTGGCTTTTGGGGAG	0.542													10	22	---	---	---	---	PASS
HDX	139324	broad.mit.edu	37	X	83576744	83576744	+	3'UTR	SNP	C	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83576744C>A	uc004eek.1	-	10					HDX_uc011mqv.1_3'UTR|HDX_uc004eel.1_3'UTR	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2						TGCACTGTAGCCATTATATCT	0.318													2	3	---	---	---	---	PASS
HTATSF1	27336	broad.mit.edu	37	X	135593367	135593367	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135593367G>A	uc004ezw.2	+	10	1885	c.1463G>A	c.(1462-1464)GGC>GAC	p.G488D	HTATSF1_uc004ezx.2_Missense_Mutation_p.G488D	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	488	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					TCTGAAGAAGGCAATCCCGTA	0.438													3	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	6570	6570	+	5'UTR	SNP	G	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6570G>T	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		TCTTCGACCCCGCCGGAGGAG	0.483													4	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14312	14312	+	RNA	SNP	A	G	G			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14312A>G	uc004cox.3	+	1		c.1976A>G			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		TTCAGCTTCCTACACTATTAA	0.468													10	5	---	---	---	---	PASS
C1orf174	339448	broad.mit.edu	37	1	3806288	3806291	+	3'UTR	DEL	AAGG	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3806288_3806291delAAGG	uc001alf.2	-	4					C1orf174_uc009vls.2_RNA	NM_207356	NP_997239	Q8IYL3	CA174_HUMAN	hypothetical protein LOC339448												0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)		aaaaaaaagaaAGGACATTGGCAC	0.225													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	82617156	82617163	+	IGR	DEL	AAGAAAGA	-	-	rs36191171	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82617156_82617163delAAGAAAGA								LPHN2 (159050 upstream) : None (None downstream)																							ggaaggaaggaagaaagaaagaaagaaa	0.000													3	4	---	---	---	---	
GDAP2	54834	broad.mit.edu	37	1	118429438	118429439	+	Intron	INS	-	ACA	ACA	rs143592216	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118429438_118429439insACA	uc001ehf.2	-						GDAP2_uc001ehg.2_Intron	NM_017686	NP_060156	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated											ovary(2)	2		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		CTACTCTGCAGACAACACCTAT	0.307													1	5	---	---	---	---	
IQGAP3	128239	broad.mit.edu	37	1	156499845	156499846	+	Intron	DEL	CA	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156499845_156499846delCA	uc001fpf.2	-							NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TATATGcacgcacacacacaca	0.460													4	2	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162338874	162338875	+	3'UTR	DEL	TG	-	-	rs12727261		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162338874_162338875delTG	uc001gbv.2	+	10					NOS1AP_uc010pks.1_RNA|NOS1AP_uc001gbw.2_3'UTR|NOS1AP_uc009wut.1_3'UTR	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			gtgtgtgttttgtgtgtgtgtg	0.332													4	2	---	---	---	---	
AIDA	64853	broad.mit.edu	37	1	222876706	222876706	+	Intron	DEL	A	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222876706delA	uc001hnn.2	-						AIDA_uc001hno.2_Intron|AIDA_uc010pus.1_Intron	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated						dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						AATTCTTCTCAAAAAAAAAAA	0.274													3	3	---	---	---	---	
EXO1	9156	broad.mit.edu	37	1	242016558	242016558	+	Intron	DEL	T	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242016558delT	uc001hzh.2	+						EXO1_uc001hzi.2_Intron|EXO1_uc001hzj.2_Intron|EXO1_uc009xgq.2_Intron	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b						meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			AGTCAAAAACTTTTTTCAGTT	0.343								Direct_reversal_of_damage|Editing_and_processing_nucleases					43	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6953876	6953879	+	IGR	DEL	GAGG	-	-	rs112872966		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6953876_6953879delGAGG								LOC400940 (825512 upstream) : CMPK2 (26624 downstream)																							gggagggagagagggagggaggaa	0.005													4	2	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11678927	11678927	+	Intron	DEL	T	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11678927delT	uc002rbk.1	+						GREB1_uc002rbl.2_5'Flank	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ccttcccttctttacttcctt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91764886	91764893	+	IGR	DEL	TATGTGTG	-	-	rs4005074		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764886_91764893delTATGTGTG								None (None upstream) : LOC654342 (40299 downstream)																							gatgtacgtatatgtgtgtgtgtgtgtg	0.000													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	213748812	213748819	+	IGR	DEL	TGTGTGTG	-	-	rs111421332		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213748812_213748819delTGTGTGTG								ERBB4 (345460 upstream) : IKZF2 (115594 downstream)																							GGCTAAACAAtgtgtgtgtgtgtgtgtg	0.135													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	223906657	223906658	+	IGR	INS	-	CCTT	CCTT	rs35885220		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223906657_223906658insCCTT								ACSL3 (97303 upstream) : KCNE4 (10204 downstream)																							ctttctttctcccttccttcct	0.163													4	3	---	---	---	---	
COL4A3	1285	broad.mit.edu	37	2	228142056	228142057	+	Intron	DEL	AC	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228142056_228142057delAC	uc002vom.1	+						COL4A3_uc002von.1_Intron|COL4A3_uc002voo.1_Intron|COL4A3_uc002vop.1_Intron|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor						activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		aaaaaaaaaaaCAATGTGCAAA	0.178													4	2	---	---	---	---	
SPINK8	646424	broad.mit.edu	37	3	48348869	48348869	+	Intron	DEL	C	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48348869delC	uc003csq.1	-							NM_001080525	NP_001073994	P0C7L1	ISK8_HUMAN	serine peptidase inhibitor, Kazal type 8							extracellular region	serine-type endopeptidase inhibitor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		cctttcctttcccttctcttt	0.189													4	2	---	---	---	---	
NHEDC1	150159	broad.mit.edu	37	4	103826510	103826511	+	Intron	DEL	CA	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103826510_103826511delCA	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN	Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)		cctgagtagccaggaCTGGTTA	0.119													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	115005190	115005191	+	IGR	DEL	AC	-	-	rs72347495		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115005190_115005191delAC								ARSJ (104312 upstream) : UGT8 (514420 downstream)																							acttatcacaacacacacacac	0.129													3	3	---	---	---	---	
PGRMC2	10424	broad.mit.edu	37	4	129208984	129208989	+	5'Flank	DEL	TGCCCT	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129208984_129208989delTGCCCT	uc003igg.2	-							NM_006320	NP_006311			progesterone receptor membrane component 2												0						CCCCGCCCCCTGCCCTCCCCAACCCC	0.641													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	174691784	174691785	+	IGR	DEL	TC	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174691784_174691785delTC								MORF4 (153990 upstream) : FBXO8 (466027 downstream)																							ttttttcttttctctctctctc	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	37086022	37086022	+	IGR	DEL	A	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37086022delA								NIPBL (20102 upstream) : C5orf42 (20308 downstream)																							AATTAATAGGAAAAAAAAaaa	0.204													3	3	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80404654	80404659	+	Intron	DEL	TGTGTG	-	-	rs143382125		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80404654_80404659delTGTGTG	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TTACCTACTCtgtgtgtgtgtgtgtg	0.272													5	3	---	---	---	---	
CAP2	10486	broad.mit.edu	37	6	17436298	17436299	+	Intron	INS	-	TCTT	TCTT			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17436298_17436299insTCTT	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357	P40123	CAP2_HUMAN	adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			AAACTAAGGAAtctttctttct	0.203													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18309205	18309206	+	IGR	INS	-	CCCTCCCCTC	CCCTCCCCTC	rs140722672	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18309205_18309206insCCCTCCCCTC								DEK (44406 upstream) : RNF144B (78388 downstream)																							ccttccttcttccctcccctcc	0.054													5	3	---	---	---	---	
HCG4	54435	broad.mit.edu	37	6	29760353	29760373	+	RNA	DEL	GCGGGCGCCGTGGATGGAGCA	-	-	rs146714150		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29760353_29760373delGCGGGCGCCGTGGATGGAGCA	uc003nns.2	-	1		c.478_498delTGCTCCATCCACGGCGCCCGC			uc010jrm.1_In_Frame_Del_p.AGAVDGA111del|uc003nnt.2_In_Frame_Del_p.RAPWMEQ147del|uc011dma.1_5'Flank	NR_002139				Homo sapiens clone HCG IV.9 unknown mRNA.												0						GGATGGAGCCGCGGGCGCCGTGGATGGAGCAGGAGGGGCCG	0.674													4	2	---	---	---	---	
HS3ST5	222537	broad.mit.edu	37	6	114405997	114405997	+	Intron	DEL	C	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114405997delC	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		cttttcttttctttttttttt	0.189													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1235601	1235602	+	IGR	DEL	CA	-	-	rs151264424		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1235601_1235602delCA								ZFAND2A (35746 upstream) : UNCX (37052 downstream)																							acacacacaccacacacacaca	0.292													4	2	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111474750	111474750	+	Intron	DEL	A	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111474750delA	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCCCTAAGTTAAAAAAAAAAA	0.318													3	3	---	---	---	---	
NRF1	4899	broad.mit.edu	37	7	129330491	129330492	+	Intron	INS	-	T	T			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129330491_129330492insT	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						TGACCAGGGAGTGAGATGCTGA	0.525													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131319257	131319260	+	IGR	DEL	TTCT	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131319257_131319260delTTCT								PODXL (77881 upstream) : PLXNA4 (488832 downstream)																							ccttctttccttctttctttcttt	0.000													5	3	---	---	---	---	
TRIM55	84675	broad.mit.edu	37	8	67062909	67062909	+	Intron	DEL	T	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67062909delT	uc003xvv.2	+						TRIM55_uc003xvu.2_Intron|TRIM55_uc003xvw.2_Intron|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1							cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			ATATGGTGCCttttttttttt	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4852942	4852943	+	IGR	DEL	GT	-	-	rs71931877		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4852942_4852943delGT								LOC100216001 (132680 upstream) : AKR1E2 (15459 downstream)																							AGCTTTCGTGgtgtgtgtgtgt	0.257													4	2	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94268316	94268317	+	Intron	INS	-	A	A	rs144722232		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268316_94268317insA	uc001kia.2	-							NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	atctaaaaaagaaaaaaaaAAA	0.188													5	3	---	---	---	---	
C10orf26	54838	broad.mit.edu	37	10	104503753	104503754	+	5'UTR	INS	-	GGGAGG	GGGAGG			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104503753_104503754insGGGAGG	uc001kwf.3	+	1					C10orf26_uc009xxg.1_RNA	NM_001083913	NP_001077382	Q9NX94	OPA1L_HUMAN	hypothetical protein LOC54838 isoform 1							integral to membrane				central_nervous_system(1)	1		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;6.14e-09)|all cancers(201;1.66e-07)|BRCA - Breast invasive adenocarcinoma(275;0.224)		agaggaggagagggaggaggag	0.302													2	5	---	---	---	---	
TCERG1L	256536	broad.mit.edu	37	10	133055212	133055215	+	Intron	DEL	GAAG	-	-	rs141999228		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133055212_133055215delGAAG	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		ggaagagaaagaaggaaggaagga	0.000													4	2	---	---	---	---	
KRT79	338785	broad.mit.edu	37	12	53223675	53223675	+	Intron	DEL	A	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53223675delA	uc001sbb.2	-						KRT79_uc001sba.2_Intron	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L							keratin filament	structural molecule activity			ovary(2)|skin(2)	4						actccgtctcaaaaaaaaaaG	0.204													6	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117917834	117917835	+	Intron	DEL	TG	-	-	rs150630387		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117917834_117917835delTG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CACAtgtgtatgtgtgtgtgtg	0.228													3	3	---	---	---	---	
PITPNM2	57605	broad.mit.edu	37	12	123618359	123618362	+	Intron	DEL	ACAG	-	-	rs10589925		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123618359_123618362delACAG	uc001uek.1	-							NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,						metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		acacacacacacagacacacacac	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22300182	22300190	+	IGR	DEL	ATCACCACT	-	-	rs144766632	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22300182_22300190delATCACCACT								FGF9 (21542 upstream) : None (None downstream)																							catcaccaccatcaccactaccatcacca	0.000													6	4	---	---	---	---	
ATP12A	479	broad.mit.edu	37	13	25260915	25260916	+	Intron	INS	-	GAAA	GAAA	rs9553419	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25260915_25260916insGAAA	uc001upp.2	+						ATP12A_uc010aaa.2_Intron	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A						ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	aaggaaggaaggaaagaaagaa	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	30984754	30984755	+	IGR	INS	-	AGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA	AGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA	rs68107497		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30984754_30984755insAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA								LOC100188949 (36718 upstream) : HMGB1 (48126 downstream)																							aagaaaGAGAGaggaaggaagg	0.084													4	2	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33751980	33751983	+	Intron	DEL	AAGG	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33751980_33751983delAAGG	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		gaaggaaggaaaggaaggaaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	53277555	53277556	+	IGR	INS	-	GT	GT	rs150000297	by1000genomes	TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53277555_53277556insGT								ONECUT1 (195346 upstream) : WDR72 (528382 downstream)																							TGTACACTTCCgtgtgtgtgtg	0.327													3	4	---	---	---	---	
GOLGA6L5	374650	broad.mit.edu	37	15	85055754	85055756	+	RNA	DEL	CTC	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85055754_85055756delCTC	uc002bkm.2	-	6		c.804_806delGAG				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						CACGTAGCCTCTCCTCCTGTTCA	0.547													6	3	---	---	---	---	
ADAMTS17	170691	broad.mit.edu	37	15	100672459	100672459	+	Intron	DEL	A	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100672459delA	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CCCATTTGCTAAATTTACATA	0.498											OREG0023513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19056912	19056913	+	Intron	DEL	TC	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19056912_19056913delTC	uc002dfq.2	+						TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						CTGGTAACtttctttttttttt	0.203													3	3	---	---	---	---	
TMC5	79838	broad.mit.edu	37	16	19476434	19476445	+	Intron	DEL	CCTCCCTCCCTC	-	-	rs71812351		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19476434_19476445delCCTCCCTCCCTC	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron|TMC5_uc002dgd.1_Intron|TMC5_uc002dge.3_Intron|TMC5_uc002dgf.3_Intron|TMC5_uc002dgg.3_Intron	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1						ttccttccttcctccctccctccctccctccc	0.014													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	3895175	3895176	+	IGR	INS	-	CTTC	CTTC	rs72199089		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3895175_3895176insCTTC								ATP2A3 (27439 upstream) : ZZEF1 (12564 downstream)																							ctctctctcttcttccttcctt	0.109													4	3	---	---	---	---	
KRTAP4-1	85285	broad.mit.edu	37	17	39340475	39340477	+	Splice_Site	DEL	TGC	-	-	rs145519739		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39340475_39340477delTGC	uc002hwe.3	-	2	613	c.572_splice	c.e2+1			NM_033060	NP_149049	Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1							keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GAGGTCTGAATGCTGCTGGGAAG	0.379													6	3	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39754647	39754652	+	Intron	DEL	GATTTC	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39754647_39754652delGATTTC	uc010wfs.1	-							NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		tgggggtggtgatttcagtggtggtg	0.000													4	2	---	---	---	---	
FAM59A	64762	broad.mit.edu	37	18	29973144	29973145	+	Intron	DEL	TT	-	-	rs10708225		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29973144_29973145delTT	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A											ovary(1)|skin(1)	2						CTCTGAATTGtttttttttttt	0.307													4	3	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49103825	49103837	+	Intron	DEL	TCCTGACCATCTG	-	-	rs141710021		TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49103825_49103837delTCCTGACCATCTG	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GGTGCTAAATTCCTGACCATCTGTCCTGGGGCA	0.620													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	77981366	77981366	+	IGR	DEL	T	-	-			TCGA-B0-5104-01A-01D-1421-08	TCGA-B0-5104-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77981366delT								ZCCHC5 (66541 upstream) : LPAR4 (21840 downstream)																							ttctttcttcttttttttttt	0.015													4	2	---	---	---	---	
