Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11291426	11291426	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11291426C>A	uc001asd.2	-	17	2701	c.2580G>T	c.(2578-2580)AAG>AAT	p.K860N		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	860	HEAT 3.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						AAGTAGGGTACTTCCTGTAGG	0.517													8	213	---	---	---	---	PASS
COL8A2	1296	broad.mit.edu	37	1	36563552	36563552	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36563552A>C	uc001bzv.1	-	2	1737	c.1730T>G	c.(1729-1731)TTC>TGC	p.F577C	COL8A2_uc001bzw.1_Missense_Mutation_p.F512C	NM_005202	NP_005193	P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2 precursor	577	C1q.|Nonhelical region (NC1).				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CACCGCAGTGAAGGCCGGTGT	0.662													9	20	---	---	---	---	PASS
NGF	4803	broad.mit.edu	37	1	115829228	115829228	+	Silent	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115829228C>A	uc001efu.1	-	3	358	c.189G>T	c.(187-189)GTG>GTT	p.V63V		NM_002506	NP_002497	P01138	NGF_HUMAN	nerve growth factor, beta polypeptide precursor	63					activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	TCTGCCCCGCCACGCGTGCAG	0.627													26	24	---	---	---	---	PASS
RGL1	23179	broad.mit.edu	37	1	183835159	183835159	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183835159A>G	uc001gqo.2	+	4	534	c.377A>G	c.(376-378)GAA>GGA	p.E126G	RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Missense_Mutation_p.E161G|RGL1_uc010pog.1_Missense_Mutation_p.E124G|RGL1_uc010poh.1_Missense_Mutation_p.E124G|RGL1_uc010poi.1_Missense_Mutation_p.E126G	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation	126	N-terminal Ras-GEF.				cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						CCAAACTGTGAAGAAGATGGA	0.398													61	144	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204380314	204380314	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204380314C>A	uc001hav.3	-	1	631	c.226G>T	c.(226-228)GGA>TGA	p.G76*		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	76					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TGAAGCAATCCGGGGAGCGGC	0.567													41	125	---	---	---	---	PASS
RBBP5	5929	broad.mit.edu	37	1	205069187	205069187	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205069187G>T	uc001hbu.1	-	8	888	c.758C>A	c.(757-759)CCA>CAA	p.P253Q	RBBP5_uc010prd.1_Missense_Mutation_p.P288Q|RBBP5_uc001hbv.1_Missense_Mutation_p.P253Q|RBBP5_uc010pre.1_Missense_Mutation_p.P120Q	NM_005057	NP_005048	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	253	WD 5.				histone H3-K4 methylation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription, DNA-dependent	MLL1 complex|Set1C/COMPASS complex	methylated histone residue binding|transcription regulatory region DNA binding			lung(1)	1	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			TTTCTTCCATGGGGTCCTAAA	0.488													42	70	---	---	---	---	PASS
SMYD2	56950	broad.mit.edu	37	1	214510074	214510074	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214510074G>A	uc010ptx.1	+	12	1282	c.1249G>A	c.(1249-1251)GGC>AGC	p.G417S	SMYD2_uc009xdl.1_RNA	NM_020197	NP_064582	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	417					negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		AGTAGCTCACGGCAAAGATCA	0.403													46	104	---	---	---	---	PASS
CABC1	56997	broad.mit.edu	37	1	227174152	227174152	+	Splice_Site	SNP	A	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227174152A>T	uc001hqm.1	+	20	5079	c.1660_splice	c.e20-2	p.V554_splice	CABC1_uc001hqn.1_Splice_Site_p.V554_splice|CABC1_uc009xeq.1_Splice_Site_p.V502_splice|CABC1_uc010pvq.1_Splice_Site_p.V275_splice|CABC1_uc010pvr.1_Splice_Site_p.V228_splice|CABC1_uc001hqo.1_Splice_Site_p.V275_splice|CABC1_uc009xer.1_Splice_Site_p.V70_splice	NM_020247	NP_064632	Q8NI60	ADCK3_HUMAN	chaperone, ABC1 activity of bc1 complex like						cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)				CTCTTGCCCCAGGTCATGGAA	0.597													12	47	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947660	237947660	+	Silent	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947660G>A	uc001hyl.1	+	90	12768	c.12648G>A	c.(12646-12648)GCG>GCA	p.A4216A	RYR2_uc010pya.1_Silent_p.A631A	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4216					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGAGGTCAGCGAATAAGGAAG	0.542													3	50	---	---	---	---	PASS
TPO	7173	broad.mit.edu	37	2	1440117	1440117	+	Missense_Mutation	SNP	C	A	A	rs138509145		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1440117C>A	uc002qww.2	+	5	534	c.443C>A	c.(442-444)GCG>GAG	p.A148E	TPO_uc010ewj.2_Intron|TPO_uc010yin.1_Missense_Mutation_p.A148E|TPO_uc002qwu.2_Missense_Mutation_p.A148E|TPO_uc002qwr.2_Missense_Mutation_p.A148E|TPO_uc002qwx.2_Missense_Mutation_p.A148E|TPO_uc010yio.1_Missense_Mutation_p.A148E|TPO_uc010yip.1_Missense_Mutation_p.A148E	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	148	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ACTTGCCTGGCGAACAAATAC	0.443													35	84	---	---	---	---	PASS
PAPOLG	64895	broad.mit.edu	37	2	61020826	61020826	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61020826C>T	uc002sai.2	+	18	1975	c.1744C>T	c.(1744-1746)CTT>TTT	p.L582F	PAPOLG_uc002saj.2_Missense_Mutation_p.L271F|PAPOLG_uc002sak.2_Missense_Mutation_p.L117F|PAPOLG_uc010fch.2_Missense_Mutation_p.L271F	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	582					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AGCCCAAGGACTTTCCATTCC	0.299													23	53	---	---	---	---	PASS
ANO10	55129	broad.mit.edu	37	3	43618354	43618354	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43618354T>C	uc003cmv.2	-	6	1163	c.992A>G	c.(991-993)TAT>TGT	p.Y331C	ANO10_uc011azs.1_Missense_Mutation_p.Y331C|ANO10_uc003cmw.2_Missense_Mutation_p.Y265C|ANO10_uc010hil.2_Intron|ANO10_uc011azt.1_Missense_Mutation_p.Y220C	NM_018075	NP_060545	Q9NW15	ANO10_HUMAN	transmembrane protein 16K	331	Helical; (Potential).				cell death	chloride channel complex	chloride channel activity			ovary(2)	2						CATCATGACATACAGTGAGAA	0.522													36	30	---	---	---	---	PASS
FSTL1	11167	broad.mit.edu	37	3	120130797	120130797	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120130797T>G	uc003eds.2	-	4	377	c.202A>C	c.(202-204)AGT>CGT	p.S68R	FSTL1_uc011bjh.1_Missense_Mutation_p.S33R|FSTL1_uc010hrb.2_Missense_Mutation_p.S68R	NM_007085	NP_009016	Q12841	FSTL1_HUMAN	follistatin-like 1 precursor	68	Kazal-like.				BMP signaling pathway	extracellular space	calcium ion binding|heparin binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.189)		TTGCCATTACTGCCACACACA	0.418													36	72	---	---	---	---	PASS
PLOD2	5352	broad.mit.edu	37	3	145820619	145820619	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145820619C>G	uc003evs.1	-	7	1206	c.700G>C	c.(700-702)GAA>CAA	p.E234Q	PLOD2_uc011bnm.1_Missense_Mutation_p.E179Q|PLOD2_uc003evr.1_Missense_Mutation_p.E234Q	NM_000935	NP_000926	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	234					protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)	TTGCCATTTTCAAATTTTAAA	0.244													25	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	149700473	149700473	+	IGR	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149700473T>C								PFN2 (11732 upstream) : TSC22D2 (426315 downstream)																							ATACATATGGTACAGAGATCG	0.502													94	181	---	---	---	---	PASS
MYNN	55892	broad.mit.edu	37	3	169492076	169492076	+	5'UTR	SNP	A	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169492076A>G	uc003fft.2	+	2					MYNN_uc011bpm.1_5'UTR|MYNN_uc003ffu.2_5'UTR|MYNN_uc003ffv.2_5'UTR|MYNN_uc010hwo.2_5'UTR	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			TTCCATTCTGATATCAAAATG	0.418													63	152	---	---	---	---	PASS
NAALADL2	254827	broad.mit.edu	37	3	174815003	174815003	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174815003C>G	uc003fit.2	+	2	554	c.467C>G	c.(466-468)TCT>TGT	p.S156C	NAALADL2_uc003fiu.1_Missense_Mutation_p.S149C	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	156	Extracellular (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GATGCTCCATCTTCAGGAACA	0.363													86	174	---	---	---	---	PASS
ZBTB49	166793	broad.mit.edu	37	4	4304210	4304210	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4304210T>G	uc003ghu.2	+	3	822	c.647T>G	c.(646-648)CTC>CGC	p.L216R	ZBTB49_uc003ghv.2_5'UTR|ZBTB49_uc010icy.2_RNA|ZBTB49_uc010icz.2_5'UTR	NM_145291	NP_660334	Q6ZSB9	ZBT49_HUMAN	zinc finger protein 509	216					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						TATTACAAACTCAGAAACTTT	0.453													26	57	---	---	---	---	PASS
F2R	2149	broad.mit.edu	37	5	76028881	76028881	+	Silent	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76028881C>A	uc003ken.3	+	2	1096	c.831C>A	c.(829-831)GTC>GTA	p.V277V		NM_001992	NP_001983	P25116	PAR1_HUMAN	coagulation factor II receptor precursor	277	Helical; Name=5; (Potential).				activation of caspase activity|anatomical structure morphogenesis|connective tissue replacement involved in inflammatory response wound healing|negative regulation of cell proliferation|platelet activation|positive regulation of blood coagulation|positive regulation of cell migration|positive regulation of collagen biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JAK-STAT cascade|positive regulation of MAPKKK cascade|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of transcription, DNA-dependent|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	caveola|extracellular region|Golgi apparatus|integral to plasma membrane|platelet dense tubular network	receptor binding|thrombin receptor activity			ovary(3)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	TCTCTGCTGTCTTCTTTTTTG	0.507													46	110	---	---	---	---	PASS
SHROOM1	134549	broad.mit.edu	37	5	132158730	132158730	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132158730C>T	uc003kxx.2	-	10	3122	c.2317G>A	c.(2317-2319)GTG>ATG	p.V773M	SHROOM1_uc003kxy.1_Missense_Mutation_p.V768M	NM_133456	NP_597713	Q2M3G4	SHRM1_HUMAN	shroom family member 1	773	ASD2.				actin filament bundle assembly|cell morphogenesis	cytoplasm|microtubule	actin filament binding			pancreas(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACCTCCCGCACGGCCCGCTCG	0.721													5	19	---	---	---	---	PASS
SAR1B	51128	broad.mit.edu	37	5	133944073	133944073	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133944073T>A	uc003kzq.2	-	7	716	c.469A>T	c.(469-471)ACA>TCA	p.T157S	SAR1B_uc003kzr.2_Missense_Mutation_p.T157S	NM_001033503	NP_001028675	Q9Y6B6	SAR1B_HUMAN	SAR1a gene homolog 2	157					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi cisterna membrane	GTP binding|GTPase activity|metal ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTTCCTGTTGTCTGACCATAT	0.358													9	22	---	---	---	---	PASS
GNB2L1	10399	broad.mit.edu	37	5	180668903	180668903	+	Intron	SNP	A	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180668903A>C	uc003mni.1	-						GNB2L1_uc003mnh.1_Intron|GNB2L1_uc003mnk.1_5'UTR|GNB2L1_uc003mnj.1_Intron|GNB2L1_uc003mnl.1_5'Flank|GNB2L1_uc011dhk.1_Intron|GNB2L1_uc010jls.2_Intron|GNB2L1_uc011dhl.1_Intron|SNORD96A_uc010jlt.1_5'Flank	NM_006098	NP_006089	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein),						apoptosis|cell cycle|gastrulation|interspecies interaction between organisms|negative regulation of cell growth|negative regulation of phagocytosis|negative regulation of translation|negative regulation of Wnt receptor signaling pathway|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of gastrulation|positive regulation of GTPase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein homooligomerization|positive regulation of protein phosphorylation|regulation of cell cycle|regulation of cell division|regulation of establishment of cell polarity|regulation of protein localization|rhythmic process	cytoskeleton|dendrite|midbody|nucleus|perikaryon|perinuclear region of cytoplasm|phagocytic cup|small ribosomal subunit	ion channel inhibitor activity|protein kinase C binding|protein phosphatase binding|protein tyrosine kinase inhibitor activity|receptor tyrosine kinase binding|SH2 domain binding				0	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		CTCTAATTCCACCTGCCAATT	0.478													11	72	---	---	---	---	PASS
OR2W1	26692	broad.mit.edu	37	6	29012082	29012082	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29012082T>A	uc003nlw.2	-	1	871	c.871A>T	c.(871-873)ACC>TCC	p.T291S		NM_030903	NP_112165	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W,	291	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TTTCTTAAGGTGTAAATGAGC	0.428													13	49	---	---	---	---	PASS
GABBR1	2550	broad.mit.edu	37	6	29550080	29550080	+	Intron	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29550080G>A	uc003nmp.3	-						SNORD32B_uc003nmq.2_RNA	NM_021903	NP_068703	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1						gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	ATGGCCATGAGACCAACCCCA	0.398													30	38	---	---	---	---	PASS
TAPBP	6892	broad.mit.edu	37	6	33272444	33272444	+	Intron	SNP	G	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33272444G>C	uc003odx.1	-						TAPBP_uc010jus.1_Intron|TAPBP_uc003ody.2_3'UTR|TAPBP_uc003odz.2_Intron|TAPBP_uc010jut.1_Intron|TAPBP_uc011drc.1_Intron	NM_003190	NP_003181	O15533	TPSN_HUMAN	tapasin isoform 1 precursor						antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding			ovary(1)	1						ATGAGCATAGGGAAATCAGTC	0.552													17	27	---	---	---	---	PASS
BAK1	578	broad.mit.edu	37	6	33542988	33542988	+	Intron	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33542988C>T	uc003oes.2	-						BAK1_uc003oer.2_Intron|BAK1_uc003oet.2_Intron|BAK1_uc010jvb.2_Intron|BAK1_uc003oeu.2_Intron|BAK1_uc011drj.1_3'UTR	NM_001188	NP_001179	Q16611	BAK_HUMAN	BCL2-antagonist/killer 1						activation of pro-apoptotic gene products|cellular response to mechanical stimulus|cellular response to UV|establishment or maintenance of transmembrane electrochemical gradient|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|release of cytochrome c from mitochondria	integral to mitochondrial outer membrane|pore complex	metal ion binding|protein heterodimerization activity			ovary(1)	1						TCTCCCCATGCCAGGAGAGCA	0.537													3	31	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33639879	33639879	+	Silent	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33639879C>T	uc011drk.1	+	22	3021	c.2802C>T	c.(2800-2802)TCC>TCT	p.S934S		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	934	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						GCAAGCAGTCCGTCTTCAGTG	0.607													15	47	---	---	---	---	PASS
CDKN1A	1026	broad.mit.edu	37	6	36652157	36652157	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36652157G>C	uc003omm.3	+	2	401	c.279G>C	c.(277-279)AGG>AGC	p.R93S	CDKN1A_uc011dtq.1_Missense_Mutation_p.R127S|CDKN1A_uc003oml.2_Missense_Mutation_p.R93S|CDKN1A_uc003omn.2_Missense_Mutation_p.R93S	NM_000389	NP_000380	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A	93					cell cycle arrest|cellular response to extracellular stimulus|cellular response to ionizing radiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of fibroblast proliferation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|S phase of mitotic cell cycle|stress-induced premature senescence	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleoplasm|PCNA-p21 complex	cyclin-dependent protein kinase activating kinase activity|cyclin-dependent protein kinase inhibitor activity|metal ion binding			ovary(1)|breast(1)	2						GAGGAGGCAGGCGGCCTGGCA	0.672									Multiple_Endocrine_Neoplasia_type_1				9	22	---	---	---	---	PASS
TNFRSF21	27242	broad.mit.edu	37	6	47200394	47200394	+	3'UTR	SNP	C	A	A	rs34093099		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47200394C>A	uc003oyv.2	-	6						NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,						cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)			cacacacacacaaacacacac	0.259													5	19	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128150971	128150971	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128150971T>C	uc003qbi.2	-	4	678	c.359A>G	c.(358-360)CAG>CGG	p.Q120R	THEMIS_uc010kfa.2_Missense_Mutation_p.Q23R|THEMIS_uc011ebt.1_Missense_Mutation_p.Q120R|THEMIS_uc010kfb.2_Missense_Mutation_p.Q85R	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	120	CABIT 1.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						TATATCCTTCTGATGATAGAA	0.398													77	76	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129833510	129833510	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129833510G>C	uc003qbn.2	+	62	8965	c.8860G>C	c.(8860-8862)GGT>CGT	p.G2954R	LAMA2_uc003qbo.2_Missense_Mutation_p.G2950R|uc003qbq.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2954	Laminin G-like 5.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TTTTACAGTTGGTGGATTCAA	0.343													4	87	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121651278	121651278	+	Silent	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121651278T>C	uc003vjy.2	+	12	2573	c.2178T>C	c.(2176-2178)CAT>CAC	p.H726H	PTPRZ1_uc003vjz.2_Silent_p.H726H|PTPRZ1_uc011knt.1_Silent_p.H176H	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	726	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						TAACACCTCATGCTTTTACCC	0.493													8	131	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32505280	32505280	+	Intron	SNP	G	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32505280G>C	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Missense_Mutation_p.R15T|NRG1_uc010lvt.2_Missense_Mutation_p.R15T	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GCCGCCGAGAGGTCCTCCAGC	0.602													13	27	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67578932	67578932	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67578932C>A	uc003xwn.2	-	1	521	c.262G>T	c.(262-264)GTG>TTG	p.V88L	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	88					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GGGTCGGTCACCTCCTCAACC	0.622													14	29	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67578933	67578933	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67578933C>G	uc003xwn.2	-	1	520	c.261G>C	c.(259-261)GAG>GAC	p.E87D	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	87					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GGTCGGTCACCTCCTCAACCC	0.622													14	28	---	---	---	---	PASS
SULF1	23213	broad.mit.edu	37	8	70512843	70512843	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70512843C>G	uc010lza.1	+	9	1457	c.740C>G	c.(739-741)CCT>CGT	p.P247R	SULF1_uc003xyd.2_Missense_Mutation_p.P247R|SULF1_uc003xye.2_Missense_Mutation_p.P247R|SULF1_uc003xyf.2_Missense_Mutation_p.P247R|SULF1_uc003xyg.2_Missense_Mutation_p.P247R|SULF1_uc003xyh.1_RNA	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	247					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TTCAGAACTCCTAGTTATAAC	0.348													53	119	---	---	---	---	PASS
OSGIN2	734	broad.mit.edu	37	8	90937648	90937648	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90937648A>G	uc003yeg.2	+	6	1752	c.1406A>G	c.(1405-1407)AAT>AGT	p.N469S	OSGIN2_uc003yeh.2_Missense_Mutation_p.N513S	NM_004337	NP_004328	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family	469					germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)			GTTGGAGACAATTTTGTTCGA	0.403													16	248	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100847774	100847774	+	Silent	SNP	A	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100847774A>G	uc003yiv.2	+	54	9936	c.9825A>G	c.(9823-9825)CCA>CCG	p.P3275P	VPS13B_uc003yiw.2_Silent_p.P3250P	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3275					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CAGATATTCCAAAGTTTGAGG	0.373													56	119	---	---	---	---	PASS
IFNA7	3444	broad.mit.edu	37	9	21201782	21201782	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21201782C>A	uc003zop.1	-	1	423	c.383G>T	c.(382-384)GGG>GTG	p.G128V	IFNA14_uc003zoo.1_Intron	NM_021057	NP_066401	P01567	IFNA7_HUMAN	interferon, alpha 7 precursor	128					blood coagulation|cell-cell signaling|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding				0				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CTCTTCCACCCCAACCTCCTG	0.453													11	405	---	---	---	---	PASS
LAMC3	10319	broad.mit.edu	37	9	133914596	133914596	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133914596G>C	uc004caa.1	+	6	1342	c.1244G>C	c.(1243-1245)TGT>TCT	p.C415S		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	415	Laminin EGF-like 3.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TGTGACCGCTGTCTGCCCGGG	0.632													6	19	---	---	---	---	PASS
ADAMTSL2	9719	broad.mit.edu	37	9	136401894	136401894	+	Silent	SNP	A	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136401894A>G	uc011mdl.1	+	2	617	c.60A>G	c.(58-60)GTA>GTG	p.V20V	ADAMTSL2_uc004cei.2_Silent_p.V20V	NM_001145320	NP_001138792	Q86TH1	ATL2_HUMAN	ADAMTS-like 2 precursor	20					negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		TGGCAGTTGTAGCTGGGGACA	0.602													5	148	---	---	---	---	PASS
OLFM1	10439	broad.mit.edu	37	9	137990174	137990174	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137990174G>C	uc010nar.2	+	4	815	c.499G>C	c.(499-501)GTG>CTG	p.V167L	OLFM1_uc004cfl.3_Missense_Mutation_p.V149L	NM_014279	NP_055094	Q99784	NOE1_HUMAN	olfactomedin related ER localized protein	167	Potential.				nervous system development	endoplasmic reticulum lumen	protein binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		TTTGATACCTGTGTTGGAAGA	0.458													51	96	---	---	---	---	PASS
IDI2	91734	broad.mit.edu	37	10	1065406	1065406	+	3'UTR	SNP	G	A	A	rs41260144	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1065406G>A	uc001ifv.1	-	5						NM_033261	NP_150286	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2						carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		TCAATGGTGCGTCTGCCTGCA	0.483													9	9	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	22002761	22002761	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22002761C>T	uc001iqs.2	+	15	2156	c.1808C>T	c.(1807-1809)TCT>TTT	p.S603F	MLLT10_uc001iqt.2_Missense_Mutation_p.S587F|MLLT10_uc001iqv.2_RNA|MLLT10_uc001iqy.2_Missense_Mutation_p.S587F|MLLT10_uc001ira.2_Missense_Mutation_p.S44F|MLLT10_uc001irb.2_RNA	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	603	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						GGCTCGGGATCTAGTACTCCT	0.433			T	MLL|PICALM|CDK6	AL								68	134	---	---	---	---	PASS
BICC1	80114	broad.mit.edu	37	10	60558280	60558280	+	Silent	SNP	A	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60558280A>G	uc001jki.1	+	11	1488	c.1488A>G	c.(1486-1488)ACA>ACG	p.T496T	BICC1_uc001jkj.1_Silent_p.T137T	NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1	496					multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						CCAGCCCCACATTATGGGCAC	0.413													72	182	---	---	---	---	PASS
OIT3	170392	broad.mit.edu	37	10	74673124	74673124	+	Silent	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74673124T>C	uc001jte.1	+	6	1067	c.849T>C	c.(847-849)GGT>GGC	p.G283G	OIT3_uc009xqs.1_RNA	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor	283	ZP.					nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					AGCTGGTTGGTGGCCTGGAGC	0.532													87	171	---	---	---	---	PASS
DNAJC9	23234	broad.mit.edu	37	10	75003130	75003130	+	3'UTR	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75003130C>A	uc001jtr.2	-	5					DNAJC9_uc010qkg.1_3'UTR	NM_015190	NP_056005	Q8WXX5	DNJC9_HUMAN	DnaJ homolog, subfamily C, member 9						protein folding		heat shock protein binding|unfolded protein binding				0	Prostate(51;0.0119)					CAATTTACACCTAAGGACCTT	0.398													65	157	---	---	---	---	PASS
DOCK1	1793	broad.mit.edu	37	10	128944247	128944247	+	Intron	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128944247G>A	uc001ljt.2	+						DOCK1_uc010qun.1_Intron|FAM196A_uc010quo.1_Intron|FAM196A_uc001ljv.1_Intron|FAM196A_uc001lju.1_Intron|FAM196A_uc009yap.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CCTGCCCTGGGGACCCCGCAC	0.552													8	15	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023864	6023864	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023864A>G	uc010qzv.1	-	1	515	c.515T>C	c.(514-516)GTC>GCC	p.V172A		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	120	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATAGGCCATGACCATGAACGT	0.498													3	64	---	---	---	---	PASS
STK33	65975	broad.mit.edu	37	11	8496516	8496516	+	5'UTR	SNP	G	A	A	rs2289923	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8496516G>A	uc001mgi.1	-	1					STK33_uc001mgj.1_5'UTR|STK33_uc001mgk.1_5'UTR|STK33_uc010rbn.1_Intron|STK33_uc001mgl.3_Intron|STK33_uc009yfp.2_Intron	NM_030906	NP_112168	Q9BYT3	STK33_HUMAN	serine/threonine kinase 33							Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		AGAAAACCAGGCCAAAAAGGA	0.378													4	90	---	---	---	---	PASS
EIF3M	10480	broad.mit.edu	37	11	32610272	32610272	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32610272T>C	uc001mtu.2	+	3	351	c.308T>C	c.(307-309)CTG>CCG	p.L103P	EIF3M_uc010ref.1_Intron	NM_006360	NP_006351	Q7L2H7	EIF3M_HUMAN	eukaryotic translation initiation factor 3,	103						eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)					TCTCTGAGACTGCAGTTGTAA	0.338													94	207	---	---	---	---	PASS
C11orf74	119710	broad.mit.edu	37	11	36680650	36680650	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36680650C>T	uc001mwy.1	+	6	653	c.580C>T	c.(580-582)CCT>TCT	p.P194S	C11orf74_uc010rfd.1_RNA|C11orf74_uc001mww.1_Missense_Mutation_p.P120S|C11orf74_uc001mwx.1_Intron|C11orf74_uc001mwz.1_Missense_Mutation_p.P120S|C11orf74_uc010rfe.1_Intron	NM_138787	NP_620142	Q86VG3	CK074_HUMAN	hypothetical protein LOC119710	194											0	all_lung(20;0.226)	all_hematologic(20;0.0118)				CAAGTTTAGTCCTGCAGAGAT	0.393													29	58	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68312471	68312471	+	Silent	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68312471T>C	uc001onw.2	+	4	660	c.393T>C	c.(391-393)CTT>CTC	p.L131L	SAPS3_uc010rqb.1_Silent_p.L40L|SAPS3_uc001onv.2_Silent_p.L131L|SAPS3_uc001ony.3_Silent_p.L131L|SAPS3_uc001onx.2_Silent_p.L131L|SAPS3_uc009ysh.2_Silent_p.L131L|SAPS3_uc001onu.2_Silent_p.L131L|SAPS3_uc010rqc.1_Silent_p.L40L	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	131					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			TAAGTATTCTTATCAGCAGAA	0.393													59	132	---	---	---	---	PASS
PPP2R1B	5519	broad.mit.edu	37	11	111624212	111624212	+	Silent	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111624212G>T	uc001plx.1	-	9	1203	c.1119C>A	c.(1117-1119)ACC>ACA	p.T373T	PPP2R1B_uc001plw.1_Silent_p.T373T|PPP2R1B_uc010rwi.1_Silent_p.T309T|PPP2R1B_uc010rwj.1_Silent_p.T212T|PPP2R1B_uc010rwk.1_Intron|PPP2R1B_uc010rwl.1_Silent_p.T246T	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein	373	HEAT 10.						protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		GATGTTCAATGGTATTTTCTT	0.333													36	69	---	---	---	---	PASS
OR10G7	390265	broad.mit.edu	37	11	123909297	123909297	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123909297G>A	uc001pzq.1	-	1	412	c.412C>T	c.(412-414)CGC>TGC	p.R138C		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GCACACGAGCGCCCAGTCATC	0.562													7	272	---	---	---	---	PASS
DCN	1634	broad.mit.edu	37	12	91545456	91545456	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91545456C>A	uc001tbs.2	-	6	954	c.860G>T	c.(859-861)GGG>GTG	p.G287V	DCN_uc001tbo.2_Missense_Mutation_p.G178V|DCN_uc001tbp.2_Missense_Mutation_p.G140V|DCN_uc001tbq.2_Intron|DCN_uc001tbr.2_Intron|DCN_uc001tbt.2_Missense_Mutation_p.G287V|DCN_uc001tbu.2_Missense_Mutation_p.G287V	NM_133503	NP_598010	P07585	PGS2_HUMAN	decorin isoform a preproprotein	287	LRR 10.				organ morphogenesis	extracellular space				central_nervous_system(2)|ovary(1)|lung(1)	4						CTCTGCCAGCCCACCAGGTAC	0.502													19	52	---	---	---	---	PASS
RBM19	9904	broad.mit.edu	37	12	114352885	114352885	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114352885G>A	uc009zwi.2	-	21	2591	c.2447C>T	c.(2446-2448)GCC>GTC	p.A816V	RBM19_uc001tvn.3_Missense_Mutation_p.A816V|RBM19_uc001tvm.2_Missense_Mutation_p.A816V	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	816					multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CAATGTCACGGCTGGCCTGGA	0.572													4	69	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117703219	117703219	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117703219C>T	uc001twm.1	-	12	2724	c.2038G>A	c.(2038-2040)GAC>AAC	p.D680N		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	680					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CACACCCAGTCGGCAGGGCAG	0.587													10	10	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124272412	124272412	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124272412A>T	uc001uft.3	+	10	1325	c.1300A>T	c.(1300-1302)AAA>TAA	p.K434*	DNAH10_uc010tav.1_5'Flank|DNAH10_uc010taw.1_5'Flank	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	434	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CAGGCTGTGGAAAAAGGCCTA	0.557													9	26	---	---	---	---	PASS
CHFR	55743	broad.mit.edu	37	12	133435664	133435664	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133435664C>T	uc001ulf.2	-	8	1021	c.937G>A	c.(937-939)GAC>AAC	p.D313N	CHFR_uc001ulc.1_RNA|CHFR_uc001ule.2_Missense_Mutation_p.D301N|CHFR_uc010tbs.1_Missense_Mutation_p.D313N|CHFR_uc001uld.2_Missense_Mutation_p.D272N|CHFR_uc010tbt.1_Missense_Mutation_p.D221N	NM_001161344	NP_001154816	Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains	313	RING-type.				cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		CTCACGCAGTCGTGCAGCAGG	0.612													18	28	---	---	---	---	PASS
C13orf18	80183	broad.mit.edu	37	13	46919734	46919734	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46919734C>A	uc010acl.2	-	13	2238	c.1633G>T	c.(1633-1635)GCA>TCA	p.A545S	C13orf18_uc010tfy.1_Missense_Mutation_p.A68S|C13orf18_uc001vbf.3_Missense_Mutation_p.A478S|C13orf18_uc001vbg.3_Missense_Mutation_p.A273S|C13orf18_uc010tfz.1_Missense_Mutation_p.A388S|C13orf18_uc010acm.2_Missense_Mutation_p.A410S|C13orf18_uc010acn.2_Missense_Mutation_p.A330S|C13orf18_uc001vbe.3_Intron|C13orf18_uc001vbh.3_Missense_Mutation_p.A545S|C13orf18_uc001vbi.3_Missense_Mutation_p.A388S	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183	545											0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		TCCTTTAATGCACTGCCAGAG	0.517													16	23	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61985497	61985497	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61985497C>G	uc001vid.3	-	2	3099	c.2735G>C	c.(2734-2736)TGT>TCT	p.C912S	PCDH20_uc010thj.1_Missense_Mutation_p.C912S	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	885	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TTTCCTTAAACAGATGTATAT	0.433													17	92	---	---	---	---	PASS
C13orf34	79866	broad.mit.edu	37	13	73309117	73309117	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73309117G>C	uc001viv.1	+	4	399	c.280G>C	c.(280-282)GAC>CAC	p.D94H	C13orf34_uc010thq.1_Intron|C13orf34_uc010aen.1_Missense_Mutation_p.D169H|C13orf34_uc010thr.1_Missense_Mutation_p.D24H|C13orf34_uc001viw.1_Intron	NM_024808	NP_079084	Q6PGQ7	BORA_HUMAN	aurora borealis	94					cell division|mitosis|regulation of mitosis|regulation of mitotic spindle organization|regulation of protein localization		protein kinase binding				0		Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.000227)		AGATGTGGAAGACAAAAGACA	0.274													30	67	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24884387	24884387	+	Silent	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24884387C>A	uc001wpf.3	+	9	3750	c.3432C>A	c.(3430-3432)GCC>GCA	p.A1144A		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	1144					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						TGAAGCGAGCCCTGGTGTCTG	0.662													3	55	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33292027	33292027	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33292027G>T	uc001wrq.2	+	13	5178	c.5008G>T	c.(5008-5010)GGC>TGC	p.G1670C		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1670	Ser-rich.				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GTCCTTTACTGGCCAGATGTC	0.438													27	88	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33292028	33292028	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33292028G>T	uc001wrq.2	+	13	5179	c.5009G>T	c.(5008-5010)GGC>GTC	p.G1670V		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1670	Ser-rich.				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TCCTTTACTGGCCAGATGTCA	0.433													27	87	---	---	---	---	PASS
CTAGE5	4253	broad.mit.edu	37	14	39783984	39783984	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39783984T>C	uc001wvg.3	+	15	1673	c.1337T>C	c.(1336-1338)ATT>ACT	p.I446T	CTAGE5_uc010tqe.1_Missense_Mutation_p.I408T|CTAGE5_uc001wuz.3_Missense_Mutation_p.I434T|CTAGE5_uc001wuy.3_Missense_Mutation_p.I366T|CTAGE5_uc001wvb.3_Missense_Mutation_p.I417T|CTAGE5_uc001wvc.3_Missense_Mutation_p.I391T|CTAGE5_uc001wva.3_Missense_Mutation_p.I417T|CTAGE5_uc001wvh.3_Missense_Mutation_p.I446T|CTAGE5_uc001wvf.3_Missense_Mutation_p.I371T|CTAGE5_uc001wvi.3_Missense_Mutation_p.I451T|CTAGE5_uc010amz.2_Missense_Mutation_p.I62T|CTAGE5_uc001wvj.3_Missense_Mutation_p.I417T	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	446	Potential.						enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		GAGAGAACTATTCATTCTTAT	0.229													4	167	---	---	---	---	PASS
WDR25	79446	broad.mit.edu	37	14	100847489	100847489	+	Nonsense_Mutation	SNP	T	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100847489T>A	uc010avx.2	+	2	321	c.228T>A	c.(226-228)TAT>TAA	p.Y76*	WDR25_uc001yhm.2_Nonsense_Mutation_p.Y68*|WDR25_uc001yhn.2_Nonsense_Mutation_p.Y76*|WDR25_uc010avy.2_RNA|WDR25_uc001yho.2_5'Flank	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25	76											0		Melanoma(154;0.212)				CAGGGGGCTATCGCCTTCCAT	0.597													32	49	---	---	---	---	PASS
GOLGA8C	729786	broad.mit.edu	37	15	20777925	20777925	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20777925G>T	uc010tzc.1	+	18	2181	c.1166G>T	c.(1165-1167)GGA>GTA	p.G389V	uc001ytq.2_5'Flank	NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E											skin(1)	1						CCTGTGCAAGGAGAGACCAGG	0.617													3	16	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	30012148	30012148	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30012148T>A	uc001zcr.2	-	20	3311	c.2836A>T	c.(2836-2838)AAT>TAT	p.N946Y	TJP1_uc010azl.2_Missense_Mutation_p.N934Y|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	946					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ACATTATGATTAACAGCAGAG	0.408													63	136	---	---	---	---	PASS
RAD51	5888	broad.mit.edu	37	15	40993342	40993342	+	Silent	SNP	A	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40993342A>T	uc001zmi.3	+	3	467	c.168A>T	c.(166-168)CCA>CCT	p.P56P	RAD51_uc010bbw.2_Silent_p.P56P|RAD51_uc010bbx.2_Silent_p.P56P|RAD51_uc001zmk.3_RNA|RAD51_uc001zml.3_Silent_p.P56P|RAD51_uc001zmm.1_RNA|RAD51_uc001zmn.1_5'UTR	NM_002875	NP_002866	Q06609	RAD51_HUMAN	RAD51 homolog protein isoform 1	56	HhH.				DNA recombinase assembly|DNA unwinding involved in replication|mitotic recombination|positive regulation of DNA ligation|protein homooligomerization|reciprocal meiotic recombination	mitochondrial matrix|nucleus|perinuclear region of cytoplasm|PML body	ATP binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|protein C-terminus binding|single-stranded DNA binding|single-stranded DNA-dependent ATPase activity				0		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		CCTATGCGCCAAAGAAGGAGC	0.408								Homologous_recombination					60	113	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52510811	52510811	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52510811C>T	uc010bff.2	-	32	3996	c.3859G>A	c.(3859-3861)GAG>AAG	p.E1287K	MYO5C_uc010uga.1_RNA	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	1287	Potential.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		TCACTGGCCTCCTGCATTTCT	0.463													30	70	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89382024	89382024	+	Silent	SNP	C	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89382024C>G	uc010upo.1	+	3	575	c.201C>G	c.(199-201)GCC>GCG	p.A67A	ACAN_uc002bmx.2_Silent_p.A67A|ACAN_uc010upp.1_Silent_p.A67A|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	67					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CTTCTACCGCCCCACTGGCCC	0.637													20	39	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652													5	24	---	---	---	---	PASS
TELO2	9894	broad.mit.edu	37	16	1552946	1552946	+	Silent	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1552946G>T	uc002cly.2	+	15	2076	c.1785G>T	c.(1783-1785)CTG>CTT	p.L595L		NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	595						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				CCGACTATCTGACCTCACAGT	0.657													49	115	---	---	---	---	PASS
UBN1	29855	broad.mit.edu	37	16	4903144	4903144	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4903144A>C	uc002cyb.2	+	2	565	c.226A>C	c.(226-228)AAA>CAA	p.K76Q	UBN1_uc010uxw.1_Missense_Mutation_p.K76Q|UBN1_uc002cyc.2_Missense_Mutation_p.K76Q	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1	76	Sufficient for interaction with HIRA.				chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						AGGGAAGGTAAAAGGCCTTCA	0.537													32	76	---	---	---	---	PASS
C16orf62	57020	broad.mit.edu	37	16	19576270	19576270	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19576270A>C	uc002dgn.1	+	2	127	c.115A>C	c.(115-117)ACT>CCT	p.T39P	C16orf62_uc002dgo.1_Missense_Mutation_p.T39P|C16orf62_uc010vas.1_5'UTR|C16orf62_uc002dgm.1_Missense_Mutation_p.T39P	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020	39						integral to membrane				ovary(1)	1						GAAACCCATAACTGTAAGTTT	0.433													32	58	---	---	---	---	PASS
LOC81691	81691	broad.mit.edu	37	16	20851655	20851655	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20851655G>T	uc002dhv.2	+	15	1754	c.1491G>T	c.(1489-1491)ATG>ATT	p.M497I	ERI2_uc002dht.3_Intron|LOC81691_uc002dhx.2_Missense_Mutation_p.M497I|LOC81691_uc002dhw.2_Missense_Mutation_p.M240I|LOC81691_uc002dhy.3_Missense_Mutation_p.M497I	NM_030941	NP_112203	Q96IC2	REXON_HUMAN	exonuclease NEF-sp isoform 1	497						nucleolus	exonuclease activity|nucleotide binding|RNA binding			ovary(1)|kidney(1)	2						TCCTACAGATGAGGATCAAGT	0.388													39	98	---	---	---	---	PASS
CNGB1	1258	broad.mit.edu	37	16	57984387	57984387	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57984387G>A	uc002emt.2	-	13	997	c.932C>T	c.(931-933)CCG>CTG	p.P311L	CNGB1_uc010cdh.2_Missense_Mutation_p.P305L	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	311					sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						CTCCCAGGGCGGTTCAACCTC	0.557													4	108	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	88620237	88620237	+	Silent	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88620237T>C	uc010vox.1	-	2	393	c.393A>G	c.(391-393)GCA>GCG	p.A131A						RecName: Full=Putative uncharacterized protein C16orf85;																		GGGGAATGCGTGCCGAGTGGA	0.527													40	50	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1582621	1582621	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1582621G>A	uc002fte.2	-	10	1487	c.1373C>T	c.(1372-1374)GCC>GTC	p.A458V		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	458						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		ATGCTTCAGGGCATTCAGCAC	0.537													62	114	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35609856	35609856	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35609856T>C	uc002hnm.2	-	15	2013	c.1822A>G	c.(1822-1824)ATT>GTT	p.I608V	ACACA_uc002hnk.2_Missense_Mutation_p.I530V|ACACA_uc002hnl.2_Missense_Mutation_p.I550V|ACACA_uc002hnn.2_Missense_Mutation_p.I608V|ACACA_uc002hno.2_Missense_Mutation_p.I645V|ACACA_uc010cuz.2_Missense_Mutation_p.I608V	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	608	Biotin carboxylation.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CCAGTATCAATTCTGTTCATC	0.423													8	235	---	---	---	---	PASS
TOP2A	7153	broad.mit.edu	37	17	38574074	38574074	+	5'UTR	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38574074T>C	uc002huq.2	-	1						NM_001067	NP_001058	P11388	TOP2A_HUMAN	DNA topoisomerase II, alpha isozyme						apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TCAAGAACCCTGAAAGCGACT	0.647													12	17	---	---	---	---	PASS
CACNA1G	8913	broad.mit.edu	37	17	48652948	48652948	+	Silent	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48652948C>T	uc002irk.1	+	8	1557	c.1185C>T	c.(1183-1185)GCC>GCT	p.A395A	CACNA1G_uc002iri.1_Silent_p.A395A|CACNA1G_uc002irj.1_Silent_p.A395A|CACNA1G_uc002irl.1_Silent_p.A395A|CACNA1G_uc002irm.1_Silent_p.A395A|CACNA1G_uc002irn.1_Silent_p.A395A|CACNA1G_uc002iro.1_Silent_p.A395A|CACNA1G_uc002irp.1_Silent_p.A395A|CACNA1G_uc002irq.1_Silent_p.A395A|CACNA1G_uc002irr.1_Silent_p.A395A|CACNA1G_uc002irs.1_Silent_p.A395A|CACNA1G_uc002irt.1_Silent_p.A395A|CACNA1G_uc002irv.1_Silent_p.A395A|CACNA1G_uc002irw.1_Silent_p.A395A|CACNA1G_uc002iru.1_Silent_p.A395A|CACNA1G_uc002irx.1_Silent_p.A308A|CACNA1G_uc002iry.1_Silent_p.A308A|CACNA1G_uc002irz.1_Silent_p.A308A|CACNA1G_uc002isa.1_Silent_p.A308A|CACNA1G_uc002isb.1_Silent_p.A308A|CACNA1G_uc002isc.1_Silent_p.A308A|CACNA1G_uc002isd.1_Silent_p.A308A|CACNA1G_uc002ise.1_Silent_p.A308A|CACNA1G_uc002isf.1_Silent_p.A308A|CACNA1G_uc002isg.1_Silent_p.A308A|CACNA1G_uc002ish.1_Silent_p.A308A|CACNA1G_uc002isi.1_Silent_p.A308A	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	395	I.|Helical; Name=S6 of repeat I; (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGGTGATTGCCACGCAGTTCT	0.557													13	42	---	---	---	---	PASS
MRC2	9902	broad.mit.edu	37	17	60757631	60757631	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60757631G>A	uc002jad.2	+	15	2801	c.2399G>A	c.(2398-2400)TGC>TAC	p.C800Y	MRC2_uc010ddq.1_RNA|MRC2_uc002jae.2_5'Flank|MRC2_uc002jaf.2_5'Flank	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	800	Extracellular (Potential).|C-type lectin 4.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GCCATGCAGTGCGACACACAG	0.652													12	35	---	---	---	---	PASS
CD79B	974	broad.mit.edu	37	17	62006561	62006561	+	3'UTR	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62006561C>T	uc002jdq.1	-	6					CD79B_uc002jdo.1_3'UTR|CD79B_uc002jdp.1_3'UTR|CD79B_uc002jdr.1_3'UTR	NM_000626	NP_000617	P40259	CD79B_HUMAN	CD79B antigen isoform 1 precursor						cell surface receptor linked signaling pathway|immune response	Golgi apparatus|integral to plasma membrane|nucleus	transmembrane receptor activity				0						GGAGCCTGCACCCAGGTCATG	0.642			Mis|O		DLBCL								18	35	---	---	---	---	PASS
C17orf58	284018	broad.mit.edu	37	17	65987984	65987984	+	3'UTR	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65987984C>A	uc002jgi.3	-	3					C17orf58_uc002jgj.3_3'UTR	NM_181655	NP_858041	Q2M2W7	CQ058_HUMAN	hypothetical protein LOC284018 isoform a												0	all_cancers(12;4.57e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTCTTGTTGCCGACGTCCAAG	0.458													25	79	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73624786	73624786	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73624786T>A	uc010dgl.2	-	17	2702	c.2546A>T	c.(2545-2547)GAC>GTC	p.D849V	RECQL5_uc010dgk.2_Missense_Mutation_p.D822V|RECQL5_uc002jot.3_Missense_Mutation_p.D45V	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	849					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CTTCCATGTGTCCTTTGCAGG	0.652								Other_identified_genes_with_known_or_suspected_DNA_repair_function					30	57	---	---	---	---	PASS
CIDEA	1149	broad.mit.edu	37	18	12264452	12264452	+	Silent	SNP	G	A	A	rs149175539		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12264452G>A	uc002kqt.3	+	3	395	c.330G>A	c.(328-330)CCG>CCA	p.P110P	CIDEA_uc002kqu.3_Silent_p.P144P|CIDEA_uc010dlc.2_RNA	NM_001279	NP_001270	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a isoform	110	CIDE-N.				DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change|lipid metabolic process|lipid storage|negative regulation of apoptosis|negative regulation of cytokine secretion|negative regulation of lipid catabolic process|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of sequestering of triglyceride|temperature homeostasis	mitochondrial envelope|nucleus	protein homodimerization activity			ovary(1)|central_nervous_system(1)	2						AGTGGATGCCGGTAAGCAAAA	0.443													3	45	---	---	---	---	PASS
B4GALT6	9331	broad.mit.edu	37	18	29207086	29207086	+	Splice_Site	SNP	T	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29207086T>G	uc002kwz.3	-	7	1074	c.777_splice	c.e7-1	p.I259_splice	B4GALT6_uc010dma.2_Splice_Site_p.I220_splice|B4GALT6_uc010dmb.2_Splice_Site_p.I220_splice|B4GALT6_uc002kwy.3_5'Flank	NM_004775	NP_004766	Q9UBX8	B4GT6_HUMAN	beta-1,4-galactosyltransferase 6						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding				0			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			TATGGAAGACTAGAAAAGAAA	0.353													43	93	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54361920	54361920	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54361920A>G	uc002lgk.1	+	10	1248	c.1037A>G	c.(1036-1038)CAG>CGG	p.Q346R	WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Missense_Mutation_p.Q346R	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	346	WD 4.									ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		CTGTTAATTCAGGGTGATTCT	0.343													10	138	---	---	---	---	PASS
STK11	6794	broad.mit.edu	37	19	1220429	1220429	+	Silent	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1220429C>T	uc002lrl.1	+	4	1637	c.522C>T	c.(520-522)CAC>CAT	p.H174H		NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11	174	Protein kinase.		H -> R (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39).		anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)|p.Y156fs*87(4)|p.?(4)|p.G52_P179del(1)|p.H174R(1)		lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GCATTGTGCACAAGGACATCA	0.652		14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			4	11	---	---	---	---	PASS
CREB3L3	84699	broad.mit.edu	37	19	4171691	4171691	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4171691G>A	uc002lzl.2	+	10	1227	c.1111G>A	c.(1111-1113)GTG>ATG	p.V371M	CREB3L3_uc002lzm.2_Missense_Mutation_p.V361M|CREB3L3_uc010xib.1_Missense_Mutation_p.V360M|CREB3L3_uc010xic.1_Missense_Mutation_p.R326H	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	371	Lumenal (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCCTCCCGCGTGGCTGCTGA	0.647													8	173	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8592225	8592225	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8592225A>T	uc002mkg.2	-	22	2585	c.2471T>A	c.(2470-2472)CTC>CAC	p.L824H		NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	824						unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						GCTTCACCTGAGGGAGACTCC	0.557													6	38	---	---	---	---	PASS
OR7G1	125962	broad.mit.edu	37	19	9225524	9225524	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9225524C>A	uc002mks.1	-	1	916	c.916G>T	c.(916-918)GGC>TGC	p.G306C		NM_001005192	NP_001005192	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G,	306	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						AACAGCCTACCAATAAGTTTC	0.418													64	136	---	---	---	---	PASS
OR7G1	125962	broad.mit.edu	37	19	9226001	9226001	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9226001G>C	uc002mks.1	-	1	439	c.439C>G	c.(439-441)CTC>GTC	p.L147V		NM_001005192	NP_001005192	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G,	147	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						AACATGGAGAGAAGAATCAGC	0.483													32	60	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	23329223	23329223	+	RNA	SNP	A	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23329223A>T	uc002nrb.1	+	4		c.1576A>T								Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85.																		AATGTGGCAAAGCTTTTAACC	0.398													26	55	---	---	---	---	PASS
LSR	51599	broad.mit.edu	37	19	35741512	35741512	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35741512C>A	uc002nyl.2	+	2	771	c.548C>A	c.(547-549)GCT>GAT	p.A183D	LSR_uc002nym.2_Missense_Mutation_p.A183D|LSR_uc002nyn.2_Missense_Mutation_p.A183D|LSR_uc002nyo.2_Missense_Mutation_p.A183D|LSR_uc010xsr.1_Missense_Mutation_p.A183D|LSR_uc002nyp.2_Missense_Mutation_p.A146D	NM_205834	NP_991403	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	183	Extracellular (Potential).|Ig-like V-type.				embryo development|liver development	chylomicron|integral to membrane|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle	receptor activity				0	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CAGGGCAACGCTGTGACCCTG	0.647													3	51	---	---	---	---	PASS
PAK4	10298	broad.mit.edu	37	19	39664492	39664492	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39664492C>A	uc002okj.1	+	6	1401	c.940C>A	c.(940-942)CCA>ACA	p.P314T	PAK4_uc002okl.1_Missense_Mutation_p.P314T|PAK4_uc002okn.1_Missense_Mutation_p.P314T|PAK4_uc002okm.1_Missense_Mutation_p.P161T|PAK4_uc002oko.1_Missense_Mutation_p.P161T|PAK4_uc002okp.1_Missense_Mutation_p.P224T	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1	314	GEF-interaction domain (GID).|Linker.				cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GGTGGTGGACCCAGGCGACCC	0.677													6	27	---	---	---	---	PASS
RAB4B	53916	broad.mit.edu	37	19	41285997	41285997	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41285997G>T	uc002opd.1	+	2	200	c.90G>T	c.(88-90)GAG>GAT	p.E30D	MIA_uc010xvt.1_RNA|RAB4B_uc002opc.1_RNA|RAB4B_uc002ope.1_RNA|EGLN2_uc010ehd.2_5'UTR|RAB4B_uc002opf.1_Missense_Mutation_p.E56D	NM_016154	NP_057238	P61018	RAB4B_HUMAN	ras-related GTP-binding protein 4b	30					protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	intracellular|plasma membrane	GTP binding|GTPase activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AGTTCATTGAGAATAAGTGTG	0.547													12	277	---	---	---	---	PASS
PRKD2	25865	broad.mit.edu	37	19	47177845	47177845	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47177845C>G	uc002pfh.2	-	19	2914	c.2572G>C	c.(2572-2574)GGT>CGT	p.G858R	PRKD2_uc002pfd.2_Missense_Mutation_p.G232R|PRKD2_uc010eks.2_Missense_Mutation_p.G261R|PRKD2_uc010ekt.2_Missense_Mutation_p.G125R|PRKD2_uc002pfe.2_Missense_Mutation_p.G388R|PRKD2_uc002pff.2_Missense_Mutation_p.G378R|PRKD2_uc002pfg.2_Missense_Mutation_p.G701R|PRKD2_uc002pfi.2_Missense_Mutation_p.G858R|PRKD2_uc002pfj.2_Missense_Mutation_p.G858R|PRKD2_uc010xye.1_Missense_Mutation_p.G868R|PRKD2_uc002pfk.2_Missense_Mutation_p.G701R	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	858					cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CAGGCCCCACCGAGATCCCTG	0.642													11	23	---	---	---	---	PASS
ZNF816A	125893	broad.mit.edu	37	19	53453353	53453353	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53453353G>A	uc002qal.1	-	5	1976	c.1675C>T	c.(1675-1677)CAT>TAT	p.H559Y	ZNF321_uc010eqj.2_Intron|ZNF321_uc002qak.1_Intron|ZNF816A_uc002qam.1_Missense_Mutation_p.H543Y	NM_001031665	NP_001026835	Q0VGE8	ZN816_HUMAN	zinc finger protein 816A	559	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0313)		TCTCCAGTATGAACTCTCGTA	0.393													45	98	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55693237	55693237	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55693237C>T	uc002qjq.2	-	20	3306	c.3233G>A	c.(3232-3234)CGG>CAG	p.R1078Q	PTPRH_uc010esv.2_Missense_Mutation_p.R900Q|SYT5_uc002qjm.1_5'Flank|SYT5_uc002qjp.2_5'Flank|SYT5_uc002qjn.1_5'Flank|SYT5_uc002qjo.1_5'Flank	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	1078	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TTGGAGGAACCGCAGGATGCA	0.627													59	147	---	---	---	---	PASS
ZNF583	147949	broad.mit.edu	37	19	56935610	56935610	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56935610C>T	uc010ygl.1	+	5	1748	c.1583C>T	c.(1582-1584)TCT>TTT	p.S528F	ZNF583_uc002qnc.2_Missense_Mutation_p.S528F|ZNF583_uc010ygm.1_Missense_Mutation_p.S528F	NM_001159860	NP_001153332	Q96ND8	ZN583_HUMAN	zinc finger protein 583	528	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		TGCAGGAAATCTTTCAGGCAG	0.279													5	215	---	---	---	---	PASS
ZNF805	390980	broad.mit.edu	37	19	57765250	57765250	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57765250A>T	uc010ygt.1	+	4	1270	c.1063A>T	c.(1063-1065)AGA>TGA	p.R355*	ZNF805_uc010ygu.1_Nonsense_Mutation_p.R222*	NM_001023563	NP_001018857	Q5CZA5	ZN805_HUMAN	zinc finger protein 805 isoform 1	355	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTTCAAACACAGATCATACCT	0.512													22	50	---	---	---	---	PASS
CST4	1472	broad.mit.edu	37	20	23666496	23666496	+	3'UTR	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23666496G>A	uc002wto.1	-	3						NM_001899	NP_001890	P01036	CYTS_HUMAN	cystatin S precursor							extracellular region	cysteine-type endopeptidase inhibitor activity			breast(1)	1	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					GGTGGGAGTGGGTGGTGGTCG	0.617													6	6	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29624093	29624093	+	Splice_Site	SNP	G	T	T	rs75468660		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29624093G>T	uc010ztl.1	+	1	58	c.26_splice	c.e1+1	p.R9_splice	FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						CTGATTCCAGGTGAGCTTATG	0.289													4	22	---	---	---	---	PASS
COL6A1	1291	broad.mit.edu	37	21	47424005	47424005	+	3'UTR	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47424005G>A	uc002zhu.1	+	35					COL6A1_uc010gqd.1_3'UTR|COL6A1_uc002zhv.1_3'UTR|COL6A1_uc002zhw.1_3'UTR	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	AATGTGATGCGAATTTTCCCG	0.557													3	43	---	---	---	---	PASS
ZDHHC8	29801	broad.mit.edu	37	22	20127356	20127356	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20127356C>A	uc002zrq.2	+	4	604	c.498C>A	c.(496-498)TTC>TTA	p.F166L	ZDHHC8_uc002zrr.1_Missense_Mutation_p.F166L|ZDHHC8_uc010gsa.2_Intron	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	166	Helical; (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					TCGTGGCCTTCGGCCTGGTCT	0.602													3	54	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21152931	21152931	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21152931A>C	uc002zsz.3	-	17	2106	c.1875T>G	c.(1873-1875)AGT>AGG	p.S625R	PI4KA_uc010gsq.1_Missense_Mutation_p.S683R	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	625					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TGGCCTTCACACTGATCTGCT	0.488													72	145	---	---	---	---	PASS
ADSL	158	broad.mit.edu	37	22	40742638	40742638	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40742638A>C	uc003ayp.3	+	1	135	c.76A>C	c.(76-78)ATG>CTG	p.M26L	ADSL_uc003ays.3_Missense_Mutation_p.M26L|ADSL_uc003ayq.3_Missense_Mutation_p.M26L|ADSL_uc003ayr.3_5'UTR|ADSL_uc003ayt.3_Missense_Mutation_p.M26L	NM_000026	NP_000017	P30566	PUR8_HUMAN	adenylosuccinate lyase isoform a	26			M -> L (in ADSL deficiency; severe).		AMP biosynthetic process|protein tetramerization|purine base metabolic process	cytosol	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity			ovary(1)	1						CAGCCCGGAGATGTGCTTCGT	0.652													5	17	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46807519	46807519	+	Silent	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46807519G>T	uc003bhw.1	-	6	4749	c.4749C>A	c.(4747-4749)GGC>GGA	p.G1583G	CELSR1_uc011arc.1_5'Flank	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1583	Extracellular (Potential).|Laminin G-like 1.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGGTCTGAGTGCCCTGGGCAG	0.632													43	67	---	---	---	---	PASS
SFRS17A	8227	broad.mit.edu	37	X	1712876	1712876	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1712876T>C	uc004cqa.2	+	2	717	c.521T>C	c.(520-522)CTG>CCG	p.L174P	SFRS17A_uc010ncx.1_Missense_Mutation_p.L174P|SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_5'Flank	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	174	RRM.				B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAGGACGTCCTGGTCAAGGTG	0.647													40	114	---	---	---	---	PASS
XAGE3	170626	broad.mit.edu	37	X	52896107	52896107	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52896107G>T	uc004dre.2	-	2	118	c.58C>A	c.(58-60)CCT>ACT	p.P20T	XAGE3_uc004drf.2_Missense_Mutation_p.P20T	NM_130776	NP_570132	Q8WTP9	GAGD4_HUMAN	XAGE-3 protein	20											0						ATCAGCTCAGGAGGTGGTACA	0.403													6	164	---	---	---	---	PASS
SLC25A5	292	broad.mit.edu	37	X	118605114	118605114	+	3'UTR	SNP	C	A	A	rs75063279	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118605114C>A	uc004erh.3	+	4					LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_5'Flank	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2						chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)	CTGTCAGTTTCTCAGTGGCAA	0.378													4	54	---	---	---	---	PASS
ATP1B4	23439	broad.mit.edu	37	X	119504657	119504657	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119504657G>A	uc004esr.2	+	3	500	c.416G>A	c.(415-417)AGT>AAT	p.S139N	ATP1B4_uc004esq.2_Missense_Mutation_p.S135N|ATP1B4_uc011mtx.1_Missense_Mutation_p.S104N|ATP1B4_uc011mty.1_Intron	NM_001142447	NP_001135919	Q9UN42	AT1B4_HUMAN	ATPase, (Na+)/K+ transporting, beta 4	139	Perinuclear space (Potential).				ATP biosynthetic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to plasma membrane|nuclear inner membrane	sodium:potassium-exchanging ATPase activity			ovary(1)|skin(1)	2						CTGACCATCAGTCCCTATATA	0.493													187	454	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151870276	151870276	+	3'UTR	SNP	C	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151870276C>A	uc004ffq.1	+	3					MAGEA6_uc004ffr.1_3'UTR|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6								protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					GAGTTGCAGCCAGGGCCAGTG	0.572													43	97	---	---	---	---	PASS
IRAK1	3654	broad.mit.edu	37	X	153278782	153278782	+	Missense_Mutation	SNP	C	T	T	rs140583367		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153278782C>T	uc004fjs.1	-	12	1721	c.1642G>A	c.(1642-1644)GTG>ATG	p.V548M	IRAK1_uc004fjr.1_Missense_Mutation_p.V518M|IRAK1_uc004fjt.1_Missense_Mutation_p.V469M|IRAK1_uc010nur.2_Intron	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	548					activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTGCTGGACACGTAGGAGTTC	0.682													25	41	---	---	---	---	PASS
PLEKHN1	84069	broad.mit.edu	37	1	908749	908750	+	Intron	INS	-	T	T	rs111919992	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:908749_908750insT	uc001ace.2	+						PLEKHN1_uc001acd.2_Intron|PLEKHN1_uc001acf.2_Intron	NM_032129	NP_115505	Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		TGGTTCCCACCGTTCCGCACCA	0.673													21	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	8296357	8296358	+	IGR	DEL	TC	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8296357_8296358delTC								ERRFI1 (209964 upstream) : SLC45A1 (88032 downstream)																							tttctttctttctttctttctt	0.035													2	5	---	---	---	---	
UBR4	23352	broad.mit.edu	37	1	19474752	19474752	+	Intron	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19474752delA	uc001bbi.2	-						UBR4_uc001bbk.1_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGCAAAGAGAAAAAAAAAAA	0.448													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22569928	22569929	+	IGR	DEL	AG	-	-	rs142077239		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22569928_22569929delAG								WNT4 (99543 upstream) : ZBTB40 (208415 downstream)																							tcaaaaaaaaagaagaagaagg	0.064													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	23571840	23571841	+	IGR	INS	-	A	A	rs149379094	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23571840_23571841insA								HTR1D (50618 upstream) : HNRNPR (64436 downstream)																							GAGGCAGGATGAAAAAAAAAAG	0.520													4	2	---	---	---	---	
KDM4A	9682	broad.mit.edu	37	1	44169065	44169066	+	Intron	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44169065_44169066insT	uc001cjx.2	+						uc001cjy.2_Intron|ST3GAL3_uc009vwu.1_5'Flank|KDM4A_uc010oki.1_Intron	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						TTATAGCTGGATTTTTTTTTTT	0.431													6	3	---	---	---	---	
SLC6A9	6536	broad.mit.edu	37	1	44496839	44496840	+	Intron	DEL	CA	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44496839_44496840delCA	uc001cln.2	-						SLC6A9_uc010okm.1_Intron|SLC6A9_uc010oko.1_Intron|SLC6A9_uc010okp.1_Intron	NM_001024845	NP_001020016	P48067	SC6A9_HUMAN	solute carrier family 6 member 9 isoform 3							integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity				0	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	CATGCGCGATcacacacacaca	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855840	148855842	+	IGR	DEL	GGT	-	-	rs60282471		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855840_148855842delGGT								NBPF16 (97529 upstream) : LOC645166 (72444 downstream)																							aagccgcggcggtggcggcggag	0.335													7	5	---	---	---	---	
XPR1	9213	broad.mit.edu	37	1	180628330	180628341	+	Intron	DEL	CTTCCTTCCTTC	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180628330_180628341delCTTCCTTCCTTC	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0						tgtagtcagtcttccttccttccttccttcct	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184320812	184320815	+	IGR	DEL	AGGA	-	-	rs71904036	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184320812_184320815delAGGA								TSEN15 (277471 upstream) : C1orf21 (35335 downstream)																							gaaggaaggcaggaaggaaggaag	0.167													4	2	---	---	---	---	
RPS10P7	376693	broad.mit.edu	37	1	201489310	201489311	+	RNA	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201489310_201489311insT	uc009wzz.1	+	1		c.1480_1481insT			RPS10P7_uc010ppt.1_RNA					Homo sapiens cDNA FLJ31028 fis, clone HLUNG2000570, weakly similar to 40S RIBOSOMAL PROTEIN S10.												0						TGCGCCCAACCTTCGTGTCATG	0.510													25	17	---	---	---	---	
FAM179A	165186	broad.mit.edu	37	2	29221046	29221048	+	In_Frame_Del	DEL	CAT	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29221046_29221048delCAT	uc010ezl.2	+	3	417_419	c.66_68delCAT	c.(64-69)AGCATC>AGC	p.I23del	FAM179A_uc010ymm.1_In_Frame_Del_p.I23del	NM_199280	NP_954974	Q6ZUX3	F179A_HUMAN	hypothetical protein LOC165186	23							binding			ovary(3)|skin(1)	4						ACTGCGGGAGCATCCCTCGGACC	0.626													14	7	---	---	---	---	
PLEKHH2	130271	broad.mit.edu	37	2	43934336	43934336	+	Intron	DEL	A	-	-	rs148315076		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43934336delA	uc010yny.1	+						PLEKHH2_uc002rte.3_Intron|PLEKHH2_uc002rtf.3_Intron	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				actccacctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
UGP2	7360	broad.mit.edu	37	2	64082655	64082655	+	Intron	DEL	T	-	-	rs71393335		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64082655delT	uc002scm.2	+						UGP2_uc002scl.2_Intron|UGP2_uc010ypx.1_Intron	NM_006759	NP_006750	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2 isoform a						glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0						tctttttctgttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64603416	64603417	+	IGR	INS	-	CACCACCAT	CACCACCAT	rs141783487	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603416_64603417insCACCACCAT								PELI1 (231811 upstream) : HSPC159 (77910 downstream)																							catgccaccaccaccaccatca	0.040													4	2	---	---	---	---	
NCL	4691	broad.mit.edu	37	2	232325997	232325998	+	Intron	INS	-	A	A	rs34075637		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232325997_232325998insA	uc002vru.2	-						SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		caaaaaaatttaaaaaaaaaaa	0.119													3	4	---	---	---	---	
MLPH	79083	broad.mit.edu	37	2	238419911	238419911	+	Intron	DEL	T	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238419911delT	uc002vwt.2	+						MLPH_uc002vws.2_Intron|MLPH_uc010fyt.1_Intron|MLPH_uc002vwu.2_Intron|MLPH_uc002vwv.2_Intron|MLPH_uc002vww.2_Intron	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN	melanophilin isoform 1								metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		TTCTGGCTGCttttttttttt	0.104													4	3	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	239990088	239990089	+	Intron	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239990088_239990089insT	uc002vyk.3	-						HDAC4_uc010fyy.2_Intron	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGTGCCCTTCCTTATCTCGTTA	0.530													19	11	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	241991198	241991199	+	Frame_Shift_Ins	INS	-	G	G	rs138612536	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241991198_241991199insG	uc002wah.1	+	13	1773_1774	c.1773_1774insG	c.(1771-1776)AACGGGfs	p.N591fs		NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor	591_592	EGF-like 8.				cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CCTGCCGGAACGGGGGCACGTG	0.693													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32647937	32647938	+	IGR	INS	-	A	A	rs34405029		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32647937_32647938insA								DYNC1LI1 (35587 upstream) : CNOT10 (78760 downstream)																							aggaaggaaggaggaaggaagg	0.000													5	4	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52649433	52649434	+	Frame_Shift_Del	DEL	CC	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52649433_52649434delCC	uc003des.2	-	15	1869_1870	c.1857_1858delGG	c.(1855-1860)AAGGAGfs	p.K619fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.K619fs|PBRM1_uc003der.2_Frame_Shift_Del_p.K587fs|PBRM1_uc003det.2_Frame_Shift_Del_p.K634fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.K634fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.K619fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.K619fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.K619fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.K619fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.K532fs|PBRM1_uc003dfc.2_5'UTR	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	619_620					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTCCTTTTCTCCTTGAGTAACT	0.366			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								78	58	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137009715	137009716	+	IGR	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137009715_137009716insT								IL20RB (279795 upstream) : SOX14 (473863 downstream)																							tccttccttccttccttccttc	0.000													7	4	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143271179	143271180	+	Intron	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143271179_143271180insT	uc003evn.2	-							NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						AAGAGACCAAGTCTGTAGTAAA	0.347													46	30	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	172054957	172054958	+	Intron	INS	-	T	T	rs148135964	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172054957_172054958insT	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TTGTTTTTTTCTTTTTTTTCAA	0.302													4	5	---	---	---	---	
MCF2L2	23101	broad.mit.edu	37	3	183027758	183027758	+	Intron	DEL	T	-	-	rs79706532		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183027758delT	uc003fli.1	-						MCF2L2_uc003flj.1_Intron|MCF2L2_uc003flp.1_Intron|MCF2L2_uc011bqs.1_Intron	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			ATGTTAAAAATTTTTTTTTTG	0.313													4	2	---	---	---	---	
TMEM207	131920	broad.mit.edu	37	3	190147704	190147704	+	Intron	DEL	A	-	-	rs67899321		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147704delA	uc003fsj.2	-							NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		CACAGGGGGGAAAAAAAAAAT	0.353													3	3	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7656930	7656931	+	Intron	DEL	AC	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7656930_7656931delAC	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TTGTGCGTGTacacacacacac	0.485													5	3	---	---	---	---	
PI4K2B	55300	broad.mit.edu	37	4	25262250	25262265	+	Intron	DEL	ATATATATATATATAC	-	-	rs71600578		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25262250_25262265delATATATATATATATAC	uc003grk.2	+						PI4K2B_uc011bxs.1_Intron	NM_018323	NP_060793	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta							cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)				atatatatatatatatatatatatacacacacacac	0.148													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31961719	31961722	+	IGR	DEL	CTCT	-	-	rs77033972		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31961719_31961722delCTCT								PCDH7 (813298 upstream) : None (None downstream)																							tcctccctccctctttctttcctt	0.064													6	4	---	---	---	---	
CCDC158	339965	broad.mit.edu	37	4	77272457	77272457	+	Intron	DEL	A	-	-	rs112268994		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77272457delA	uc003hkb.3	-							NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6						TGTACGATTTAAAAAAAAAAC	0.174													2	8	---	---	---	---	
FAM175A	84142	broad.mit.edu	37	4	84390469	84390469	+	Intron	DEL	G	-	-	rs148107040		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84390469delG	uc003hou.2	-						FAM175A_uc003hot.2_5'UTR|FAM175A_uc003hov.2_Intron	NM_139076	NP_620775	Q6UWZ7	F175A_HUMAN	coiled-coil domain containing 98						chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|response to ionizing radiation	BRCA1-A complex	polyubiquitin binding			kidney(1)	1						TGAAACAACTGtttttttttt	0.164													5	3	---	---	---	---	
MAPKSP1	8649	broad.mit.edu	37	4	100813090	100813090	+	Intron	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100813090delA	uc003hvg.2	-						MAPKSP1_uc003hvi.2_Intron|MAPKSP1_uc003hvh.2_Intron	NM_021970	NP_068805	Q9UHA4	LTOR3_HUMAN	MAPK scaffold protein 1						cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade	Ragulator complex	protein binding				0						aaatacagacaaaatgctTCA	0.104													44	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	184532577	184532578	+	IGR	DEL	CA	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184532577_184532578delCA								ING2 (100328 upstream) : RWDD4A (28211 downstream)																							cacacacacgcacacacacaca	0.228													4	2	---	---	---	---	
CCDC111	201973	broad.mit.edu	37	4	185613052	185613052	+	Intron	DEL	T	-	-	rs10567357		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185613052delT	uc003iwk.2	+						CCDC111_uc003iwj.2_Intron|CCDC111_uc003iwl.2_Intron|CCDC111_uc003iwm.2_Intron|CCDC111_uc003iwn.2_Intron	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111						DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)		aatacaaaccttttttttttt	0.025													5	3	---	---	---	---	
SDHA	6389	broad.mit.edu	37	5	225328	225329	+	Intron	INS	-	G	G	rs34815560		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:225328_225329insG	uc003jao.3	+						SDHA_uc003jan.2_Intron|SDHA_uc011clv.1_Intron|SDHA_uc011clw.1_Intron|SDHA_uc003jap.3_Intron|SDHA_uc003jaq.3_5'Flank	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	actgaggctaagGATGGAATCA	0.297									Familial_Paragangliomas				5	5	---	---	---	---	
SLC6A19	340024	broad.mit.edu	37	5	1210432	1210433	+	Intron	INS	-	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1210432_1210433insA	uc003jbw.3	+							NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19						cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GTCGGCCCCTCAGATTCTGGAG	0.668													4	4	---	---	---	---	
TARS	6897	broad.mit.edu	37	5	33457584	33457584	+	Intron	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33457584delA	uc003jhy.2	+						TARS_uc011cob.1_Intron|TARS_uc010iup.1_Intron|TARS_uc011coc.1_Intron|TARS_uc003jhz.2_Intron|TARS_uc011cod.1_Intron	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase						threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)	CAGCTGCATGAAGTACTAGGA	0.358													29	13	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	38963027	38963027	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38963027delT	uc003jlp.2	-	17	1541	c.1517delA	c.(1516-1518)CAGfs	p.Q506fs	RICTOR_uc003jlo.2_Frame_Shift_Del_p.Q506fs|RICTOR_uc010ivf.2_Frame_Shift_Del_p.Q221fs	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	506					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					ATCCCGTTTCTGGTGTGTTGC	0.353													192	93	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55028949	55028952	+	IGR	DEL	TCCT	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55028949_55028952delTCCT								SLC38A9 (20395 upstream) : DDX4 (4893 downstream)																							ttctctttcctccttccttccttc	0.000													6	3	---	---	---	---	
NUDT12	83594	broad.mit.edu	37	5	102886823	102886823	+	Intron	DEL	T	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102886823delT	uc003koi.2	-						NUDT12_uc011cvb.1_Intron	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12							nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		ACATGCAAAGttttttttttt	0.139													3	3	---	---	---	---	
LARP1	23367	broad.mit.edu	37	5	154174679	154174679	+	Intron	DEL	C	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154174679delC	uc003lvp.2	+						LARP1_uc003lvo.2_Intron|LARP1_uc010jie.1_Intron	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2								protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GGAAGGCATACTCATAAAACT	0.458													44	22	---	---	---	---	
TIMD4	91937	broad.mit.edu	37	5	156381896	156381896	+	Intron	DEL	T	-	-	rs71922795		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156381896delT	uc003lwh.2	-						TIMD4_uc010jii.2_Intron	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain							integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ttttctttccttttttttttt	0.164													4	2	---	---	---	---	
RIPK1	8737	broad.mit.edu	37	6	3110842	3110842	+	Intron	DEL	T	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3110842delT	uc010jni.2	+						RIPK1_uc003muv.3_Intron|RIPK1_uc003muw.3_Intron|RIPK1_uc011dhs.1_Intron|RIPK1_uc003mux.2_Intron	NM_003804	NP_003795	Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine						activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				gtgttatttcttttttttttt	0.085													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32497712	32497713	+	Intron	INS	-	A	A	rs146725750	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32497712_32497713insA	uc003obj.2	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						GCCCCTTACACAGTCTCATGGA	0.411													5	3	---	---	---	---	
GCLC	2729	broad.mit.edu	37	6	53370495	53370496	+	Intron	DEL	TT	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53370495_53370496delTT	uc003pbw.1	-						GCLC_uc003pbv.1_Intron	NM_001498	NP_001489	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit						anti-apoptosis|cell redox homeostasis|cysteine metabolic process|glutamate metabolic process|glutathione biosynthetic process|negative regulation of transcription, DNA-dependent|regulation of blood vessel size|response to heat|response to hormone stimulus|response to oxidative stress|xenobiotic metabolic process	cytosol	ADP binding|ATP binding|coenzyme binding|glutamate binding|glutamate-cysteine ligase activity|magnesium ion binding			ovary(1)|central_nervous_system(1)	2	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)	ACATACttaatttttattttat	0.426													10	9	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57512916	57512917	+	Splice_Site	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512916_57512917insT	uc003pdx.2	+	16	1839	c.1752_splice	c.e16+1			NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttttttcaattttttttgta	0.000													4	2	---	---	---	---	
FGFR1OP	11116	broad.mit.edu	37	6	167453552	167453552	+	3'UTR	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167453552delA	uc003qvj.2	+	13					CCR6_uc003qvl.2_Intron|FGFR1OP_uc011egp.1_Frame_Shift_Del_p.E334fs|FGFR1OP_uc003qvk.2_3'UTR	NM_007045	NP_008976	O95684	FR1OP_HUMAN	FGFR1 oncogene partner isoform a						G2/M transition of mitotic cell cycle|microtubule anchoring|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell proliferation	centrosome|cytosol|nucleus|perinuclear region of cytoplasm	protein homodimerization activity|protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(1)	1		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		ACTCAGCTGGAATGTCTGCTC	0.353			T	FGFR1	MPD|NHL								13	13	---	---	---	---	
C7orf31	136895	broad.mit.edu	37	7	25194529	25194530	+	Intron	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25194529_25194530insT	uc003sxn.1	-						C7orf31_uc003sxm.1_Intron	NM_138811	NP_620166	Q8N865	CG031_HUMAN	hypothetical protein LOC136895												0						TGAGTCACACATTTGTGACTTG	0.406													12	7	---	---	---	---	
FAM133B	257415	broad.mit.edu	37	7	92208488	92208488	+	Intron	DEL	G	-	-	rs113560614		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92208488delG	uc003umc.2	-						FAM133B_uc003umb.2_Intron|FAM133B_uc003umd.2_Intron	NM_152789	NP_690002	Q5BKY9	F133B_HUMAN	hypothetical protein LOC257415 isoform 1											ovary(1)	1	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CAAGGGCGGCGGGGGggggcc	0.199													4	2	---	---	---	---	
PDAP1	11333	broad.mit.edu	37	7	98994127	98994127	+	3'UTR	DEL	C	-	-	rs113663373		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98994127delC	uc003uqe.2	-	6						NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1						cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)	CTCCCCCAGTCCCCCCCCCCA	0.542													5	7	---	---	---	---	
TMEM176A	55365	broad.mit.edu	37	7	150499164	150499165	+	Intron	INS	-	TTCTC	TTCTC	rs137988135		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150499164_150499165insTTCTC	uc003whx.1	+						TMEM176B_uc003whu.3_5'Flank|TMEM176B_uc003whv.3_5'Flank|TMEM176B_uc003whw.3_5'Flank	NM_018487	NP_060957	Q96HP8	T176A_HUMAN	hepatocellular carcinoma-associated antigen 112							integral to membrane				ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ttcttctccttttctcttctct	0.213													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81511384	81511385	+	IGR	DEL	AC	-	-	rs61242679		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81511384_81511385delAC								ZBTB10 (76776 upstream) : ZNF704 (39384 downstream)																							gagccagggaacacacacacac	0.000													4	2	---	---	---	---	
FBXO43	286151	broad.mit.edu	37	8	101153402	101153402	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101153402delC	uc003yjd.2	-	2	1793	c.1080delG	c.(1078-1080)CAGfs	p.Q360fs	FBXO43_uc003yje.2_Frame_Shift_Del_p.Q326fs|FBXO43_uc010mbp.1_Frame_Shift_Del_p.Q360fs	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	360					meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			CCTTATGTTTCTGCAGTAGTT	0.463													183	99	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5091046	5091046	+	Intron	DEL	T	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5091046delT	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		TACATTTAACTTTTTTTTTTT	0.289		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66545704	66545704	+	Intron	DEL	C	-	-	rs12353356		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66545704delC	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																		GAAAAAAAAACAAAGAAAGAA	0.373													4	2	---	---	---	---	
NAA35	60560	broad.mit.edu	37	9	88592180	88592181	+	Intron	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88592180_88592181insT	uc004aoi.3	+						NAA35_uc004aoj.3_Intron|NAA35_uc004aok.1_Intron	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						AATGTAGTAAGTTATTAACATT	0.322													17	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	107008293	107008293	+	IGR	DEL	G	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107008293delG								SMC2 (104600 upstream) : OR13F1 (258251 downstream)																							aaggaaggaaggaaggaagga	0.025													2	4	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113243811	113243817	+	Intron	DEL	CTGTCTA	-	-	rs3841727		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113243811_113243817delCTGTCTA	uc010mtz.2	-						SVEP1_uc010mua.1_Intron|SVEP1_uc004beu.2_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						AGGACTCCTCCTGTCTATCGCTATTTC	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	11704236	11704237	+	IGR	INS	-	A	A			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11704236_11704237insA								USP6NL (50557 upstream) : ECHDC3 (80119 downstream)																							aggaaggaaggaaggaaggaag	0.000													4	3	---	---	---	---	
PDLIM1	9124	broad.mit.edu	37	10	97031194	97031194	+	Intron	DEL	A	-	-	rs5787128		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97031194delA	uc001kkh.2	-						PDLIM1_uc001kki.2_Intron|PDLIM1_uc009xuv.2_Intron|PDLIM1_uc001kkj.1_Intron	NM_020992	NP_066272	O00151	PDLI1_HUMAN	PDZ and LIM domain 1						response to oxidative stress	cytoplasm|cytoskeleton	zinc ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		actccgtctcaaaaaaaaaaa	0.164													4	2	---	---	---	---	
ALDH18A1	5832	broad.mit.edu	37	10	97380692	97380692	+	Intron	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97380692delA	uc001kkz.2	-						ALDH18A1_uc001kky.2_Intron|ALDH18A1_uc010qog.1_Intron|ALDH18A1_uc010qoh.1_Intron	NM_002860	NP_002851	P54886	P5CS_HUMAN	pyrroline-5-carboxylate synthetase isoform 1						proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)	aacttaaattaaaaaaaaaaa	0.189													3	3	---	---	---	---	
PCGF6	84108	broad.mit.edu	37	10	105086146	105086146	+	Intron	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105086146delA	uc001kwt.2	-						PCGF6_uc001kwu.2_Intron|PCGF6_uc009xxk.2_Intron|PCGF6_uc009xxl.2_Intron|PCGF6_uc009xxm.2_Intron	NM_001011663	NP_001011663	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6 isoform a						negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		actccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	109128457	109128458	+	IGR	DEL	TG	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109128457_109128458delTG								SORCS1 (204165 upstream) : None (None downstream)																							AATTtgtatatgtgtgtgtgtg	0.188													3	3	---	---	---	---	
RRM1	6240	broad.mit.edu	37	11	4159297	4159298	+	Intron	INS	-	G	G			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4159297_4159298insG	uc001lyw.3	+						RRM1_uc009yej.2_Intron|RRM1_uc009yei.2_Intron|RRM1_uc010qyc.1_Intron|RRM1_uc010qyd.1_Intron	NM_001033	NP_001024	P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	gctggccgggcgggggctgacc	0.089													4	2	---	---	---	---	
CWF19L2	143884	broad.mit.edu	37	11	107207442	107207442	+	Intron	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107207442delA	uc010rvp.1	-						CWF19L2_uc001pjh.3_Intron|CWF19L2_uc009yxo.2_Intron	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control								catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		CTGAACATCTAAAAAAAAAAA	0.259													10	5	---	---	---	---	
NCAM1	4684	broad.mit.edu	37	11	112917525	112917526	+	Intron	DEL	AG	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112917525_112917526delAG	uc009yyq.1	+						NCAM1_uc001pno.2_Intron	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		aagaaagaaaagagagagagag	0.015													3	3	---	---	---	---	
LRP6	4040	broad.mit.edu	37	12	12317063	12317064	+	Intron	DEL	AA	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12317063_12317064delAA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				gacaccgtttaaaaaaaaaaaa	0.183													4	2	---	---	---	---	
NTS	4922	broad.mit.edu	37	12	86270630	86270630	+	Intron	DEL	T	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86270630delT	uc001tag.2	+							NM_006183	NP_006174	P30990	NEUT_HUMAN	neurotensin/neuromedin N preproprotein						regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity				0						TTTCTTTTAGTTAAAAGAAGT	0.284													6	3	---	---	---	---	
CCDC92	80212	broad.mit.edu	37	12	124427761	124427762	+	Intron	INS	-	A	A	rs148378755	by1000genomes	TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124427761_124427762insA	uc001ufw.1	-						CCDC92_uc001ufv.1_Intron|CCDC92_uc001ufx.1_Intron|CCDC92_uc001ufy.1_Intron	NM_025140	NP_079416	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92												0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		ATGAGGATGATATAAGGCATTC	0.490													7	8	---	---	---	---	
RAN	5901	broad.mit.edu	37	12	131357345	131357345	+	Intron	DEL	G	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131357345delG	uc001uir.2	+						RAN_uc010tbk.1_Intron|RAN_uc010tbl.1_Intron|RAN_uc001uis.2_Intron	NM_006325	NP_006316	P62826	RAN_HUMAN	ras-related nuclear protein						androgen receptor signaling pathway|cell division|DNA metabolic process|mitosis|mitotic spindle organization|positive regulation of transcription, DNA-dependent|protein export from nucleus|RNA export from nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|melanosome|nuclear pore|nucleoplasm	androgen receptor binding|chromatin binding|GTP binding|GTPase activity|transcription coactivator activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		GAGGTGAAGTGTTTAGGGTTT	0.458													78	34	---	---	---	---	
USPL1	10208	broad.mit.edu	37	13	31232080	31232081	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31232080_31232081delCA	uc001utc.2	+	9	2298_2299	c.1866_1867delCA	c.(1864-1869)ACCAATfs	p.T622fs	USPL1_uc001utd.2_Frame_Shift_Del_p.T293fs|USPL1_uc001ute.1_Frame_Shift_Del_p.T293fs	NM_005800	NP_005791	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	622_623					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			pancreas(2)|skin(1)	3		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TTCTCAAAACCAATACTTTGCT	0.347													94	42	---	---	---	---	
CHRNA7	1139	broad.mit.edu	37	15	32450491	32450493	+	Intron	DEL	TTT	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32450491_32450493delTTT	uc001zft.2	+						uc001zfv.1_Intron|CHRNA7_uc010bae.1_Intron|CHRNA7_uc010baf.2_Intron|CHRNA7_uc010baj.1_Intron|CHRNA7_uc010bak.2_Intron	NM_000746	NP_000737	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7						activation of MAPK activity|calcium ion transport|cellular calcium ion homeostasis|memory|negative regulation of tumor necrosis factor production|positive regulation of angiogenesis|positive regulation of cell proliferation|response to hypoxia|response to nicotine	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|beta-amyloid binding|chloride channel regulator activity|nicotinic acetylcholine-activated cation-selective channel activity|protein homodimerization activity|toxin binding			ovary(1)	1		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Nicotine(DB00184)|Varenicline(DB01273)	aacccccccctttttttttttta	0.074													5	4	---	---	---	---	
EIF2AK4	440275	broad.mit.edu	37	15	40314414	40314417	+	Intron	DEL	TGTA	-	-	rs66677539		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40314414_40314417delTGTA	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Intron|EIF2AK4_uc001zko.1_Intron|EIF2AK4_uc010bbk.1_Intron	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		tgtgtgtgtgtgtatgttgtgtTG	0.270													4	2	---	---	---	---	
SHCBP1	79801	broad.mit.edu	37	16	46652119	46652119	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46652119delA	uc002eec.3	-	2	309	c.269delT	c.(268-270)TTAfs	p.L90fs		NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	90										ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				CTACTCACCTAAAATGTAATC	0.194													56	29	---	---	---	---	
CLEC18C	283971	broad.mit.edu	37	16	70066043	70066043	+	Intron	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70066043delA	uc002exy.2	+						PDXDC2_uc002eyb.2_Intron|PDXDC2_uc002eyc.2_Intron	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						AGCCAAGCCGAAAAAAAAAAA	0.289													6	3	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20242718	20242718	+	Intron	DEL	A	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20242718delA	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						AGCTATTTTTAAAACATGTAG	0.318													24	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47281288	47281295	+	IGR	DEL	GAAGGAAA	-	-	rs71658037		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47281288_47281295delGAAGGAAA								B4GALNT2 (33937 upstream) : GNGT2 (2302 downstream)																							agaaagaaaggaaggaaagaaggaagga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8414734	8414734	+	IGR	DEL	A	-	-	rs113380593		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8414734delA								KANK3 (6588 upstream) : ANGPTL4 (14277 downstream)																							ggaaggaaggaaAAAAAAAAA	0.055													4	2	---	---	---	---	
MARK4	57787	broad.mit.edu	37	19	45767748	45767749	+	Intron	INS	-	A	A	rs79255924		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45767748_45767749insA	uc002pbb.1	+						MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Intron|MARK4_uc002pbc.1_5'Flank			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;						microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		aactccatctcaaaaaaaaaaa	0.228													4	3	---	---	---	---	
TULP2	7288	broad.mit.edu	37	19	49384468	49384468	+	Intron	DEL	C	-	-	rs68173909		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49384468delC	uc002pkz.2	-							NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2						visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		ttttttttttctttttttttt	0.199													11	5	---	---	---	---	
TPX2	22974	broad.mit.edu	37	20	30382559	30382562	+	Intron	DEL	GTGT	-	-	rs113985100		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30382559_30382562delGTGT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			ctgtcgcatagtgtgtgtgtgtgt	0.039													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	45502691	45502691	+	IGR	DEL	A	-	-	rs74735132		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45502691delA								SLC2A10 (137708 upstream) : EYA2 (20572 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
C21orf81	391267	broad.mit.edu	37	21	15347257	15347258	+	Intron	INS	-	A	A	rs80199214		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15347257_15347258insA	uc002yji.2	-							NR_027270				Homo sapiens C21orf81 protein (C21orf81) mRNA, complete cds.												0						ACCCTGCACAGAAAAAAAGTTG	0.307													3	3	---	---	---	---	
C21orf63	59271	broad.mit.edu	37	21	33821319	33821322	+	Intron	DEL	GGAA	-	-	rs113419257		TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33821319_33821322delGGAA	uc002ypr.1	+						C21orf63_uc002ypq.1_Intron|C21orf63_uc002yps.1_Intron|C21orf63_uc010glw.1_Intron|C21orf63_uc002ypt.1_Intron	NM_058187	NP_478067	P58658	CU063_HUMAN	hypothetical protein LOC59271 precursor							integral to membrane	sugar binding			ovary(2)|pancreas(1)	3						agggagggtgggaaggaaggaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16419352	16419352	+	IGR	DEL	T	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16419352delT								POTEH (131415 upstream) : OR11H1 (29474 downstream)																							GAATCGACGATTTTTTTTTTG	0.398													7	4	---	---	---	---	
APOL1	8542	broad.mit.edu	37	22	36657866	36657869	+	Intron	DEL	GCCC	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36657866_36657869delGCCC	uc003apf.2	+						APOL1_uc011amn.1_Intron|APOL1_uc003apc.2_Intron|APOL1_uc003ape.2_Intron|APOL1_uc011amo.1_Intron|APOL1_uc011amp.1_Intron|APOL1_uc011amq.1_Intron|APOL1_uc010gwx.2_Intron	NM_003661	NP_003652	O14791	APOL1_HUMAN	apolipoprotein L1 isoform a precursor						cholesterol metabolic process|cytolysis|innate immune response|killing of cells of other organism|lipid transport|lipoprotein metabolic process	high-density lipoprotein particle|very-low-density lipoprotein particle	chloride channel activity|lipid binding|protein binding			breast(2)|ovary(1)	3						CCTCCAGGCAGCCCCCTCTGCTGG	0.593													14	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49467012	49467019	+	IGR	DEL	TTCCTTCC	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49467012_49467019delTTCCTTCC								FAM19A5 (319270 upstream) : C22orf34 (341157 downstream)																							ccttccttcgttccttccttccttcctt	0.005													5	5	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2683418	2683425	+	Intron	DEL	GGAAGGAA	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2683418_2683425delGGAAGGAA	uc011mhg.1	+						XG_uc010ndb.2_Intron|XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				agggagggagggaaggaaggaaggaagg	0.135													5	3	---	---	---	---	
CXorf26	51260	broad.mit.edu	37	X	75393056	75393057	+	Intron	INS	-	T	T			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75393056_75393057insT	uc004ecl.1	+						CXorf26_uc004eck.1_Intron	NM_016500	NP_057584	Q9BVG4	CX026_HUMAN	hypothetical protein LOC51260												0						CAGGTGGAGCCttttttttttc	0.327													3	3	---	---	---	---	
ATP7A	538	broad.mit.edu	37	X	77299156	77299156	+	Intron	DEL	T	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77299156delT	uc004ecx.3	+							NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide						ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						TCCCTCCAACttttttttttt	0.129													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13501672	13501674	+	IGR	DEL	AAT	-	-			TCGA-B0-5119-01A-02D-1421-08	TCGA-B0-5119-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13501672_13501674delAAT								None (None upstream) : None (None downstream)																							TCTTACCAACAATATTTGATTCA	0.217													3	3	---	---	---	---	
