Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MIR429	554210	broad.mit.edu	37	1	1104459	1104459	+	RNA	SNP	A	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1104459A>G	hsa-mir-429|MI0001641	+			c.75A>G			uc010nyf.1_RNA																	0						AAAACCGTCCATCCGCTGCCT	0.622													4	9	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974662	16974662	+	RNA	SNP	C	A	A	rs28460410	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974662C>A	uc010och.1	+	7		c.1122C>A			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						GCTACCAGATCCGGCGTTGTA	0.692													6	83	---	---	---	---	PASS
MAGI3	260425	broad.mit.edu	37	1	114184768	114184768	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114184768G>T	uc001edk.2	+	10	1777	c.1596G>T	c.(1594-1596)AAG>AAT	p.K532N	MAGI3_uc001edh.3_Missense_Mutation_p.K557N|MAGI3_uc001edi.3_Missense_Mutation_p.K532N|MAGI3_uc010owm.1_Missense_Mutation_p.K557N|MAGI3_uc001edj.2_Missense_Mutation_p.K253N	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	557					apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGATTTTAAGCCAGGAGCAA	0.468													19	66	---	---	---	---	PASS
LOC100286793	100286793	broad.mit.edu	37	1	143663875	143663875	+	RNA	SNP	G	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143663875G>T	uc001ejp.3	-	2		c.709C>A								Homo sapiens cDNA FLJ39739 fis, clone SMINT2016440.												0						CCCCGACACAGACCTGAACCG	0.632													4	46	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145293212	145293212	+	5'Flank	SNP	G	C	C	rs4382783		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145293212G>C	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc010oyh.1_Intron|NBPF10_uc001emq.1_5'Flank	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTCGAACCTTGTTTTTGTGGT	0.468													5	18	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152280282	152280282	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152280282G>C	uc001ezu.1	-	3	7116	c.7080C>G	c.(7078-7080)CAC>CAG	p.H2360Q		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2360	Ser-rich.|Filaggrin 14.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGACCCTCGGTGTCCACTGT	0.587									Ichthyosis				25	29	---	---	---	---	PASS
TP53BP2	7159	broad.mit.edu	37	1	223994599	223994599	+	Silent	SNP	T	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223994599T>C	uc010pvb.1	-	5	715	c.423A>G	c.(421-423)GCA>GCG	p.A141A	TP53BP2_uc001hod.2_Silent_p.A12A	NM_001031685	NP_001026855	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein, 2 isoform 1	135	Gln-rich.				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(2)|lung(1)	3				GBM - Glioblastoma multiforme(131;0.0958)		GCTGGCGAGATGCCATTTCCT	0.343													30	92	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248005200	248005200	+	5'Flank	SNP	G	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248005200G>T	uc001idn.1	-							NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGGCTCCATTGCCTGTGGGGG	0.433													8	33	---	---	---	---	PASS
DDX1	1653	broad.mit.edu	37	2	15758358	15758358	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15758358G>C	uc002rce.2	+	16	1458	c.1170G>C	c.(1168-1170)CAG>CAC	p.Q390H	DDX1_uc010yjq.1_Missense_Mutation_p.Q298H	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1	390	Necessary for interaction with RELA.|Helicase ATP-binding.				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		TGCACAATCAGATTCCTCAGG	0.284													21	71	---	---	---	---	PASS
ATP6V1B1	525	broad.mit.edu	37	2	71190307	71190307	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71190307G>C	uc002shj.2	+	10	1012	c.925G>C	c.(925-927)GAG>CAG	p.E309Q	ATP6V1B1_uc010fdv.2_Missense_Mutation_p.E309Q|ATP6V1B1_uc010fdw.2_RNA|ATP6V1B1_uc010fdx.2_Missense_Mutation_p.E267Q	NM_001692	NP_001683	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1	309					ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1						TGCTGCTAGAGAGGAGGTGCC	0.607													6	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96646519	96646519	+	RNA	SNP	T	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96646519T>A	uc010yug.1	-	5		c.693A>T								Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																		AGTAACAGCATGTATGAGGGC	0.313													6	72	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114356414	114356414	+	3'UTR	SNP	A	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114356414A>T	uc002tkh.2	+	6					WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CTTCCCTGGGAGGGGGTGACG	0.627													2	2	---	---	---	---	PASS
HSPD1	3329	broad.mit.edu	37	2	198362076	198362076	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198362076T>G	uc002uui.2	-	3	352	c.215A>C	c.(214-216)AAA>ACA	p.K72T	HSPD1_uc002uuj.2_Missense_Mutation_p.K72T|HSPD1_uc010zgx.1_Missense_Mutation_p.K72T|HSPD1_uc010fsm.2_Intron|HSPD1_uc002uuk.2_Missense_Mutation_p.K72T|HSPD1_uc010zgy.1_Missense_Mutation_p.K72T|HSPE1_uc002uul.2_5'Flank	NM_002156	NP_002147	P10809	CH60_HUMAN	chaperonin	72					'de novo' protein folding|activation of caspase activity|B cell cytokine production|B cell proliferation|chaperone-mediated protein complex assembly|interspecies interaction between organisms|isotype switching to IgG isotypes|MyD88-dependent toll-like receptor signaling pathway|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of interferon-alpha production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of macrophage activation|positive regulation of T cell activation|positive regulation of T cell mediated immune response to tumor cell|protein maturation|protein refolding|protein stabilization|response to unfolded protein|T cell activation	cell surface|coated pit|coated vesicle|cytosol|early endosome|extracellular space|lipopolysaccharide receptor complex|mitochondrial inner membrane|mitochondrial matrix|stored secretory granule	ATP binding|ATPase activity|cell surface binding|chaperone binding|DNA replication origin binding|lipopolysaccharide binding|p53 binding|single-stranded DNA binding				0			Epithelial(96;0.225)			TTTTGTTACTTTGGGACTTCC	0.338													10	30	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	240504869	240504869	+	3'UTR	SNP	G	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240504869G>T	uc002vym.1	+	2										SubName: Full=cDNA FLJ45964 fis, clone PLACE7014396;																		AGCATGTTTGGTAGCCATTCT	0.478													10	70	---	---	---	---	PASS
IP6K2	51447	broad.mit.edu	37	3	48732030	48732030	+	Intron	SNP	T	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48732030T>A	uc003cup.2	-						IP6K2_uc003cuq.2_Intron|IP6K2_uc011bbq.1_Intron|IP6K2_uc011bbr.1_Intron|IP6K2_uc003cur.2_Intron|IP6K2_uc003cus.2_Intron|IP6K2_uc003cut.2_Intron|IP6K2_uc011bbs.1_Intron|IP6K2_uc011bbt.1_3'UTR|IP6K2_uc003cuv.1_3'UTR|IP6K2_uc011bbu.1_3'UTR|IP6K2_uc011bbv.1_3'UTR|IP6K2_uc003cuw.1_3'UTR	NM_001005909	NP_001005909	Q9UHH9	IP6K2_HUMAN	inositol hexaphosphate kinase 2 isoform a						negative regulation of cell growth|phosphatidylinositol phosphorylation|positive regulation of apoptosis|type I interferon-mediated signaling pathway	intermediate filament cytoskeleton|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity				0						CATATAGCAATTTTGGGGACA	0.438													6	14	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52651357	52651357	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52651357T>C	uc003des.2	-	14	1751	c.1739A>G	c.(1738-1740)TAT>TGT	p.Y580C	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.Y580C|PBRM1_uc003der.2_Missense_Mutation_p.Y548C|PBRM1_uc003det.2_Missense_Mutation_p.Y595C|PBRM1_uc003deu.2_Missense_Mutation_p.Y595C|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.Y580C|PBRM1_uc010hmk.1_Missense_Mutation_p.Y580C|PBRM1_uc003dey.2_Missense_Mutation_p.Y580C|PBRM1_uc003dez.1_Missense_Mutation_p.Y580C|PBRM1_uc003dfb.1_Missense_Mutation_p.Y493C|PBRM1_uc003dfc.2_5'Flank	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	580	Bromo 4.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTCACCAGCATATTTGTCATT	0.433			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								33	60	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104080236	104080236	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104080236A>C	uc003hxb.1	-	22	2622	c.2532T>G	c.(2530-2532)AAT>AAG	p.N844K	CENPE_uc003hxc.1_Missense_Mutation_p.N819K	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	844	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTATTTCCTGATTCATTCTCT	0.353													11	126	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82815685	82815685	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82815685G>T	uc003kii.3	+	7	1916	c.1560G>T	c.(1558-1560)TTG>TTT	p.L520F	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.L520F|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	520	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		AAACACCATTGGTAACTGCAA	0.393													20	66	---	---	---	---	PASS
PCDHB3	56132	broad.mit.edu	37	5	140480794	140480794	+	Silent	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140480794C>T	uc003lio.2	+	1	561	c.561C>T	c.(559-561)GAC>GAT	p.D187D	uc003lin.2_Intron	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	187	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTCGTAGGGACGGAAGGAAGT	0.562													11	33	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140594775	140594775	+	Silent	SNP	C	T	T	rs111778165	byFrequency	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140594775C>T	uc003lja.1	+	1	1267	c.1080C>T	c.(1078-1080)AAC>AAT	p.N360N		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	360	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TACCTGAGAACGCGCCTGAAA	0.453													6	94	---	---	---	---	PASS
FOXF2	2295	broad.mit.edu	37	6	1395205	1395205	+	3'UTR	SNP	A	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1395205A>C	uc003mtm.2	+	2					FOXF2_uc003mtn.2_3'UTR	NM_001452	NP_001443	Q12947	FOXF2_HUMAN	forkhead box F2						epithelial to mesenchymal transition|genitalia development|palate development|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		TAAGCCACACACCTGCCACTT	0.567													7	16	---	---	---	---	PASS
EDN1	1906	broad.mit.edu	37	6	12292680	12292680	+	Silent	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12292680C>T	uc003nae.3	+	2	505	c.171C>T	c.(169-171)TCC>TCT	p.S57S	EDN1_uc010jpb.2_Silent_p.S57S|EDN1_uc003nad.2_Silent_p.S57S|EDN1_uc003naf.3_Silent_p.S56S	NM_001955	NP_001946	P05305	EDN1_HUMAN	endothelin 1 precursor	57					artery smooth muscle contraction|calcium-mediated signaling|leukocyte activation|negative regulation of blood coagulation|negative regulation of cellular protein metabolic process|negative regulation of nitric-oxide synthase biosynthetic process|negative regulation of transcription from RNA polymerase II promoter|nitric oxide transport|peptide hormone secretion|phosphatidylinositol 3-kinase cascade|positive regulation of cardiac muscle hypertrophy|positive regulation of cell size|positive regulation of endothelial cell migration|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of JUN kinase activity|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of sarcomere organization|positive regulation of smooth muscle cell proliferation|prostaglandin biosynthetic process|protein kinase C deactivation|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	cytoplasm|extracellular space	cytokine activity|endothelin A receptor binding|endothelin B receptor binding|hormone activity			skin(1)	1	all_cancers(95;0.241)|Breast(50;0.0266)|Ovarian(93;0.12)	all_hematologic(90;0.117)				CCTGCTCGTCCCTGATGGATA	0.582													8	28	---	---	---	---	PASS
SLC22A7	10864	broad.mit.edu	37	6	43272019	43272019	+	Intron	SNP	A	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43272019A>G	uc003out.2	+						SLC22A7_uc003ous.2_3'UTR	NM_153320	NP_696961	Q9Y694	S22A7_HUMAN	solute carrier family 22 member 7 isoform b							basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			ACGTGTGATAACATGCATATG	0.512													3	28	---	---	---	---	PASS
COX19	90639	broad.mit.edu	37	7	1012903	1012903	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1012903T>A	uc003sjp.1	-	2	198	c.108A>T	c.(106-108)AAA>AAT	p.K36N	ADAP1_uc010ksc.2_5'UTR	NM_001031617	NP_001026788	Q49B96	COX19_HUMAN	COX19 cytochrome c oxidase assembly homolog	36	CHCH.					cytosol					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;2.15e-15)		ACTTCATGAATTTCTCTTTAA	0.353													17	63	---	---	---	---	PASS
ST7	7982	broad.mit.edu	37	7	116863308	116863308	+	3'UTR	SNP	T	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116863308T>C	uc003vin.2	+	16					ST7_uc011knl.1_3'UTR|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7_uc011knn.1_Intron	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ttgcctgaactcctgccatag	0.000													5	6	---	---	---	---	PASS
HYAL4	23553	broad.mit.edu	37	7	123516829	123516829	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123516829C>A	uc003vlc.2	+	5	1704	c.1066C>A	c.(1066-1068)CAG>AAG	p.Q356K	HYAL4_uc011knz.1_3'UTR	NM_012269	NP_036401	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	356	Extracellular (Potential).				fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity			skin(1)	1						AAAGGTGAAGCAGTTTGTGAG	0.428													5	98	---	---	---	---	PASS
ARHGEF5	7984	broad.mit.edu	37	7	144060770	144060770	+	Silent	SNP	T	C	C	rs141931104	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144060770T>C	uc003wel.2	+	2	1126	c.1008T>C	c.(1006-1008)AAT>AAC	p.N336N	ARHGEF5_uc003wek.2_Silent_p.N336N	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	336					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					CAGAAGAGAATAGGGCGGACT	0.512													6	217	---	---	---	---	PASS
CTSB	1508	broad.mit.edu	37	8	11702542	11702542	+	3'UTR	SNP	T	C	C	rs8898	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11702542T>C	uc003wum.2	-	12					CTSB_uc003wul.2_3'UTR|CTSB_uc011kxl.1_3'UTR|CTSB_uc003wun.2_3'UTR|CTSB_uc003wuo.2_3'UTR|CTSB_uc003wup.2_3'UTR|CTSB_uc003wuq.2_3'UTR|CTSB_uc010lsc.2_3'UTR|CTSB_uc003wur.2_3'UTR|CTSB_uc003wus.1_Intron|CTSB_uc003wut.1_Intron|CTSB_uc003wuu.2_3'UTR	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein						proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		TCAGACCCTGTCTGAAACTTG	0.507													3	19	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43147724	43147724	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43147724C>T	uc003xpz.1	+	1	140	c.97C>T	c.(97-99)CCC>TCC	p.P33S	POTEA_uc003xqa.1_Missense_Mutation_p.P33S	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	33	Cys-rich.									ovary(1)	1						CTGCTGCTTCCCCTGCTGCAG	0.587													4	10	---	---	---	---	PASS
PIGO	84720	broad.mit.edu	37	9	35093849	35093849	+	Intron	SNP	G	A	A	rs2240115	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35093849G>A	uc003zwd.2	-						PIGO_uc003zwc.1_Intron|PIGO_uc003zwe.2_Intron|PIGO_uc003zwf.2_Intron|PIGO_uc003zwg.1_5'UTR	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity			large_intestine(1)|ovary(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GAGCTTCTTCGAGATTCTCAG	0.488													4	42	---	---	---	---	PASS
SURF4	6836	broad.mit.edu	37	9	136234216	136234216	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136234216G>A	uc004cdj.2	-	2	284	c.154C>T	c.(154-156)CGC>TGC	p.R52C	SURF4_uc011mda.1_Missense_Mutation_p.R43C|SURF4_uc010nal.2_Missense_Mutation_p.R84C|SURF4_uc011mdb.1_Missense_Mutation_p.R9C|SURF4_uc011mdc.1_Missense_Mutation_p.R9C|SURF4_uc011mdd.1_Missense_Mutation_p.R52C	NM_033161	NP_149351	O15260	SURF4_HUMAN	surfeit 4	52						endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		ATGTAGTCGCGCTGCTCGCTC	0.612													7	29	---	---	---	---	PASS
FBXO18	84893	broad.mit.edu	37	10	5951142	5951142	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5951142G>A	uc001iis.2	+	5	1000	c.905G>A	c.(904-906)TGC>TAC	p.C302Y	FBXO18_uc001iir.2_Missense_Mutation_p.C228Y|FBXO18_uc009xig.2_Missense_Mutation_p.C228Y|FBXO18_uc001iit.2_Missense_Mutation_p.C353Y	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2	302					DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						ACCACTAAGTGCTCTCCGAGT	0.577													8	29	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33199338	33199338	+	Silent	SNP	G	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33199338G>A	uc001iws.3	-	14	2113	c.1977C>T	c.(1975-1977)GAC>GAT	p.D659D	ITGB1_uc001iwp.3_Silent_p.D659D|ITGB1_uc001iwq.3_Silent_p.D659D|ITGB1_uc001iwr.3_Silent_p.D659D|ITGB1_uc001iwt.3_Silent_p.D659D|ITGB1_uc001iwu.1_Silent_p.D659D	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	659	Extracellular (Potential).				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				GTGTGCATGTGTCTTTCTTTT	0.363													5	63	---	---	---	---	PASS
C10orf57	80195	broad.mit.edu	37	10	81838462	81838462	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81838462A>C	uc001kbl.2	+	1	37	c.7A>C	c.(7-9)ACG>CCG	p.T3P	LOC219347_uc001kbk.2_Intron|LOC219347_uc001kbi.3_Intron|LOC219347_uc009xsk.2_Intron|LOC219347_uc009xsl.2_Intron|LOC219347_uc009xsm.2_Intron|LOC219347_uc001kbj.3_Intron|C10orf57_uc009xsn.2_Missense_Mutation_p.T3P|C10orf57_uc010qlv.1_5'Flank|C10orf57_uc010qlw.1_5'Flank|C10orf57_uc001kbn.3_5'Flank|C10orf57_uc009xsp.2_5'Flank|C10orf57_uc001kbo.3_5'Flank	NM_025125	NP_079401	Q8TBM7	CJ057_HUMAN	hypothetical protein LOC80195	3						integral to membrane					0	Prostate(51;0.0095)|all_epithelial(25;0.175)		Epithelial(14;0.0793)|Colorectal(32;0.109)|all cancers(16;0.154)			AGCCATGGCTACGGCAGCCGG	0.677													15	15	---	---	---	---	PASS
STAMBPL1	57559	broad.mit.edu	37	10	90682964	90682964	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90682964G>T	uc001kfk.2	+	11	1717	c.1294G>T	c.(1294-1296)GTG>TTG	p.V432L	STAMBPL1_uc010qmx.1_Intron|STAMBPL1_uc009xto.2_RNA|STAMBPL1_uc001kfl.2_Missense_Mutation_p.V432L|STAMBPL1_uc001kfn.2_Missense_Mutation_p.V266L	NM_020799	NP_065850	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	432							metal ion binding|metallopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		AAAAATAATTGTGTTGGATCT	0.348													8	75	---	---	---	---	PASS
PIPSL	266971	broad.mit.edu	37	10	95720827	95720827	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95720827C>A	uc009xuj.2	-	1	846	c.327G>T	c.(325-327)TTG>TTT	p.L109F		NR_002319				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0						AGAGGGAATACAAGTAATCAT	0.498													45	139	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													6	38	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427885	3427885	+	RNA	SNP	A	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427885A>G	uc010qxs.1	+	9		c.878A>G			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						AGCTTCACAGATCCACCGCTG	0.587													4	29	---	---	---	---	PASS
OR51I2	390064	broad.mit.edu	37	11	5474970	5474970	+	Silent	SNP	C	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5474970C>G	uc010qzf.1	+	1	252	c.252C>G	c.(250-252)ACC>ACG	p.T84T	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004754	NP_001004754	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I,	84	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TACTCCGAACCTTCTGCCTCA	0.493													6	81	---	---	---	---	PASS
RELA	5970	broad.mit.edu	37	11	65426222	65426222	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65426222C>T	uc001ofg.2	-	7	771	c.631G>A	c.(631-633)GAG>AAG	p.E211K	RELA_uc001ofh.2_Missense_Mutation_p.E208K|RELA_uc010ron.1_Missense_Mutation_p.E222K|RELA_uc009yqr.2_Missense_Mutation_p.E158K|RELA_uc001ofe.2_Missense_Mutation_p.E211K|RELA_uc001off.2_Missense_Mutation_p.E211K|RELA_uc009yqs.1_Intron	NM_021975	NP_068810	Q04206	TF65_HUMAN	v-rel reticuloendotheliosis viral oncogene	211	RHD.				anti-apoptosis|cellular defense response|cytokine-mediated signaling pathway|defense response to virus|inflammatory response|innate immune response|interspecies interaction between organisms|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription, DNA-dependent|nerve growth factor receptor signaling pathway|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of inflammatory response|response to interleukin-1|response to UV-B|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|transcription factor complex	activating transcription factor binding|chromatin binding|identical protein binding|NF-kappaB binding|phosphate binding|protein kinase binding|protein N-terminus binding|repressing transcription factor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding			lung(3)|ovary(1)	4						AGGAAGATCTCATCCCCACCG	0.567													18	51	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88780579	88780579	+	Silent	SNP	T	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88780579T>C	uc001pcq.2	-	1	662	c.462A>G	c.(460-462)GTA>GTG	p.V154V	GRM5_uc009yvm.2_Silent_p.V154V|GRM5_uc009yvn.1_Silent_p.V154V	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	154	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	CCTGAATGGCTACAGAACTGG	0.493													3	51	---	---	---	---	PASS
BCL9L	283149	broad.mit.edu	37	11	118779364	118779364	+	Silent	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118779364C>T	uc001pug.2	-	2	992	c.27G>A	c.(25-27)AGG>AGA	p.R9R	BCL9L_uc009zal.2_Intron	NM_182557	NP_872363	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	9					negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		transcription coactivator activity			ovary(1)|pancreas(1)	2	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GGTGGGGTAACCTGGGAGGAG	0.597													4	20	---	---	---	---	PASS
TMEM225	338661	broad.mit.edu	37	11	123753906	123753906	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123753906G>A	uc001pzi.2	-	4	825	c.617C>T	c.(616-618)GCA>GTA	p.A206V		NM_001013743	NP_001013765	Q6GV28	TM225_HUMAN	transmembrane protein 225	206						integral to membrane				upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	3						CACAGTGTGTGCACGGACAAT	0.393													25	76	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082245	8082245	+	Intron	SNP	T	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082245T>G	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GTGAAATACTTTAAGACACGT	0.254													3	53	---	---	---	---	PASS
MCRS1	10445	broad.mit.edu	37	12	49952386	49952386	+	3'UTR	SNP	A	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49952386A>G	uc001ruk.1	-	15					MCRS1_uc001rui.1_3'UTR|MCRS1_uc001ruj.1_3'UTR|MCRS1_uc001rul.1_3'UTR|MCRS1_uc009zlj.1_3'UTR|MCRS1_uc001rum.1_3'UTR	NM_006337	NP_006328	Q96EZ8	MCRS1_HUMAN	microspherule protein 1 isoform 1						DNA recombination|DNA repair|protein modification process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|MLL1 complex|nucleolus	protein binding			large_intestine(1)	1						GTGGCAGGGGAAACAGGCCGG	0.607													3	3	---	---	---	---	PASS
CTDSP2	10106	broad.mit.edu	37	12	58220853	58220853	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58220853C>T	uc001sqm.2	-	4	809	c.280G>A	c.(280-282)GTG>ATG	p.V94M	CTDSP2_uc010ssg.1_5'Flank|CTDSP2_uc009zqf.2_Translation_Start_Site|CTDSP2_uc009zqg.2_Intron|uc001sqn.2_5'Flank|MIR26A2_hsa-mir-26a-2|MI0000750_5'Flank	NM_005730	NP_005721	O14595	CTDS2_HUMAN	nuclear LIM interactor-interacting factor 2	94					protein dephosphorylation	nucleus|soluble fraction	CTD phosphatase activity|metal ion binding			central_nervous_system(1)	1	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					TCCTCTGTCACCTCTGGGAGC	0.493													18	34	---	---	---	---	PASS
SBNO1	55206	broad.mit.edu	37	12	123800154	123800154	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123800154A>G	uc010tap.1	-	21	2989	c.2989T>C	c.(2989-2991)TCT>CCT	p.S997P	SBNO1_uc010tao.1_Missense_Mutation_p.S996P|SBNO1_uc010taq.1_5'UTR|SBNO1_uc001ues.1_5'Flank	NM_018183	NP_060653	A3KN83	SBNO1_HUMAN	sno, strawberry notch homolog 1	997			S -> C (in a breast cancer sample; somatic mutation).				ATP binding|DNA binding|hydrolase activity			breast(5)|skin(2)|ovary(1)|kidney(1)	9	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		GCCAGTTCAGATATCAGAAAG	0.388													45	104	---	---	---	---	PASS
FITM1	161247	broad.mit.edu	37	14	24600851	24600851	+	Missense_Mutation	SNP	G	A	A	rs139596139		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24600851G>A	uc001wmf.2	+	1	177	c.79G>A	c.(79-81)GTG>ATG	p.V27M		NM_203402	NP_981947	A5D6W6	FITM1_HUMAN	fat-inducing transcript 1	27	Helical; (Potential).				lipid particle organization|positive regulation of sequestering of triglyceride	endoplasmic reticulum membrane|integral to membrane					0						CCTGCTCAAGGTGCTGCTCTG	0.448													3	24	---	---	---	---	PASS
ADAL	161823	broad.mit.edu	37	15	43644189	43644189	+	3'UTR	SNP	T	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43644189T>C	uc010udo.1	+	12					ADAL_uc001zri.1_3'UTR	NM_001159280	NP_001152752	Q6DHV7	ADAL_HUMAN	adenosine deaminase-like isoform 1						adenosine catabolic process|inosine biosynthetic process|purine ribonucleoside monophosphate biosynthetic process		adenosine deaminase activity|metal ion binding				0		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		TCAATCAAGTTCCTGCCATAT	0.353													6	7	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88476307	88476307	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88476307C>T	uc002bme.1	-	15	1987	c.1825G>A	c.(1825-1827)GAT>AAT	p.D609N	NTRK3_uc002bmh.2_Missense_Mutation_p.D601N|NTRK3_uc002bmf.1_Missense_Mutation_p.D609N|NTRK3_uc010upl.1_Missense_Mutation_p.D511N|NTRK3_uc010bnh.1_Missense_Mutation_p.D601N	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	609	Cytoplasmic (Potential).|Protein kinase.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGGTCCCCATCGCCGCACACT	0.552			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			10	35	---	---	---	---	PASS
FURIN	5045	broad.mit.edu	37	15	91424976	91424976	+	Silent	SNP	C	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91424976C>A	uc002bpu.1	+	16	2469	c.2253C>A	c.(2251-2253)ACC>ACA	p.T751T	FES_uc010uqj.1_5'Flank|FES_uc010uqk.1_5'Flank|FES_uc002bpw.2_5'Flank|FES_uc002bpv.2_5'Flank	NM_002569	NP_002560	P09958	FURIN_HUMAN	furin preproprotein	751					cell proliferation|negative regulation of low-density lipoprotein particle receptor catabolic process|negative regulation of transforming growth factor-beta1 production|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|Notch signaling pathway|peptide biosynthetic process|peptidyl-glutamic acid carboxylation|post-translational protein modification|secretion by cell|signal peptide processing|transforming growth factor beta receptor signaling pathway|viral assembly, maturation, egress, and release	cell surface|Golgi lumen|Golgi membrane|integral to membrane|membrane raft|plasma membrane|trans-Golgi network|trans-Golgi network transport vesicle	metal ion binding|nerve growth factor binding|peptide binding|protease binding|serine-type endopeptidase activity|serine-type endopeptidase inhibitor activity			central_nervous_system(4)|lung(2)|breast(1)	7	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			AGGTGTACACCATGGACCGTG	0.632													3	41	---	---	---	---	PASS
SLC13A5	284111	broad.mit.edu	37	17	6589398	6589398	+	3'UTR	SNP	T	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6589398T>G	uc002gdj.2	-	12					SLC13A5_uc010vtf.1_3'UTR|SLC13A5_uc010clq.2_3'UTR|SLC13A5_uc002gdk.2_3'UTR	NM_177550	NP_808218	Q86YT5	S13A5_HUMAN	solute carrier family 13, member 5 isoform a							integral to membrane	citrate transmembrane transporter activity				0						ATTGGCTGGGTTTTGGTGGTG	0.557													8	22	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72516044	72516044	+	Intron	SNP	G	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72516044G>A	uc002llw.2	+						ZNF407_uc010xfc.1_3'UTR|ZNF407_uc010dqu.1_Intron	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ACCTGCAGTGGGAGGATTGGC	0.418													19	36	---	---	---	---	PASS
S1PR2	9294	broad.mit.edu	37	19	10334693	10334693	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10334693G>A	uc002mnl.2	-	2	1000	c.889C>T	c.(889-891)CGG>TGG	p.R297W		NM_004230	NP_004221	O95136	S1PR2_HUMAN	endothelial differentiation, sphingolipid	297	Cytoplasmic (By similarity).				activation of MAPK activity|positive regulation of cell proliferation	integral to membrane|plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			lung(1)|central_nervous_system(1)	2						AGCACCTCCCGCCGCAGGTCC	0.692													7	20	---	---	---	---	PASS
S1PR2	9294	broad.mit.edu	37	19	10335160	10335160	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10335160C>T	uc002mnl.2	-	2	533	c.422G>A	c.(421-423)GGC>GAC	p.G141D		NM_004230	NP_004221	O95136	S1PR2_HUMAN	endothelial differentiation, sphingolipid	141	Cytoplasmic (By similarity).				activation of MAPK activity|positive regulation of cell proliferation	integral to membrane|plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			lung(1)|central_nervous_system(1)	2						CTTGTCGCTGCCATACAGCTT	0.642													3	18	---	---	---	---	PASS
OR10H2	26538	broad.mit.edu	37	19	15839311	15839311	+	Missense_Mutation	SNP	C	T	T	rs139469467		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839311C>T	uc002nbm.2	+	1	478	c.458C>T	c.(457-459)TCG>TTG	p.S153L		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					GCTGGTGGCTCGGTCATGGGG	0.592													8	111	---	---	---	---	PASS
ZNF383	163087	broad.mit.edu	37	19	37733520	37733520	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37733520G>C	uc002oft.1	+	8	962	c.382G>C	c.(382-384)GCA>CCA	p.A128P	ZNF383_uc002ofs.1_Missense_Mutation_p.A63P|ZNF383_uc002ofu.1_Missense_Mutation_p.A128P	NM_152604	NP_689817	Q8NA42	ZN383_HUMAN	zinc finger protein 383	128					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGCCACCTTGCAAAACAACT	0.383													15	42	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41631142	41631142	+	Intron	SNP	A	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41631142A>G	uc002opu.1	+						CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_3'UTR|CYP2F1_uc002opv.1_Intron	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						TTTTCCCCAGAAACCCCACAT	0.542													6	12	---	---	---	---	PASS
IGFL1	374918	broad.mit.edu	37	19	46734248	46734248	+	3'UTR	SNP	A	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46734248A>C	uc002pee.2	+	4						NM_198541	NP_940943	Q6UW32	IGFL1_HUMAN	IGF-like family member 1 precursor							extracellular space	protein binding				0		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.00242)|all cancers(93;0.0132)|GBM - Glioblastoma multiforme(486;0.0294)|Epithelial(262;0.201)		TCTGAGGCCCACCCTGCAGCT	0.587													6	15	---	---	---	---	PASS
LILRP2	79166	broad.mit.edu	37	19	55221501	55221501	+	RNA	SNP	C	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55221501C>G	uc002qgs.1	+	1		c.1901C>G			LILRP2_uc002qgt.1_RNA	NR_003061				Homo sapiens leukocyte immunoglobulin-like receptor pseudogene 2 (LILRP2), non-coding RNA.												0						CAGCCCCAGGCTGGGCTCTCC	0.632													7	18	---	---	---	---	PASS
RFPL4A	342931	broad.mit.edu	37	19	56274249	56274249	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56274249G>C	uc010yge.1	+	3	616	c.572G>C	c.(571-573)TGC>TCC	p.C191S		NM_001145014	NP_001138486	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	191	B30.2/SPRY.						zinc ion binding				0						ACTGTGGGTTGCAGAGAAGGA	0.537													12	156	---	---	---	---	PASS
TBC1D20	128637	broad.mit.edu	37	20	422395	422395	+	Intron	SNP	G	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:422395G>A	uc002wds.2	-						TBC1D20_uc002wdv.2_5'UTR|TBC1D20_uc002wdt.2_Intron|TBC1D20_uc002wdu.2_Intron	NM_144628	NP_653229	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20						interspecies interaction between organisms	integral to membrane|intracellular	Rab GTPase activator activity			central_nervous_system(1)	1		all_epithelial(17;0.228)|Breast(17;0.231)				TCAGGGTGGCGAGGGCTCAAA	0.493													19	45	---	---	---	---	PASS
TRAPPC10	7109	broad.mit.edu	37	21	45479405	45479405	+	Intron	SNP	C	A	A	rs112709517	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45479405C>A	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc002zdz.2_3'UTR	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						TTCTGTCCCTCGTTAGAATCA	0.413													4	63	---	---	---	---	PASS
UFD1L	7353	broad.mit.edu	37	22	19452561	19452561	+	Intron	SNP	A	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19452561A>C	uc002zpm.2	-						UFD1L_uc002zpo.2_Intron|UFD1L_uc011agy.1_Intron|UFD1L_uc002zpp.2_Intron|UFD1L_uc010grq.2_3'UTR	NM_005659	NP_005650	Q92890	UFD1_HUMAN	ubiquitin fusion degradation 1-like isoform A						skeletal system development|ubiquitin-dependent protein catabolic process	cytosol|nucleus	protein binding|ubiquitin-specific protease activity				0	Colorectal(54;0.0993)					CAAATGAATTAGGGCTCTAAA	0.408													4	13	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22661517	22661517	+	RNA	SNP	G	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22661517G>A	uc011aim.1	+	28		c.1741G>A			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						CTCAAGTCCCGAGATCCAATC	0.463													4	14	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22977554	22977554	+	Intron	SNP	G	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22977554G>C	uc011aim.1	+						POM121L1P_uc011ait.1_RNA|uc002zwm.2_5'Flank					Parts of antibodies, mostly variable regions.												0						CCAGGGTCGAGGTCACTCCCT	0.622													4	16	---	---	---	---	PASS
EFHC2	80258	broad.mit.edu	37	X	44132000	44132000	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44132000T>C	uc004dgb.3	-	4	404	c.314A>G	c.(313-315)TAC>TGC	p.Y105C		NM_025184	NP_079460	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	105	DM10 1.						calcium ion binding			breast(3)|ovary(2)|central_nervous_system(1)	6						AGGGTAGAAGTAGATTTTATA	0.323													67	172	---	---	---	---	PASS
GNL3L	54552	broad.mit.edu	37	X	54577474	54577474	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54577474G>C	uc004dth.1	+	10	993	c.854G>C	c.(853-855)GGA>GCA	p.G285A	GNL3L_uc004dti.2_RNA	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3	285	G.				ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						GCTGTTCCTGGAATTACCAAG	0.547													15	47	---	---	---	---	PASS
SPANXE	171489	broad.mit.edu	37	X	140785612	140785612	+	3'UTR	SNP	T	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140785612T>A	uc004fbq.2	-	2						NM_145665	NP_663698	Q8TAD1	SPNXE_HUMAN	SPANX family, member E							cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)					TTGAGAGATGTAGCTTCTTGC	0.458													7	201	---	---	---	---	PASS
RAB39B	116442	broad.mit.edu	37	X	154490260	154490260	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154490260G>C	uc004fne.2	-	2	749	c.470C>G	c.(469-471)GCC>GGC	p.A157G		NM_171998	NP_741995	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	157					protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CACATTAATGGCATCTCGGGC	0.512													7	78	---	---	---	---	PASS
SLC25A33	84275	broad.mit.edu	37	1	9639705	9639706	+	Intron	DEL	AG	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9639705_9639706delAG	uc001apw.2	+						SLC25A33_uc001apx.2_Intron	NM_032315	NP_115691	Q9BSK2	S2533_HUMAN	mitochondrial carrier protein MGC4399						transport	integral to membrane|mitochondrial inner membrane					0	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.44e-05)|Kidney(185;0.000262)|KIRC - Kidney renal clear cell carcinoma(229;0.000957)|BRCA - Breast invasive adenocarcinoma(304;0.0019)|STAD - Stomach adenocarcinoma(132;0.00355)|READ - Rectum adenocarcinoma(331;0.0419)		tttttctggaagcttcatgtca	0.000													8	4	---	---	---	---	
SLC25A33	84275	broad.mit.edu	37	1	9639710	9639710	+	Intron	DEL	C	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9639710delC	uc001apw.2	+						SLC25A33_uc001apx.2_Intron	NM_032315	NP_115691	Q9BSK2	S2533_HUMAN	mitochondrial carrier protein MGC4399						transport	integral to membrane|mitochondrial inner membrane					0	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.44e-05)|Kidney(185;0.000262)|KIRC - Kidney renal clear cell carcinoma(229;0.000957)|BRCA - Breast invasive adenocarcinoma(304;0.0019)|STAD - Stomach adenocarcinoma(132;0.00355)|READ - Rectum adenocarcinoma(331;0.0419)		ctggaagcttcatgtcagcag	0.000													8	4	---	---	---	---	
EXOSC10	5394	broad.mit.edu	37	1	11131769	11131770	+	Intron	INS	-	C	C	rs147069928	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11131769_11131770insC	uc001asa.2	-						EXOSC10_uc001asb.2_Intron	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN	exosome component 10 isoform 1						CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		ttctctacccgctctgctcatg	0.005													6	5	---	---	---	---	
EPHA10	284656	broad.mit.edu	37	1	38226758	38226758	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38226758delT	uc009vvi.2	-						EPHA10_uc001cbw.3_3'UTR	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3							extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				agactccttattttaaaaaaa	0.065													4	2	---	---	---	---	
KIAA0494	9813	broad.mit.edu	37	1	47139255	47139255	+	Intron	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47139255delA	uc010omh.1	-							NM_014774	NP_055589	O75071	K0494_HUMAN	hypothetical protein LOC9813								calcium ion binding				0	Acute lymphoblastic leukemia(166;0.155)					ACATTAAAAGAAAAAAAAAAA	0.448													4	3	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	66084015	66084016	+	Intron	INS	-	C	C	rs58102309	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66084015_66084016insC	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Intron|LEPR_uc001dck.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		tctcttctcttttcttttcttt	0.114													6	3	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	66084016	66084017	+	Intron	INS	-	CTTC	CTTC	rs72641130	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66084016_66084017insCTTC	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Intron|LEPR_uc001dck.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		ctcttctcttttcttttctttt	0.109													6	3	---	---	---	---	
TGFBR3	7049	broad.mit.edu	37	1	92181557	92181557	+	Intron	DEL	G	-	-	rs67268182		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92181557delG	uc001doh.2	-						TGFBR3_uc009wde.2_Intron|TGFBR3_uc010osy.1_Intron|TGFBR3_uc001doi.2_Intron|TGFBR3_uc001doj.2_Intron	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III						BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TTTTTTTTTTGTTAACATTCA	0.363													8	5	---	---	---	---	
SASS6	163786	broad.mit.edu	37	1	100573687	100573687	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100573687delT	uc001dsu.2	-						SASS6_uc009wdz.2_Intron	NM_194292	NP_919268	Q6UVJ0	SAS6_HUMAN	spindle assembly abnormal protein 6						centriole replication	centriole				upper_aerodigestive_tract(1)|ovary(1)	2		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		TTAGTACAGATTTTTTTTTAA	0.239													4	2	---	---	---	---	
COL11A1	1301	broad.mit.edu	37	1	103364163	103364164	+	Intron	INS	-	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103364163_103364164insT	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTCATTCaaaatttttttaaaa	0.312													4	2	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148016184	148016184	+	Intron	DEL	C	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148016184delC	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc001eqq.2_Intron|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GAGAATACAGCTTTTGAGGTA	0.373													8	5	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154687075	154687075	+	Intron	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154687075delA	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			ggtgtgtgtgatgtgtggtgt	0.095													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	160640165	160640165	+	IGR	DEL	G	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160640165delG								SLAMF1 (23084 upstream) : CD48 (8373 downstream)																							GATCATTGATGGCCCAAATCC	0.418													4	2	---	---	---	---	
CD247	919	broad.mit.edu	37	1	167400667	167400675	+	3'UTR	DEL	ACCTGCACC	-	-	rs34484379		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167400667_167400675delACCTGCACC	uc001gei.3	-	8					CD247_uc001gej.3_3'UTR	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)			AGACAGGTCTACCTGCACCACCGGCAAAC	0.579													8	6	---	---	---	---	
CD247	919	broad.mit.edu	37	1	167404197	167404209	+	Intron	DEL	TCCTCCGGAGCCC	-	-	rs71097675		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167404197_167404209delTCCTCCGGAGCCC	uc001gei.3	-						CD247_uc001gej.3_Intron	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)			ctccagcccttcctccggagccctcctccagcc	0.141													7	5	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202173634	202173635	+	Intron	INS	-	AC	AC	rs142684093		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202173634_202173635insAC	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						cacacctccaaacacacacaca	0.000													2	4	---	---	---	---	
PPP1R12B	4660	broad.mit.edu	37	1	202399589	202399590	+	Intron	INS	-	T	T	rs143691042	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202399589_202399590insT	uc001gya.1	+						PPP1R12B_uc001gxy.2_Intron|PPP1R12B_uc009xad.1_Intron|PPP1R12B_uc009xae.1_Intron|PPP1R12B_uc001gxz.1_Intron	NM_002481	NP_002472	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)			AGAATCTAGACTTTTTTTTTTG	0.317													4	4	---	---	---	---	
CR1L	1379	broad.mit.edu	37	1	207842739	207842756	+	Intron	DEL	ATTTCAGTTTTCTTCGAG	-	-	rs139825875		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207842739_207842756delATTTCAGTTTTCTTCGAG	uc001hga.3	+						CR1L_uc001hfz.2_Intron	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like							cytoplasm|extracellular region|membrane					0						TTTTCCTCTTATTTCAGTTTTCTTCGAGATCAAATCTG	0.573													4	2	---	---	---	---	
ABCB10	23456	broad.mit.edu	37	1	229677712	229677712	+	Intron	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229677712delA	uc001htp.3	-							NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B, member 10							integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				aaaaaaaaacaaaaaaaaaaa	0.134													5	3	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237919549	237919549	+	Intron	DEL	C	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237919549delC	uc001hyl.1	+						RYR2_uc010pya.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTTGTGCTTACTGATACCCTC	0.413													33	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	26909433	26909434	+	IGR	DEL	AC	-	-	rs66839615		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26909433_26909434delAC								CIB4 (45222 upstream) : KCNK3 (6147 downstream)																							CTGCCCTGAGacacacacacac	0.490													3	3	---	---	---	---	
PREPL	9581	broad.mit.edu	37	2	44573121	44573121	+	Intron	DEL	T	-	-	rs75345516		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44573121delT	uc002ruf.2	-						PREPL_uc002rug.2_Intron|PREPL_uc002ruh.2_Intron|PREPL_uc010fax.2_Intron|PREPL_uc002rui.3_Intron|PREPL_uc002ruj.1_Intron|PREPL_uc002ruk.1_Intron	NM_006036	NP_006027	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like isoform C						proteolysis	cytosol	serine-type endopeptidase activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				tctctTGAAATTTTTTTTTTT	0.114													8	5	---	---	---	---	
MERTK	10461	broad.mit.edu	37	2	112726104	112726105	+	Intron	DEL	TT	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112726104_112726105delTT	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						Gttcttcttctttttttttttg	0.228													6	3	---	---	---	---	
UGGT1	56886	broad.mit.edu	37	2	128935126	128935127	+	Intron	DEL	CA	-	-	rs66520826		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128935126_128935127delCA	uc002tps.2	+						UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						GGTTTCACTGCACAGTTGAGTT	0.460													14	9	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133014827	133014828	+	Intron	INS	-	A	A	rs146639319		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133014827_133014828insA	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						CCAGGCGGCCCAACCCCGTGCC	0.683													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133102450	133102451	+	IGR	INS	-	TT	TT	rs141217632	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133102450_133102451insTT								NCRNA00164 (86908 upstream) : GPR39 (71696 downstream)																							gtcaggagttcaagaccagcct	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156126643	156126643	+	IGR	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156126643delA								KCNJ3 (413629 upstream) : None (None downstream)																							agaaatgaacaaaaaaaagaa	0.000													4	2	---	---	---	---	
UBR3	130507	broad.mit.edu	37	2	170871495	170871495	+	Intron	DEL	C	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170871495delC	uc010zdi.1	+						UBR3_uc002ufr.3_Intron|UBR3_uc010fqa.2_Intron|UBR3_uc002uft.3_Intron|UBR3_uc010zdj.1_Intron|UBR3_uc002ufu.3_5'UTR	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						TTTTTTTTTTCTTAAGGCCTA	0.338													3	3	---	---	---	---	
PDK1	5163	broad.mit.edu	37	2	173431286	173431286	+	Intron	DEL	A	-	-	rs74725860		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173431286delA	uc002uhr.2	+						PDK1_uc010zdz.1_Intron|PDK1_uc010zea.1_Intron|PDK1_uc002uhq.1_Intron|PDK1_uc002uhs.2_Intron|PDK1_uc010zeb.1_Intron	NM_002610	NP_002601	Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase 1 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)			gtctcaaaggaaaaaaaaaaa	0.030									Autosomal_Dominant_Polycystic_Kidney_Disease				7	5	---	---	---	---	
INPP1	3628	broad.mit.edu	37	2	191231136	191231145	+	Intron	DEL	TCTCACTCTG	-	-	rs10601586		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191231136_191231145delTCTCACTCTG	uc002ury.3	+						INPP1_uc010fsb.2_Intron|INPP1_uc002urx.3_Intron	NM_001128928	NP_001122400	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase						signal transduction		inositol-1,4-bisphosphate 1-phosphatase activity|metal ion binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)		Lithium(DB01356)	tctctcttgctctcactctgtctcactctg	0.000													6	3	---	---	---	---	
COL4A4	1286	broad.mit.edu	37	2	227906563	227906564	+	Intron	DEL	AG	-	-	rs72139797		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227906563_227906564delAG	uc010zlt.1	-							NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		aaagaaagaaagagaaagaaag	0.054													5	3	---	---	---	---	
IL5RA	3568	broad.mit.edu	37	3	3132231	3132231	+	Intron	DEL	T	-	-	rs71922238		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3132231delT	uc011ask.1	-						IL5RA_uc010hbq.2_Intron|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Intron|IL5RA_uc011asl.1_Intron|IL5RA_uc011asm.1_Intron|IL5RA_uc010hbt.2_Intron|IL5RA_uc010hbp.2_Intron	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1						cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		TTGAAttttcttttttttttt	0.194													5	3	---	---	---	---	
STT3B	201595	broad.mit.edu	37	3	31658788	31658789	+	Intron	INS	-	A	A	rs113636660		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31658788_31658789insA	uc011axe.1	+						STT3B_uc010hft.1_Intron|STT3B_uc003cer.1_Intron|STT3B_uc003cet.2_Intron	NM_178862	NP_849193	Q8TCJ2	STT3B_HUMAN	source of immunodominant MHC-associated						protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0						ACTATAAAAAGAAAAAAAAAAT	0.351													4	2	---	---	---	---	
RBM15B	29890	broad.mit.edu	37	3	51431680	51431680	+	3'UTR	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51431680delT	uc003dbd.2	+	1						NM_013286	NP_037418	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B						interspecies interaction between organisms|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nucleoplasm	nucleotide binding|protein binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TTTTGGGGGATTTTTTTTTTT	0.368													4	2	---	---	---	---	
CACNA1D	776	broad.mit.edu	37	3	53774626	53774626	+	Intron	DEL	T	-	-	rs149016635		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53774626delT	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron|CACNA1D_uc003dgw.3_Intron|CACNA1D_uc003dgx.1_Intron	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	TTGAGCTAAGTTTTTTTTTTT	0.373													4	3	---	---	---	---	
NIT2	56954	broad.mit.edu	37	3	100060223	100060223	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100060223delT	uc003dtv.2	+						NIT2_uc011bha.1_Intron	NM_020202	NP_064587	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2						nitrogen compound metabolic process		omega-amidase activity			ovary(1)	1						gctatagtaattttttttttg	0.045													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112616236	112616236	+	IGR	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112616236delA								CD200R1L (51439 upstream) : CD200R1 (25296 downstream)																							AAAAGTTTGTAAATATTCTTT	0.224													4	2	---	---	---	---	
ZDHHC23	254887	broad.mit.edu	37	3	113675641	113675641	+	Intron	DEL	A	-	-	rs67169423		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113675641delA	uc003eau.2	+						ZDHHC23_uc003eav.2_Intron|ZDHHC23_uc003eaw.1_5'Flank	NM_173570	NP_775841	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC domain containing 23							integral to membrane	acyltransferase activity|zinc ion binding			ovary(2)	2						TCATAGGCTCAAAAGTCGCAA	0.403													6	3	---	---	---	---	
ITGB5	3693	broad.mit.edu	37	3	124484907	124484909	+	Intron	DEL	AAA	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124484907_124484909delAAA	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		agcctgtgtcaaaaaaaaaaaaa	0.192													4	2	---	---	---	---	
DZIP1L	199221	broad.mit.edu	37	3	137806083	137806083	+	Intron	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137806083delA	uc003erq.2	-						DZIP1L_uc003err.1_Intron	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like							intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						tagctacctgaaaaaaaatag	0.000													4	2	---	---	---	---	
FAIM	55179	broad.mit.edu	37	3	138348258	138348259	+	Intron	INS	-	TAGCAAGTAAAATACC	TAGCAAGTAAAATACC	rs144618719	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138348258_138348259insTAGCAAGTAAAATACC	uc003esr.2	+						FAIM_uc003eso.1_3'UTR|FAIM_uc003esp.2_Intron|FAIM_uc003esq.2_Intron|FAIM_uc003ess.2_Intron	NM_001033032	NP_001028204	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule isoform c						apoptosis	cytoplasm					0						AGGCTCCAGCATAGCAAGTAAA	0.446													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9706756	9706757	+	IGR	INS	-	G	G	rs149131142	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9706756_9706757insG								MIR548I2 (148819 upstream) : DRD5 (76501 downstream)																							TACAAAGGCCTGGGGGGGGCGC	0.574													1	6	---	---	---	---	
SDAD1	55153	broad.mit.edu	37	4	76877561	76877561	+	Intron	DEL	T	-	-	rs11315314		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76877561delT	uc003hje.3	-						SDAD1_uc003hjf.3_Intron|SDAD1_uc011cbr.1_Intron	NM_018115	NP_060585	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1						protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			tttttttttgttttttttttt	0.000													4	8	---	---	---	---	
ADH1A	124	broad.mit.edu	37	4	100242808	100242808	+	5'Flank	DEL	C	-	-	rs5860575		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100242808delC	uc011ceg.1	-						ADH1B_uc003hus.3_5'Flank|ADH1B_uc003hut.3_5'Flank|ADH1B_uc011ceh.1_5'Flank|ADH1B_uc011cei.1_5'Flank	NM_000667	NP_000658	P07327	ADH1A_HUMAN	class I alcohol dehydrogenase, alpha subunit						ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Fomepizole(DB01213)|NADH(DB00157)	TCACTTCCCACCCCCCCCCGG	0.373													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	120314223	120314224	+	Intron	INS	-	C	C	rs76398583		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120314223_120314224insC	uc003icx.1	+											Homo sapiens cDNA FLJ40382 fis, clone TESTI2035775.																		AAAAAAAAAAAAAacacacaca	0.351													7	4	---	---	---	---	
PDGFC	56034	broad.mit.edu	37	4	157688638	157688639	+	Intron	INS	-	T	T	rs147804978	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157688638_157688639insT	uc003iph.1	-						PDGFC_uc003ipi.1_Intron|PDGFC_uc011cis.1_Intron|PDGFC_uc011cir.1_Intron	NM_016205	NP_057289	Q9NRA1	PDGFC_HUMAN	platelet-derived growth factor C precursor						central nervous system development|platelet-derived growth factor receptor signaling pathway|positive regulation of cell division|positive regulation of DNA replication|positive regulation of fibroblast proliferation|vascular endothelial growth factor receptor signaling pathway	endoplasmic reticulum lumen|extracellular space|Golgi membrane|nucleus	cell surface binding|growth factor activity|platelet-derived growth factor receptor binding|protein homodimerization activity			ovary(1)|lung(1)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		AACTTTACTCATTTTTTTTTCC	0.297													4	2	---	---	---	---	
EXOC3	11336	broad.mit.edu	37	5	462732	462733	+	Intron	DEL	CA	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:462732_462733delCA	uc003jba.2	+							NM_007277	NP_009208	O60645	EXOC3_HUMAN	Sec6 protein						exocytosis|protein transport						0		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			ATTGAGAGTGCACACACACACA	0.228													4	2	---	---	---	---	
C5orf35	133383	broad.mit.edu	37	5	56209215	56209215	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56209215delT	uc003jqx.2	+						C5orf35_uc003jqy.2_Intron	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383											ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)		ttttttttacttttttttttt	0.030													6	3	---	---	---	---	
PCDHB10	56126	broad.mit.edu	37	5	140574170	140574175	+	In_Frame_Del	DEL	AGGCCG	-	-	rs140613424	byFrequency	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140574170_140574175delAGGCCG	uc003lix.2	+	1	2219_2224	c.2045_2050delAGGCCG	c.(2044-2052)CAGGCCGAG>CAG	p.AE683del		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	683_684	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCAGGCCCAGGCCGAGGCCGACTT	0.704													6	6	---	---	---	---	
ADAM19	8728	broad.mit.edu	37	5	156922002	156922002	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156922002delT	uc003lwz.2	-						ADAM19_uc003lww.1_Intron|ADAM19_uc003lwy.2_Intron|ADAM19_uc011ddr.1_Intron	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATATAAATCCttttttttttc	0.209													4	3	---	---	---	---	
BTNL9	153579	broad.mit.edu	37	5	180486891	180486892	+	3'UTR	INS	-	G	G	rs151240170	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180486891_180486892insG	uc003mmt.2	+	11						NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor							integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGACTGGCCCCGGGGGGCCCCC	0.683													3	5	---	---	---	---	
ETV7	51513	broad.mit.edu	37	6	36355495	36355502	+	5'Flank	DEL	GCCCGGGT	-	-	rs67070303		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36355495_36355502delGCCCGGGT	uc003omb.2	-						ETV7_uc003olz.1_5'Flank|ETV7_uc003oma.1_5'Flank|ETV7_uc010jwg.2_5'Flank|ETV7_uc003omc.2_5'Flank|ETV7_uc010jwj.2_5'Flank|ETV7_uc010jwh.2_5'Flank|ETV7_uc010jwi.2_5'Flank|ETV7_uc011dtl.1_5'Flank	NM_016135	NP_057219	Q9Y603	ETV7_HUMAN	ets variant 7						organ morphogenesis|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						AGGCGTGTGCGCCCGGGTCCTCCGCAGG	0.663													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58147860	58147861	+	IGR	INS	-	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58147860_58147861insT								PRIM2 (634485 upstream) : GUSBL2 (98298 downstream)																							TTCGGAGCGTGTTTTTTTTTTC	0.446													11	7	---	---	---	---	
SNAP91	9892	broad.mit.edu	37	6	84417256	84417257	+	Intron	DEL	GT	-	-	rs111588453		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84417256_84417257delGT	uc011dze.1	-						SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron|SNAP91_uc011dzf.1_Intron	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		atacatatgcgtgtgtgtgtgt	0.238													4	2	---	---	---	---	
TRMT11	60487	broad.mit.edu	37	6	126320096	126320096	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126320096delT	uc003qam.2	+						TRMT11_uc003qan.2_Intron|TRMT11_uc010kev.2_Intron	NM_001031712	NP_001026882	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11						tRNA processing		methyltransferase activity|nucleic acid binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0356)		ATCTGGACTGttttttttttt	0.353													6	3	---	---	---	---	
SOD2	6648	broad.mit.edu	37	6	160105646	160105646	+	Intron	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160105646delA	uc003qsg.2	-						SOD2_uc003qsh.2_Intron|SOD2_uc003qsi.1_Intron|SOD2_uc011efu.1_Intron|SOD2_uc011efv.1_Intron	NM_001024465	NP_001019636	P04179	SODM_HUMAN	manganese superoxide dismutase isoform A						age-dependent response to reactive oxygen species|negative regulation of neuron apoptosis|oxygen homeostasis|protein homotetramerization|regulation of transcription from RNA polymerase II promoter|release of cytochrome c from mitochondria|removal of superoxide radicals|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure		manganese ion binding|superoxide dismutase activity				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)		gatctgtctcaaaaaaaataa	0.090													3	3	---	---	---	---	
AMZ1	155185	broad.mit.edu	37	7	2749072	2749073	+	Intron	INS	-	GGCCTCCCCAG	GGCCTCCCCAG	rs142816481	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2749072_2749073insGGCCTCCCCAG	uc003smr.1	+						AMZ1_uc003sms.1_Intron|AMZ1_uc011jwa.1_Intron	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1								metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CTATCCTGTGTGGCCTCCCACC	0.629											OREG0017838	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	4	---	---	---	---	
STK31	56164	broad.mit.edu	37	7	23776301	23776301	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23776301delT	uc003sws.3	+						STK31_uc003swt.3_Intron|STK31_uc011jze.1_Intron|STK31_uc010kuq.2_Intron	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						AGTTGGAATATTTTTTTTTGA	0.303													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	34917961	34917961	+	IGR	DEL	T	-	-	rs113680136		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34917961delT								NPSR1 (17 upstream) : DPY19L1 (43120 downstream)																							tttttctttcttttttttttt	0.025													3	3	---	---	---	---	
NSUN5P2	260294	broad.mit.edu	37	7	72436916	72436917	+	Intron	DEL	GT	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72436916_72436917delGT	uc010lao.2	-						uc003tws.1_Intron	NM_198853	NP_942150			tripartite motif-containing 74												0						ttGAAGATACgtgtgtgtgtgt	0.213													5	3	---	---	---	---	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72664015	72664016	+	5'UTR	INS	-	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72664015_72664016insG	uc003txs.1	-	11					FKBP6_uc003twz.2_Intron	NR_002164				RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;												0						ATACCACCCCCGGGGCATGCCA	0.505													6	3	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99030664	99030664	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99030664delT	uc003uqh.2	-						PTCD1_uc011kiw.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			gctccctctGTTTTTTTTTGA	0.104													3	3	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99032131	99032131	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99032131delT	uc003uqh.2	-						PTCD1_uc011kiw.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			ttctttttccttttttttttt	0.030													4	3	---	---	---	---	
AGBL3	340351	broad.mit.edu	37	7	134819418	134819418	+	Intron	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134819418delA	uc011kpw.1	+						uc003vsg.2_Intron|C7orf49_uc003vsh.2_Intron	NM_178563	NP_848658	Q8NEM8	CBPC3_HUMAN	carboxypeptidase 3, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding				0						GAATAGTGCTAAAAAAAAAAT	0.303													4	2	---	---	---	---	
UBN2	254048	broad.mit.edu	37	7	138950807	138950807	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138950807delT	uc011kqr.1	+						UBN2_uc003vuv.2_Intron	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2											ovary(1)|skin(1)	2						TAGGAGATTCTTTTTTTTTTT	0.219													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143508187	143508188	+	Intron	INS	-	T	T	rs150064856		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143508187_143508188insT	uc011ktn.1	+						uc011kto.1_Intron|uc011ktp.1_Intron|LOC154761_uc011ktq.1_Intron|LOC154761_uc011ktr.1_Intron|LOC154761_uc011kts.1_Intron|LOC154761_uc003wdj.1_Intron	NM_001130026	NP_001123498			hypothetical protein LOC285966 isoform B																		TGACCCCAttcttttttttttt	0.243													6	3	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250946	86250946	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250946delT	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	tttctctctcttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	88800612	88800612	+	IGR	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88800612delT								CNBD1 (405657 upstream) : DCAF4L2 (82361 downstream)																							GCTTGTCATATTTTTTTTTGT	0.358													5	3	---	---	---	---	
C8orf37	157657	broad.mit.edu	37	8	96275608	96275608	+	Intron	DEL	T	-	-	rs112339846		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96275608delT	uc003yho.1	-							NM_177965	NP_808880	Q96NL8	CH037_HUMAN	hypothetical protein LOC157657												0	Breast(36;3.41e-05)					GTTTTTGGCCTTTTAGAAAAG	0.343													4	3	---	---	---	---	
SMARCA2	6595	broad.mit.edu	37	9	2110070	2110070	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2110070delT	uc003zhc.2	+						SMARCA2_uc003zhd.2_Intron|SMARCA2_uc010mha.2_Intron	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TGTTTCTTTCTTTTTTTTTGT	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44133212	44133213	+	IGR	INS	-	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44133212_44133213insT								FAM75A6 (502482 upstream) : FAM27C (857023 downstream)																							GCTGAATAcacttcaaaaaaaa	0.158													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68420736	68420736	+	IGR	DEL	G	-	-	rs145155427		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68420736delG								FAM27B (626547 upstream) : MIR1299 (581503 downstream)																							AGGTGTTGCAGAAACTGGGCA	0.363													4	2	---	---	---	---	
PDCL	5082	broad.mit.edu	37	9	125583102	125583102	+	Intron	DEL	A	-	-	rs35459443		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125583102delA	uc004bmz.1	-						PDCL_uc004bna.2_Intron	NM_005388	NP_005379	Q13371	PHLP_HUMAN	phosducin-like						signal transduction|visual perception						0						atctctccttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SEC61A2	55176	broad.mit.edu	37	10	12210026	12210027	+	Intron	INS	-	T	T			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12210026_12210027insT	uc001ilg.3	+						SEC61A2_uc001ilf.3_Intron|SEC61A2_uc001ilh.3_Intron|uc001ili.1_5'Flank|NUDT5_uc001ilj.2_Intron|NUDT5_uc001ilk.2_Intron	NM_001142627	NP_001136099	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform c							endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				AGGGATAATGAttttttttttt	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30900630	30900631	+	IGR	DEL	AA	-	-	rs72207434		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30900630_30900631delAA								MAP3K8 (149869 upstream) : LYZL2 (78 downstream)																							agaaagaaagaaaaagaaagaa	0.084													6	3	---	---	---	---	
ZEB1	6935	broad.mit.edu	37	10	31799802	31799805	+	Splice_Site	DEL	AAGT	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31799802_31799805delAAGT	uc001ivs.3	+	5	747	c.684_splice	c.e5+1	p.Q228_splice	ZEB1_uc001ivr.3_Splice_Site_p.Q10_splice|ZEB1_uc010qee.1_Splice_Site_p.Q10_splice|ZEB1_uc010qef.1_Splice_Site_p.Q10_splice|ZEB1_uc009xlh.1_Splice_Site|ZEB1_uc009xli.1_Splice_Site|ZEB1_uc009xlj.1_Splice_Site_p.Q154_splice|ZEB1_uc010qeg.1_Splice_Site_p.Q87_splice|ZEB1_uc009xlk.1_Splice_Site_p.Q10_splice|ZEB1_uc001ivt.3_Splice_Site_p.Q10_splice|ZEB1_uc001ivu.3_Splice_Site_p.Q229_splice|ZEB1_uc001ivv.3_Splice_Site_p.Q208_splice|ZEB1_uc010qeh.1_Splice_Site_p.Q161_splice|ZEB1_uc009xll.2_Splice_Site|ZEB1_uc009xlm.1_Splice_Site|ZEB1_uc009xln.1_Splice_Site|ZEB1_uc009xlo.1_Splice_Site_p.Q211_splice|ZEB1_uc009xlp.2_Splice_Site_p.Q212_splice	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b						cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				GGAAGAGATCAAGTAAGTGCAATG	0.368													23	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52417853	52417853	+	IGR	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52417853delA								SGMS1 (32930 upstream) : ASAH2B (81843 downstream)																							aaccatctccaaaaaaaaTTG	0.219													4	2	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116223944	116223944	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116223944delT	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc010qsf.1_Intron|ABLIM1_uc009xyn.2_Intron|ABLIM1_uc010qsj.1_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		GCATAAAGGAttttttttttt	0.279													4	2	---	---	---	---	
SLC3A2	6520	broad.mit.edu	37	11	62650688	62650689	+	Intron	DEL	CT	-	-	rs148336191		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62650688_62650689delCT	uc001nwd.2	+						SLC3A2_uc001nwb.2_Intron|SLC3A2_uc001nwc.2_Intron|SLC3A2_uc001nwe.2_Intron|SLC3A2_uc001nwf.2_Intron|SLC3A2_uc001nwg.2_Intron|SLC3A2_uc010rml.1_Intron	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c						blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						ATTTCCTTGACTCTGAGGATGA	0.436													4	6	---	---	---	---	
ALG8	79053	broad.mit.edu	37	11	77824764	77824768	+	Intron	DEL	AAAAC	-	-	rs59172901	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77824764_77824768delAAAAC	uc001oza.1	-						ALG8_uc001oyz.1_Intron|ALG8_uc009yux.1_Intron	NM_024079	NP_076984	Q9BVK2	ALG8_HUMAN	dolichyl pyrophosphate Glc1Man9GlcNAc2						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity|dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|pancreas(1)	3	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			atcttaaacaaaaacaaaaaaaaaa	0.161													9	4	---	---	---	---	
EED	8726	broad.mit.edu	37	11	85963553	85963554	+	Intron	INS	-	T	T	rs142260874	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85963553_85963554insT	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AAGAATTGGCGTCCTTTTTTTT	0.252													2	6	---	---	---	---	
ZBTB44	29068	broad.mit.edu	37	11	130155186	130155186	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130155186delT	uc001qga.2	-						ZBTB44_uc001qgb.3_Intron|ZBTB44_uc001qfx.2_Intron|ZBTB44_uc001qgc.1_Intron	NM_014155	NP_054874	Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		tcttgttttcttttttttttt	0.124													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13003861	13003861	+	IGR	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13003861delA								DDX47 (20952 upstream) : RPL13AP20 (24550 downstream)																							agagaagtagaggggaactcc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	20289196	20289196	+	IGR	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20289196delA								AEBP2 (614023 upstream) : PDE3A (233001 downstream)																							ggacctgcataaaaaacagtc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31302566	31302569	+	Intron	DEL	TAAA	-	-	rs112733055		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31302566_31302569delTAAA	uc010sjy.1	-											RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CACTCCAAATTAAATAATCTCTTT	0.186													9	6	---	---	---	---	
KRT7	3855	broad.mit.edu	37	12	52641620	52641620	+	Intron	DEL	T	-	-	rs5798205		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52641620delT	uc001saa.1	+						KRT86_uc010snq.1_5'Flank|KRT7_uc009zmf.1_Intron	NM_005556	NP_005547	P08729	K2C7_HUMAN	keratin 7						cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.105)		acagctaccattcaccgaatc	0.174													4	6	---	---	---	---	
PDE1B	5153	broad.mit.edu	37	12	54961125	54961125	+	Intron	DEL	A	-	-	rs68027171		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54961125delA	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						ctgtctctacaaaaaaaaaaa	0.000													7	4	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114393323	114393324	+	Intron	INS	-	A	A	rs138613800	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114393323_114393324insA	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CCCTGAAGAACGGGGTGTCAGt	0.351													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132914384	132914402	+	IGR	DEL	TGGCGACCTGCAGGTGACG	-	-	rs28719937		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132914384_132914402delTGGCGACCTGCAGGTGACG								GALNT9 (8479 upstream) : FBRSL1 (152755 downstream)																							gcgggtgacatggcgacctgcaggtgacgtggcgACCTG	0.292													8	5	---	---	---	---	
GPC5	2262	broad.mit.edu	37	13	92408320	92408320	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92408320delT	uc010tif.1	+							NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				AAATACTAGCTTTTTTTTTGA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	105187724	105187727	+	IGR	DEL	AAAA	-	-	rs10612713		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105187724_105187727delAAAA								None (None upstream) : DAOA (930489 downstream)																							atctcaaaacaaaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NIN	51199	broad.mit.edu	37	14	51238403	51238403	+	Intron	DEL	A	-	-	rs139982870		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51238403delA	uc001wym.2	-						NIN_uc001wyi.2_Intron|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Intron|NIN_uc001wyo.2_Intron|NIN_uc001wyp.1_Intron	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5						centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					TGTTAAAAAGAAAAAAAAAAA	0.179			T	PDGFRB	MPD								3	3	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28524962	28524962	+	Intron	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28524962delA	uc001zbj.2	-						HERC2_uc001zbl.1_Intron	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ttgtctctccaaaaaaaagaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	32462352	32462353	+	Intron	INS	-	AGTT	AGTT			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32462352_32462353insAGTT	uc001zfv.1	-											Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.																		TTGATTTTCAGAGTTAAATAAA	0.391													1	5	---	---	---	---	
SNUPN	10073	broad.mit.edu	37	15	75913604	75913604	+	Intron	DEL	T	-	-	rs67400161		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75913604delT	uc002ban.2	-						SNUPN_uc002bao.2_Intron|SNUPN_uc002bap.2_Intron|SNUPN_uc002baq.2_Intron|SNUPN_uc002bar.2_Intron|SNUPN_uc002bas.2_Intron	NM_005701	NP_005692	O95149	SPN1_HUMAN	snurportin 1						ncRNA metabolic process|protein import into nucleus|spliceosomal snRNP assembly	cytosol|nuclear pore	protein transporter activity|RNA cap binding			pancreas(1)	1						AGATAtttccttttttttttt	0.139													3	5	---	---	---	---	
ACAN	176	broad.mit.edu	37	15	89403776	89403777	+	Intron	INS	-	CTCAGGCTT	CTCAGGCTT	rs147084610	by1000genomes	TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89403776_89403777insCTCAGGCTT	uc010upo.1	+						ACAN_uc010upp.1_Intron|ACAN_uc002bna.2_Intron	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor						cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTCCACTGAGGCTCAGGCTGGG	0.416													6	3	---	---	---	---	
CYLD	1540	broad.mit.edu	37	16	50815633	50815633	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50815633delT	uc002egp.1	+						CYLD_uc002ego.2_Intron|CYLD_uc010cbs.1_Intron|CYLD_uc002egq.1_Intron|CYLD_uc002egr.1_Intron|CYLD_uc002egs.1_Intron	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD						cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				TGTAACCTTCTTTTTTTTTTT	0.318			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				4	2	---	---	---	---	
CMTM2	146225	broad.mit.edu	37	16	66621465	66621465	+	Intron	DEL	A	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66621465delA	uc002ept.2	+						CMTM2_uc010cdu.2_Intron	NM_144673	NP_653274	Q8TAZ6	CKLF2_HUMAN	chemokine-like factor superfamily 2						chemotaxis	extracellular space|integral to membrane	cytokine activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		gtctcaaaggaaaaaaaaaaa	0.204													2	4	---	---	---	---	
SLC2A4	6517	broad.mit.edu	37	17	7190435	7190436	+	3'UTR	DEL	TT	-	-	rs149352045		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7190435_7190436delTT	uc002gfp.2	+	11					SLC2A4_uc010cmd.2_RNA	NM_001042	NP_001033	P14672	GTR4_HUMAN	glucose transporter 4						carbohydrate metabolic process|glucose homeostasis|glucose import	external side of plasma membrane|integral to plasma membrane|perinuclear region of cytoplasm	D-glucose transmembrane transporter activity|protein binding				0						GGCAAAGGGGtttttttttttt	0.262													4	2	---	---	---	---	
PSMD11	5717	broad.mit.edu	37	17	30800601	30800601	+	Intron	DEL	T	-	-	rs112811195		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30800601delT	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			gtgcccagcattttttttttt	0.000													3	4	---	---	---	---	
RPL23	9349	broad.mit.edu	37	17	37006922	37006922	+	Intron	DEL	T	-	-	rs34258429		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37006922delT	uc002hqx.1	-						RPL23_uc002hqw.1_Intron|RPL23_uc002hqy.1_3'UTR	NM_000978	NP_000969	P62829	RL23_HUMAN	ribosomal protein L23						endocrine pancreas development|ribosomal protein import into nucleus|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0						catgcccagattttttttttt	0.124													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	37135945	37135946	+	IGR	INS	-	T	T	rs147622484		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37135945_37135946insT								FBXO47 (12290 upstream) : PLXDC1 (83610 downstream)																							AAAAAGACGGAtttttttttct	0.050													8	5	---	---	---	---	
KCNH4	23415	broad.mit.edu	37	17	40314618	40314618	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40314618delT	uc002hzb.2	-							NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		attgtttttgttttttttttt	0.000													3	3	---	---	---	---	
OTOP3	347741	broad.mit.edu	37	17	72937367	72937374	+	Intron	DEL	CCCAACCA	-	-	rs111606345		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72937367_72937374delCCCAACCA	uc010wrr.1	+						OTOP3_uc010wrq.1_Intron	NM_178233	NP_839947	Q7RTS5	OTOP3_HUMAN	otopetrin 3							integral to membrane|intracellular	zinc ion binding			ovary(1)	1	all_lung(278;0.151)|Lung NSC(278;0.185)					gttccaatgtcccaaccacccaaccaga	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	46051338	46051339	+	IGR	INS	-	G	G			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46051338_46051339insG								ZBTB7C (115675 upstream) : KIAA0427 (14088 downstream)																							TTGGTGTGGCAGGAATTGCCCT	0.559													4	2	---	---	---	---	
PQLC1	80148	broad.mit.edu	37	18	77679550	77679550	+	Intron	DEL	A	-	-	rs7236021		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77679550delA	uc002lnl.2	-						PQLC1_uc010dre.2_Intron|PQLC1_uc002lnk.2_Intron|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1							integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		ggggagagacaggaaccgagg	0.149													2	5	---	---	---	---	
STK11	6794	broad.mit.edu	37	19	1218143	1218144	+	Intron	INS	-	A	A			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1218143_1218144insA	uc002lrl.1	+							NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11						anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)|p.?(2)		lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		ctctgtctcagaaaaaaaaaaa	0.287		14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			4	3	---	---	---	---	
C19orf24	55009	broad.mit.edu	37	19	1277476	1277476	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1277476delT	uc002lrw.3	+						C19orf24_uc002lrx.3_Intron	NM_017914	NP_060384	Q9BVV8	CS024_HUMAN	hypothetical protein LOC55009							cytoplasm|extracellular region part|integral to membrane					0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATTTACAACTTTTTTTTTTT	0.318													5	3	---	---	---	---	
CHAF1A	10036	broad.mit.edu	37	19	4418406	4418406	+	Intron	DEL	C	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4418406delC	uc002mal.2	+							NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)						cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTCCTGtctctttttttttt	0.189								Chromatin_Structure					4	2	---	---	---	---	
EML2	24139	broad.mit.edu	37	19	46136716	46136716	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46136716delT	uc002pcn.2	-						EML2_uc002pco.2_Intron|EML2_uc002pcp.2_Intron|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_Intron|EML2_uc010ekj.2_Intron|EML2_uc010ekk.1_5'Flank	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GCCTATTCAGttttttttttt	0.269													4	2	---	---	---	---	
DIDO1	11083	broad.mit.edu	37	20	61514118	61514119	+	Intron	INS	-	TATC	TATC	rs10656139		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61514118_61514119insTATC	uc002ydr.1	-						DIDO1_uc002yds.1_Intron	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c						apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					ATATTTTAAATTATAATGCTAG	0.515													4	2	---	---	---	---	
PRPF6	24148	broad.mit.edu	37	20	62663045	62663045	+	Intron	DEL	C	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62663045delC	uc002yho.2	+						PRPF6_uc002yhp.2_Intron|NCRNA00176_uc002yhq.2_5'Flank|NCRNA00176_uc011abq.1_5'Flank	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					aaaaaaaaaacaacaaaaaaa	0.219													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10720584	10720585	+	IGR	INS	-	A	A	rs146809111		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10720584_10720585insA								None (None upstream) : TPTE (186158 downstream)																							ttcgcagaaatttcctttgcag	0.000													6	3	---	---	---	---	
C21orf34	388815	broad.mit.edu	37	21	17466758	17466758	+	Intron	DEL	G	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17466758delG	uc002ykb.2	+						C21orf34_uc010glc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)		ACCTTTTTTTGTTGGGTGGTG	0.368													4	2	---	---	---	---	
C22orf28	51493	broad.mit.edu	37	22	32805188	32805189	+	Intron	INS	-	A	A	rs35351089		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32805188_32805189insA	uc003amm.2	-						C22orf28_uc011ama.1_Intron	NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493						cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						TTTTGAAAATTAAAAAAAAAAA	0.287													4	5	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774829	2774830	+	Intron	INS	-	T	T	rs55951939		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774829_2774830insT	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				atctatctatcatctatctatc	0.173													3	3	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774833	2774833	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774833delT	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				atctatcatctatctatcatc	0.174													3	3	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774838	2774840	+	Intron	DEL	ATC	-	-	rs150374646		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774838_2774840delATC	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				tcatctatctatcatctatctat	0.177													3	3	---	---	---	---	
GK	2710	broad.mit.edu	37	X	30709586	30709586	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30709586delT	uc004dch.3	+						GK_uc010ngj.2_Intron|GK_uc004dci.3_Intron|GK_uc011mjz.1_Intron|GK_uc011mka.1_Intron|GK_uc010ngk.2_Intron	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a						glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1						CAAGGGGTGCttttttttttt	0.224													4	2	---	---	---	---	
GPR173	54328	broad.mit.edu	37	X	53107201	53107204	+	3'UTR	DEL	TCTC	-	-	rs12847453		TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53107201_53107204delTCTC	uc004dru.2	+	2						NM_018969	NP_061842	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173							integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						tctctctctgtctctctctctctc	0.348													5	3	---	---	---	---	
RGAG1	57529	broad.mit.edu	37	X	109652418	109652418	+	Intron	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109652418delT	uc011msr.1	+						AMMECR1_uc004eoq.2_Intron	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1											lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						AGATGGGGACTTTTTTTTTTG	0.428													4	2	---	---	---	---	
LUZP4	51213	broad.mit.edu	37	X	114524121	114524121	+	5'Flank	DEL	T	-	-			TCGA-B8-4148-01A-02D-1386-10	TCGA-B8-4148-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114524121delT	uc004eqa.2	+						LUZP4_uc004eqb.2_5'Flank	NM_016383	NP_057467	Q9P127	LUZP4_HUMAN	leucine zipper protein 4							nucleus				ovary(2)	2						GGGTCTTTCCTTTTTTTTTCT	0.502													4	2	---	---	---	---	
