Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16890580	16890580	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16890580G>A	uc009vos.1	-	31	4391	c.3503C>T	c.(3502-3504)TCA>TTA	p.S1168L	uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	1168	NBPF 8.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GTGCTGGAATGAGTCAGGTAG	0.458													31	634	---	---	---	---	PASS
C1orf91	56063	broad.mit.edu	37	1	32686772	32686772	+	Silent	SNP	C	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32686772C>T	uc009vub.1	-	3	198	c.195G>A	c.(193-195)CAG>CAA	p.Q65Q	C1orf91_uc001buo.3_RNA|C1orf91_uc001bup.3_RNA|C1orf91_uc010oha.1_RNA|C1orf91_uc001buq.3_Silent_p.Q65Q|EIF3I_uc001bur.3_5'Flank|EIF3I_uc009vuc.2_5'Flank|EIF3I_uc001bus.2_5'Flank			Q8WY98	TM234_HUMAN	RecName: Full=UPF0546 membrane protein C1orf91;	65						integral to membrane					0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGGATCCACACTGGTTGAGGA	0.527													6	12	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44070946	44070946	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44070946C>G	uc001cjr.2	+	18	3561	c.3221C>G	c.(3220-3222)TCG>TGG	p.S1074W	PTPRF_uc001cjs.2_Missense_Mutation_p.S1065W|PTPRF_uc001cju.2_Missense_Mutation_p.S452W|PTPRF_uc009vwt.2_Missense_Mutation_p.S634W|PTPRF_uc001cjv.2_Missense_Mutation_p.S534W|PTPRF_uc001cjw.2_Missense_Mutation_p.S300W	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1074	Extracellular (Potential).|Fibronectin type-III 8.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACAGAGTACTCGTTTGTGCTG	0.637													13	47	---	---	---	---	PASS
TMEM69	51249	broad.mit.edu	37	1	46159076	46159076	+	Silent	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46159076C>A	uc001cor.1	+	3	439	c.243C>A	c.(241-243)GCC>GCA	p.A81A		NM_016486	NP_057570	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	81						integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CACTTCTAGCCAGACCCTCAA	0.488													90	220	---	---	---	---	PASS
RPF1	80135	broad.mit.edu	37	1	84962024	84962024	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84962024A>G	uc001djv.3	+	8	1024	c.979A>G	c.(979-981)AAA>GAA	p.K327E		NM_025065	NP_079341	Q9H9Y2	RPF1_HUMAN	RNA processing factor 1	327					rRNA processing|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|rRNA binding				0						CTTTGATTCTAAATATGGAGA	0.299													24	69	---	---	---	---	PASS
CNN3	1266	broad.mit.edu	37	1	95368739	95368739	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95368739A>C	uc010otw.1	-	4	267	c.185T>G	c.(184-186)ATA>AGA	p.I62R	CNN3_uc010otv.1_Missense_Mutation_p.I21R|CNN3_uc001dqz.3_Missense_Mutation_p.I62R|CNN3_uc010otx.1_Missense_Mutation_p.I62R	NM_001839	NP_001830	Q15417	CNN3_HUMAN	calponin 3	62	CH.				actomyosin structure organization|smooth muscle contraction		actin binding|calmodulin binding|tropomyosin binding|troponin C binding				0		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)		TAGCTTGTTTATAAGTCTGAA	0.423													18	57	---	---	---	---	PASS
AP4B1	10717	broad.mit.edu	37	1	114443035	114443035	+	Intron	SNP	C	G	G	rs3789613	by1000genomes	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114443035C>G	uc001eeb.2	-						uc001edv.1_RNA|AP4B1_uc001eec.2_Intron|AP4B1_uc001eed.2_Intron|AP4B1_uc010owp.1_Intron|AP4B1_uc001eea.1_5'Flank|AP4B1_uc010owq.1_Intron	NM_006594	NP_006585	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|soluble fraction|trans-Golgi network	protein binding|protein transporter activity			ovary(3)|central_nervous_system(1)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATCCAAAAAACAAAACAAAAG	0.413													3	60	---	---	---	---	PASS
TUFT1	7286	broad.mit.edu	37	1	151542166	151542166	+	Silent	SNP	T	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151542166T>C	uc001eyl.2	+	7	576	c.514T>C	c.(514-516)TTG>CTG	p.L172L	TUFT1_uc001eym.2_Silent_p.L147L|TUFT1_uc010pdf.1_Silent_p.L191L|TUFT1_uc010pdg.1_Silent_p.L120L	NM_020127	NP_064512	Q9NNX1	TUFT1_HUMAN	tuftelin 1 isoform 1	172	Potential.				bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGTTGAGAGCTTGAGGAAGAC	0.527													7	341	---	---	---	---	PASS
C1orf43	25912	broad.mit.edu	37	1	154185075	154185075	+	Silent	SNP	C	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154185075C>T	uc001fei.2	-	5	756	c.366G>A	c.(364-366)CGG>CGA	p.R122R	C1orf43_uc001fef.1_Silent_p.R19R|C1orf43_uc001feg.2_Silent_p.R88R|C1orf43_uc001feh.2_Silent_p.R70R|C1orf43_uc001fej.2_Silent_p.R104R|C1orf43_uc009wos.1_Silent_p.R104R|C1orf43_uc001fek.2_Silent_p.R122R|C1orf43_uc001fel.2_Silent_p.R88R	NM_001098616	NP_001092086	Q9BWL3	CA043_HUMAN	hypothetical protein LOC25912 isoform 3	122						integral to membrane	coenzyme binding|oxidoreductase activity				0	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					AACGGGGATGCCGGCCTTCAG	0.393													3	67	---	---	---	---	PASS
RGL1	23179	broad.mit.edu	37	1	183891413	183891413	+	Silent	SNP	C	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183891413C>T	uc001gqo.2	+	17	2219	c.2062C>T	c.(2062-2064)CTG>TTG	p.L688L	RGL1_uc001gqm.2_Silent_p.L723L|RGL1_uc010pog.1_Silent_p.L686L|RGL1_uc010poh.1_Silent_p.L686L|RGL1_uc010poi.1_Silent_p.L659L	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation	688	Ras-associating.				cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						GAAGCACAATCTGGACTCAGA	0.547											OREG0014047	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	25	---	---	---	---	PASS
GCKR	2646	broad.mit.edu	37	2	27729702	27729702	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27729702G>C	uc002rky.2	+	12	1082	c.1016G>C	c.(1015-1017)GGC>GCC	p.G339A	GCKR_uc010ezd.2_Missense_Mutation_p.G339A|GCKR_uc010ylu.1_Missense_Mutation_p.G149A	NM_001486	NP_001477	Q14397	GCKR_HUMAN	glucokinase regulatory protein	339	SIS 2.				carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)					CAGACCCTGGGCATCATTGCC	0.552													12	246	---	---	---	---	PASS
C2orf61	285051	broad.mit.edu	37	2	47382357	47382357	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47382357A>G	uc002rvs.2	-	1	161	c.34T>C	c.(34-36)TCA>CCA	p.S12P	C2orf61_uc010fbd.2_Intron|C2orf61_uc010yog.1_Missense_Mutation_p.S12P	NM_173649	NP_775920	Q8N801	CB061_HUMAN	hypothetical protein LOC285051 isoform 2	12								p.0?(2)			0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			TCCCTTATTGAGGTGGAAGCG	0.637													6	21	---	---	---	---	PASS
VAX2	25806	broad.mit.edu	37	2	71160067	71160067	+	Silent	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71160067G>A	uc002shh.2	+	3	638	c.606G>A	c.(604-606)GCG>GCA	p.A202A	ATP6V1B1_uc002shi.1_5'Flank|ATP6V1B1_uc002shj.2_5'Flank|ATP6V1B1_uc010fdv.2_5'Flank|ATP6V1B1_uc010fdw.2_5'Flank	NM_012476	NP_036608	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	202					ectoderm development|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GCCTCCTGGCGCTGACCCCTA	0.687													4	11	---	---	---	---	PASS
IMMT	10989	broad.mit.edu	37	2	86385746	86385746	+	Silent	SNP	A	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86385746A>T	uc002sqz.3	-	10	1519	c.1131T>A	c.(1129-1131)ACT>ACA	p.T377T	IMMT_uc002sqy.3_Silent_p.T118T|IMMT_uc002srb.3_Silent_p.T366T|IMMT_uc002sra.3_Silent_p.T376T|IMMT_uc010ytd.1_Silent_p.T365T|IMMT_uc010yte.1_Silent_p.T330T|IMMT_uc002src.1_Silent_p.T118T|IMMT_uc002srd.2_Silent_p.T377T	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	377	Mitochondrial intermembrane (Potential).					integral to mitochondrial inner membrane	protein binding			skin(1)	1						GGACTTCTGGAGTAATACTGT	0.418													4	19	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207174280	207174280	+	Silent	SNP	G	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207174280G>T	uc002vbp.2	+	5	5278	c.5028G>T	c.(5026-5028)ACG>ACT	p.T1676T		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1676							nucleic acid binding|zinc ion binding			ovary(3)	3						CTCATCGAACGACTCACCGAC	0.408													16	66	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228973613	228973613	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228973613A>T	uc002vpq.2	-	3	228	c.181T>A	c.(181-183)TTG>ATG	p.L61M	SPHKAP_uc002vpp.2_Missense_Mutation_p.L61M|SPHKAP_uc010zlx.1_Missense_Mutation_p.L61M	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	61						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TGATTCTGCAACCAGTAGTCT	0.433													31	98	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191469	10191469	+	Splice_Site	SNP	A	G	G	rs5030816		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191469A>G	uc003bvc.2	+	3	677	c.464_splice	c.e3-2	p.V155_splice	VHL_uc003bvd.2_Splice_Site_p.V114_splice	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1						anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(3)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TTGCCCTTCCAGTGTATACTC	0.498		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				9	26	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66436782	66436782	+	Intron	SNP	G	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66436782G>T	uc003dmx.2	-						SLC25A26_uc011bft.1_RNA|LRIG1_uc011bfu.1_Intron|LRIG1_uc003dmw.2_Intron|LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Intron	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		AGAGGAACCAGCTGCTGTTCA	0.537													5	52	---	---	---	---	PASS
AADAC	13	broad.mit.edu	37	3	151545364	151545364	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151545364C>G	uc003eze.2	+	5	694	c.604C>G	c.(604-606)CTC>GTC	p.L202V		NM_001086	NP_001077	P22760	AAAD_HUMAN	arylacetamide deacetylase	202	Lumenal (Potential).				positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity			skin(2)	2		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TGCTTCTCAGCTCCTTGATGA	0.284													20	87	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168833806	168833806	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168833806C>A	uc003ffi.3	-	7	1559	c.1290G>T	c.(1288-1290)ATG>ATT	p.M430I	MECOM_uc010hwk.1_Missense_Mutation_p.M453I|MECOM_uc003ffj.3_Missense_Mutation_p.M495I|MECOM_uc011bpi.1_Missense_Mutation_p.M431I|MECOM_uc003ffn.3_Missense_Mutation_p.M430I|MECOM_uc003ffk.2_Missense_Mutation_p.M430I|MECOM_uc003ffl.2_Missense_Mutation_p.M590I|MECOM_uc011bpj.1_Missense_Mutation_p.M618I|MECOM_uc011bpk.1_Missense_Mutation_p.M420I|MECOM_uc010hwn.2_Missense_Mutation_p.M618I	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	430	Nuclear localization signal (Potential).				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						TGTCTTTGAACATTTTACCAT	0.373													24	96	---	---	---	---	PASS
KLHL6	89857	broad.mit.edu	37	3	183211796	183211796	+	Intron	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183211796G>A	uc003flr.2	-						KLHL6_uc003fls.1_Intron|KLHL6_uc003flt.1_3'UTR|KLHL6_uc010hxk.1_Intron	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6											haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CGGCAGGCACGTTCCAAAGCT	0.458													6	132	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69816847	69816847	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69816847T>G	uc003hef.2	-	1	663	c.632A>C	c.(631-633)AAT>ACT	p.N211T	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	211	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						AAGCATTGAATTTTTTACTCT	0.393													19	45	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85742692	85742692	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85742692C>G	uc003hpd.2	-	11	1544	c.1136G>C	c.(1135-1137)AGA>ACA	p.R379T	WDFY3_uc003hpf.2_Missense_Mutation_p.R379T	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	379						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTGGACGTTTCTCACACTGTG	0.343													16	119	---	---	---	---	PASS
MAML3	55534	broad.mit.edu	37	4	140811637	140811637	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140811637T>A	uc003ihz.1	-	2	1705	c.953A>T	c.(952-954)AAC>ATC	p.N318I	MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	318					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					AGGAACCGTGTTGGCCAATTC	0.438													41	93	---	---	---	---	PASS
ZNF827	152485	broad.mit.edu	37	4	146824164	146824164	+	Silent	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146824164G>A	uc003ikn.2	-	2	295	c.247C>T	c.(247-249)CTG>TTG	p.L83L	ZNF827_uc003ikm.2_Silent_p.L83L|ZNF827_uc010iox.2_Intron	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	83					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					AGTGCCACCAGCTCCAACGTG	0.582													15	26	---	---	---	---	PASS
HIST1H3B	8358	broad.mit.edu	37	6	26032061	26032061	+	Silent	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26032061G>A	uc003nfs.1	-	1	228	c.228C>T	c.(226-228)GCC>GCT	p.A76A		NM_003537	NP_003528	P68431	H31_HUMAN	histone cluster 1, H3b	76					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						TGAAGTCTTGGGCGATTTCTC	0.602													4	86	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51799018	51799018	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51799018G>A	uc003pah.1	-	37	6287	c.6011C>T	c.(6010-6012)CCC>CTC	p.P2004L	PKHD1_uc010jzn.1_Missense_Mutation_p.P29L|PKHD1_uc003pai.2_Missense_Mutation_p.P2004L	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2004	Extracellular (Potential).|G8 1.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GCCTTGGAAGGGCTTGTCTTC	0.537											OREG0017491	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	103	---	---	---	---	PASS
HCRTR2	3062	broad.mit.edu	37	6	55128616	55128616	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55128616G>A	uc003pcl.2	+	4	1073	c.758G>A	c.(757-759)CGA>CAA	p.R253Q	HCRTR2_uc010jzv.2_RNA|HCRTR2_uc010jzw.1_Missense_Mutation_p.R188Q	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	253	Cytoplasmic (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CTCTGGTGTCGACAGGTATAT	0.368													13	53	---	---	---	---	PASS
COX7A2	1347	broad.mit.edu	37	6	75950931	75950931	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75950931A>C	uc003phv.1	-	2	144	c.69T>G	c.(67-69)CAT>CAG	p.H23Q		NM_001865	NP_001856	P14406	CX7A2_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2	23						mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0						TATTTTTAAAATGCCTGCGGG	0.313													57	231	---	---	---	---	PASS
SLC22A2	6582	broad.mit.edu	37	6	160668236	160668236	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160668236A>G	uc003qtf.2	-	5	1107	c.937T>C	c.(937-939)TCT>CCT	p.S313P	SLC22A2_uc003qte.1_Missense_Mutation_p.S313P	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	313	Cytoplasmic (Potential).				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		GCGGGTAGAGATTTTCCATTT	0.488													15	38	---	---	---	---	PASS
WIPI2	26100	broad.mit.edu	37	7	5269291	5269291	+	Missense_Mutation	SNP	G	A	A	rs147945082	byFrequency	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5269291G>A	uc003snv.2	+	12	1390	c.1174G>A	c.(1174-1176)GAC>AAC	p.D392N	WIPI2_uc003snw.2_Missense_Mutation_p.D392N|WIPI2_uc003snx.2_Missense_Mutation_p.D374N|WIPI2_uc003sny.2_Missense_Mutation_p.D374N|WIPI2_uc010ksv.2_Missense_Mutation_p.D248N|WIPI2_uc003soa.2_Missense_Mutation_p.D333N|WIPI2_uc003sob.2_Missense_Mutation_p.D135N	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	392					autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		TGCCTCTCACGACTGCCCCTT	0.572													17	25	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180451	20180451	+	3'UTR	SNP	C	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180451C>G	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacagacacacacacac	0.159													4	52	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20682904	20682904	+	Silent	SNP	A	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20682904A>C	uc010kuh.2	+	6	649	c.412A>C	c.(412-414)AGG>CGG	p.R138R		NM_001163941	NP_001157413	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	322	Extracellular (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						ACAGACCAAGAGGATTCGAAA	0.423													9	42	---	---	---	---	PASS
NUPL2	11097	broad.mit.edu	37	7	23240017	23240017	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23240017T>A	uc003svu.2	+	7	1184	c.925T>A	c.(925-927)TCC>ACC	p.S309T	NUPL2_uc003svv.2_RNA|NUPL2_uc003svw.2_Missense_Mutation_p.S186T|NUPL2_uc011jyw.1_RNA|NUPL2_uc003svx.2_Missense_Mutation_p.S186T|NUPL2_uc011jyx.1_Missense_Mutation_p.S81T	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	309	Ser-rich.				carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			skin(2)|ovary(1)	3						CCCTGCAGCTTCCAGTTTTGG	0.507													23	49	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82595325	82595325	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82595325T>C	uc003uhx.2	-	4	4068	c.3779A>G	c.(3778-3780)CAG>CGG	p.Q1260R	PCLO_uc003uhv.2_Missense_Mutation_p.Q1260R	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1199					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GTCATGTTTCTGTTCTTCTGG	0.423													79	355	---	---	---	---	PASS
GCC1	79571	broad.mit.edu	37	7	127225152	127225152	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127225152G>A	uc003vma.2	-	1	503	c.85C>T	c.(85-87)CTC>TTC	p.L29F		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	29	Potential.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2						TGGTACTGGAGAAGCTGCTTC	0.542											OREG0003808	type=REGULATORY REGION|Gene=GCC1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	43	153	---	---	---	---	PASS
EPHA1	2041	broad.mit.edu	37	7	143095137	143095137	+	Silent	SNP	T	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143095137T>A	uc003wcz.2	-	8	1578	c.1491A>T	c.(1489-1491)CTA>CTT	p.L497L		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	497	Extracellular (Potential).|Fibronectin type-III 2.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CCCTGGGTTCTAGAACCATCT	0.562													34	45	---	---	---	---	PASS
AGAP3	116988	broad.mit.edu	37	7	150825758	150825758	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150825758A>C	uc003wjg.1	+	10	1316	c.1313A>C	c.(1312-1314)CAC>CCC	p.H438P	AGAP3_uc003wje.1_Missense_Mutation_p.H210P	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	402	PH.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						CTCACCTATCACCCCAGCCTG	0.587													5	26	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48730110	48730110	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48730110G>T	uc003xqi.2	-	69	9515	c.9458C>A	c.(9457-9459)TCT>TAT	p.S3153Y	PRKDC_uc003xqj.2_Missense_Mutation_p.S3153Y|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	3153	KIP-binding.|FAT.				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				GGGAACTTGAGATGATAAATT	0.358								NHEJ					4	11	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618282	77618282	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618282C>A	uc003yav.2	+	2	2346	c.1959C>A	c.(1957-1959)TAC>TAA	p.Y653*	ZFHX4_uc003yat.1_Nonsense_Mutation_p.Y653*|ZFHX4_uc003yau.1_Nonsense_Mutation_p.Y653*|ZFHX4_uc003yaw.1_Nonsense_Mutation_p.Y653*	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	653	C2H2-type 2.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACTGGCACTACAAATATCAGC	0.498										HNSCC(33;0.089)			27	42	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361304	105361304	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361304T>A	uc003ylx.1	+	2	573	c.524T>A	c.(523-525)CTT>CAT	p.L175H		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	175					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GCAGTCTCTCTTTTCAGTCCC	0.473													60	111	---	---	---	---	PASS
UTP23	84294	broad.mit.edu	37	8	117783792	117783792	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117783792C>A	uc003yoc.2	+	3	562	c.461C>A	c.(460-462)ACA>AAA	p.T154K		NM_032334	NP_115710	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component,	154					rRNA processing	nucleolus					0						TCTCCCAAAACAATTGCCTTT	0.383													7	123	---	---	---	---	PASS
KDM4C	23081	broad.mit.edu	37	9	7015920	7015920	+	Silent	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7015920G>A	uc003zkh.2	+	15	2830	c.2250G>A	c.(2248-2250)GCG>GCA	p.A750A	KDM4C_uc010mhu.2_Silent_p.A772A|KDM4C_uc011lmi.1_Silent_p.A750A|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Silent_p.A750A|KDM4C_uc011lmk.1_Silent_p.A495A|KDM4C_uc011lml.1_Silent_p.A437A	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1	750					positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						AAAGAAATGCGTGGACAGCAG	0.408													23	45	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135797252	135797252	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135797252T>C	uc004cca.2	-	7	851	c.617A>G	c.(616-618)CAT>CGT	p.H206R	TSC1_uc004ccb.3_Missense_Mutation_p.H206R|TSC1_uc011mcq.1_Missense_Mutation_p.H155R|TSC1_uc011mcr.1_Missense_Mutation_p.H85R|TSC1_uc011mcs.1_Missense_Mutation_p.H85R|TSC1_uc004ccc.1_Missense_Mutation_p.H206R|TSC1_uc004ccd.2_Missense_Mutation_p.H206R|TSC1_uc004cce.1_Missense_Mutation_p.H206R	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	206			H -> D (in a bladder tumor; somatic mutation; reduced stability; does not affect interaction with TSC2).		activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding			lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CATACTGTAATGAGAACGCAA	0.418			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				32	56	---	---	---	---	PASS
CYP2C8	1558	broad.mit.edu	37	10	96797036	96797036	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96797036G>A	uc001kkb.2	-	9	1417	c.1322C>T	c.(1321-1323)GCC>GTC	p.A441V	CYP2C8_uc001kkc.2_RNA|CYP2C8_uc010qoa.1_Missense_Mutation_p.A371V|CYP2C8_uc010qob.1_Missense_Mutation_p.A355V|CYP2C8_uc010qoc.1_Missense_Mutation_p.A339V	NM_000770	NP_000761	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C,	441					exogenous drug catabolic process|organic acid metabolic process|oxidative demethylation|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|electron carrier activity|heme binding|oxygen binding				0		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Aminophenazone(DB01424)|Amiodarone(DB01118)|Amodiaquine(DB00613)|Benzphetamine(DB00865)|Carbamazepine(DB00564)|Cerivastatin(DB00439)|Diclofenac(DB00586)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lovastatin(DB00227)|Midazolam(DB00683)|Montelukast(DB00471)|Nicardipine(DB00622)|Paclitaxel(DB01229)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rifampin(DB01045)|Rosiglitazone(DB00412)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Tolbutamide(DB01124)|Torasemide(DB00214)|Tretinoin(DB00755)|Trimethoprim(DB00440)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zopiclone(DB01198)	CTCCATGCGGGCAAGTCCTTC	0.358													3	47	---	---	---	---	PASS
GAS2	2620	broad.mit.edu	37	11	22833447	22833447	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22833447G>A	uc009yie.2	+	8	1133	c.827G>A	c.(826-828)CGT>CAT	p.R276H	GAS2_uc001mqm.2_Missense_Mutation_p.R276H|GAS2_uc001mqn.2_RNA|GAS2_uc001mqo.2_Missense_Mutation_p.R276H	NM_001143830	NP_001137302	O43903	GAS2_HUMAN	growth arrest-specific 2	276					cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2						CAGATCTCCCGTGTGGATGGC	0.483													37	75	---	---	---	---	PASS
ZBTB3	79842	broad.mit.edu	37	11	62520590	62520590	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62520590G>A	uc001nuz.2	-	2	819	c.697C>T	c.(697-699)CCT>TCT	p.P233S		NM_024784	NP_079060	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	233	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3						TCATCTGGAGGACGGACAGTA	0.592													8	33	---	---	---	---	PASS
SLC22A11	55867	broad.mit.edu	37	11	64337144	64337144	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64337144T>G	uc001oai.2	+	9	1777	c.1403T>G	c.(1402-1404)CTG>CGG	p.L468R	SLC22A11_uc001oaj.2_Intron|SLC22A11_uc009ypq.2_Missense_Mutation_p.L360R	NM_018484	NP_060954	Q9NSA0	S22AB_HUMAN	solute carrier family 22 member 11	468	Helical; (Potential).				urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2					Probenecid(DB01032)	GATGGCATTCTGCATACAGTG	0.617													30	69	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108196255	108196255	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108196255C>T	uc001pkb.1	+	46	7176	c.6791C>T	c.(6790-6792)ACT>ATT	p.T2264I	ATM_uc009yxr.1_Missense_Mutation_p.T2264I|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.T916I|ATM_uc001pkg.1_Missense_Mutation_p.T621I	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2264	FAT.				cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		CTGGCCAGAACTTTCAAGAAC	0.348			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			18	64	---	---	---	---	PASS
CADM1	23705	broad.mit.edu	37	11	115080343	115080343	+	Silent	SNP	G	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115080343G>T	uc001ppi.3	-	8	1158	c.1029C>A	c.(1027-1029)ACC>ACA	p.T343T	CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001pph.3_Silent_p.T95T	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	343	Extracellular (Potential).			PPTTIPPPTTTTTTTTTTTTTILTIIT -> TTATTEPAVH GLTQLPNSAEELDSEDLS (in Ref. 3; BAC11657).	adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		tggtggtggtggttgttgtgg	0.269													3	48	---	---	---	---	PASS
HOXC4	3221	broad.mit.edu	37	12	54447835	54447835	+	Silent	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54447835G>A	uc001seu.2	+	3	809	c.129G>A	c.(127-129)TCG>TCA	p.S43S	HOXC4_uc001sex.2_Silent_p.S43S	NM_014620	NP_055435	P09017	HXC4_HUMAN	homeobox C4	43						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCAGGGAATCGGGATTCCAGC	0.562													6	178	---	---	---	---	PASS
NUP107	57122	broad.mit.edu	37	12	69136217	69136217	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69136217C>A	uc001suf.2	+	28	2868	c.2753C>A	c.(2752-2754)CCA>CAA	p.P918Q	NUP107_uc001sug.2_Missense_Mutation_p.P677Q|NUP107_uc010stj.1_Missense_Mutation_p.P889Q	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa	918					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			GGACTTGACCCATTAGGGTAT	0.313													68	77	---	---	---	---	PASS
GLT8D2	83468	broad.mit.edu	37	12	104387219	104387219	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104387219A>C	uc001tkh.1	-	10	1237	c.831T>G	c.(829-831)TTT>TTG	p.F277L	GLT8D2_uc001tki.1_Missense_Mutation_p.F277L	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	277	Lumenal (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						ATTTCCCATGAAACACAATCA	0.423													14	58	---	---	---	---	PASS
SETD8	387893	broad.mit.edu	37	12	123892273	123892273	+	3'UTR	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123892273C>A	uc001uew.2	+	8					SETD8_uc001uex.2_3'UTR	NM_020382	NP_065115	Q9NQR1	SETD8_HUMAN	SET domain-containing 8						cell division|mitosis|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding|transcription corepressor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		GTGCCCTCCCCGCCCCACTTT	0.502													2	5	---	---	---	---	PASS
ZMYM5	9205	broad.mit.edu	37	13	20398642	20398642	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20398642T>A	uc010tcn.1	-	8	2250	c.1985A>T	c.(1984-1986)GAT>GTT	p.D662V	ZMYM5_uc001umm.1_Missense_Mutation_p.D486V	NM_001142684	NP_001136156	Q9UJ78	ZMYM5_HUMAN	zinc finger protein 237 isoform 3	662						nucleus	zinc ion binding				0		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		cagcacaccatcatttttctc	0.095													10	14	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32972539	32972539	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32972539G>A	uc001uub.1	+	27	10116	c.9889G>A	c.(9889-9891)GCA>ACA	p.A3297T		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	3297					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TGCACAGAAGGCATTTCAGCC	0.413			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			51	113	---	---	---	---	PASS
TDRD3	81550	broad.mit.edu	37	13	61103273	61103273	+	Silent	SNP	A	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61103273A>G	uc001via.2	+	11	2423	c.1635A>G	c.(1633-1635)GAA>GAG	p.E545E	TDRD3_uc010aef.2_Silent_p.E370E|TDRD3_uc001vhz.3_Silent_p.E545E|TDRD3_uc010aeg.2_Silent_p.E638E|TDRD3_uc001vib.3_Silent_p.E544E	NM_030794	NP_110421	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3 isoform 2	545					chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		AAATACTAGAATCATCTATTC	0.383													51	71	---	---	---	---	PASS
FAM155A	728215	broad.mit.edu	37	13	108518837	108518837	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108518837C>G	uc001vql.2	-	1	624	c.108G>C	c.(106-108)CAG>CAC	p.Q36H		NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	36						integral to membrane	binding			skin(1)	1						GTCGCCATTTCTGAGCCCTCT	0.562													19	263	---	---	---	---	PASS
REC8	9985	broad.mit.edu	37	14	24642238	24642238	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24642238C>T	uc001wmr.2	+	4	683	c.256C>T	c.(256-258)CAG>TAG	p.Q86*	REC8_uc001wms.2_Nonsense_Mutation_p.Q86*	NM_005132	NP_005123	O95072	REC8_HUMAN	REC8 homolog	86					mitotic metaphase/anaphase transition|mitotic prometaphase|reciprocal meiotic recombination|sister chromatid cohesion	nucleoplasm					0				GBM - Glioblastoma multiforme(265;0.00839)		TCAACAATGCCAGTACCTCGT	0.622													27	90	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68234548	68234548	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68234548C>G	uc001xka.2	-	31	5802	c.5663G>C	c.(5662-5664)AGC>ACC	p.S1888T	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.S1888T	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1888					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		ATTCTTGGAGCTGTCTAGAGC	0.483													24	78	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71543031	71543031	+	Silent	SNP	A	G	G	rs144508419	byFrequency	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71543031A>G	uc001xmo.2	+	28	5678	c.5232A>G	c.(5230-5232)CCA>CCG	p.P1744P	PCNX_uc010are.1_Silent_p.P1633P|PCNX_uc010arf.1_Silent_p.P532P	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1744						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CCTTTAATCCAAACATTGATG	0.473													33	96	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	42042855	42042855	+	3'UTR	SNP	T	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42042855T>G	uc001zoi.2	+	2					MGA_uc010ucy.1_Intron|MGA_uc010ucz.1_Intron|MGA_uc010uda.1_Intron			Q8IWI9	MGAP_HUMAN	RecName: Full=MAX gene-associated protein;							MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		CTAAAGGATTTAAATGATTTA	0.348													5	7	---	---	---	---	PASS
IGDCC3	9543	broad.mit.edu	37	15	65621770	65621770	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65621770G>T	uc002aos.2	-	13	2415	c.2163C>A	c.(2161-2163)TTC>TTA	p.F721L	IGDCC3_uc002aor.1_Missense_Mutation_p.F8L	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	721	Cytoplasmic (Potential).									ovary(3)	3						TGGCCGGGGGGAACAGCTGCT	0.637													21	76	---	---	---	---	PASS
KIAA1199	57214	broad.mit.edu	37	15	81213426	81213426	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81213426C>T	uc002bfw.1	+	15	2317	c.2057C>T	c.(2056-2058)GCC>GTC	p.A686V	KIAA1199_uc010unn.1_Missense_Mutation_p.A686V	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN	KIAA1199 precursor	686										upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						ATCAACTGTGCCGCTGCAGGA	0.547													3	61	---	---	---	---	PASS
BLM	641	broad.mit.edu	37	15	91346812	91346812	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91346812C>A	uc002bpr.2	+	18	3517	c.3420C>A	c.(3418-3420)CAC>CAA	p.H1140Q	BLM_uc010uqh.1_Missense_Mutation_p.H1140Q|BLM_uc010uqi.1_Missense_Mutation_p.H765Q|BLM_uc010bnx.2_Intron|BLM_uc002bpt.2_Missense_Mutation_p.H115Q	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	1140					double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ATTCACGACACAATGCCGAAA	0.378			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				31	117	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2506955	2506955	+	Silent	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2506955G>A	uc002cqd.1	+	17	2383	c.2295G>A	c.(2293-2295)GTG>GTA	p.V765V	CCNF_uc002cqe.1_Silent_p.V457V	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	765	PEST.				cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				AGCAACAGGTGAAGCGGATAA	0.557													15	54	---	---	---	---	PASS
KIAA0174	9798	broad.mit.edu	37	16	71961539	71961539	+	Silent	SNP	C	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71961539C>G	uc002fbj.1	+	12	1246	c.963C>G	c.(961-963)GCC>GCG	p.A321A	KIAA0174_uc010cgh.1_Silent_p.A321A|KIAA0174_uc002fbk.1_Missense_Mutation_p.P307R|KIAA0174_uc002fbm.1_Silent_p.A308A|KIAA0174_uc002fbl.1_Silent_p.A277A|KIAA0174_uc002fbn.1_Silent_p.A160A|KIAA0174_uc010cgi.1_Silent_p.A79A|KIAA0174_uc010cgj.1_Silent_p.A225A|KIAA0174_uc010vml.1_RNA			P53990	IST1_HUMAN	SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;	306	Interaction with VTA1.				cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding			ovary(1)	1						AGCCAGAAGCCTCTGCAAAGC	0.468													61	164	---	---	---	---	PASS
GOSR1	9527	broad.mit.edu	37	17	28811828	28811828	+	Intron	SNP	G	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28811828G>C	uc002hfe.2	+						GOSR1_uc002hfd.2_Intron|GOSR1_uc002hff.2_Intron|GOSR1_uc002hfc.1_Missense_Mutation_p.V130L	NM_004871	NP_004862	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1 isoform 1						intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0						TATCACAGGAGTTTGGGTTTT	0.373													11	28	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37884010	37884010	+	Silent	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37884010C>A	uc002hso.2	+	27	3719	c.3481C>A	c.(3481-3483)CGA>AGA	p.R1161R	ERBB2_uc002hsm.2_Silent_p.R1131R|ERBB2_uc010cwa.2_Silent_p.R1146R|ERBB2_uc002hsp.2_Silent_p.R964R|ERBB2_uc010cwb.2_3'UTR|ERBB2_uc010wek.1_Silent_p.R885R	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	1161	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	GCCTGCTGCCCGACCTGCTGG	0.602		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			3	45	---	---	---	---	PASS
PLEKHM1P	440456	broad.mit.edu	37	17	62801048	62801048	+	5'UTR	SNP	C	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62801048C>G	uc002jew.3	-	5					PLEKHM1P_uc002jev.3_RNA|PLEKHM1P_uc010wqe.1_5'UTR	NR_024386				RecName: Full=Putative pleckstrin homology domain-containing family M member 1P;												0						CTTGGTCTAACGCCCCCAGGG	0.562													9	17	---	---	---	---	PASS
KCNJ2	3759	broad.mit.edu	37	17	68171453	68171453	+	Silent	SNP	T	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68171453T>A	uc010dfg.2	+	2	674	c.273T>A	c.(271-273)GCT>GCA	p.A91A	KCNJ2_uc002jir.2_Silent_p.A91A	NM_000891	NP_000882	P63252	IRK2_HUMAN	potassium inwardly-rectifying channel J2	91	Helical; Name=M1; (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding				0	Breast(10;1.64e-08)					TCTGCCTGGCTTTCGTCCTGT	0.532													30	75	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76506511	76506511	+	Silent	SNP	G	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76506511G>T	uc010wtu.1	-	1	243	c.66C>A	c.(64-66)GTC>GTA	p.V22V						full-length cDNA clone CS0DJ002YI14 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CGATGTTGCGGACCTCATCCT	0.532													60	151	---	---	---	---	PASS
DSG2	1829	broad.mit.edu	37	18	29102086	29102086	+	Silent	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29102086G>A	uc002kwu.3	+	6	752	c.564G>A	c.(562-564)GAG>GAA	p.E188E		NM_001943	NP_001934	Q14126	DSG2_HUMAN	desmoglein 2 preproprotein	188	Extracellular (Potential).|Cadherin 2.				cellular component disassembly involved in apoptosis|homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(2)|breast(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			ATGCAGATGAGCCCAATACCC	0.348													23	59	---	---	---	---	PASS
RPS15	6209	broad.mit.edu	37	19	1438450	1438450	+	Intron	SNP	T	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1438450T>A	uc002lsp.1	+						RPS15_uc002lsq.1_5'UTR	NM_001018	NP_001009	P62841	RS15_HUMAN	ribosomal protein S15						endocrine pancreas development|ribosomal small subunit export from nucleus|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleoplasm	DNA binding|protein binding|RNA binding				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATTTGGCGCGTCTCTGCCGGG	0.672											OREG0025117	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	22	---	---	---	---	PASS
PSG7	5676	broad.mit.edu	37	19	43439612	43439612	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43439612A>C	uc002ovl.3	-	3	476	c.374T>G	c.(373-375)ATA>AGA	p.I125R	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Intron	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	125	Ig-like V-type.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				ACCTCGCTTTATGATGTGTAA	0.512													22	408	---	---	---	---	PASS
C20orf94	128710	broad.mit.edu	37	20	10604013	10604013	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10604013G>T	uc010zre.1	+	8	1393	c.1213G>T	c.(1213-1215)GAA>TAA	p.E405*		NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710	405							protein binding				0						AAAGAAATACGAAAGAGGCCA	0.448													9	48	---	---	---	---	PASS
MYBL2	4605	broad.mit.edu	37	20	42343846	42343846	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42343846C>T	uc002xlb.1	+	13	2112	c.1897C>T	c.(1897-1899)CAG>TAG	p.Q633*	MYBL2_uc010zwj.1_Nonsense_Mutation_p.Q609*	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B	633						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CTTGCTCAACCAGGGCTTCTT	0.567													71	297	---	---	---	---	PASS
LOC91316	91316	broad.mit.edu	37	22	23980988	23980988	+	RNA	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23980988G>A	uc002zxh.3	-	5		c.3502C>T			LOC91316_uc002zxi.3_RNA|LOC91316_uc002zxk.3_RNA|LOC91316_uc010gua.2_RNA|LOC91316_uc002zxl.3_RNA|LOC91316_uc011aiz.1_RNA					Homo sapiens cDNA FLJ32313 fis, clone PROST2003232, weakly similar to BETA-GLUCURONIDASE PRECURSOR (EC 3.2.1.31).												0						TCTGGGTGATGAGGGTACCAT	0.567													11	51	---	---	---	---	PASS
ZNF70	7621	broad.mit.edu	37	22	24086149	24086149	+	Silent	SNP	G	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24086149G>A	uc002zxs.2	-	2	1640	c.1179C>T	c.(1177-1179)ACC>ACT	p.T393T	ZNF70_uc002zxr.1_5'Flank	NM_021916	NP_068735	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	393	C2H2-type 10.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						CACACTCGCAGGTGTAGGGCT	0.572													41	108	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659591	24659591	+	RNA	SNP	A	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659591A>G	uc002zzs.3	+	7		c.3323A>G			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						ACTCACTGACATCGAAGGCTG	0.632													6	24	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659593	24659593	+	RNA	SNP	C	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659593C>T	uc002zzs.3	+	7		c.3325C>T			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						TCACTGACATCGAAGGCTGCC	0.632													6	24	---	---	---	---	PASS
CRYBB2	1415	broad.mit.edu	37	22	25617408	25617408	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25617408T>G	uc003abp.1	+	2	60	c.12T>G	c.(10-12)GAT>GAG	p.D4E		NM_000496	NP_000487	P43320	CRBB2_HUMAN	crystallin, beta B2	4	N-terminal arm.				response to stimulus|visual perception		structural constituent of eye lens				0						TGGCCTCAGATCACCAGACCC	0.602													7	32	---	---	---	---	PASS
NEFH	4744	broad.mit.edu	37	22	29879399	29879399	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29879399A>G	uc003afo.2	+	2	990	c.919A>G	c.(919-921)AAC>GAC	p.N307D		NM_021076	NP_066554	P12036	NFH_HUMAN	neurofilament, heavy polypeptide 200kDa	307	Coil 2B.|Rod.				cell death|nervous system development	neurofilament					0						AGCCAAGGTGAACACAGACGC	0.587													47	164	---	---	---	---	PASS
PACSIN2	11252	broad.mit.edu	37	22	43278213	43278213	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43278213C>A	uc010gzg.2	-	7	1105	c.883G>T	c.(883-885)GCC>TCC	p.A295S	PACSIN2_uc003bdg.3_Missense_Mutation_p.A295S|PACSIN2_uc003bde.3_Missense_Mutation_p.A295S|PACSIN2_uc003bdf.3_Missense_Mutation_p.A295S	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in	295					actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				CAGTTCATGGCCATGCCCGGC	0.562													3	43	---	---	---	---	PASS
GNL3L	54552	broad.mit.edu	37	X	54587075	54587075	+	3'UTR	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54587075C>A	uc004dth.1	+	16					GNL3L_uc004dti.2_RNA	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3						ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						AGCACCAGTTCCGGTGGTACG	0.507													37	32	---	---	---	---	PASS
KLF8	11279	broad.mit.edu	37	X	56310756	56310756	+	Silent	SNP	T	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56310756T>G	uc004dur.2	+	6	1855	c.909T>G	c.(907-909)CCT>CCG	p.P303P	KLF8_uc011mop.1_Missense_Mutation_p.L257V|KLF8_uc010nkh.2_RNA	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1	303					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GAGAGAAGCCTTATAAATGCA	0.443													5	4	---	---	---	---	PASS
TCEAL5	340543	broad.mit.edu	37	X	102529072	102529072	+	Silent	SNP	C	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102529072C>A	uc004ejz.1	-	3	715	c.420G>T	c.(418-420)CTG>CTT	p.L140L		NM_001012979	NP_001012997	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5	140					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(1)|breast(1)	2						CCTCACTGCTCAGATGCCTTT	0.488													72	54	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122387173	122387173	+	Silent	SNP	A	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122387173A>G	uc004etq.3	+	4	581	c.288A>G	c.(286-288)AGA>AGG	p.R96R	GRIA3_uc004etr.3_Silent_p.R96R|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Silent_p.R80R	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	96	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	AGTTCTCGAGAGGGGTGTATG	0.463													4	108	---	---	---	---	PASS
FOXJ3	22887	broad.mit.edu	37	1	42776675	42776676	+	Intron	INS	-	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42776675_42776676insA	uc001che.2	-						FOXJ3_uc001chf.2_Intron|FOXJ3_uc001chg.2_Intron|FOXJ3_uc001chh.1_Intron	NM_014947	NP_055762	Q9UPW0	FOXJ3_HUMAN	forkhead box J3						embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTCTAACTTTTAAAATGTTATA	0.342													29	13	---	---	---	---	
LPHN2	23266	broad.mit.edu	37	1	82187977	82187977	+	Intron	DEL	A	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82187977delA	uc001dit.3	+						LPHN2_uc001dis.2_Intron	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		gactccgtctaaaaaaaaaag	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116024584	116024584	+	IGR	DEL	C	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116024584delC								NGF (143727 upstream) : VANGL1 (159990 downstream)																							TGAGCCAAATCCCTAGCAGAC	0.507													4	2	---	---	---	---	
SPTA1	6708	broad.mit.edu	37	1	158612341	158612341	+	Intron	DEL	A	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158612341delA	uc001fst.1	-							NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTCTGAAGGGAAAATGAAACA	0.388													68	30	---	---	---	---	
ZC3H11A	9877	broad.mit.edu	37	1	203802746	203802747	+	Intron	INS	-	TTTTTT	TTTTTT	rs59117283		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203802746_203802747insTTTTTT	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_Intron	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATAGGTTTGGGTTTTTTTTTTT	0.257													3	4	---	---	---	---	
ADI1	55256	broad.mit.edu	37	2	3504893	3504894	+	Intron	INS	-	A	A	rs144556875	by1000genomes	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3504893_3504894insA	uc002qxp.3	-						ADI1_uc010yiq.1_Intron	NM_018269	NP_060739	Q9BV57	MTND_HUMAN	acireductone dioxygenase 1						L-methionine salvage from methylthioadenosine	cytoplasm|nucleus|plasma membrane	acireductone dioxygenase (Ni2+-requiring) activity|metal ion binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		CCATAAAAATGAAACTACACTT	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11060847	11060848	+	IGR	DEL	TG	-	-	rs33928142		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11060847_11060848delTG								KCNF1 (6497 upstream) : C2orf50 (212331 downstream)																							tgcgtgtgcctgtgtgtgtgtg	0.391													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	17527086	17527086	+	IGR	DEL	C	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17527086delC								FAM49A (679990 upstream) : RAD51AP2 (164900 downstream)																							aggcacccctcccgaggaaat	0.000													10	11	---	---	---	---	
TRMT61B	55006	broad.mit.edu	37	2	29075179	29075179	+	Intron	DEL	A	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29075179delA	uc002rmm.2	-						TRMT61B_uc002rmn.2_Intron|TRMT61B_uc010ezk.2_Intron	NM_017910	NP_060380	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B								tRNA (adenine-N1-)-methyltransferase activity				0						tttctgtctcaaaaaaaaaaa	0.095													10	5	---	---	---	---	
IL1RL2	8808	broad.mit.edu	37	2	102851636	102851636	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102851636delC	uc002tbs.2	+	11	1703	c.1577delC	c.(1576-1578)ACCfs	p.T526fs	IL1RL2_uc002tbt.2_Frame_Shift_Del_p.T408fs	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor	526	TIR.|Cytoplasmic (Potential).				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2						TGTATGAAGACCAAGTTTTGG	0.547											OREG0014848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	104	47	---	---	---	---	
MIR663B	100302269	broad.mit.edu	37	2	133014651	133014652	+	RNA	INS	-	C	C	rs150907057		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133014651_133014652insC	hsa-mir-663b|MI0006336	-			c.2_3insC			NCRNA00164_uc002ttj.3_Intron																	0						GGCCCTCGGCACCACCGAGACC	0.678													5	3	---	---	---	---	
ORC4L	5000	broad.mit.edu	37	2	148716139	148716140	+	Intron	INS	-	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148716139_148716140insA	uc002twi.2	-						ORC4L_uc002twj.2_Intron|ORC4L_uc010zbo.1_Intron|ORC4L_uc010zbp.1_Intron|ORC4L_uc010fnr.2_Intron|ORC4L_uc010zbq.1_Intron|ORC4L_uc002twk.2_Intron|ORC4L_uc010zbr.1_Intron	NM_181741	NP_859525	O43929	ORC4_HUMAN	origin recognition complex subunit 4						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)		TTAGAATGATTAAAAAAAAAAA	0.312													3	3	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	242026957	242026958	+	Intron	INS	-	C	C	rs148540051	by1000genomes	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242026957_242026958insC	uc002wah.1	+						SNED1_uc002waj.1_Intron	NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GGCAAGGGCGGGGTGCTATGGG	0.624													4	4	---	---	---	---	
ITPR1	3708	broad.mit.edu	37	3	4715262	4715273	+	Intron	DEL	TTTGTTTGTTTG	-	-	rs112871347		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4715262_4715273delTTTGTTTGTTTG	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Intron	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		GTTTTTGGTTtttgtttgtttgtttgtttgtt	0.137													4	6	---	---	---	---	
ANO10	55129	broad.mit.edu	37	3	43607224	43607225	+	Intron	INS	-	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43607224_43607225insA	uc003cmv.2	-						ANO10_uc011azs.1_Intron|ANO10_uc003cmw.2_Intron|ANO10_uc010hil.2_Intron|ANO10_uc011azt.1_Intron	NM_018075	NP_060545	Q9NW15	ANO10_HUMAN	transmembrane protein 16K						cell death	chloride channel complex	chloride channel activity			ovary(2)	2						GTTGAACTGCCAAAAAAAAAAA	0.312													3	3	---	---	---	---	
COL6A6	131873	broad.mit.edu	37	3	130345153	130345153	+	Intron	DEL	C	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130345153delC	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						CTTGCTGAGGCTTCACTGATC	0.438													8	4	---	---	---	---	
SGEF	26084	broad.mit.edu	37	3	153842162	153842162	+	Intron	DEL	T	-	-	rs66618151		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153842162delT	uc011bog.1	+						SGEF_uc011boh.1_Intron	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine						regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTGCttttccttttttttttt	0.244													7	4	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39507525	39507525	+	Intron	DEL	A	-	-	rs35867925		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39507525delA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	CCTATGGATTAAAAAAAAAAA	0.229													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57554288	57554290	+	IGR	DEL	AGG	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57554288_57554290delAGG								HOPX (6416 upstream) : SPINK2 (121744 downstream)																							gaaggaaaaaaggagggagggag	0.000													2	5	---	---	---	---	
CCNG2	901	broad.mit.edu	37	4	78081697	78081697	+	Intron	DEL	A	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78081697delA	uc003hkq.3	+						CCNG2_uc003hkn.3_Intron|CCNG2_uc011ccc.1_Intron|CCNG2_uc003hkp.3_Intron	NM_004354	NP_004345	Q16589	CCNG2_HUMAN	cyclin G2						cell cycle checkpoint|cell division|mitosis	cytoplasm				ovary(2)|lung(1)	3						GGGGGGGGGGAGGTCGAGAAC	0.249													6	3	---	---	---	---	
EGF	1950	broad.mit.edu	37	4	110925377	110925378	+	Intron	INS	-	AG	AG			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110925377_110925378insAG	uc003hzy.3	+						EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Intron|EGF_uc010imk.2_Intron	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	tacatacacacacacacacaca	0.203													4	2	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243419	120243420	+	5'Flank	INS	-	TT	TT	rs151066719	by1000genomes	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243419_120243420insTT	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						AATTCTTATTAATTAATTCTTA	0.287													8	4	---	---	---	---	
RNF175	285533	broad.mit.edu	37	4	154670000	154670002	+	Intron	DEL	AAC	-	-	rs28451296	by1000genomes	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154670000_154670002delAAC	uc003int.2	-						RNF175_uc003inu.1_Intron	NM_173662	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175							integral to membrane	zinc ion binding			ovary(1)|pancreas(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				TAGCaaaaaaaacaaaaaacaaa	0.365													9	4	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130800138	130800138	+	Intron	DEL	T	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130800138delT	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvq.2_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		AAATATATCCTTTTTTTTTTT	0.204													6	3	---	---	---	---	
HAVCR1	26762	broad.mit.edu	37	5	156469453	156469455	+	Intron	DEL	AAA	-	-	rs71741602		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156469453_156469455delAAA	uc010jij.1	-						HAVCR1_uc011ddl.1_Intron|HAVCR1_uc003lwi.2_Intron	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1						interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			actccgtctcaaaaaaaaaaaaa	0.103													5	3	---	---	---	---	
MRS2	57380	broad.mit.edu	37	6	24418168	24418169	+	Intron	INS	-	A	A	rs75694059		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24418168_24418169insA	uc003neb.2	+						MRS2_uc003nea.2_Intron|MRS2_uc011djl.1_Intron|MRS2_uc011djm.1_Intron|MRS2_uc011djn.1_Intron|MRS2_uc003nec.2_Intron	NM_020662	NP_065713	Q9HD23	MRS2_HUMAN	MRS2-like, magnesium homeostasis factor						ion transport	integral to membrane|mitochondrial inner membrane					0						aactccatctcaaaaaaaaaaa	0.124													9	6	---	---	---	---	
PM20D2	135293	broad.mit.edu	37	6	89872000	89872001	+	3'UTR	INS	-	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89872000_89872001insA	uc003pmz.2	+	7						NM_001010853	NP_001010853	Q8IYS1	P20D2_HUMAN	aminoacylase 1-like 2								hydrolase activity				0		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		AGGGGCCACTTATAAATCAAGA	0.307													47	23	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	32338297	32338304	+	Frame_Shift_Del	DEL	GGCGCTCC	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32338297_32338304delGGCGCTCC	uc003tco.1	-	1	638_645	c.44_51delGGAGCGCC	c.(43-51)CGGAGCGCCfs	p.R15fs		NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	Error:Variant_position_missing_in_Q14123_after_alignment					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TGCTGAAAGTGGCGCTCCGGCATTTTTT	0.659													8	5	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100229246	100229247	+	Intron	INS	-	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100229246_100229247insA	uc003uvv.1	-						TFR2_uc010lhc.1_Intron|TFR2_uc003uvu.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					gactccatctcaaaaaaaaaaa	0.035													4	4	---	---	---	---	
ZNF800	168850	broad.mit.edu	37	7	127013660	127013660	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127013660delG	uc003vlx.1	-	5	1993	c.1730delC	c.(1729-1731)CCTfs	p.P577fs	ZNF800_uc003vlw.1_Frame_Shift_Del_p.P480fs|ZNF800_uc003vly.1_Frame_Shift_Del_p.P577fs|ZNF800_uc010lla.2_Frame_Shift_Del_p.P577fs	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN	zinc finger protein 800	577					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ATCCCTCGAAGGGCCTCTTTT	0.363													117	83	---	---	---	---	
AHCYL2	23382	broad.mit.edu	37	7	128865042	128865042	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128865042delC	uc011kov.1	+	1	179	c.125delC	c.(124-126)GCCfs	p.A42fs	AHCYL2_uc003vot.2_Frame_Shift_Del_p.A42fs	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN	S-adenosylhomocysteine hydrolase-like 2 isoform	42					one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2						GGCGCCATGGCCCCCCCGGCG	0.537													4	2	---	---	---	---	
RECK	8434	broad.mit.edu	37	9	36123173	36123173	+	3'UTR	DEL	T	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36123173delT	uc003zyv.2	+	21					RECK_uc003zyw.2_3'UTR|RECK_uc003zyx.2_RNA	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			CCACACAGTATTTTTTTTTTT	0.353													4	2	---	---	---	---	
CBWD6	644019	broad.mit.edu	37	9	69207122	69207122	+	Intron	DEL	G	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69207122delG	uc004afj.3	-						CBWD6_uc004afk.3_Intron|CBWD6_uc011lrf.1_Intron	NM_001085457	NP_001078926	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding				0						CATATGTGCTGTTTTTTTGGA	0.294													4	2	---	---	---	---	
FAM21C	253725	broad.mit.edu	37	10	46254740	46254741	+	Intron	INS	-	CA	CA			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46254740_46254741insCA	uc001jcu.2	+						FAM21C_uc001jcs.1_Intron|FAM21C_uc001jct.2_Intron|FAM21C_uc010qfi.1_Intron|FAM21C_uc010qfj.1_Intron|FAM21C_uc010qfk.1_Intron	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725											ovary(1)	1						TTCTTCCCCACCCCCCCCCCAC	0.421													4	2	---	---	---	---	
FAM21C	253725	broad.mit.edu	37	10	46254741	46254742	+	Intron	INS	-	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46254741_46254742insA	uc001jcu.2	+						FAM21C_uc001jcs.1_Intron|FAM21C_uc001jct.2_Intron|FAM21C_uc010qfi.1_Intron|FAM21C_uc010qfj.1_Intron|FAM21C_uc010qfk.1_Intron	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725											ovary(1)	1						TCTTCCCCACCCCCCCCCCACC	0.416													4	3	---	---	---	---	
CSTF2T	23283	broad.mit.edu	37	10	53457289	53457289	+	3'UTR	DEL	A	-	-	rs143102624		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53457289delA	uc001jjp.2	-	1					PRKG1_uc001jjm.2_Intron|PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_015235	NP_056050	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit						mRNA processing	nucleus	nucleotide binding|RNA binding			ovary(1)	1				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		ACCCTCAATTaaaaaaaaaag	0.313													2	4	---	---	---	---	
ATRNL1	26033	broad.mit.edu	37	10	117287572	117287583	+	Intron	DEL	CTTCCTTCCTTT	-	-	rs144179474	by1000genomes	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117287572_117287583delCTTCCTTCCTTT	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		tccttccttccttccttccttTCCCTTCTCAT	0.094													4	2	---	---	---	---	
CAPN1	823	broad.mit.edu	37	11	64954882	64954882	+	Intron	DEL	C	-	-	rs3832790		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64954882delC	uc009yqd.1	+						CAPN1_uc001odf.1_Intron|CAPN1_uc001odg.1_Intron|CAPN1_uc010roa.1_Intron	NM_005186	NP_005177	P07384	CAN1_HUMAN	calpain 1, large subunit						positive regulation of cell proliferation|proteolysis	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		CCTTTCCCCTCCTGCAGCACC	0.617													4	2	---	---	---	---	
CHRDL2	25884	broad.mit.edu	37	11	74407796	74407797	+	Intron	INS	-	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74407796_74407797insT	uc001ovi.2	-						CHRDL2_uc001ovg.2_Intron|CHRDL2_uc001ovh.2_Intron			Q6WN34	CRDL2_HUMAN	RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;						cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)					ACTGGGTGTGATGGGGCACATG	0.599													2	4	---	---	---	---	
CHD4	1108	broad.mit.edu	37	12	6682042	6682042	+	Intron	DEL	A	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6682042delA	uc001qpo.2	-						CHD4_uc001qpn.2_Intron|CHD4_uc001qpp.2_Intron	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						CCATCTCTTTAAAAAAAAAAA	0.244													4	2	---	---	---	---	
ITPR2	3709	broad.mit.edu	37	12	26637009	26637010	+	Intron	DEL	TA	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26637009_26637010delTA	uc001rhg.2	-						ITPR2_uc009zjg.1_Intron	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CCCAAGCATCtatatatatata	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	40842476	40842477	+	IGR	INS	-	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40842476_40842477insC								LRRK2 (79392 upstream) : CNTN1 (243881 downstream)																							cttccttccttcttctttcctt	0.050													4	2	---	---	---	---	
LTA4H	4048	broad.mit.edu	37	12	96414872	96414872	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96414872delA	uc001ten.1	-	6	697	c.629delT	c.(628-630)TTAfs	p.L210fs	LTA4H_uc010suy.1_Frame_Shift_Del_p.L172fs|LTA4H_uc010suz.1_Frame_Shift_Del_p.L172fs|LTA4H_uc010sva.1_RNA	NM_000895	NP_000886	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	210					hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1						CCTGCTTTCTAAAGCTCCAAC	0.398													77	60	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101713543	101713543	+	Intron	DEL	T	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101713543delT	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TATTAAAGCCTTTTTTTTTTT	0.294													6	3	---	---	---	---	
DYNLL1	8655	broad.mit.edu	37	12	120934545	120934545	+	Intron	DEL	T	-	-	rs35017041		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120934545delT	uc001tyj.2	+						uc001tyk.1_5'Flank|DYNLL1_uc001tyl.2_Intron|DYNLL1_uc001tym.2_Intron	NM_001037494	NP_001032583	P63167	DYL1_HUMAN	dynein light chain 1						actin cytoskeleton organization|activation of pro-apoptotic gene products|anatomical structure morphogenesis|female gamete generation|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|microtubule-based process|negative regulation of phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transport	centrosome|cytoplasmic dynein complex|cytosol|microtubule|mitochondrion|nucleus|plasma membrane	motor activity|protein binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGTCCGAAGttttttttttt	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19487487	19487488	+	IGR	INS	-	C	C			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19487487_19487488insC								OR11H12 (108915 upstream) : POTEG (65877 downstream)																							CTGAAGTCATACCCCCCCACAC	0.401													4	3	---	---	---	---	
SNORD114-24	767604	broad.mit.edu	37	14	101451063	101451064	+	5'Flank	INS	-	T	T			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101451063_101451064insT	uc001yjo.1	+						SNORD114-25_uc001yjp.1_5'Flank|SNORD114-26_uc001yjq.2_5'Flank	NR_003217				Homo sapiens small nucleolar RNA, C/D box 114-24 (SNORD114-24), non-coding RNA.												0						TGAATTAATGAATTAATCAACA	0.327													50	24	---	---	---	---	
MYH13	8735	broad.mit.edu	37	17	10209538	10209547	+	Intron	DEL	TGTGTGTGTG	-	-	rs66516471		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10209538_10209547delTGTGTGTGTG	uc002gmk.1	-							NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CCAAAATAGAtgtgtgtgtgtgtgtgtgtg	0.286													4	2	---	---	---	---	
POLDIP2	26073	broad.mit.edu	37	17	26684390	26684391	+	Splice_Site	INS	-	C	C	rs148075904	by1000genomes	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26684390_26684391insC	uc002haz.2	-	3	211	c.79_splice	c.e3+0	p.P27_splice	POLDIP2_uc010wag.1_RNA|TMEM199_uc002hba.2_5'Flank|SARM1_uc010wah.1_5'Flank	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GCACAGAGCGGCTTTGCCACCG	0.762													5	4	---	---	---	---	
SPOP	8405	broad.mit.edu	37	17	47700373	47700373	+	Intron	DEL	T	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47700373delT	uc010dbk.2	-						SPOP_uc002ipb.2_Intron|SPOP_uc002ipc.2_Intron|SPOP_uc002ipd.2_Intron|SPOP_uc002ipe.2_Intron|SPOP_uc002ipf.2_Intron|SPOP_uc002ipg.2_Intron|SPOP_uc010wlx.1_Intron	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein						mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						GGTCCTAAAAttttttttttt	0.194										Prostate(2;0.17)			4	2	---	---	---	---	
CACNA1G	8913	broad.mit.edu	37	17	48698971	48698972	+	Intron	DEL	GT	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48698971_48698972delGT	uc002irk.1	+						CACNA1G_uc002irj.1_Intron|CACNA1G_uc002irl.1_Intron|CACNA1G_uc002irm.1_Intron|CACNA1G_uc002irn.1_Intron|CACNA1G_uc002iro.1_Intron|CACNA1G_uc002irp.1_Intron|CACNA1G_uc002irq.1_Intron|CACNA1G_uc002irr.1_Intron|CACNA1G_uc002irs.1_Intron|CACNA1G_uc002irt.1_Intron|CACNA1G_uc002irv.1_Intron|CACNA1G_uc002irw.1_Intron|CACNA1G_uc002iru.1_Intron|CACNA1G_uc002irx.1_Intron|CACNA1G_uc002iry.1_Intron|CACNA1G_uc002irz.1_Intron|CACNA1G_uc002isa.1_Intron|CACNA1G_uc002isb.1_Intron|CACNA1G_uc002isc.1_Intron|CACNA1G_uc002isd.1_Intron|CACNA1G_uc002ise.1_Intron|CACNA1G_uc002isf.1_Intron|CACNA1G_uc002isg.1_Intron|CACNA1G_uc002ish.1_Intron|CACNA1G_uc002isi.1_Intron	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G						axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GTGCACGCGCGTGTGCGCTGTC	0.579													17	11	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	58945899	58945900	+	Intron	INS	-	A	A			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58945899_58945900insA	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CTTTCTTTTTTAAAAAAATGAC	0.228													32	17	---	---	---	---	
GPRC5C	55890	broad.mit.edu	37	17	72437119	72437120	+	Intron	INS	-	T	T	rs141781708		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72437119_72437120insT	uc002jks.2	+						GPRC5C_uc002jkp.2_Intron|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Intron|GPRC5C_uc002jkt.2_Intron|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						TAATTTAAAGATTTTTTTTTTT	0.198													3	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544277	80544278	+	Intron	INS	-	A	A	rs149999499	by1000genomes	TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544277_80544278insA	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gaaaggtgggcgggggggaaag	0.000													5	3	---	---	---	---	
ARID3A	1820	broad.mit.edu	37	19	966459	966459	+	Intron	DEL	A	-	-	rs71335324		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:966459delA	uc002lql.2	+							NM_005224	NP_005215	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT- like)							cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actccgtctcaaaaaaaaaaa	0.204													5	3	---	---	---	---	
WDR88	126248	broad.mit.edu	37	19	33623050	33623051	+	5'UTR	INS	-	G	G			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33623050_33623051insG	uc002nui.2	+	1						NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing											ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					GGCTTGTCGGCGGCCACCGGCG	0.624													4	2	---	---	---	---	
PAK4	10298	broad.mit.edu	37	19	39667514	39667515	+	Intron	INS	-	T	T	rs34636072		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39667514_39667515insT	uc002okj.1	+						PAK4_uc002okl.1_Intron|PAK4_uc002okn.1_Intron|PAK4_uc002okm.1_Intron|PAK4_uc002oko.1_Intron|PAK4_uc002okp.1_Intron	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			ATTCAttcttcttttttttttt	0.282													4	2	---	---	---	---	
DPM1	8813	broad.mit.edu	37	20	49565355	49565355	+	Intron	DEL	A	-	-	rs76899294		TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49565355delA	uc002xvw.1	-						DPM1_uc002xvv.1_5'Flank|DPM1_uc002xvx.1_Intron	NM_003859	NP_003850	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase 1						C-terminal protein lipidation|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|protein N-linked glycosylation via asparagine|protein O-linked mannosylation	dolichol-phosphate-mannose synthase complex|endoplasmic reticulum membrane|membrane fraction	dolichyl-phosphate beta-D-mannosyltransferase activity|dolichyl-phosphate-mannose-protein mannosyltransferase activity|protein binding			ovary(1)	1						TTGCCAAAAGAAAAAAAAAAG	0.189													6	3	---	---	---	---	
PPEF1	5475	broad.mit.edu	37	X	18842027	18842028	+	Intron	INS	-	TT	TT			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18842027_18842028insTT	uc004cyq.2	+						PPEF1_uc004cyp.2_Intron|PPEF1_uc004cyr.2_Intron|PPEF1_uc004cys.2_Intron|PPEF1_uc011mja.1_Intron|PPEF1_uc011mjb.1_Intron	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding						detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					GGGCTTTGTTATTGTTGTTGTT	0.436													70	74	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48305869	48305869	+	IGR	DEL	T	-	-			TCGA-B8-4622-01A-02D-1553-08	TCGA-B8-4622-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48305869delT								SSX4 (53084 upstream) : SLC38A5 (11059 downstream)																							ATAATACCCATTTTTTTTCTG	0.353													4	2	---	---	---	---	
