Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AGRN	375790	broad.mit.edu	37	1	981443	981443	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:981443C>G	uc001ack.1	+	16	2830	c.2780C>G	c.(2779-2781)ACC>AGC	p.T927S		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	927	Kazal-like 9.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CCGATGCTCACCTGTCCAGAG	0.637													44	143	---	---	---	---	PASS
PARK7	11315	broad.mit.edu	37	1	8025470	8025470	+	Silent	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8025470A>G	uc001aou.3	+	3	282	c.177A>G	c.(175-177)GAA>GAG	p.E59E	PARK7_uc001aow.3_Silent_p.E59E|PARK7_uc001aox.3_Silent_p.E59E|PARK7_uc001aov.3_Silent_p.E59E	NM_001123377	NP_001116849	Q99497	PARK7_HUMAN	Parkinson disease protein 7	59					autophagy|cell death|cellular response to hydrogen peroxide|inflammatory response|mitochondrion organization|negative regulation of cell death|negative regulation of protein binding|neuroprotection|protein stabilization|regulation of androgen receptor signaling pathway|regulation of inflammatory response|single fertilization	mitochondrion|nucleus	mRNA binding|peptidase activity|peroxidase activity|protein homodimerization activity				0	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;1.28e-70)|GBM - Glioblastoma multiforme(8;3.05e-36)|Colorectal(212;6.83e-08)|COAD - Colon adenocarcinoma(227;7.51e-06)|Kidney(185;5.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000414)|KIRC - Kidney renal clear cell carcinoma(229;0.000967)|STAD - Stomach adenocarcinoma(132;0.00102)|READ - Rectum adenocarcinoma(331;0.0649)		CCAGCCTTGAAGATGCAAAAA	0.428													6	371	---	---	---	---	PASS
ENO1	2023	broad.mit.edu	37	1	8921407	8921407	+	3'UTR	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8921407C>T	uc001apj.1	-	12					ENO1_uc001api.1_3'UTR|ENO1_uc001apk.1_3'UTR|ENO1_uc001apl.1_3'UTR|ENO1_uc009vmi.1_3'UTR|ENO1_uc009vmj.1_3'UTR|ENO1_uc009vmk.1_3'UTR	NM_001428	NP_001419	P06733	ENOA_HUMAN	enolase 1						gluconeogenesis|glycolysis|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|response to virus	phosphopyruvate hydratase complex|plasma membrane|sarcomere	DNA binding|magnesium ion binding|phosphopyruvate hydratase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|kidney(1)|central_nervous_system(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GAAGGGCTTGCCTGCCCACAG	0.587													4	91	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918543	16918543	+	5'UTR	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918543A>G	uc009vos.1	-	7					NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GAAGAGGTGGAGCCAGGGACT	0.458													14	449	---	---	---	---	PASS
LRRC39	127495	broad.mit.edu	37	1	100626023	100626023	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100626023T>C	uc001dsw.1	-	4	417	c.218A>G	c.(217-219)AAG>AGG	p.K73R	LRRC39_uc001dsx.1_Missense_Mutation_p.K73R|LRRC39_uc001dsy.1_Missense_Mutation_p.K73R|LRRC39_uc001dsz.1_Missense_Mutation_p.K73R	NM_144620	NP_653221	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39	73										ovary(2)|skin(1)	3		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		AAAGCTTACCTTCCATTCCTC	0.368													8	740	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104122085	104122085	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104122085A>G	uc001duq.2	+	12	2115	c.1499A>G	c.(1498-1500)GAT>GGT	p.D500G	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.D500G|AMY2B_uc001dus.1_Intron	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	500					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TCTGCTGAGGATCCATTTATT	0.308													5	219	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148343767	148343767	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148343767G>A	uc001eqf.2	-	3	355	c.320C>T	c.(319-321)ACC>ATC	p.T107I	LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc009wkf.1_RNA|uc001erd.3_Missense_Mutation_p.T107I|uc001erc.3_RNA|uc010paj.1_Intron|uc010pau.1_5'Flank|uc010pav.1_Missense_Mutation_p.T107I|uc010paw.1_Missense_Mutation_p.T32I	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672	107	Potential.					cytoplasm					0						CCTTAACTGGGTCAGCTCTCG	0.498													5	157	---	---	---	---	PASS
DCST1	149095	broad.mit.edu	37	1	155014062	155014062	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155014062G>C	uc001fgn.1	+	7	817	c.721G>C	c.(721-723)GAG>CAG	p.E241Q	DCST1_uc010per.1_Missense_Mutation_p.E266Q|DCST1_uc010pes.1_Missense_Mutation_p.E216Q	NM_152494	NP_689707	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1 isoform 1	241	Extracellular (Potential).					integral to membrane	zinc ion binding			ovary(1)|skin(1)	2	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GAAGATGTATGAGCTGAAGAC	0.617													8	27	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155308050	155308050	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155308050T>C	uc009wqq.2	-	27	9128	c.8648A>G	c.(8647-8649)GAG>GGG	p.E2883G	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.E2878G	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2883					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CCGTTCTGGCTCCTCCAGGCT	0.522													5	158	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237791209	237791209	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237791209G>A	uc001hyl.1	+	41	6389	c.6269G>A	c.(6268-6270)CGG>CAG	p.R2090Q		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2090	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGCTCCATCGGCAGTATGAC	0.557													42	143	---	---	---	---	PASS
OR2T12	127064	broad.mit.edu	37	1	248458511	248458511	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458511C>A	uc010pzj.1	-	1	370	c.370G>T	c.(370-372)GTC>TTC	p.V124F		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	124	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GGGTGGCAGACAGCCGCATAG	0.617													15	49	---	---	---	---	PASS
SH3BP5L	80851	broad.mit.edu	37	1	249106452	249106452	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249106452C>T	uc001iew.1	-	7	1381	c.829G>A	c.(829-831)GGG>AGG	p.G277R	SH3BP5L_uc010pzp.1_Missense_Mutation_p.G170R|SH3BP5L_uc010pzq.1_Missense_Mutation_p.G245R|SH3BP5L_uc001iev.1_Missense_Mutation_p.G158R	NM_030645	NP_085148	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	277											0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GGCAGACCCCCGCGGCGCCGT	0.692													3	16	---	---	---	---	PASS
EIF2AK2	5610	broad.mit.edu	37	2	37362649	37362649	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37362649T>C	uc010ynh.1	-	10	1320	c.763A>G	c.(763-765)ACA>GCA	p.T255A	EIF2AK2_uc010fab.1_Missense_Mutation_p.T255A|EIF2AK2_uc010yng.1_Missense_Mutation_p.T255A|EIF2AK2_uc010fac.2_Missense_Mutation_p.T255A|EIF2AK2_uc010fad.2_Missense_Mutation_p.T255A	NM_002759	NP_002750	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha	255				T->A: Moderate loss of activity; when associated with A-242 and A-255.|Missing: Loss of activity.	evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity			ovary(2)|lung(2)|pancreas(1)	5		all_hematologic(82;0.248)				GTATACTTTGTTTCTTTCATG	0.224													7	535	---	---	---	---	PASS
ARL6IP6	151188	broad.mit.edu	37	2	153577075	153577075	+	Silent	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153577075A>G	uc002tyn.2	+	2	1145	c.429A>G	c.(427-429)GAA>GAG	p.E143E	ARL6IP6_uc002tym.2_RNA|ARL6IP6_uc002tyo.2_Silent_p.E35E	NM_152522	NP_689735	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation-like factor 6 interacting	143						integral to membrane					0						TGAAAAATGAAGATGATGTAG	0.373													8	628	---	---	---	---	PASS
GORASP2	26003	broad.mit.edu	37	2	171822367	171822367	+	Silent	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171822367C>T	uc002ugk.2	+	10	1226	c.1086C>T	c.(1084-1086)TCC>TCT	p.S362S	GORASP2_uc002ugj.2_Silent_p.S294S|GORASP2_uc010zdl.1_Silent_p.S374S|GORASP2_uc010zdm.1_Silent_p.S318S|GORASP2_uc002ugl.2_Silent_p.S294S|GORASP2_uc002ugm.2_Silent_p.S144S	NM_015530	NP_056345	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2	362	Pro-rich.					Golgi membrane				breast(1)|central_nervous_system(1)	2						CCCTGCCATCCGAGTTCCTCC	0.582													5	384	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173354250	173354250	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173354250C>A	uc002uhp.1	+	20	2746	c.2543C>A	c.(2542-2544)ACA>AAA	p.T848K	ITGA6_uc010zdy.1_Missense_Mutation_p.T729K|ITGA6_uc002uho.1_Missense_Mutation_p.T848K|ITGA6_uc010fqm.1_Missense_Mutation_p.T494K	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	887	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AACCTCGGCACAGCAACCTTG	0.343													42	199	---	---	---	---	PASS
UGT1A9	54600	broad.mit.edu	37	2	234580804	234580804	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234580804A>G	uc002vus.2	+	1	261	c.224A>G	c.(223-225)AAG>AGG	p.K75R	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Missense_Mutation_p.K75R	NM_021027	NP_066307	O60656	UD19_HUMAN	UDP glycosyltransferase 1 family, polypeptide A9	75					drug metabolic process|flavone metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding			ovary(3)|breast(1)|skin(1)	5		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Entacapone(DB00494)|Etodolac(DB00749)|Indomethacin(DB00328)|Irinotecan(DB00762)|Mycophenolic acid(DB01024)|Oxyphenonium(DB00219)|Propofol(DB00818)|Sorafenib(DB00398)	TGCACAGTGAAGACTTATTCA	0.473													8	309	---	---	---	---	PASS
FBLN2	2199	broad.mit.edu	37	3	13612493	13612493	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13612493G>C	uc011avb.1	+	2	763	c.638G>C	c.(637-639)GGG>GCG	p.G213A	FBLN2_uc011auz.1_Missense_Mutation_p.G239A|FBLN2_uc011ava.1_Missense_Mutation_p.G213A|FBLN2_uc011avc.1_Missense_Mutation_p.G213A	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	213	Subdomain NB (Cys-free).|N.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			ACAGCCCTGGGGGGTGAGGTC	0.672													10	10	---	---	---	---	PASS
TDGF1	6997	broad.mit.edu	37	3	46622816	46622816	+	3'UTR	SNP	A	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46622816A>C	uc003cpv.2	+	6					LRRC2_uc003cpu.3_5'Flank	NM_003212	NP_003203	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1						activation of MAPK activity|anterior/posterior axis specification, embryo|mammary gland development|morphogenesis of a branching structure|negative regulation of apoptosis|peptidyl-serine phosphorylation|positive regulation of cell migration|positive regulation of peptidyl-tyrosine phosphorylation	anchored to membrane|cell surface|extrinsic to plasma membrane	growth factor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		CTGCTGCTACAATGTCCTAAC	0.323													25	42	---	---	---	---	PASS
USP4	7375	broad.mit.edu	37	3	49373006	49373006	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49373006A>C	uc003cwq.2	-	2	204	c.125T>G	c.(124-126)TTC>TGC	p.F42C	USP4_uc003cwr.2_Missense_Mutation_p.F42C	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a	42	DUSP.				negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		CCACTGCTTGAACCACCGGCT	0.413													77	127	---	---	---	---	PASS
GMPPB	29925	broad.mit.edu	37	3	49760827	49760827	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49760827T>C	uc003cxk.1	-	2	433	c.208A>G	c.(208-210)AGG>GGG	p.R70G	GMPPB_uc003cxl.1_Missense_Mutation_p.R70G	NM_021971	NP_068806	Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B isoform 2	70					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine		GTP binding|mannose-1-phosphate guanylyltransferase activity				0				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGCCTCACCCTCTGCTCCTGT	0.612													5	126	---	---	---	---	PASS
IQCF5	389124	broad.mit.edu	37	3	51907961	51907961	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51907961G>T	uc011bdx.1	-	2	288	c.235C>A	c.(235-237)CGC>AGC	p.R79S	IQCF1_uc003dbq.3_Intron	NM_001145059	NP_001138531	A8MTL0	IQCF5_HUMAN	IQ motif containing F5	79	IQ 2.										0						CACCACATGCGGACCCAGGAC	0.582													4	65	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142089398	142089398	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142089398A>G	uc003eus.2	-	27	3200	c.3133T>C	c.(3133-3135)TCT>CCT	p.S1045P	XRN1_uc010huu.2_Missense_Mutation_p.S511P|XRN1_uc003eut.2_Missense_Mutation_p.S1045P|XRN1_uc003euu.2_Missense_Mutation_p.S1045P	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a	1045					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						TCACAAGAAGAACGAGATAAA	0.308													7	471	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193049056	193049056	+	Silent	SNP	G	A	A	rs149554375	byFrequency	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193049056G>A	uc011bsq.1	-	12	1317	c.1317C>T	c.(1315-1317)ACC>ACT	p.T439T		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	439	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GGACAGTCACGGTGAGGAGGA	0.522													10	195	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195510062	195510062	+	Missense_Mutation	SNP	G	C	C	rs143689443	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195510062G>C	uc011bto.1	-	3	8465	c.8005C>G	c.(8005-8007)CAC>GAC	p.H2669D	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTGACCTGTGGAT	0.587													13	158	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195510108	195510108	+	Silent	SNP	G	A	A	rs142152945	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195510108G>A	uc011bto.1	-	3	8419	c.7959C>T	c.(7957-7959)CAC>CAT	p.H2653H	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.592													13	160	---	---	---	---	PASS
HSP90AB2P	391634	broad.mit.edu	37	4	13339118	13339118	+	RNA	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13339118T>C	uc003gms.2	+	1		c.4082T>C				NR_003132				Homo sapiens heat shock protein 90Bb (HSP90Bb) mRNA, complete cds.											kidney(1)	1						CTCCTTAGGCTCCCTTTCATC	0.433													5	162	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69870606	69870606	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69870606C>T	uc011cao.1	-	9	1580	c.1444G>A	c.(1444-1446)GCT>ACT	p.A482T	UGT2B10_uc011can.1_Missense_Mutation_p.A398T			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	519					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						CCTTTTCTAGCGAACTTCCAG	0.398													7	649	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90171338	90171338	+	5'UTR	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90171338G>T	uc003hsm.1	-	2						NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth											ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CGCAGTCAGAGCTCAGAGTGA	0.507													3	14	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95578668	95578668	+	Silent	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95578668T>C	uc003hti.2	+	11	1706	c.1555T>C	c.(1555-1557)TTG>CTG	p.L519L	PDLIM5_uc011cdx.1_Silent_p.L416L|PDLIM5_uc003hth.2_Silent_p.L410L|PDLIM5_uc003htj.2_Silent_p.L194L|PDLIM5_uc003htk.2_Silent_p.L548L|PDLIM5_uc011cdy.1_Silent_p.L397L|PDLIM5_uc003htl.2_Silent_p.L194L	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	519	LIM zinc-binding 2.				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TGTTTTTCACTTGGAGGATGG	0.393													8	460	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21751935	21751935	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21751935C>A	uc010iuc.2	-	12	2754	c.2296G>T	c.(2296-2298)GAC>TAC	p.D766Y	CDH12_uc011cno.1_Missense_Mutation_p.D726Y|CDH12_uc003jgk.2_Missense_Mutation_p.D766Y|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	766	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						GTCAGATAGTCATAGTCCTGG	0.507										HNSCC(59;0.17)			60	268	---	---	---	---	PASS
SEPT8	23176	broad.mit.edu	37	5	132096940	132096940	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132096940T>C	uc003kxr.2	-	8	1218	c.980A>G	c.(979-981)GAG>GGG	p.E327G	SEPT8_uc003kxs.1_Missense_Mutation_p.E327G|SEPT8_uc003kxu.2_Missense_Mutation_p.E327G|SEPT8_uc011cxi.1_Missense_Mutation_p.E325G|SEPT8_uc003kxv.2_Missense_Mutation_p.E325G|SEPT8_uc003kxt.2_Missense_Mutation_p.E267G	NM_001098811	NP_001092281	Q92599	SEPT8_HUMAN	septin 8 isoform a	327	Potential.				cell cycle	septin complex	GTP binding|protein binding			ovary(2)	2		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCTCTTGGCCTCGTATGTCTC	0.512													8	740	---	---	---	---	PASS
ZMAT2	153527	broad.mit.edu	37	5	140080064	140080064	+	Splice_Site	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140080064G>T	uc003lgy.1	+	1	32	c.18_splice	c.e1+1	p.G6_splice		NM_144723	NP_653324	Q96NC0	ZMAT2_HUMAN	zinc finger, matrin type 2							nucleus	DNA binding|zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCAGCGGGGTAGGTGTTGT	0.542													14	703	---	---	---	---	PASS
POU4F3	5459	broad.mit.edu	37	5	145718726	145718726	+	Silent	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145718726A>G	uc003loa.2	+	1	140	c.51A>G	c.(49-51)CAA>CAG	p.Q17Q		NM_002700	NP_002691	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	17					sensory perception of sound|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGGTGCTGCAAGAACCCAAAT	0.592													6	144	---	---	---	---	PASS
PAK1IP1	55003	broad.mit.edu	37	6	10702651	10702651	+	Silent	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10702651A>G	uc003mzg.2	+	3	328	c.297A>G	c.(295-297)GGA>GGG	p.G99G		NM_017906	NP_060376	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1	99	WD 2.				negative regulation of signal transduction	nucleolus|plasma membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				TAATCAGTGGAGCGGAAGATG	0.388													6	271	---	---	---	---	PASS
SLC17A1	6568	broad.mit.edu	37	6	25830753	25830753	+	Silent	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25830753T>C	uc003nfh.3	-	2	149	c.33A>G	c.(31-33)AAA>AAG	p.K11K	SLC17A1_uc011djy.1_RNA|SLC17A1_uc010jqb.1_Silent_p.K9K|SLC17A1_uc010jqc.1_Silent_p.K9K	NM_005074	NP_005065	Q14916	NPT1_HUMAN	solute carrier family 17 (sodium phosphate),	11					sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(3)|pancreas(1)	4						AAGTGCTACCTTTTTTGGGAG	0.403													15	62	---	---	---	---	PASS
IL20RA	53832	broad.mit.edu	37	6	137330599	137330599	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137330599G>A	uc003qhj.2	-	4	867	c.434C>T	c.(433-435)ACT>ATT	p.T145I	IL20RA_uc011edl.1_Missense_Mutation_p.T96I|IL20RA_uc003qhk.2_Missense_Mutation_p.T34I|IL20RA_uc010kgy.1_Intron|IL20RA_uc003qhi.2_5'Flank	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha precursor	145	Extracellular (Potential).|Fibronectin type-III 2.					integral to membrane	receptor activity			ovary(2)|skin(2)	4	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		CTCATCTGTAGTCAGTGCCAC	0.418													5	198	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152706918	152706918	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152706918G>A	uc010kiw.2	-	55	9145	c.8543C>T	c.(8542-8544)GCG>GTG	p.A2848V	SYNE1_uc003qot.3_Missense_Mutation_p.A2855V|SYNE1_uc003qou.3_Missense_Mutation_p.A2848V|SYNE1_uc010kjb.1_Missense_Mutation_p.A2831V	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2848	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCGTGGACCGCATCTAAATA	0.403										HNSCC(10;0.0054)			6	282	---	---	---	---	PASS
C7orf31	136895	broad.mit.edu	37	7	25218907	25218907	+	Silent	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25218907C>T	uc003sxn.1	-	2	582	c.21G>A	c.(19-21)AGG>AGA	p.R7R		NM_138811	NP_620166	Q8N865	CG031_HUMAN	hypothetical protein LOC136895	7											0						AACAGTAGGGCCTGCCGTGAA	0.498													14	185	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38370163	38370163	+	Silent	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38370163T>C	uc010kxj.1	-	2	271	c.135A>G	c.(133-135)GTA>GTG	p.V45V	uc010kxk.1_RNA					SubName: Full=Putative uncharacterized protein ENSP00000374866;																		CGGCATTTTCTACAGGAAGAT	0.502													5	281	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38398653	38398653	+	Intron	SNP	C	T	T	rs75695637	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38398653C>T	uc003tgp.1	+						uc003tgr.2_5'UTR					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		AAAACTCAGGCCCCACTCAAC	0.537													5	96	---	---	---	---	PASS
STAG3L2	442582	broad.mit.edu	37	7	74298857	74298857	+	RNA	SNP	T	C	C	rs148673816	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74298857T>C	uc011kfj.1	-	6		c.810A>G						P0CL84	ST3L2_HUMAN	Homo sapiens cDNA FLJ76564 complete cds.							nucleus	binding				0						CTCTCCTGCATATCACCCAGG	0.378													5	56	---	---	---	---	PASS
BAIAP2L1	55971	broad.mit.edu	37	7	97937353	97937353	+	Intron	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97937353G>A	uc003upj.2	-						uc003upk.1_Missense_Mutation_p.A14T	NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			CTATTTCCTCGCTTTGATCAT	0.532													11	36	---	---	---	---	PASS
FAM200A	221786	broad.mit.edu	37	7	99145777	99145777	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99145777A>T	uc003ura.2	-	2	593	c.254T>A	c.(253-255)ATC>AAC	p.I85N	FAM200A_uc003urb.2_Missense_Mutation_p.I85N	NM_145111	NP_659802	Q8TCP9	F200A_HUMAN	hypothetical protein LOC221786	85	Extracellular (Potential).					integral to membrane	nucleic acid binding				0						tgctggaaggataattttttc	0.000													42	216	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101923413	101923413	+	Splice_Site	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101923413G>T	uc003uyt.2	+	19	1783	c.1764_splice	c.e19+1	p.R588_splice	CUX1_uc011kkn.1_Splice_Site_p.R549_splice|CUX1_uc003uyw.2_Splice_Site_p.R542_splice|CUX1_uc003uyv.2_Splice_Site_p.R572_splice|CUX1_uc003uyu.2_Splice_Site_p.R586_splice|CUX1_uc003uyz.2_Splice_Site	NM_001913	NP_001904	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform b						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						CAGCAAGCGGGTTCGTGAGCC	0.677													16	21	---	---	---	---	PASS
PMPCB	9512	broad.mit.edu	37	7	102952754	102952754	+	3'UTR	SNP	T	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102952754T>A	uc003vbl.2	+	13					PMPCB_uc003vbk.1_3'UTR|PMPCB_uc003vbm.2_3'UTR|PMPCB_uc010liv.2_3'UTR|PMPCB_uc010liw.2_3'UTR|PMPCB_uc011kll.1_Intron	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit						proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						ACACATGTATTTATAAAACAG	0.299													10	62	---	---	---	---	PASS
DENND2A	27147	broad.mit.edu	37	7	140268596	140268596	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140268596C>T	uc010lnj.2	-	6	1703	c.1558G>A	c.(1558-1560)GAG>AAG	p.E520K	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.E520K|DENND2A_uc003vvw.2_Missense_Mutation_p.E520K|DENND2A_uc003vvx.2_Missense_Mutation_p.E520K	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	520										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					CTGTCAGACTCACTGTTCTCA	0.468													6	412	---	---	---	---	PASS
WDR86	349136	broad.mit.edu	37	7	151092874	151092874	+	Silent	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151092874G>A	uc003wkb.2	-	3	1163	c.714C>T	c.(712-714)GTC>GTT	p.V238V	WDR86_uc003wka.2_Silent_p.V196V|WDR86_uc011kvk.1_Silent_p.V238V|WDR86_uc003wkc.2_Silent_p.V110V	NM_198285	NP_938026	Q86TI4	WDR86_HUMAN	WD repeat domain 86	238	WD 6.										0			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCAGACAGATGACGGAGCCCC	0.677													3	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12435889	12435889	+	Intron	SNP	C	A	A	rs617055	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12435889C>A	uc003wvy.3	-						uc003wwb.1_RNA					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		TAACTTCAGACTCAGCTTAGA	0.483													4	37	---	---	---	---	PASS
MRPS28	28957	broad.mit.edu	37	8	80831121	80831121	+	3'UTR	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80831121T>C	uc003ybp.2	-	3					MRPS28_uc003ybo.2_3'UTR|TPD52_uc010lzr.2_RNA	NM_014018	NP_054737	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S28							mitochondrial small ribosomal subunit					0	Lung NSC(7;1.86e-06)|all_lung(9;6.91e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00769)|Epithelial(68;0.0208)|all cancers(69;0.0805)			ATTTATTATATCTTCATTCAA	0.289													27	94	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127790688C>A	uc004bpe.2	-	5	477	c.396G>T	c.(394-396)CAG>CAT	p.Q132H	SCAI_uc004bpd.2_Missense_Mutation_p.Q155H|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	132	Required for interaction with MKL1 (By similarity).|Necessary to inhibit MKL1-induced SRF transcriptional activity (By similarity).				negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						GATAGTATAGCTGCCCAATCT	0.338													15	305	---	---	---	---	PASS
SEC16A	9919	broad.mit.edu	37	9	139342543	139342543	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139342543T>C	uc004chx.2	-	24	6692	c.6383A>G	c.(6382-6384)AAC>AGC	p.N2128S	SEC16A_uc004chp.2_5'Flank|SEC16A_uc004chq.2_5'Flank|SEC16A_uc011mea.1_5'Flank|SEC16A_uc004chr.2_Missense_Mutation_p.N134S|SEC16A_uc004chs.2_5'UTR|SEC16A_uc004cht.2_Missense_Mutation_p.N159S|SEC16A_uc004chu.2_Missense_Mutation_p.N313S|SEC16A_uc004chv.3_Missense_Mutation_p.N1518S|SEC16A_uc004chw.2_Missense_Mutation_p.N2128S|SEC16A_uc010nbn.2_Missense_Mutation_p.N2128S	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	1950	Required for interaction with SEC23A.|Pro-rich.				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CACCGATTTGTTCTTGTCATC	0.378													7	465	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071078	141071078	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071078A>G	uc004com.2	+	4	742	c.481A>G	c.(481-483)ATG>GTG	p.M161V	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						GTCTGCTACCATGAGTGGGGT	0.552													4	16	---	---	---	---	PASS
RBM17	84991	broad.mit.edu	37	10	6156125	6156125	+	Intron	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6156125T>C	uc001ijb.2	+						RBM17_uc010qav.1_Intron|RBM17_uc001ijc.2_5'Flank	NM_032905	NP_116294	Q96I25	SPF45_HUMAN	RNA binding motif protein 17						mRNA processing|RNA splicing	spliceosomal complex	nucleotide binding|protein binding|RNA binding				0						GAGTGTTTTCTTTTGATGTTT	0.353													5	188	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26377305	26377305	+	Silent	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26377305G>T	uc001isn.2	+	15	1893	c.1533G>T	c.(1531-1533)CTG>CTT	p.L511L	MYO3A_uc009xko.1_Silent_p.L511L|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Silent_p.L511L	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	511	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						AATATCTCCTGGAAAAATCCC	0.343													47	110	---	---	---	---	PASS
CASP7	840	broad.mit.edu	37	10	115489084	115489084	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115489084A>T	uc001lan.2	+	7	871	c.697A>T	c.(697-699)AGG>TGG	p.R233W	CASP7_uc001lam.2_Silent_p.G221G|CASP7_uc001lao.2_Missense_Mutation_p.R266W|CASP7_uc001lap.2_Missense_Mutation_p.R233W|CASP7_uc001laq.2_Missense_Mutation_p.R233W|CASP7_uc010qsa.1_Missense_Mutation_p.R318W|CASP7_uc010qsb.1_Missense_Mutation_p.R208W	NM_033339	NP_203125	P55210	CASP7_HUMAN	caspase 7 isoform alpha	233					activation of caspase activity by cytochrome c|cellular component disassembly involved in apoptosis|induction of apoptosis by intracellular signals|proteolysis	cytosol|endoplasmic reticulum membrane|mitochondrial membrane|nucleoplasm	cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)		TTACTCGTGGAGGAGCCCAGG	0.502													14	51	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9225842	9225842	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9225842G>A	uc001mhl.2	-	4	569	c.314C>T	c.(313-315)GCA>GTA	p.A105V	DENND5A_uc010rbw.1_Missense_Mutation_p.A105V|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	105	UDENN.									liver(1)	1						GGTCTTGAATGCCAGCCCTTT	0.473													20	56	---	---	---	---	PASS
NDUFS3	4722	broad.mit.edu	37	11	47602131	47602131	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602131A>G	uc001nga.2	+	3	270	c.188A>G	c.(187-189)GAG>GGG	p.E63G	NDUFS3_uc001nft.3_5'UTR|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_Missense_Mutation_p.E63G	NM_004551	NP_004542	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3	63					induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	GCTTTTGGAGAGTATGTGGCT	0.443													6	182	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56185258	56185258	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56185258A>G	uc010rji.1	-	1	451	c.451T>C	c.(451-453)TAC>CAC	p.Y151H		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					AGGAAGCTGTATATATATGGA	0.453													3	12	---	---	---	---	PASS
MMP20	9313	broad.mit.edu	37	11	102487664	102487664	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102487664C>T	uc001phc.2	-	2	266	c.253G>A	c.(253-255)GGG>AGG	p.G85R		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	85					proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		TCTAACTTCCCGGTGACTTGG	0.478													6	235	---	---	---	---	PASS
BCO2	83875	broad.mit.edu	37	11	112087000	112087000	+	Missense_Mutation	SNP	A	G	G	rs150855336	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112087000A>G	uc001pnf.2	+	11	1690	c.1573A>G	c.(1573-1575)ACC>GCC	p.T525A	BCO2_uc001png.2_Missense_Mutation_p.T452A|BCO2_uc001pnh.2_Missense_Mutation_p.T491A|BCO2_uc010rwt.1_Missense_Mutation_p.T420A|BCO2_uc009yyn.2_Missense_Mutation_p.T485A|BCO2_uc001pni.2_Missense_Mutation_p.T491A	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN	beta-carotene dioxygenase 2 isoform a	525					carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AGCACCAGGAACCAATGAAGA	0.413													7	571	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	2022187	2022187	+	Splice_Site	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2022187A>G	uc001qjp.2	-	3	657	c.426_splice	c.e3+1	p.Q142_splice	CACNA2D4_uc009zds.1_Splice_Site|CACNA2D4_uc009zdt.1_Splice_Site_p.Q142_splice	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GGCCTGGAGTACCTGGACCGC	0.607													26	113	---	---	---	---	PASS
CASC1	55259	broad.mit.edu	37	12	25347862	25347862	+	Intron	SNP	G	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25347862G>C	uc001rgl.2	-						CASC1_uc001rgk.2_Intron|CASC1_uc001rgm.3_Silent_p.P45P|CASC1_uc001rgj.2_Intron|CASC1_uc010sje.1_Intron|CASC1_uc010sjf.1_Intron|CASC1_uc010sjg.1_Intron|CASC1_uc010sjh.1_Intron|LYRM5_uc001rgn.2_5'Flank|LYRM5_uc001rgo.2_5'Flank	NM_001082973	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1 isoform b											ovary(2)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			GCTGAGAAGAGGGCCGACCCA	0.498													29	105	---	---	---	---	PASS
RPS26	6231	broad.mit.edu	37	12	56436231	56436231	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56436231G>A	uc001sjf.2	+	2	291	c.26G>A	c.(25-27)GGT>GAT	p.G9D		NM_001029	NP_001020	P62854	RS26_HUMAN	ribosomal protein S26	9					endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|protein binding|structural constituent of ribosome			breast(1)	1			OV - Ovarian serous cystadenocarcinoma(18;0.123)			AGGAACAATGGTCGTGCCAAA	0.547													16	60	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112650409	112650409	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112650409G>T	uc009zwc.2	-	42	6263	c.6245C>A	c.(6244-6246)CCT>CAT	p.P2082H	C12orf51_uc001ttr.1_Missense_Mutation_p.P257H	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TCCCGGAGGAGGTGGAGTCCC	0.527													13	32	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120582805	120582805	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120582805A>T	uc001txo.2	-	40	5090	c.5077T>A	c.(5077-5079)TTT>ATT	p.F1693I		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1693					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAGTCCTCAAAGCACGACTCC	0.587													65	89	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122801335	122801335	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122801335G>A	uc001ucg.1	-	18	3540	c.3434C>T	c.(3433-3435)ACT>ATT	p.T1145I	CLIP1_uc001uch.1_Missense_Mutation_p.T1134I|CLIP1_uc001uci.1_Missense_Mutation_p.T1099I|CLIP1_uc001ucj.1_Missense_Mutation_p.T720I	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	1145	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		ATTCTCTACAGTCAGGAGTTC	0.284													7	783	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22946683	22946683	+	Intron	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22946683C>T	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wed.1_RNA|uc001wee.3_5'Flank|uc010tmt.1_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTGCAAAGCCCCTCAGCACAG	0.473													4	87	---	---	---	---	PASS
C14orf109	26175	broad.mit.edu	37	14	93652729	93652729	+	Silent	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93652729C>T	uc010auo.2	+	2	581	c.223C>T	c.(223-225)CTG>TTG	p.L75L	MOAP1_uc001ybj.2_5'Flank|C14orf109_uc001ybk.3_Silent_p.L37L	NM_001098621	NP_001092091	Q8N6I4	CN109_HUMAN	hypothetical protein LOC26175 isoform 1	69						integral to membrane					0		all_cancers(154;0.11)|Acute lymphoblastic leukemia(33;0.0488)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		TTACAACAGGCTGGCCTTGGA	0.478													156	437	---	---	---	---	PASS
SPRED1	161742	broad.mit.edu	37	15	38632097	38632097	+	Splice_Site	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38632097G>T	uc001zka.3	+	5	917	c.582_splice	c.e5+1	p.Q194_splice		NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain						inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AGCCAATCAGGTAAGAAGATA	0.383									Legius_syndrome				5	243	---	---	---	---	PASS
MFAP1	4236	broad.mit.edu	37	15	44106815	44106815	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44106815C>T	uc001zth.1	-	4	685	c.501G>A	c.(499-501)ATG>ATA	p.M167I		NM_005926	NP_005917	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	167						microfibril				skin(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		CTTCCACTTCCATGACTTCCA	0.478													7	598	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	83014106	83014106	+	Silent	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83014106T>C	uc010uny.1	-	6	539	c.441A>G	c.(439-441)GTA>GTG	p.V147V	GOLGA6L10_uc010unt.1_RNA|uc002bhl.2_Intron|uc002bhm.2_Intron|GOLGA6L10_uc002bia.1_5'Flank	NM_198181	NP_937824	A6NI86	GG6LA_HUMAN	golgi autoantigen, golgin subfamily a, 6D-like	159	Potential.										0						GTAGCTGCTCTACCTTAGATG	0.498													7	52	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85053188	85053188	+	RNA	SNP	C	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85053188C>G	uc002bkm.2	-	9		c.1859G>C			uc002bkl.1_5'Flank	NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						CCCTGTTCTCCGCAGCCCGAA	0.488													8	30	---	---	---	---	PASS
ZC3H7A	29066	broad.mit.edu	37	16	11858973	11858973	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11858973T>C	uc002dbk.2	-	14	1954	c.1756A>G	c.(1756-1758)AGA>GGA	p.R586G	ZC3H7A_uc002dbj.2_RNA|ZC3H7A_uc002dbl.2_Missense_Mutation_p.R586G|ZC3H7A_uc002dbm.1_Missense_Mutation_p.R496G	NM_014153	NP_054872	Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	586						nucleus	nucleic acid binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						TCTTTATTTCTTTTACTTATC	0.274													7	606	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74496466	74496466	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74496466C>A	uc002fcy.3	-	21	2904	c.2854G>T	c.(2854-2856)GGT>TGT	p.G952C	GLG1_uc002fcx.2_Missense_Mutation_p.G952C|GLG1_uc002fcw.3_Missense_Mutation_p.G941C|GLG1_uc002fcz.3_Missense_Mutation_p.G369C	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	952	Cys-rich GLG1 14.|Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						GTCAGGATACCGTGACAGAAT	0.443													5	292	---	---	---	---	PASS
ITGAE	3682	broad.mit.edu	37	17	3619990	3619990	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3619990G>T	uc002fwo.3	-	30	3535	c.3436C>A	c.(3436-3438)CTG>ATG	p.L1146M	ITGAE_uc002fwn.3_RNA	NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	1146	Helical; (Potential).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		ACCTTGAACAGGATGACCAGA	0.478													5	284	---	---	---	---	PASS
UBE2G1	7326	broad.mit.edu	37	17	4186112	4186112	+	3'UTR	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4186112C>T	uc002fxs.2	-	5						NM_003342	NP_003333	P62253	UB2G1_HUMAN	ubiquitin-conjugating enzyme E2G 1						protein K48-linked ubiquitination|protein K63-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						AGTGAAGTTACTAGCTGCTAA	0.308													6	491	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10298475	10298475	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10298475T>C	uc002gmm.2	-	34	5032	c.4937A>G	c.(4936-4938)TAC>TGC	p.Y1646C	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1646	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GGTGTTCCTGTAGTTCCTTAA	0.458									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				6	334	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27438794	27438794	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27438794T>C	uc002hdt.1	-	16	2844	c.2686A>G	c.(2686-2688)ACC>GCC	p.T896A	MYO18A_uc010wbc.1_Missense_Mutation_p.T438A|MYO18A_uc002hds.2_Missense_Mutation_p.T438A|MYO18A_uc010csa.1_Missense_Mutation_p.T896A|MYO18A_uc002hdu.1_Missense_Mutation_p.T896A|MYO18A_uc010wbd.1_Missense_Mutation_p.T565A	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	896	Myosin head-like.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TCCAGGAGGGTGTCCTCACTG	0.592											OREG0024287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	36	---	---	---	---	PASS
EFCAB5	374786	broad.mit.edu	37	17	28386632	28386632	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28386632G>T	uc002het.2	+	14	2842	c.2650G>T	c.(2650-2652)GAT>TAT	p.D884Y	EFCAB5_uc010wbj.1_Intron|EFCAB5_uc010wbk.1_Intron|EFCAB5_uc010csd.2_RNA|EFCAB5_uc010cse.2_Intron|EFCAB5_uc010csf.2_Missense_Mutation_p.D763Y	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a	884	EF-hand.|Potential.						calcium ion binding			ovary(1)|skin(1)	2						GTGGGACAGTGATGGCTCAGG	0.413													47	158	---	---	---	---	PASS
RDM1	201299	broad.mit.edu	37	17	34257122	34257122	+	Missense_Mutation	SNP	C	G	G	rs145918765		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34257122C>G	uc002hkh.2	-	2	283	c.234G>C	c.(232-234)AAG>AAC	p.K78N	RDM1_uc010cty.2_RNA|RDM1_uc010ctz.2_Missense_Mutation_p.K55N|RDM1_uc010cua.2_Missense_Mutation_p.K55N|RDM1_uc002hkg.3_Missense_Mutation_p.K55N|RDM1_uc010cub.2_RNA|RDM1_uc010cud.2_Missense_Mutation_p.K78N|RDM1_uc010cuf.2_RNA|RDM1_uc010cue.2_Intron|RDM1_uc010cug.2_RNA|RDM1_uc010cuc.2_Missense_Mutation_p.K78N|RDM1_uc010wco.1_Missense_Mutation_p.K55N|RDM1_uc010wcp.1_Missense_Mutation_p.K55N|RDM1_uc002hki.2_Missense_Mutation_p.K78N	NM_145654	NP_663629	Q8NG50	RDM1_HUMAN	RAD52 motif 1 isoform 1	78	RRM.|Necessary for nuclear localization and for nucleolar accumulation in response to heat shock.				DNA recombination|DNA repair	Cajal body|cytoplasm|nucleolus|PML body	DNA binding|nucleotide binding|RNA binding			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GGTCGCATGCCTTTTGGGCTC	0.473								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					39	130	---	---	---	---	PASS
ARHGAP23	57636	broad.mit.edu	37	17	36654047	36654047	+	Silent	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36654047C>T	uc010wdp.1	+	21	3677	c.3015C>T	c.(3013-3015)GAC>GAT	p.D1005D	ARHGAP23_uc002hqc.2_Silent_p.D893D	NM_020876	NP_065927	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1099					signal transduction	intracellular	GTPase activator activity			lung(1)	1						TCTTCAGTGACGAAGAGGACA	0.587													5	237	---	---	---	---	PASS
NPEPPS	9520	broad.mit.edu	37	17	45696469	45696469	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45696469A>G	uc002ilr.3	+	21	2721	c.2498A>G	c.(2497-2499)GAC>GGC	p.D833G	NPEPPS_uc010wkt.1_Missense_Mutation_p.D829G|NPEPPS_uc010wku.1_Missense_Mutation_p.D797G|NPEPPS_uc010wkv.1_Missense_Mutation_p.D387G|NPEPPS_uc002ils.1_Missense_Mutation_p.D266G	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	833					proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						TTCATAAAGGACAACTGGGAA	0.413													6	259	---	---	---	---	PASS
MFSD11	79157	broad.mit.edu	37	17	74774372	74774372	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74774372T>C	uc002jta.2	+	14	2261	c.1288T>C	c.(1288-1290)TTC>CTC	p.F430L	MFSD11_uc002jtb.2_Missense_Mutation_p.F430L|MFSD11_uc010dha.2_Missense_Mutation_p.F378L|MFSD11_uc002jtc.2_Missense_Mutation_p.F430L|MFSD11_uc002jtd.3_Missense_Mutation_p.F430L|MFSD11_uc010dhb.2_Missense_Mutation_p.F378L|MFSD11_uc002jte.2_Missense_Mutation_p.F430L	NM_024311	NP_077287	O43934	MFS11_HUMAN	major facilitator superfamily domain containing	430	Helical; (Potential).					integral to membrane				ovary(1)	1						AATTTCTTTCTTCACTGTGGA	0.493													7	511	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18608832	18608832	+	Silent	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18608832T>C	uc002kte.2	-	10	2057	c.1116A>G	c.(1114-1116)GAA>GAG	p.E372E		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	372	Interaction with FHOD1.|AGC-kinase C-terminal.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					CTTTATCTTCTTCCAAGTCAT	0.348													7	369	---	---	---	---	PASS
RNF138	51444	broad.mit.edu	37	18	29691879	29691879	+	Silent	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29691879A>G	uc002kxg.2	+	3	712	c.273A>G	c.(271-273)AAA>AAG	p.K91K	RNF138_uc002kxh.2_Intron	NM_016271	NP_057355	Q8WVD3	RN138_HUMAN	ring finger protein 138 isoform 1	91					Wnt receptor signaling pathway	intracellular	ligase activity|protein kinase binding|zinc ion binding				0						GCTGTGCAAAACAGGTAGAGT	0.373													6	182	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	74402418	74402418	+	RNA	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74402418T>C	uc002lmh.1	+	1		c.433T>C								Homo sapiens cDNA FLJ44881 fis, clone BRAMY2036254.																		ATCTCGTCTCTCATTTCTGTC	0.488													6	279	---	---	---	---	PASS
EPS15L1	58513	broad.mit.edu	37	19	16472527	16472527	+	3'UTR	SNP	A	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16472527A>T	uc002ndz.1	-	23					EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpe.1_3'UTR|EPS15L1_uc010xpf.1_3'UTR|EPS15L1_uc002nea.1_3'UTR	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						AGGAGACAAAAATCCCAGGGA	0.532													12	36	---	---	---	---	PASS
WDR87	83889	broad.mit.edu	37	19	38380084	38380084	+	Silent	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38380084G>A	uc010efu.2	-	6	4335	c.4110C>T	c.(4108-4110)GGC>GGT	p.G1370G	WDR87_uc002ohj.2_Silent_p.G1409G	NM_031951	NP_114157	Q6ZQQ6	WDR87_HUMAN	NYD-SP11 protein	1370											0						TAACTTTCTTGCCCTTTTTCA	0.393													62	189	---	---	---	---	PASS
PSG1	5669	broad.mit.edu	37	19	43358131	43358131	+	Intron	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43358131C>T	uc010eio.1	-						PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG8_uc002oul.3_Intron|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Intron|PSG10_uc010eip.2_RNA|PSG1_uc002our.1_Intron|PSG1_uc002oux.1_Intron|PSG1_uc002ouy.1_Intron	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1						female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				TTTCCAGTTACTCCTCTAGTC	0.488													76	339	---	---	---	---	PASS
HRC	3270	broad.mit.edu	37	19	49657913	49657913	+	Silent	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49657913C>T	uc002pmv.2	-	1	769	c.582G>A	c.(580-582)GAG>GAA	p.E194E		NM_002152	NP_002143	P23327	SRCH_HUMAN	histidine rich calcium binding protein	194	4 X tandem repeats, acidic.|Glu-rich (acidic).|1-1.|6 X approximate tandem repeats.				muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			ovary(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cctcctcctcctcttcTCCTT	0.443													4	106	---	---	---	---	PASS
GPR32	2854	broad.mit.edu	37	19	51274084	51274084	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51274084T>C	uc010ycf.1	+	1	227	c.227T>C	c.(226-228)GTC>GCC	p.V76A		NM_001506	NP_001497	O75388	GPR32_HUMAN	G protein-coupled receptor 32	76	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GCACGCACGGTCTCCACCGTC	0.572													7	334	---	---	---	---	PASS
ZNF350	59348	broad.mit.edu	37	19	52469415	52469415	+	Silent	SNP	C	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52469415C>G	uc002pyd.2	-	5	519	c.291G>C	c.(289-291)GTG>GTC	p.V97V	uc002pyb.2_Intron|uc002pyc.2_Intron	NM_021632	NP_067645	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	97					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|transcriptional repressor complex	DNA binding|protein binding|zinc ion binding			breast(1)	1		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		TCCTTCTGTTCACCAGGCTTT	0.358													7	35	---	---	---	---	PASS
ZNF816A	125893	broad.mit.edu	37	19	53454526	53454526	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53454526G>T	uc002qal.1	-	5	803	c.502C>A	c.(502-504)CAC>AAC	p.H168N	ZNF321_uc010eqj.2_Intron|ZNF321_uc002qak.1_Intron|ZNF816A_uc002qam.1_Missense_Mutation_p.H152N	NM_001031665	NP_001026835	Q0VGE8	ZN816_HUMAN	zinc finger protein 816A	168					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0313)		TGAAACATGTGGAGTTCAGGC	0.423													5	269	---	---	---	---	PASS
ZIM3	114026	broad.mit.edu	37	19	57646742	57646742	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57646742A>T	uc002qnz.1	-	5	1349	c.963T>A	c.(961-963)GAT>GAA	p.D321E		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	321	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTTTCACAAGATCTGACTTGT	0.408													70	246	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58601748	58601748	+	5'UTR	SNP	A	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58601748A>C	uc002qri.2	-	2					ZSCAN18_uc002qrj.3_5'UTR|ZSCAN18_uc010yhs.1_Intron|ZSCAN18_uc002qrh.2_5'UTR|ZSCAN18_uc010yht.1_Missense_Mutation_p.W19G|ZSCAN18_uc002qrk.1_5'UTR|ZSCAN18_uc002qrl.2_5'UTR	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GCCAGAACCCACAGACCTGCA	0.592													7	27	---	---	---	---	PASS
C20orf202	400831	broad.mit.edu	37	20	1184139	1184139	+	5'UTR	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1184139C>T	uc002wer.3	+	1						NM_001009612	NP_001009612	A1L168	CT202_HUMAN	hypothetical protein LOC400831												0						GAACCTGCTGCCAGTCTGAAA	0.433													25	71	---	---	---	---	PASS
KIF3B	9371	broad.mit.edu	37	20	30898421	30898421	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30898421G>T	uc002wxq.2	+	2	1008	c.841G>T	c.(841-843)GCT>TCT	p.A281S	KIF3B_uc010ztv.1_Missense_Mutation_p.A281S|KIF3B_uc010ztw.1_Missense_Mutation_p.A281S	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	281	Kinesin-motor.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TGTCATCTCTGCTCTAGTGGA	0.517													49	155	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31023443	31023443	+	Silent	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31023443A>G	uc002wxs.2	+	12	3354	c.2928A>G	c.(2926-2928)CAA>CAG	p.Q976Q	ASXL1_uc010geb.2_Silent_p.Q867Q	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	976					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding	p.Q976*(2)		haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						GTTACTGTCAACAGGTGGACA	0.502			F|N|Mis		MDS|CMML								4	65	---	---	---	---	PASS
PLAC4	191585	broad.mit.edu	37	21	42550961	42550961	+	3'UTR	SNP	G	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42550961G>T	uc002yyz.2	-	1					BACE2_uc002yyw.2_Intron|BACE2_uc002yyx.2_Intron|BACE2_uc002yyy.2_Intron	NM_182832	NP_878252	Q8WY50	PLAC4_HUMAN	placenta-specific 4												0		Prostate(19;2.29e-06)				gggaaagcgtgtcccaggctg	0.000													24	65	---	---	---	---	PASS
MAGED2	10916	broad.mit.edu	37	X	54839919	54839919	+	Splice_Site	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54839919A>G	uc004dtk.1	+	10	1303	c.1209_splice	c.e10-2	p.G403_splice	MAGED2_uc004dtl.1_Splice_Site_p.G403_splice|MAGED2_uc004dtm.1_Splice_Site_p.G318_splice|MAGED2_uc010nkc.1_Intron|MAGED2_uc004dtn.1_Splice_Site_p.G403_splice|MAGED2_uc004dto.1_Splice_Site_p.G377_splice|SNORA11_uc004dtp.1_5'Flank	NM_177433	NP_803182	Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2											ovary(2)|breast(1)	3						TTCTTCTCTCAGGATACATCA	0.408													83	274	---	---	---	---	PASS
ZCCHC13	389874	broad.mit.edu	37	X	73524500	73524500	+	Silent	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73524500C>T	uc004ebs.3	+	1	476	c.399C>T	c.(397-399)TGC>TGT	p.C133C		NM_203303	NP_976048	Q8WW36	ZCH13_HUMAN	zinc finger, CCHC domain containing 13	133	CCHC-type 6.						nucleic acid binding|zinc ion binding				0						GTTACCGATGCGGCGAGATTG	0.552													6	36	---	---	---	---	PASS
TAF7L	54457	broad.mit.edu	37	X	100524198	100524198	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100524198G>A	uc004ehb.2	-	13	1384	c.1372C>T	c.(1372-1374)CGT>TGT	p.R458C	TAF7L_uc004eha.2_Missense_Mutation_p.R298C	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	458	Potential.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						TTCAGAAAACGCTGCAACTGT	0.438													64	205	---	---	---	---	PASS
GPC4	2239	broad.mit.edu	37	X	132445345	132445345	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132445345A>G	uc004exc.1	-	4	1030	c.818T>C	c.(817-819)ATC>ACC	p.I273T	GPC4_uc011mvg.1_Missense_Mutation_p.I203T	NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4 precursor	273					anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)					GCCTCTCATGATGTTTGAGCA	0.483													6	248	---	---	---	---	PASS
GPC3	2719	broad.mit.edu	37	X	132670036	132670036	+	3'UTR	SNP	A	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132670036A>G	uc004exe.1	-	8					GPC3_uc004exd.1_3'UTR|GPC3_uc010nrn.1_3'UTR|GPC3_uc011mvh.1_3'UTR|GPC3_uc010nro.1_3'UTR	NM_004484	NP_004475	P51654	GPC3_HUMAN	glypican 3 isoform 2 precursor							extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					TCATGGCTGGAGGAGGTATAC	0.378			T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				4	6	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135957176	135957176	+	Intron	SNP	C	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135957176C>T	uc004fae.1	-						RBMX_uc004fac.1_5'Flank|RBMX_uc011mwf.1_Intron|RBMX_uc004fad.1_3'UTR|RBMX_uc011mwg.1_Intron|RBMX_uc004faf.1_Intron|RBMX_uc010nsf.1_Intron|RBMX_uc004fag.1_Intron	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1							catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					ACCACACAGCCTAATAAACTG	0.398													7	284	---	---	---	---	PASS
AVPR2	554	broad.mit.edu	37	X	153171715	153171715	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153171715G>A	uc004fjh.3	+	2	826	c.755G>A	c.(754-756)CGG>CAG	p.R252Q	AVPR2_uc004fjg.3_Missense_Mutation_p.R41Q|AVPR2_uc004fji.2_Missense_Mutation_p.R252Q	NM_000054	NP_000045	P30518	V2R_HUMAN	arginine vasopressin receptor 2 isoform 1	252	Cytoplasmic (Potential).		R -> W.		activation of adenylate cyclase activity|excretion|G-protein signaling, coupled to cAMP nucleotide second messenger|hemostasis|positive regulation of gene expression|transmembrane transport|water transport	endoplasmic reticulum|endosome|Golgi apparatus|integral to plasma membrane	vasopressin receptor activity			breast(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Terlipressin(DB02638)|Vasopressin(DB00067)	AGGGGACGCCGGACAGGCAGC	0.652													9	38	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	4608484	4608484	+	IGR	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4608484delC								LOC284661 (123740 upstream) : AJAP1 (106621 downstream)																							TTCTCTGAATCCCGAATCCTT	0.468													4	2	---	---	---	---	
SRRM1	10250	broad.mit.edu	37	1	24999031	24999032	+	3'UTR	INS	-	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24999031_24999032insA	uc001bjm.2	+	17					SRRM1_uc010oel.1_3'UTR	NM_005839	NP_005830	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ATTCCCTTTTTAAAAAAGGGGG	0.292													4	2	---	---	---	---	
WDTC1	23038	broad.mit.edu	37	1	27561886	27561889	+	Intron	DEL	TGTG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27561886_27561889delTGTG	uc009vst.2	+						WDTC1_uc001bno.2_Intron	NM_015023	NP_055838	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1								protein binding			ovary(1)|central_nervous_system(1)	2		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		tctctctttctgtgtgtgtgtgtg	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	54585646	54585647	+	IGR	DEL	CA	-	-	rs144248471		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54585646_54585647delCA								C1orf83 (7454 upstream) : CDCP2 (19021 downstream)																							TCACAAGCACCACACAcaccac	0.040													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68355633	68355633	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68355633delG	uc001deb.1	+						uc001dec.1_Intron					Homo sapiens cDNA FLJ38762 fis, clone KIDNE2013801.																		ttgtactagtggggtgccaga	0.000													4	2	---	---	---	---	
AHCYL1	10768	broad.mit.edu	37	1	110563154	110563154	+	Intron	DEL	C	-	-	rs17668509		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110563154delC	uc001dyx.2	+						AHCYL1_uc010ovw.1_Intron|AHCYL1_uc001dyy.2_Intron|AHCYL1_uc010ovx.1_Intron	NM_006621	NP_006612	O43865	SAHH2_HUMAN	S-adenosylhomocysteine hydrolase-like 1						one-carbon metabolic process	endoplasmic reticulum	adenosylhomocysteinase activity			ovary(1)	1		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		TGTACATGTGCTGAGAGAAGC	0.443													6	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145109259	145109260	+	Intron	INS	-	A	A	rs150048477	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109259_145109260insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						cactccagcccgggggcagagc	0.059													7	4	---	---	---	---	
SV2A	9900	broad.mit.edu	37	1	149883036	149883036	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149883036delG	uc001etg.2	-						SV2A_uc001eth.2_Intron	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2						neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GGGTAACTCTGGGTCCACAGG	0.577													4	2	---	---	---	---	
RPRD2	23248	broad.mit.edu	37	1	150389722	150389722	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150389722delT	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1						TTACTGGGTCTTTTTTTTTAG	0.343													4	2	---	---	---	---	
SCAMP3	10067	broad.mit.edu	37	1	155227642	155227643	+	Intron	INS	-	T	T	rs66475438		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155227642_155227643insT	uc001fjs.2	-						RAG1AP1_uc010pey.1_Intron|FAM189B_uc001fjm.2_5'Flank|FAM189B_uc001fjn.2_5'Flank|FAM189B_uc001fjo.2_5'Flank|FAM189B_uc001fjp.2_5'Flank|FAM189B_uc001fjq.1_5'Flank|SCAMP3_uc001fjr.2_Intron|SCAMP3_uc001fju.2_Intron|SCAMP3_uc001fjv.2_Intron|SCAMP3_uc001fjt.2_Intron	NM_005698	NP_005689	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3 isoform 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane				ovary(3)	3	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TTGCAAAGACAttttttttttt	0.233													4	2	---	---	---	---	
MGST3	4259	broad.mit.edu	37	1	165623279	165623281	+	Intron	DEL	AGG	-	-	rs140199766		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165623279_165623281delAGG	uc001gdf.2	+						MGST3_uc001gdg.2_Intron	NM_004528	NP_004519	O14880	MGST3_HUMAN	microsomal glutathione S-transferase 3						leukotriene biosynthetic process|leukotriene production involved in inflammatory response|signal transduction|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glutathione peroxidase activity|glutathione transferase activity				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Glutathione(DB00143)	CCACCTGTCTAGGAGAAGGCCAA	0.488													6	13	---	---	---	---	
DDX59	83479	broad.mit.edu	37	1	200624485	200624486	+	Intron	DEL	GT	-	-	rs12136672	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200624485_200624486delGT	uc009wzk.2	-						DDX59_uc010ppl.1_Intron	NM_001031725	NP_001026895	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59							intracellular	ATP binding|ATP-dependent helicase activity|metal ion binding|RNA binding			ovary(2)|breast(1)|central_nervous_system(1)	4						TGCCTCCACCGTGTGACCCCTT	0.505													4	2	---	---	---	---	
RABIF	5877	broad.mit.edu	37	1	202850536	202850536	+	Intron	DEL	T	-	-	rs111992348		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202850536delT	uc001gyl.2	-							NM_002871	NP_002862	P47224	MSS4_HUMAN	RAB-interacting factor						cellular membrane fusion|protein transport|small GTPase mediated signal transduction		guanyl-nucleotide exchange factor activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCCCTGAttcttttttttttg	0.244													5	3	---	---	---	---	
IKBKE	9641	broad.mit.edu	37	1	206644743	206644743	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206644743delG	uc001hdz.1	+						IKBKE_uc009xbu.1_Intron|IKBKE_uc009xbv.1_Intron|IKBKE_uc001hea.1_Intron	NM_014002	NP_054721	Q14164	IKKE_HUMAN	IKK-related kinase epsilon						DNA damage response, signal transduction resulting in induction of apoptosis|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane|PML body	ATP binding|IkappaB kinase activity|NF-kappaB-inducing kinase activity|protein binding			ovary(3)|lung(3)|central_nervous_system(1)|skin(1)	8	Breast(84;0.137)					TTGGGGTGGTGGGGGGAGGAT	0.607													4	2	---	---	---	---	
SMYD2	56950	broad.mit.edu	37	1	214498425	214498425	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214498425delC	uc010ptx.1	+						SMYD2_uc009xdj.2_Intron|SMYD2_uc010ptw.1_Intron|SMYD2_uc009xdl.1_Intron	NM_020197	NP_064582	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2						negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		CAAGAATTGGCCACAAGCTTG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223260519	223260519	+	IGR	DEL	T	-	-	rs78885551		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223260519delT								DISP1 (81184 upstream) : TLR5 (23065 downstream)																							TTTCTGTTTCTTTTTTTTTTT	0.398													6	5	---	---	---	---	
CAPN2	824	broad.mit.edu	37	1	223944250	223944250	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223944250delC	uc001hob.3	+						CAPN2_uc010puy.1_Intron|CAPN2_uc001hoc.2_5'Flank	NM_001748	NP_001739	P17655	CAN2_HUMAN	calpain 2 isoform 1						proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)		atcagagcttccaccctctcc	0.184													4	2	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247063196	247063197	+	Intron	DEL	AT	-	-	rs148637144		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247063196_247063197delAT	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron|AHCTF1_uc009xgs.1_5'Flank	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTTATAAAACATATAAATACTA	0.233													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	3144294	3144296	+	IGR	DEL	CTC	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3144294_3144296delCTC								MYT1L (809249 upstream) : TSSC1 (48445 downstream)																							AAGCTGCAGTCTCCAGGCCATGG	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7818985	7818985	+	IGR	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7818985delG								RNF144A (634678 upstream) : LOC339788 (243573 downstream)																							gctaagaccagggatgccaca	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	21199700	21199700	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21199700delT								C2orf43 (176873 upstream) : APOB (24602 downstream)																							GTTGCTGTTGTTTTTTTTTTT	0.284													4	2	---	---	---	---	
LOC375190	375190	broad.mit.edu	37	2	24326739	24326740	+	Intron	DEL	GA	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24326739_24326740delGA	uc002rew.2	+											SubName: Full=Putative uncharacterized protein C2orf84;												0						CATGGGGGCTGAACCCCAAAAT	0.416													4	2	---	---	---	---	
LOC375190	375190	broad.mit.edu	37	2	24389578	24389578	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24389578delG	uc010ykl.1	+						LOC375190_uc002rew.2_Intron|LOC375190_uc002rfb.2_Intron	NM_001145710	NP_001139182			hypothetical protein LOC375190												0						tagagggggtggggtgggaga	0.000													4	2	---	---	---	---	
XDH	7498	broad.mit.edu	37	2	31600307	31600308	+	Intron	INS	-	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31600307_31600308insA	uc002rnv.1	-							NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	CCCAGAAGCTGAAAAAAAAAAC	0.460													8	4	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39085574	39085575	+	Intron	DEL	TG	-	-	rs144247886		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39085574_39085575delTG	uc002rrf.2	-						DHX57_uc002rre.2_Intron|DHX57_uc002rrg.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				CACATGACTCTGAGACTATTTG	0.327													7	4	---	---	---	---	
VRK2	7444	broad.mit.edu	37	2	58362577	58362577	+	Intron	DEL	T	-	-	rs72516644		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58362577delT	uc002rzo.2	+						VRK2_uc010fcb.2_Intron|VRK2_uc002rzs.2_Intron|VRK2_uc002rzr.2_Intron|VRK2_uc010fcc.2_Intron|VRK2_uc002rzv.2_Intron|VRK2_uc010fcd.2_Intron|VRK2_uc002rzp.2_Intron|VRK2_uc010ypg.1_Intron|VRK2_uc002rzq.2_Intron|VRK2_uc002rzu.2_Intron|VRK2_uc002rzt.2_Intron	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2							integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TGCTTAGTGCTTTTTTTTTTT	0.313													5	3	---	---	---	---	
SFXN5	94097	broad.mit.edu	37	2	73169495	73169495	+	3'UTR	DEL	T	-	-	rs58199643		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73169495delT	uc002siq.2	-	14					SFXN5_uc002sio.2_3'UTR|SFXN5_uc010yrc.1_3'UTR|SFXN5_uc002sip.2_RNA|SFXN5_uc010fet.2_3'UTR|SFXN5_uc010fer.2_RNA|SFXN5_uc010feq.2_3'UTR|SFXN5_uc010fes.2_3'UTR	NM_144579	NP_653180	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis	integral to membrane	cation transmembrane transporter activity			ovary(1)	1						CACACTGCTGTCTGGGAATGG	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	83822401	83822401	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83822401delT								None (None upstream) : FUNDC2P2 (695405 downstream)																							GCAATAAATGTTTTTTTAAAT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	101005631	101005631	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101005631delA								LONRF2 (66436 upstream) : CHST10 (2692 downstream)																							AATGAAGGGCAATGAACCAAA	0.393													4	2	---	---	---	---	
TGFBRAP1	9392	broad.mit.edu	37	2	105883625	105883652	+	3'UTR	DEL	TTCCATGTACATTCATAGAGCCTGGTCA	-	-	rs11273216		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105883625_105883652delTTCCATGTACATTCATAGAGCCTGGTCA	uc002tcq.2	-	12					TGFBRAP1_uc010fjc.2_3'UTR|TGFBRAP1_uc002tcr.3_3'UTR|uc002tcp.2_5'Flank	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor						regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						TTTAGGGGTTTTCCATGTACATTCATAGAGCCTGGTCATTCCATGTAC	0.465													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106082283	106082284	+	IGR	INS	-	G	G	rs142735654	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106082283_106082284insG								FHL2 (27053 upstream) : NCK2 (279070 downstream)																							aaaaaaaaaaagaactggtggg	0.079													17	13	---	---	---	---	
TMEM163	81615	broad.mit.edu	37	2	135246648	135246648	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135246648delT	uc002ttx.2	-						TMEM163_uc002tty.2_Intron	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		aaaatccatgtttaccctaga	0.000													4	2	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152474242	152474242	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152474242delT	uc010fnx.2	-							NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCACACAGTATTTTTTTTTTT	0.199													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177885790	177885790	+	IGR	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177885790delG								MIR1246 (420010 upstream) : HNRNPA3 (191632 downstream)																							TCCGTTTGCTGGTCTTCAATC	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	191506275	191506276	+	IGR	DEL	AA	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191506275_191506276delAA								TMEM194B (106807 upstream) : NAB1 (7572 downstream)																							GGAGAAGGGTAAAGCCAAAGCT	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	192499273	192499274	+	IGR	DEL	TG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192499273_192499274delTG								MYO1B (209158 upstream) : OBFC2A (43524 downstream)																							GGGTCAGGGTtgtgtgtgtgtg	0.287													6	3	---	---	---	---	
LOC200726	200726	broad.mit.edu	37	2	207504556	207504556	+	5'Flank	DEL	G	-	-	rs143720305		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207504556delG	uc010fuh.1	+							NM_001102659	NP_001096129			hypothetical protein LOC200726												0				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.115)|Lung(261;0.133)		ttgttccaaagccatcagact	0.005													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221182464	221182465	+	IGR	DEL	TA	-	-	rs1454563	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221182464_221182465delTA								SLC4A3 (675763 upstream) : None (None downstream)																							ttctcaagactattgctctgta	0.000													4	2	---	---	---	---	
SP100	6672	broad.mit.edu	37	2	231358824	231358826	+	Intron	DEL	CTG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231358824_231358826delCTG	uc002vqt.2	+						SP100_uc002vqs.2_Intron|SP100_uc002vqu.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGGTACTCTTCTGCTGCTGCTGT	0.291													6	3	---	---	---	---	
NDUFA10	4705	broad.mit.edu	37	2	240920844	240920845	+	Intron	INS	-	AA	AA	rs138812666	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240920844_240920845insAA	uc002vyn.2	-							NM_004544	NP_004535	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transport	mitochondrial matrix|mitochondrial respiratory chain complex I	ATP binding|NADH dehydrogenase (ubiquinone) activity|phosphotransferase activity, alcohol group as acceptor			central_nervous_system(1)	1		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)	NADH(DB00157)	aatgtctacagagagaagcaat	0.045													0	6	---	---	---	---	
TPRXL	348825	broad.mit.edu	37	3	13997381	13997381	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13997381delT	uc011avd.1	+							NR_002223				RecName: Full=Putative protein TPRXL;												0						TGATCTGTACTTTTTTTTTTA	0.035													3	3	---	---	---	---	
SLC6A6	6533	broad.mit.edu	37	3	14474145	14474145	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14474145delG	uc010heg.2	+						SLC6A6_uc010hee.1_Intron|SLC6A6_uc003byp.2_Intron|SLC6A6_uc010hef.1_Intron|SLC6A6_uc003byq.2_Intron|SLC6A6_uc003byr.2_Intron	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter						cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						CATAGCAACAGGAAAACAACC	0.577													4	2	---	---	---	---	
SLC6A6	6533	broad.mit.edu	37	3	14486951	14486954	+	Intron	DEL	AAAG	-	-	rs66645026		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14486951_14486954delAAAG	uc010heg.2	+						SLC6A6_uc003byp.2_Intron|SLC6A6_uc010hef.1_Intron|SLC6A6_uc003byq.2_Intron|SLC6A6_uc003byr.2_Intron	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter						cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						aaaaagaaaaaaagaaagaaagaa	0.201													2	4	---	---	---	---	
ZNF445	353274	broad.mit.edu	37	3	44506847	44506847	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44506847delA	uc003cnf.2	-						ZNF445_uc011azw.1_Intron	NM_181489	NP_852466	P59923	ZN445_HUMAN	zinc finger protein 445						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		aagggtttgtaaagggttgat	0.000													4	2	---	---	---	---	
CACNA1D	776	broad.mit.edu	37	3	53621068	53621068	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53621068delC	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	AACCGTGGGGCCCCATCTCAG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	101654450	101654451	+	IGR	DEL	TG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101654450_101654451delTG								NFKBIZ (74585 upstream) : LOC152225 (5252 downstream)																							TTTTGTGCTATGTGTGTGTGCT	0.386													4	2	---	---	---	---	
FAIM	55179	broad.mit.edu	37	3	138340624	138340624	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138340624delT	uc003esr.2	+						FAIM_uc003eso.1_Intron|FAIM_uc003esp.2_Intron|FAIM_uc003esq.2_Intron|FAIM_uc003ess.2_Intron	NM_001033032	NP_001028204	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule isoform c						apoptosis	cytoplasm					0						AAATTACATCttttttttttc	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	139021293	139021294	+	IGR	DEL	CT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139021293_139021294delCT								PISRT1 (68929 upstream) : MRPS22 (41504 downstream)																							GCATCGCGTGCTCTCTCTCTGG	0.520													7	4	---	---	---	---	
PPM1L	151742	broad.mit.edu	37	3	160514797	160514798	+	Intron	DEL	GT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160514797_160514798delGT	uc003fdr.2	+							NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			ccaagtacaggtacaccttgtt	0.000													4	2	---	---	---	---	
EIF4G1	1981	broad.mit.edu	37	3	184043926	184043927	+	Intron	DEL	AC	-	-	rs112208190		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184043926_184043927delAC	uc003fnp.2	+						EIF4G1_uc003fnt.2_Intron|EIF4G1_uc003fnq.2_Intron|EIF4G1_uc003fnr.2_Intron|EIF4G1_uc010hxx.2_Intron|EIF4G1_uc003fns.2_Intron|EIF4G1_uc010hxy.2_Intron|EIF4G1_uc003fnv.3_Intron|EIF4G1_uc003fnu.3_Intron|EIF4G1_uc003fnw.2_Intron|EIF4G1_uc003fnx.2_Intron|EIF4G1_uc003fny.3_Intron|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4						insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGTTTGGCAAacacacacacac	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184356322	184356323	+	IGR	INS	-	TG	TG	rs150785619	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184356322_184356323insTG								EPHB3 (56127 upstream) : MAGEF1 (71833 downstream)																							CAGCAGATGGATGATCATGGGG	0.559													4	8	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194989782	194989782	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194989782delG	uc003fum.3	-							NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		ccccaacagtgggaatgacaa	0.264													4	2	---	---	---	---	
ZDHHC19	131540	broad.mit.edu	37	3	195937315	195937316	+	Intron	INS	-	A	A	rs59406858		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195937315_195937316insA	uc003fwc.2	-						ZDHHC19_uc010hzz.2_Intron|ZDHHC19_uc010iaa.2_Intron|ZDHHC19_uc010iab.2_Intron	NM_001039617	NP_001034706	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC domain containing 19							integral to membrane	acyltransferase activity|zinc ion binding			ovary(3)	3	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		gagaaagaaagaaagaaaagag	0.233													6	3	---	---	---	---	
EVC	2121	broad.mit.edu	37	4	5806798	5806798	+	Intron	DEL	C	-	-	rs3214939		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5806798delC	uc003gil.1	+						EVC_uc003gim.1_Intron|CRMP1_uc003gin.1_Intron	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein						muscle organ development	integral to membrane				ovary(1)|skin(1)	2		Myeloproliferative disorder(84;0.117)				CAGCTTCATTCCCAGGTTTAA	0.478													7	9	---	---	---	---	
SEL1L3	23231	broad.mit.edu	37	4	25820785	25820785	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25820785delC	uc003gru.3	-							NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3							integral to membrane	binding				0						AGTGCTAGATCCAAGCTGGAA	0.428													4	2	---	---	---	---	
NDST3	9348	broad.mit.edu	37	4	119153838	119153839	+	Intron	INS	-	GAAA	GAAA			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119153838_119153839insGAAA	uc003ibx.2	+						NDST3_uc011cgf.1_Intron	NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						gaaaagaaaaggaaagaaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	144230717	144230717	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144230717delA								USP38 (87577 upstream) : GAB1 (27266 downstream)																							tgactagcctaaaaaaaaaaa	0.060													4	2	---	---	---	---	
NEK1	4750	broad.mit.edu	37	4	170498470	170498470	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170498470delA	uc003isb.1	-						NEK1_uc003isc.1_Intron|NEK1_uc003isd.1_Intron|NEK1_uc003ise.1_Intron|NEK1_uc003isf.1_Intron|NEK1_uc003isg.1_Intron	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1						cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		ttttaatattaaaaaaaaaaa	0.174													6	4	---	---	---	---	
SORBS2	8470	broad.mit.edu	37	4	186737415	186737417	+	Intron	DEL	TCT	-	-	rs147099099		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186737415_186737417delTCT	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TCTAGTCACATCTTCTGCTGCAG	0.414													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190551611	190551612	+	IGR	INS	-	A	A	rs143984269		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190551611_190551612insA								None (None upstream) : FRG1 (310362 downstream)																							GAAAATGACAGAAAAAAATAGA	0.376													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1936596	1936597	+	IGR	DEL	CT	-	-	rs72067813		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1936596_1936597delCT								IRX4 (53716 upstream) : IRX2 (809684 downstream)																							TCCATTCCAACTCTCTCCCCAC	0.495													3	3	---	---	---	---	
ADCY2	108	broad.mit.edu	37	5	7654098	7654100	+	Intron	DEL	AGA	-	-	rs111644211		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7654098_7654100delAGA	uc003jdz.1	+						ADCY2_uc011cmo.1_5'UTR	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						agagctgttgagaagaccagtgg	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	19057927	19057927	+	IGR	DEL	C	-	-	rs66799527		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19057927delC								None (None upstream) : CDH18 (415230 downstream)																							CTCAGGCATACACTCAGCCAA	0.408													2	4	---	---	---	---	
RPL37	6167	broad.mit.edu	37	5	40832934	40832934	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40832934delG	uc003jme.1	-						SNORD72_uc003jmf.1_5'Flank	NM_000997	NP_000988	P61927	RL37_HUMAN	ribosomal protein L37						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	metal ion binding|protein binding|rRNA binding|structural constituent of ribosome				0		Breast(839;0.238)				ACTAGTCATTGGGCCAGTATG	0.358													4	2	---	---	---	---	
NNT	23530	broad.mit.edu	37	5	43612715	43612715	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43612715delT	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	TCTAAACCCATTTTTTTTTCT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	49953345	49953346	+	IGR	INS	-	AT	AT	rs60800704	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49953345_49953346insAT								EMB (216111 upstream) : PARP8 (8387 downstream)																							ACCTTTCCCACGTGCTTCTCAA	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	49953346	49953347	+	IGR	INS	-	C	C	rs60800704	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49953346_49953347insC								EMB (216112 upstream) : PARP8 (8386 downstream)																							CCTTTCCCACGTGCTTCTCAAC	0.252													4	2	---	---	---	---	
PARP8	79668	broad.mit.edu	37	5	50090386	50090387	+	Intron	DEL	AT	-	-	rs33958370		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50090386_50090387delAT	uc003jon.3	+						PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_Intron|PARP8_uc003jop.2_Intron	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				CTAAAATTACATTCTTTGCTTT	0.272													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	67778627	67778650	+	IGR	DEL	GAGAAGCTCCTGAGGGAAGGTTTT	-	-	rs113800378	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67778627_67778650delGAGAAGCTCCTGAGGGAAGGTTTT								PIK3R1 (180980 upstream) : SLC30A5 (611168 downstream)																							AGAGAGCAGGGAGAAGCTCCTGAGGGAAGGTTTTGAGGTGAAGA	0.469													6	3	---	---	---	---	
LOC100170939	100170939	broad.mit.edu	37	5	69515692	69515693	+	Intron	INS	-	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:69515692_69515693insT	uc003jyp.1	-						GUSBP3_uc003jxm.2_Intron|uc011crh.1_Intron|uc011crl.1_Intron|LOC100170939_uc010ixu.2_Intron|LOC100170939_uc003jyl.2_Intron|LOC100170939_uc003jyo.1_Intron|uc003jyr.1_Intron|LOC100170939_uc003jys.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000370107;												0						GGGGAGGCAAGTGGCATCTCTG	0.446													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	76095940	76095940	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76095940delA								F2R (64346 upstream) : F2RL1 (18893 downstream)																							AGGACCCTAGAAGCAGTGAGA	0.413													4	2	---	---	---	---	
ZBED3	84327	broad.mit.edu	37	5	76373057	76373058	+	In_Frame_Ins	INS	-	GCG	GCG			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76373057_76373058insGCG	uc003kev.1	-	3	893_894	c.646_647insCGC	c.(646-648)CTC>CCGCTC	p.215_216insP		NM_032367	NP_115743	Q96IU2	ZBED3_HUMAN	zinc finger, BED-type containing 3	215_216							DNA binding|metal ion binding				0		all_lung(232;0.00645)|Lung NSC(167;0.0135)|Ovarian(174;0.0798)|Prostate(461;0.121)		OV - Ovarian serous cystadenocarcinoma(54;2.24e-51)|Epithelial(54;9.06e-46)|all cancers(79;2.48e-41)		GTCGTCCTTGAGCGGCGGCGGC	0.733													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105920282	105920283	+	IGR	DEL	TG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105920282_105920283delTG								None (None upstream) : EFNA5 (792308 downstream)																							CCGGTGTGTCTGTGTGTGTGTG	0.272													4	2	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142361666	142361666	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142361666delA	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCTGTGACCAAATGTTTAGC	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	147302991	147302992	+	IGR	INS	-	T	T	rs111762473		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147302991_147302992insT								C5orf46 (16890 upstream) : SPINK5 (140543 downstream)																							CCAAGAGAATATTTTTTTTTAC	0.436													4	2	---	---	---	---	
C5orf4	10826	broad.mit.edu	37	5	154210994	154210994	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154210994delT	uc003lvs.3	-						C5orf4_uc011dde.1_Intron	NM_032385	NP_115761	Q96IV6	CE004_HUMAN	hypothetical protein LOC10826						fatty acid biosynthetic process	integral to membrane	iron ion binding|oxidoreductase activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTCATCGTTGTTTtttttttg	0.219													6	3	---	---	---	---	
NEURL1B	54492	broad.mit.edu	37	5	172096548	172096549	+	Intron	DEL	CA	-	-	rs34669588		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172096548_172096549delCA	uc003mbt.2	+							NM_001142651	NP_001136123	A8MQ27	NEU1B_HUMAN	neuralized homolog 1B								ligase activity|zinc ion binding				0						AGTGCTTCACCACACACACTAA	0.545													21	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7506850	7506850	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7506850delA								RIOK1 (88582 upstream) : DSP (35020 downstream)																							AATTGTACTTAAAAAAAAAAA	0.214													4	2	---	---	---	---	
ALDH5A1	7915	broad.mit.edu	37	6	24532047	24532047	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24532047delT	uc003neg.2	+						ALDH5A1_uc003nef.2_Intron	NM_001080	NP_001071	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5A1 isoform 2 precursor						acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)	ATAGTAATCCTTTTTTTTTAA	0.368													4	2	---	---	---	---	
FAM65B	9750	broad.mit.edu	37	6	24875813	24875814	+	Intron	INS	-	G	G	rs2255337	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24875813_24875814insG	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron|FAM65B_uc003nep.2_Intron|FAM65B_uc011djt.1_Intron	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						GGGGAGGAGGCCGGGGGGCGGT	0.441													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27293740	27293740	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27293740delA								FKSG83 (1 upstream) : ZNF204P (31862 downstream)																							accctgtctgaaaaaaaaaaa	0.080													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27293758	27293762	+	IGR	DEL	AAAAG	-	-	rs71725579		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27293758_27293762delAAAAG								FKSG83 (19 upstream) : ZNF204P (31840 downstream)																							aaagaaaagaaaaagaaaagaaaag	0.083													7	4	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32516494	32516494	+	Intron	DEL	G	-	-	rs112351560		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32516494delG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						aaacctctttgctttatgaat	0.050													5	3	---	---	---	---	
FKBP5	2289	broad.mit.edu	37	6	35694797	35694797	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35694797delA	uc003oky.2	-						LOC285847_uc010jvy.1_RNA	NM_001145775	NP_001139247	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						cgttcagaggagacaggaatc	0.000													4	2	---	---	---	---	
CNPY3	10695	broad.mit.edu	37	6	42905321	42905321	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42905321delA	uc003ota.3	+						CNPY3_uc003osy.2_Intron|CNPY3_uc003osz.2_Intron|CNPY3_uc003otc.3_Intron|CNPY3_uc003otb.3_Intron	NM_006586	NP_006577	Q9BT09	CNPY3_HUMAN	trinucleotide repeat containing 5 precursor						innate immune response	endoplasmic reticulum				ovary(1)	1	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			actccttctcaaaaaaaaaaG	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57050510	57050510	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57050510delT								BAG2 (500 upstream) : RAB23 (3081 downstream)																							TGTGAGATGATTTTTTGTGTG	0.343													4	2	---	---	---	---	
COX7A2	1347	broad.mit.edu	37	6	75949818	75949818	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75949818delA	uc003phv.1	-							NM_001865	NP_001856	P14406	CX7A2_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2							mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0						actccatttcaaaaaaaaaag	0.109													6	4	---	---	---	---	
DOPEY1	23033	broad.mit.edu	37	6	83857317	83857317	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83857317delA	uc003pjs.1	+						DOPEY1_uc011dyy.1_Intron|DOPEY1_uc010kbl.1_Intron|DOPEY1_uc003pjt.2_Intron	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1						protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		GAATGATTACATGAAATATCT	0.318													4	2	---	---	---	---	
C6orf167	253714	broad.mit.edu	37	6	97711585	97711585	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97711585delT	uc003ppb.2	-						C6orf167_uc011eaf.1_Intron|C6orf167_uc010kcn.1_Intron|C6orf167_uc010kco.1_Intron|C6orf167_uc003ppc.2_Intron	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714						double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		AAACtttctcttttttttttc	0.124													6	3	---	---	---	---	
PPIL6	285755	broad.mit.edu	37	6	109741855	109741855	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109741855delC	uc003ptg.3	-						PPIL6_uc010kdo.2_Intron|PPIL6_uc010kdp.2_Intron	NM_173672	NP_775943	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase-like 6 isoform 1						protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)		CCCCCATCCTCCCCATCAGTA	0.403													4	2	---	---	---	---	
TRAF3IP2	10758	broad.mit.edu	37	6	111880376	111880376	+	3'UTR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111880376delT	uc011ebc.1	-	10					TRAF3IP2_uc011ebb.1_3'UTR|TRAF3IP2_uc003pvd.2_3'UTR|TRAF3IP2_uc003pvg.2_3'UTR|TRAF3IP2_uc003pvf.2_3'UTR	NM_147686	NP_679211	O43734	CIKS_HUMAN	TRAF3 interacting protein 2 isoform 2						intracellular signal transduction|positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular				ovary(2)|central_nervous_system(1)	3		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		CCTGCAATGGTTTTTTTAAAA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	120024195	120024196	+	IGR	INS	-	A	A	rs148877154	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120024195_120024196insA								MAN1A1 (353269 upstream) : None (None downstream)																							attatataaacaattgaacatt	0.054													4	6	---	---	---	---	
PTPRK	5796	broad.mit.edu	37	6	128718505	128718505	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128718505delT	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron|PTPRK_uc003qbl.1_Intron|PTPRK_uc011ebv.1_Intron|PTPRK_uc003qbm.3_Intron	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AATACTTATCTTTTTTTTTTC	0.229													4	2	---	---	---	---	
KIAA1244	57221	broad.mit.edu	37	6	138606890	138606891	+	Intron	INS	-	G	G			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138606890_138606891insG	uc003qhu.2	+							NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine						regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GAAGAATAAATACTCCAAAGTG	0.248													12	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153678437	153678438	+	IGR	DEL	AT	-	-	rs138745391		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153678437_153678438delAT								RGS17 (226048 upstream) : OPRM1 (653198 downstream)																							cgtttgacacatgttttgacac	0.000													7	4	---	---	---	---	
COX19	90639	broad.mit.edu	37	7	1008554	1008554	+	3'UTR	DEL	T	-	-	rs72201515		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1008554delT	uc003sjp.1	-	3					ADAP1_uc010ksc.2_Intron	NM_001031617	NP_001026788	Q49B96	COX19_HUMAN	COX19 cytochrome c oxidase assembly homolog							cytosol					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;2.15e-15)		TGTGTTCCACTTTTTTTTTTT	0.363													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1216294	1216294	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1216294delT								ZFAND2A (16439 upstream) : UNCX (56360 downstream)																							agtaatattcttgttggctgt	0.000											OREG0017822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
C7orf28A	51622	broad.mit.edu	37	7	5959838	5959839	+	Intron	INS	-	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5959838_5959839insA	uc003spf.2	+							NM_015622	NP_056437	P86791	CCZ1_HUMAN	hypothetical protein LOC51622							lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)		CTCAGCTCCCCCCGAATGGAAC	0.564													6	4	---	---	---	---	
PMS2	5395	broad.mit.edu	37	7	6037603	6037603	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6037603delT	uc003spl.2	-						PMS2_uc003spj.2_Intron|PMS2_uc003spk.2_Intron|PMS2_uc011jwl.1_Intron|PMS2_uc010ktg.2_Intron|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Intron	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform						mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		ATAACTTATATTTTTTTCAGA	0.318			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				4	2	---	---	---	---	
HOXA11AS	221883	broad.mit.edu	37	7	27228484	27228484	+	RNA	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27228484delA	uc003syz.1	+	2		c.1121delA				NR_002795				Homo sapiens homeo box A11, antisense, mRNA (cDNA clone IMAGE:4865533), containing frame-shift errors.												0						GCAAGAGGCCAAAAAATGTTT	0.552													4	2	---	---	---	---	
AQP1	358	broad.mit.edu	37	7	30957966	30957966	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30957966delA	uc003tbv.1	+						AQP1_uc011kac.1_Intron|AQP1_uc010kwf.1_5'Flank	NM_198098	NP_932766	P29972	AQP1_HUMAN	aquaporin 1						ammonium transport|cell volume homeostasis|cellular hyperosmotic response|cellular response to cAMP|cellular response to copper ion|cellular response to dexamethasone stimulus|cellular response to hydrogen peroxide|cellular response to hypoxia|cellular response to mechanical stimulus|cellular response to mercury ion|cellular response to nitric oxide|cellular response to retinoic acid|cellular response to salt stress|cellular response to UV|cerebrospinal fluid secretion|cGMP biosynthetic process|establishment or maintenance of actin cytoskeleton polarity|lateral ventricle development|maintenance of symbiont-containing vacuole via substance secreted by host|negative regulation of apoptosis|odontogenesis|pancreatic juice secretion|positive regulation of angiogenesis|positive regulation of fibroblast proliferation|positive regulation of saliva secretion|renal water transport|response to drug|transepithelial water transport	apical plasma membrane|basal plasma membrane|brush border membrane|cytoplasm|integral to plasma membrane|nuclear membrane|sarcolemma|symbiont-containing vacuole	ammonia transmembrane transporter activity|carbon dioxide transmembrane transporter activity|glycerol transmembrane transporter activity|intracellular cGMP activated cation channel activity|nitric oxide transmembrane transporter activity|potassium channel activity|potassium ion transmembrane transporter activity|protein binding|water channel activity				0		Melanoma(862;0.16)			Acetazolamide(DB00819)	ACAATCTAACAAAAAAGAGAA	0.289													4	2	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	32537249	32537250	+	Intron	INS	-	TGTTGAC	TGTTGAC	rs141812812	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32537249_32537250insTGTTGAC	uc003tcv.1	+						AVL9_uc011kai.1_Intron|LSM5_uc011kag.1_5'Flank|LSM5_uc011kah.1_5'Flank	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						GCCGTGGGTCATGTTGACCATT	0.248													7	5	---	---	---	---	
GCK	2645	broad.mit.edu	37	7	44190143	44190144	+	Intron	DEL	TG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44190143_44190144delTG	uc003tkl.2	-						GCK_uc003tkj.1_Intron|GCK_uc003tkk.1_Intron	NM_000162	NP_000153	P35557	HXK4_HUMAN	glucokinase isoform 1						cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4						catatataactgtgtgtgtgtg	0.040													4	2	---	---	---	---	
ADCY1	107	broad.mit.edu	37	7	45635226	45635226	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45635226delC	uc003tne.3	+						ADCY1_uc003tnd.2_Intron	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GATGCCTCATCCCCACGTTTC	0.423													4	2	---	---	---	---	
CCT6A	908	broad.mit.edu	37	7	56127550	56127551	+	Intron	INS	-	T	T	rs35171408		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56127550_56127551insT	uc003trl.1	+						PSPH_uc003trj.2_Intron|CCT6A_uc003trm.1_Intron|CCT6A_uc011kcu.1_Intron|SNORA15_uc003trn.1_5'Flank	NM_001762	NP_001753	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A isoform						'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			tgactggctaattttttttttt	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61822440	61822441	+	IGR	DEL	AT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61822440_61822441delAT								None (None upstream) : LOC643955 (929231 downstream)																							tgagggagaaatgacttgccAG	0.361													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65257020	65257021	+	IGR	DEL	CC	-	-	rs147916926		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65257020_65257021delCC								CCT6P1 (28359 upstream) : VKORC1L1 (81236 downstream)																							CCATCACTAACCCAGCACTTGA	0.490													4	2	---	---	---	---	
WBSCR22	114049	broad.mit.edu	37	7	73111776	73111776	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73111776delA	uc003tyt.2	+						WBSCR22_uc003tyu.2_Intron|WBSCR22_uc003tyv.2_Intron|WBSCR22_uc003tyw.1_Intron	NM_017528	NP_059998	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22							nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				GGGTGTCCAGAGCGGGGAATT	0.582													7	9	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	78198110	78198110	+	Intron	DEL	A	-	-	rs113385342		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78198110delA	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				aataaagctgaaaaaaaaaca	0.080													4	2	---	---	---	---	
PEX1	5189	broad.mit.edu	37	7	92138450	92138450	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92138450delA	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_Intron	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			AAATAAAGAGAAAAAAAAAAA	0.323													11	6	---	---	---	---	
GATS	352954	broad.mit.edu	37	7	99857383	99857383	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99857383delA	uc003uua.3	-						GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc010lgt.2_Intron|GATS_uc010lgu.2_Intron	NM_178831	NP_849153	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					actctgtctcaaaaaaaaaaa	0.274													1	5	---	---	---	---	
MYL10	93408	broad.mit.edu	37	7	101258875	101258876	+	Intron	INS	-	C	C	rs139347793		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101258875_101258876insC	uc003uyr.2	-							NM_138403	NP_612412	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory							mitochondrion	calcium ion binding			ovary(1)|breast(1)	2						agaatgctgttccccccctagc	0.005													3	3	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103600059	103600062	+	Intron	DEL	TCTT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103600059_103600062delTCTT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		tctctctctctctttttttctttt	0.000													1	7	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105454839	105454839	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105454839delG	uc003vde.2	-						ATXN7L1_uc003vdi.2_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						AGAAGGGGATGGGGAGAAGGG	0.368													4	2	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128312236	128312236	+	5'Flank	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128312236delT	uc003vnk.3	+						FAM71F2_uc010llm.1_5'Flank|FAM71F2_uc003vnl.2_5'Flank|FAM71F2_uc010lln.1_5'Flank	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						CTTCCTCTTCTTTTTTTTTTC	0.483													8	4	---	---	---	---	
KLHDC10	23008	broad.mit.edu	37	7	129709057	129709057	+	5'Flank	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129709057delT	uc003vpj.1	+						KLHDC10_uc003vpk.1_5'Flank|KLHDC10_uc010lmb.1_5'Flank	NM_014997	NP_055812	Q6PID8	KLD10_HUMAN	kelch domain containing 10												0						aaccataggcttttttttttt	0.159													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142045045	142045046	+	Intron	INS	-	CACT	CACT			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142045045_142045046insCACT	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc003vxp.3_5'Flank|uc011krt.1_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																		GGACAGAGACAGGGGTAGGATC	0.525													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142045049	142045050	+	Intron	DEL	GT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142045049_142045050delGT	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc003vxp.3_5'Flank|uc011krt.1_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																		AGAGACAGGGGTAGGATCCACA	0.540													5	4	---	---	---	---	
ZNF398	57541	broad.mit.edu	37	7	148824389	148824390	+	Intron	INS	-	AAAT	AAAT	rs149168423	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148824389_148824390insAAAT	uc011kul.1	+						ZNF425_uc003wfj.2_5'Flank	NM_020781	NP_065832	Q8TD17	ZN398_HUMAN	zinc finger 398 isoform b						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			ATGTCCATGAGAAAGTAGTCCC	0.411													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149663948	149663949	+	IGR	INS	-	T	T	rs147026859	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149663948_149663949insT								ATP6V0E2 (86162 upstream) : ACTR3C (280353 downstream)																							tttttctttcctttttttttgt	0.173													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151918742	151918743	+	Intron	INS	-	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151918742_151918743insC	uc003wla.2	-						MLL3_uc003wkz.2_Intron	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		taaaaattaaGAGATTGAATTA	0.262			N		medulloblastoma								4	2	---	---	---	---	
NCAPG2	54892	broad.mit.edu	37	7	158458704	158458705	+	Intron	INS	-	TT	TT	rs147181986	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158458704_158458705insTT	uc003wnv.1	-						NCAPG2_uc010lqu.1_Intron|NCAPG2_uc003wnw.1_Intron|NCAPG2_uc003wnx.1_Intron|NCAPG2_uc011kwe.1_Intron|NCAPG2_uc011kwc.1_Intron|NCAPG2_uc011kwd.1_5'Flank	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5						cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		AAGACAGAGCAACCCCAGTACT	0.485													3	4	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38099572	38099572	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38099572delA	uc003xlb.2	+						DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			actccatctcaaaaaaaaaaa	0.139													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	48080932	48080933	+	IGR	INS	-	G	G	rs148795212	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48080932_48080933insG								BEYLA (313525 upstream) : KIAA0146 (92609 downstream)																							TGCTGGTGTCTGGCCATAAATC	0.441													9	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49772154	49772154	+	IGR	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49772154delC								EFCAB1 (124284 upstream) : SNAI2 (58085 downstream)																							CTCCGCCAGGCCAAGGCCCAG	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52945750	52945750	+	IGR	DEL	T	-	-	rs35910006		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52945750delT								PCMTD1 (134015 upstream) : ST18 (77642 downstream)																							CTGGGCCCTATTTTCTCTTCC	0.507													2	4	---	---	---	---	
LAPTM4B	55353	broad.mit.edu	37	8	98788918	98788919	+	Intron	INS	-	C	C	rs147911613	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98788918_98788919insC	uc003yia.2	+						LAPTM4B_uc010mbg.2_Intron	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4						transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			TGTGAATGGGTCCCCCCCCCGA	0.564													4	2	---	---	---	---	
RCL1	10171	broad.mit.edu	37	9	4855362	4855363	+	Intron	INS	-	TC	TC	rs149545594	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4855362_4855363insTC	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron|RCL1_uc010mhl.1_Intron	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		TGAGCGGTGGGTCTCTTTGCCC	0.530													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70182347	70182347	+	RNA	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70182347delT	uc004afw.2	-	3		c.1765delA								Homo sapiens COBW domain containing 5, mRNA (cDNA clone IMAGE:5287337), complete cds.																		CTGTGTATTGTTTTTTTTTTG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110197005	110197006	+	IGR	INS	-	C	C	rs148901542	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110197005_110197006insC								RAD23B (102536 upstream) : KLF4 (50129 downstream)																							GCTGACTCCAGCACTCCCAGGG	0.391													12	6	---	---	---	---	
DBC1	1620	broad.mit.edu	37	9	122075265	122075265	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122075265delA	uc004bkc.2	-						DBC1_uc004bkd.2_Intron	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						TTGTGCAAAGAAAAAAAAAAT	0.299													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138898671	138898671	+	3'UTR	DEL	A	-	-	rs71759143		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138898671delA	uc011mds.1	-	1										Homo sapiens cDNA FLJ30516 fis, clone BRAWH2000697.																		AAAAAAAGACAAAAAAAAAAA	0.373													3	3	---	---	---	---	
FBXW5	54461	broad.mit.edu	37	9	139837701	139837701	+	Intron	DEL	C	-	-	rs11339872		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139837701delC	uc004cjx.2	-						FBXW5_uc010nbx.2_5'Flank|FBXW5_uc004cjy.2_Intron|FBXW5_uc004cjz.2_Intron|C8G_uc004cka.2_5'Flank	NM_018998	NP_061871	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5								catalytic activity|protein binding				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GCCTGACCCACCCCCCCCCCC	0.692													7	5	---	---	---	---	
C10orf110	55853	broad.mit.edu	37	10	1081945	1081945	+	Intron	DEL	T	-	-	rs71745510		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1081945delT	uc001ifw.3	+						C10orf110_uc010qaf.1_Intron|C10orf110_uc001ifx.3_Intron|C10orf110_uc001ify.3_Intron	NR_024628				Homo sapiens uncharacterized hypothalamus protein HT009 mRNA, complete cds.												0						tttttttgtgttttttttttt	0.224													6	3	---	---	---	---	
AKR1C1	1645	broad.mit.edu	37	10	4964599	4964599	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4964599delA	uc001iho.2	+						AKR1E2_uc001ihl.1_Intron	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	TTTCAAAGAGAAAAAAAAAAT	0.368													5	3	---	---	---	---	
PTF1A	256297	broad.mit.edu	37	10	23482992	23482994	+	3'UTR	DEL	GAT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23482992_23482994delGAT	uc001irp.2	+	2						NM_178161	NP_835455	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a						endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex				pancreas(1)|skin(1)	2						TGATGAAATAGATGATTTCtttt	0.246													6	5	---	---	---	---	
ANKRD26	22852	broad.mit.edu	37	10	27332107	27332107	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27332107delA	uc001ith.2	-						ANKRD26_uc001itg.2_Intron|ANKRD26_uc009xku.1_Intron	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						aattaaaatgaaaaaaaaaaa	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29274560	29274561	+	IGR	DEL	AG	-	-	rs3069175		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29274560_29274561delAG								BAMBI (302692 upstream) : LYZL1 (303429 downstream)																							GCAGGAAAACAGGGGTCAGATG	0.500													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	47008664	47008666	+	IGR	DEL	TTG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47008664_47008666delTTG								GPRIN2 (3021 upstream) : ANXA8 (3087 downstream)																							CTTCATCATTttgttgttgttgt	0.261													5	5	---	---	---	---	
ARHGAP22	58504	broad.mit.edu	37	10	49670295	49670296	+	Intron	INS	-	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49670295_49670296insA	uc001jgt.2	-						ARHGAP22_uc001jgs.2_Intron|ARHGAP22_uc001jgu.2_Intron|ARHGAP22_uc010qgl.1_Intron|ARHGAP22_uc010qgm.1_Intron|ARHGAP22_uc001jgv.2_Intron	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						TCGGGGTGGGGGGGGGGCACCT	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467957	52467957	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467957delT								SGMS1 (83034 upstream) : ASAH2B (31739 downstream)																							TCTTCAtttcttttttttttt	0.214													6	4	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61979276	61979276	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61979276delT	uc001jky.2	-						ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						agagctaggcttttcttagta	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82057637	82057637	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82057637delT								MAT1A (8203 upstream) : DYDC1 (38227 downstream)																							CTATGTAttcttttttttttt	0.219													9	5	---	---	---	---	
WAPAL	23063	broad.mit.edu	37	10	88220475	88220476	+	Intron	DEL	TC	-	-	rs71970479		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88220475_88220476delTC	uc001kdo.2	-						WAPAL_uc009xsv.2_Intron|WAPAL_uc001kdn.2_Intron|WAPAL_uc009xsw.2_Intron	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog						cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						AATGGCCTCttctttttttttt	0.149													4	2	---	---	---	---	
PTEN	5728	broad.mit.edu	37	10	89721073	89721073	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89721073delT	uc001kfb.2	+							NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.Y27fs*1(2)|p.N212fs*1(2)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAAAGCTGCATTTTTCCTTTT	0.388		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			4	2	---	---	---	---	
HTR7	3363	broad.mit.edu	37	10	92545303	92545303	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92545303delT	uc001kha.2	-						HTR7_uc001kgz.2_Intron|HTR7_uc001khb.2_Intron	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d						blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	CTTCTCCATATAACACATGAC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	122945619	122945619	+	IGR	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122945619delG								WDR11 (276584 upstream) : FGFR2 (292226 downstream)																							TATCTTTGCTGGAGATTTAGA	0.383													4	2	---	---	---	---	
BCCIP	56647	broad.mit.edu	37	10	127513540	127513541	+	Intron	DEL	GT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127513540_127513541delGT	uc001ljb.3	+						BCCIP_uc001ljd.3_Intron|UROS_uc001lix.3_5'Flank|UROS_uc001liy.3_5'Flank|BCCIP_uc010qui.1_Intron|BCCIP_uc001ljc.3_Intron|BCCIP_uc010quj.1_Intron	NM_078468	NP_510868	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A-interacting protein isoform						cell cycle|DNA repair|neuroendocrine cell differentiation|regulation of cyclin-dependent protein kinase activity	nuclear cyclin-dependent protein kinase holoenzyme complex	kinase regulator activity|protein binding			ovary(1)|breast(1)	2		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AGGATTAGAGGTGACACCATGG	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130312725	130312726	+	IGR	DEL	GA	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130312725_130312726delGA								MKI67 (388257 upstream) : MGMT (952728 downstream)																							AAATATCAGGGAGAGAGAGGAA	0.406													4	2	---	---	---	---	
IGF2	3481	broad.mit.edu	37	11	2154596	2154596	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2154596delC	uc009yde.2	-						IGF2_uc001lvf.2_Intron|IGF2_uc001lvg.2_Intron|IGF2_uc009ydf.2_Intron|IGF2_uc001lvh.2_Intron|INS-IGF2_uc001lvi.2_Intron	NM_001007139	NP_001007140	P01344	IGF2_HUMAN	insulin-like growth factor 2 isoform 1						glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity			central_nervous_system(1)	1		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		AAGGAGCCAGCGTCTGAGCTG	0.642													4	2	---	---	---	---	
SCUBE2	57758	broad.mit.edu	37	11	9041982	9041982	+	3'UTR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9041982delT	uc001mhh.1	-	22					SCUBE2_uc001mhi.1_3'UTR|SCUBE2_uc001mhj.1_3'UTR	NM_020974	NP_066025	Q9NQ36	SCUB2_HUMAN	CEGP1 protein precursor							extracellular region	calcium ion binding			ovary(1)|skin(1)	2				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		TTCTTTCTGCTTTTTTTTTTC	0.428													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15930789	15930789	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15930789delA								INSC (662037 upstream) : SOX6 (57207 downstream)																							taatcacaagaaacccagaga	0.000													4	2	---	---	---	---	
PTPRJ	5795	broad.mit.edu	37	11	48189154	48189154	+	3'UTR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48189154delT	uc001ngp.3	+	25						NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						ATGAGGTCACTTTTTTTTTTT	0.393													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61853142	61853142	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61853142delA								FTH1 (118010 upstream) : INCENP (38303 downstream)																							TCTAAAACTGAAAGGGAGAAA	0.308													4	2	---	---	---	---	
TMEM223	79064	broad.mit.edu	37	11	62558503	62558503	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62558503delT	uc001nve.2	-							NM_001080501	NP_001073970	A0PJW6	TM223_HUMAN	transmembrane protein 223							integral to membrane					0						TACTGAGCGCttttttttttg	0.264													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	96127658	96127659	+	IGR	INS	-	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96127658_96127659insT								JRKL (931 upstream) : None (None downstream)																							TATAATGTTGCTTTTTTTTCTG	0.327													4	2	---	---	---	---	
GRIA4	2893	broad.mit.edu	37	11	105782614	105782614	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105782614delA	uc001pix.2	+						GRIA4_uc001piu.1_Frame_Shift_Del_p.N428fs|GRIA4_uc001piw.2_Intron|GRIA4_uc009yxk.1_Frame_Shift_Del_p.N428fs	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TCTGATGAAGAATCCTATTTT	0.328													10	5	---	---	---	---	
TRAPPC4	51399	broad.mit.edu	37	11	118891137	118891139	+	Intron	DEL	TTC	-	-	rs142545556	byFrequency	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118891137_118891139delTTC	uc010ryo.1	+						RPS25_uc001pun.2_5'Flank|TRAPPC4_uc010ryn.1_3'UTR|TRAPPC4_uc010ryp.1_Intron|TRAPPC4_uc001pup.2_Intron|TRAPPC4_uc010ryq.1_Intron	NM_016146	NP_057230	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4						dendrite development|ER to Golgi vesicle-mediated transport	cis-Golgi network|dendrite|endoplasmic reticulum|Golgi stack|synaptic vesicle	protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		CCTGGCACAAttctttttttttt	0.281													6	3	---	---	---	---	
B3GAT1	27087	broad.mit.edu	37	11	134267587	134267587	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134267587delA	uc001qhq.2	-						B3GAT1_uc001qhr.2_Intron	NM_018644	NP_061114	Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1						carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		AAGTTGAGTCAAGATGCCCAA	0.627													4	2	---	---	---	---	
MFAP5	8076	broad.mit.edu	37	12	8808655	8808655	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8808655delC	uc001qut.1	-						MFAP5_uc001qus.2_Intron|MFAP5_uc009zge.1_Intron	NM_003480	NP_003471	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5 precursor							microfibril	extracellular matrix structural constituent			breast(1)	1	Lung SC(5;0.184)					ATTCATAAttctttttttttt	0.144													9	4	---	---	---	---	
ATF7IP	55729	broad.mit.edu	37	12	14648954	14648954	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14648954delT	uc001rbw.2	+						ATF7IP_uc001rbx.2_Intron|ATF7IP_uc001rby.3_Intron|ATF7IP_uc001rca.2_Intron	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting						DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						gtagttagaatttttttttag	0.000													4	2	---	---	---	---	
SLCO1B3	28234	broad.mit.edu	37	12	21242654	21242655	+	Intron	INS	-	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21242654_21242655insA	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron			Q9NPD5	SO1B3_HUMAN	SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					GCTTTGCATTTAAATAAAAAAA	0.119													2	4	---	---	---	---	
KIF21A	55605	broad.mit.edu	37	12	39716856	39716857	+	Intron	INS	-	A	A	rs150407641	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39716856_39716857insA	uc001rly.2	-						KIF21A_uc001rlv.2_Intron|KIF21A_uc001rlw.2_Intron|KIF21A_uc001rlx.2_Intron|KIF21A_uc001rlz.2_Intron|KIF21A_uc010skl.1_Intron	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				TATAGCTAGATAAACCTTTAGA	0.218													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47997340	47997340	+	IGR	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47997340delC								FAM113B (366899 upstream) : RPAP3 (58376 downstream)																							GCAGGATTCTCCCACCCATTC	0.507													4	2	---	---	---	---	
NCKAP5L	57701	broad.mit.edu	37	12	50217431	50217431	+	Intron	DEL	A	-	-	rs67376016		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50217431delA	uc009zlk.2	-							NM_001037806	NP_001032895	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like											central_nervous_system(1)	1						TCTATACATTAAAAAAAAAAA	0.488													4	2	---	---	---	---	
KRT86	3892	broad.mit.edu	37	12	52690002	52690002	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52690002delA	uc010snq.1	+						KRT86_uc009zmg.2_Intron|KRT81_uc001sac.2_Intron	NM_002284	NP_002275	O43790	KRT86_HUMAN	keratin 86						cytoskeleton organization	keratin filament	structural molecule activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.189)		GAAGAAAATGAGGGAGAGATC	0.453													4	2	---	---	---	---	
PDE1B	5153	broad.mit.edu	37	12	54968026	54968027	+	Intron	DEL	TG	-	-	rs113679735		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54968026_54968027delTG	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						GAGAGTGGACTGTGTGTGTGTG	0.361													4	2	---	---	---	---	
XRCC6BP1	91419	broad.mit.edu	37	12	58347666	58347667	+	Intron	INS	-	AA	AA			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58347666_58347667insAA	uc001sqp.2	+							NM_033276	NP_150592	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1						double-strand break repair via nonhomologous end joining	DNA-dependent protein kinase-DNA ligase 4 complex	DNA-dependent protein kinase activity|metal ion binding|metalloendopeptidase activity			ovary(1)	1						CTATGTGACTCAATGAGTGTGT	0.208													14	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	64919705	64919706	+	IGR	DEL	AA	-	-	rs36047517		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64919705_64919706delAA								TBK1 (23814 upstream) : RASSF3 (84587 downstream)																							CAAAGGCTGCAAAGAGTCTCAA	0.455													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80690487	80690491	+	IGR	DEL	TAAGT	-	-	rs138318765		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80690487_80690491delTAAGT								PPP1R12A (361252 upstream) : PTPRQ (147635 downstream)																							ATTTTAGAGGTAAGTTGTTTTTCAG	0.176													9	6	---	---	---	---	
KCTD10	83892	broad.mit.edu	37	12	109898818	109898818	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109898818delC	uc001toi.1	-						KCTD10_uc001toh.1_5'Flank|KCTD10_uc009zvi.1_Intron|KCTD10_uc001toj.1_Intron|KCTD10_uc001tok.1_Intron	NM_031954	NP_114160	Q9H3F6	BACD3_HUMAN	potassium channel tetramerisation domain						proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|nucleus|voltage-gated potassium channel complex	voltage-gated potassium channel activity				0						ACAACCATAACCCCAGGTGAC	0.562													4	2	---	---	---	---	
CAMKK2	10645	broad.mit.edu	37	12	121690305	121690306	+	Intron	INS	-	CTGGTGATCCGC	CTGGTGATCCGC	rs146470009	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121690305_121690306insCTGGTGATCCGC	uc001tzu.2	-						CAMKK2_uc001tzt.2_Intron|CAMKK2_uc001tzv.2_Intron|CAMKK2_uc001tzw.2_Intron|CAMKK2_uc001tzx.2_Intron|CAMKK2_uc001tzy.2_Intron|CAMKK2_uc001tzz.1_Intron|CAMKK2_uc001uaa.1_Intron|CAMKK2_uc001uab.2_Intron|CAMKK2_uc001uac.2_Intron	NM_006549	NP_006540	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase						calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity			lung(1)|large_intestine(1)|stomach(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					actcctaacctctgcctcagcc	0.084													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	125252168	125252168	+	IGR	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125252168delG								NCOR2 (200158 upstream) : SCARB1 (10007 downstream)																							CAGATGCCCTGGGGGTGGGTG	0.577											OREG0022245	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27106450	27106450	+	IGR	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27106450delG								CDK8 (127881 upstream) : WASF3 (25390 downstream)																							ttcccaatgtgggtgggcatc	0.000													4	2	---	---	---	---	
FLJ37307	283521	broad.mit.edu	37	13	52400734	52400734	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52400734delA	uc010tgq.1	-	3	244	c.86delT	c.(85-87)TTCfs	p.F29fs	FLJ37307_uc001vft.1_Intron	NR_027047				Homo sapiens cDNA FLJ37307 fis, clone BRAMY2016327.												0						CAGAGCCAGGAAAGCACAGAG	0.562													4	2	---	---	---	---	
NALCN	259232	broad.mit.edu	37	13	101936112	101936112	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101936112delA	uc001vox.1	-						NALCN_uc001voy.2_Intron|NALCN_uc001voz.2_Intron|NALCN_uc001vpa.2_Intron	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGTGTATGTTAAAAAAAAAAA	0.348													8	4	---	---	---	---	
METTL3	56339	broad.mit.edu	37	14	21969662	21969662	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21969662delA	uc001wbc.2	-						METTL3_uc001wbb.2_Intron|METTL3_uc010tlw.1_Intron|METTL3_uc010tlx.1_3'UTR	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3						gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		GGGAGCTTTTAAAAAAAAAAA	0.403													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23030942	23030943	+	IGR	INS	-	A	A	rs145394032	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23030942_23030943insA								OR4E2 (896706 upstream) : DAD1 (2864 downstream)																							CCTCACTCTCCATGCAGTAGTA	0.450													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62327557	62327558	+	IGR	INS	-	T	T	rs139907893	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62327557_62327558insT								SNAPC1 (64412 upstream) : SYT16 (126245 downstream)																							gcagtgttggattttaccaggg	0.000													1	5	---	---	---	---	
MAP3K9	4293	broad.mit.edu	37	14	71258111	71258113	+	Intron	DEL	GCT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71258111_71258113delGCT	uc001xmm.2	-						MAP3K9_uc001xml.2_Intron	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CACTGAGTAAGCTGCAGAGAACC	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	104937961	104937962	+	IGR	DEL	CA	-	-	rs113085507		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104937961_104937962delCA								KIF26A (290727 upstream) : C14orf180 (108094 downstream)																							Ccacacacgccacacacacaca	0.282													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20210083	20210084	+	IGR	INS	-	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20210083_20210084insT								None (None upstream) : GOLGA6L6 (527010 downstream)																							GCAGGAGGGCCTTCACAAAAAG	0.574													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	41438795	41438795	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41438795delA								INO80 (30455 upstream) : EXD1 (36138 downstream)																							actctgtctcaaaaaaaaaaa	0.000													9	4	---	---	---	---	
ZFP106	64397	broad.mit.edu	37	15	42716852	42716852	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42716852delT	uc001zpw.2	-						ZFP106_uc001zpu.2_Intron|ZFP106_uc001zpv.2_Intron|ZFP106_uc001zpx.2_Intron	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog							nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		aatttttgtatttttttgtag	0.000													6	3	---	---	---	---	
TMEM62	80021	broad.mit.edu	37	15	43453132	43453136	+	Intron	DEL	ATAAG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43453132_43453136delATAAG	uc001zqr.2	+						TMEM62_uc010bda.2_Intron|TMEM62_uc001zqt.2_Intron	NM_024956	NP_079232	Q0P6H9	TMM62_HUMAN	transmembrane protein 62							integral to membrane				ovary(1)|breast(1)	2		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		attatatataataagatattttgag	0.020													10	7	---	---	---	---	
ADAL	161823	broad.mit.edu	37	15	43638385	43638385	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43638385delA	uc010udo.1	+						ADAL_uc001zrh.2_Intron|ADAL_uc001zri.1_Intron	NM_001159280	NP_001152752	Q6DHV7	ADAL_HUMAN	adenosine deaminase-like isoform 1						adenosine catabolic process|inosine biosynthetic process|purine ribonucleoside monophosphate biosynthetic process		adenosine deaminase activity|metal ion binding				0		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		ACCCTAAAAGAAAAAAAAAGA	0.269													4	4	---	---	---	---	
PPIP5K1	9677	broad.mit.edu	37	15	43864900	43864900	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43864900delT	uc001zrw.2	-						PPIP5K1_uc001zrx.1_Intron|PPIP5K1_uc001zru.2_Intron|PPIP5K1_uc001zry.3_Intron|PPIP5K1_uc001zrv.2_Intron|PPIP5K1_uc001zrz.1_Intron	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						GATAAGCAAGTTTTTTTTTTT	0.428													20	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45902837	45902837	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45902837delT								PLDN (929 upstream) : SQRDL (20509 downstream)																							GATTTTTAAGTTTTTTTTTTA	0.338													6	3	---	---	---	---	
OAZ2	4947	broad.mit.edu	37	15	64995017	64995018	+	Intron	INS	-	C	C			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64995017_64995018insC	uc002anp.2	-									O95190	OAZ2_HUMAN	Homo sapiens ornithine decarboxylase antizyme 2 (OAZ2) mRNA, complete cds.						polyamine metabolic process|regulation of cellular amino acid metabolic process	cytosol|nucleus	ornithine decarboxylase inhibitor activity|protein binding				0					L-Ornithine(DB00129)	CCGGATGAGGGGGATGGGCCCG	0.609													4	2	---	---	---	---	
GLCE	26035	broad.mit.edu	37	15	69564169	69564169	+	3'UTR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69564169delA	uc002ary.1	+	5						NM_015554	NP_056369	O94923	GLCE_HUMAN	D-glucuronyl C5-epimerase						heparan sulfate proteoglycan biosynthetic process|heparin biosynthetic process	Golgi membrane|integral to membrane	UDP-glucuronate 5'-epimerase activity			ovary(2)	2						AAGCAAGTGCAAAAATGACAC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	69570907	69570907	+	IGR	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69570907delC								GLCE (6363 upstream) : PAQR5 (20387 downstream)																							ATTGCAGGGGCAGGAGTGGAA	0.597													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70148333	70148334	+	IGR	DEL	TG	-	-	rs72463510		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70148333_70148334delTG								C15orf50 (13028 upstream) : TLE3 (192209 downstream)																							tgtttgtgtttgtgtgtgtgtg	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84924842	84924844	+	IGR	DEL	ATG	-	-	rs60843759		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84924842_84924844delATG								LOC388152 (25922 upstream) : GOLGA6L5 (122894 downstream)																							AAGAGATAATATGATAAAAAACA	0.271													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93670812	93670812	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93670812delA								RGMA (38379 upstream) : None (None downstream)																							CAGGTCAGCTAAAATGACAAG	0.547													4	2	---	---	---	---	
IFT140	9742	broad.mit.edu	37	16	1578305	1578306	+	Intron	DEL	CA	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1578305_1578306delCA	uc002cmb.2	-						IFT140_uc002clz.2_Intron|TMEM204_uc002cmc.2_5'Flank	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140											ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				CCACCAAAGCcacacacacacg	0.307													4	2	---	---	---	---	
TBC1D24	57465	broad.mit.edu	37	16	2540871	2540872	+	Intron	DEL	TG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2540871_2540872delTG	uc002cql.2	+						TBC1D24_uc002cqk.2_Intron	NM_020705	NP_065756	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24						neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity				0						TCTGCACCTTTGTCAGGGGTTG	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5851623	5851623	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5851623delA								FAM86A (703834 upstream) : A2BP1 (217509 downstream)																							AGGCACACACAAAAAAATACC	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	6010747	6010747	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6010747delA								FAM86A (862958 upstream) : A2BP1 (58385 downstream)																							AGTGTGGAGCAACCCCAACAC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8979335	8979336	+	IGR	INS	-	CATA	CATA	rs145478605	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8979335_8979336insCATA								CARHSP1 (16472 upstream) : USP7 (6615 downstream)																							GAGCCACAGTCCATAGTTCAGC	0.594													5	5	---	---	---	---	
EMP2	2013	broad.mit.edu	37	16	10676947	10676948	+	5'Flank	INS	-	A	A	rs75008384		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10676947_10676948insA	uc002czx.2	-							NM_001424	NP_001415	P54851	EMP2_HUMAN	epithelial membrane protein 2						cell proliferation	integral to membrane					0						CCAAGACGCAGAAAAAAAAACA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	58110470	58110471	+	IGR	DEL	GT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58110470_58110471delGT								MMP15 (29668 upstream) : C16orf80 (37026 downstream)																							aagagattaggtgtgtgactta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74245448	74245448	+	Intron	DEL	A	-	-	rs71741013		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74245448delA	uc002fcp.1	-											Homo sapiens, clone IMAGE:5167766, mRNA.																		agaataaaagaaaaaaaaaca	0.000													3	3	---	---	---	---	
WRAP53	55135	broad.mit.edu	37	17	7603866	7603866	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7603866delA	uc010vuh.1	+						WRAP53_uc010vui.1_Intron|WRAP53_uc002gip.2_Intron|WRAP53_uc002gir.2_Intron|WRAP53_uc002giq.2_Intron|WRAP53_uc010cnl.2_Intron|WRAP53_uc010vuj.1_5'Flank	NM_001143990	NP_001137462	Q9BUR4	WAP53_HUMAN	WD repeat domain 79 isoform 2						positive regulation of telomerase activity|telomere formation via telomerase	Cajal body|cytoplasm|telomerase holoenzyme complex	protein binding|RNA binding				0						TCAAAATAATAAAAAAAAAAA	0.184													9	5	---	---	---	---	
AKAP10	11216	broad.mit.edu	37	17	19822361	19822362	+	Intron	INS	-	CA	CA	rs145571077		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19822361_19822362insCA	uc002gwo.2	-						AKAP10_uc002gwp.1_Intron|AKAP10_uc010cqw.1_Intron	NM_007202	NP_009133	O43572	AKA10_HUMAN	A-kinase anchor protein 10 precursor						blood coagulation|protein localization	cytosol|mitochondrion|plasma membrane	signal transducer activity			skin(1)	1	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					tttatattaggtatatctccta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21328243	21328243	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21328243delA								KCNJ12 (5064 upstream) : C17orf51 (103329 downstream)																							TGCTGACTCCAAGTGTGATAG	0.393													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22258575	22258576	+	IGR	DEL	TT	-	-	rs4095137		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22258575_22258576delTT								FLJ36000 (345505 upstream) : None (None downstream)																							tgcagacctctttgaaggtttc	0.000													4	2	---	---	---	---	
RAB11FIP4	84440	broad.mit.edu	37	17	29854649	29854664	+	Intron	DEL	ATTTTGCTTACAAATA	-	-	rs11275605		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29854649_29854664delATTTTGCTTACAAATA	uc002hgn.1	+						RAB11FIP4_uc002hgo.2_Intron	NM_032932	NP_116321	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)						cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				ATAATTTACTATTTTGCTTACAAATAGTCCTTACTA	0.102													9	4	---	---	---	---	
WIPF2	147179	broad.mit.edu	37	17	38420606	38420606	+	Intron	DEL	G	-	-	rs113326809		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38420606delG	uc002hug.1	+						WIPF2_uc002huh.1_Intron|WIPF2_uc010cww.1_Intron|WIPF2_uc002hui.1_Intron|WIPF2_uc010cwx.1_Intron|WIPF2_uc010cwy.1_Intron	NM_133264	NP_573571	Q8TF74	WIPF2_HUMAN	WIRE protein							cytoplasm|cytoskeleton	actin binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						aaaaaaaaaagaaaaacaaaa	0.209										HNSCC(43;0.11)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42595438	42595438	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42595438delT								GPATCH8 (14636 upstream) : FZD2 (39487 downstream)																							tcggctaatgttttttttttt	0.055													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44325216	44325217	+	IGR	INS	-	A	A			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44325216_44325217insA								KIAA1267 (22499 upstream) : ARL17B (38646 downstream)																							AAGATAATGGTAAAAAAAAAAA	0.297													7	5	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60613897	60613897	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60613897delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						CCAGTCTCCCTTGGTTCAAGC	0.368													4	2	---	---	---	---	
DDX42	11325	broad.mit.edu	37	17	61878673	61878674	+	Intron	INS	-	TGGG	TGGG			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61878673_61878674insTGGG	uc002jbu.2	+						DDX42_uc002jbv.2_Intron|DDX42_uc002jbw.1_Intron	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						cctcggcctcccaaagcgctgg	0.109													4	2	---	---	---	---	
DDX42	11325	broad.mit.edu	37	17	61878677	61878680	+	Intron	DEL	AGCG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61878677_61878680delAGCG	uc002jbu.2	+						DDX42_uc002jbv.2_Intron|DDX42_uc002jbw.1_Intron	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						ggcctcccaaagcgctgggattac	0.118													4	2	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	70791684	70791684	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70791684delT	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						tcacttttgctttttcctatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72765903	72765903	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72765903delT								SLC9A3R1 (405 upstream) : NAT9 (786 downstream)																							TGGAGCTGGGTTTGGAATGTG	0.532													4	2	---	---	---	---	
KIAA0195	9772	broad.mit.edu	37	17	73482693	73482694	+	Intron	INS	-	GGC	GGC			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73482693_73482694insGGC	uc002jnz.3	+						KIAA0195_uc010wsa.1_Intron	NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772						ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGTGGGATGGTGGTGGGTGCC	0.614													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	27743703	27743704	+	IGR	DEL	AT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27743703_27743704delAT								None (None upstream) : MIR302F (135172 downstream)																							CACCACAAGCATAAGGAGAAAA	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	54832029	54832029	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54832029delT								WDR7 (134993 upstream) : ST8SIA3 (187692 downstream)																							CATCTTTCTATTTTTTTTTCC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	55497894	55497896	+	IGR	DEL	CTT	-	-	rs150875605		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55497894_55497896delCTT								ATP8B1 (98855 upstream) : NEDD4L (213723 downstream)																							caggtgtaaacttcttcctcagg	0.005													1	10	---	---	---	---	
MALT1	10892	broad.mit.edu	37	18	56368001	56368001	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56368001delT	uc002lhm.1	+						MALT1_uc002lhn.1_Intron	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma						activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4						TTTGTCTTTCTTtttttttta	0.139			T	BIRC3	MALT								5	3	---	---	---	---	
THEG	51298	broad.mit.edu	37	19	375296	375296	+	Intron	DEL	T	-	-	rs142402374		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:375296delT	uc002lol.2	-						THEG_uc002lom.2_Intron	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1						cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTGGGAGGCTTTTTTTTTCC	0.468													4	2	---	---	---	---	
DAZAP1	26528	broad.mit.edu	37	19	1433218	1433218	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1433218delG	uc002lsn.2	+						DAZAP1_uc002lsm.2_Intron|DAZAP1_uc002lso.2_Intron|DAZAP1_uc002lsl.1_Intron	NM_018959	NP_061832	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1 isoform b						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleotide binding|RNA binding			breast(1)	1		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGTGCTTCCGGGGCAGGAGC	0.632													4	2	---	---	---	---	
FSD1	79187	broad.mit.edu	37	19	4311683	4311683	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4311683delA	uc002lzy.2	+						FSD1_uc002lzz.2_Intron|FSD1_uc002maa.2_5'UTR	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing						cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		ctctgtctctaaaaaaaaaaa	0.264													10	6	---	---	---	---	
C19orf10	56005	broad.mit.edu	37	19	4660304	4660304	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4660304delT	uc002may.2	-							NM_019107	NP_061980	Q969H8	CS010_HUMAN	hypothetical protein LOC56005 precursor							ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		cgcctggctatttttttttta	0.000													4	2	---	---	---	---	
FCER2	2208	broad.mit.edu	37	19	7757517	7757522	+	Intron	DEL	CCATCG	-	-	rs35227229		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7757517_7757522delCCATCG	uc002mhn.2	-						FCER2_uc010xjs.1_Intron|FCER2_uc010xjt.1_Intron|FCER2_uc002mhm.2_Intron	NM_002002	NP_001993	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor						positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding				0						GTCACTAACACCATCGCCATCAGCAC	0.500													11	5	---	---	---	---	
SMARCA4	6597	broad.mit.edu	37	19	11151715	11151715	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11151715delT	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron|SMARCA4_uc002mqh.3_Intron	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity			lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				AAGATAGTTCTTTTTTTTTGG	0.463			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				4	2	---	---	---	---	
ZNF333	84449	broad.mit.edu	37	19	14810278	14810278	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14810278delT	uc002mzn.2	+						ZNF333_uc010dzq.2_Intron|ZNF333_uc002mzk.3_Intron|ZNF333_uc002mzl.3_Intron|ZNF333_uc002mzm.2_Intron|ZNF333_uc010dzr.1_Intron	NM_032433	NP_115809	Q96JL9	ZN333_HUMAN	zinc finger protein 333						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TGCTCAAGACttttttttttt	0.254													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22500220	22500220	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22500220delT								ZNF676 (120467 upstream) : ZNF98 (73679 downstream)																							GTGGCAAAACttttttttttt	0.189													13	6	---	---	---	---	
ZNF473	25888	broad.mit.edu	37	19	50547362	50547363	+	Intron	DEL	AG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50547362_50547363delAG	uc002prn.2	+						ZNF473_uc002prm.2_Intron|ZNF473_uc010ybo.1_Intron	NM_001006656	NP_001006657	Q8WTR7	ZN473_HUMAN	zinc finger protein 473						histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		GTGGAAGACTAGAGAGAGAGAG	0.470													4	2	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54392679	54392679	+	Intron	DEL	T	-	-	rs35336576		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54392679delT	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		gacaaagaggttttttttttt	0.010													6	3	---	---	---	---	
MBOAT7	79143	broad.mit.edu	37	19	54689586	54689586	+	Intron	DEL	T	-	-	rs68149603		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54689586delT	uc002qdq.2	-						MBOAT7_uc010erg.2_Intron|MBOAT7_uc010yem.1_Intron|MBOAT7_uc002qdr.2_Intron|MBOAT7_uc002qds.2_Intron|MBOAT7_uc010yen.1_Intron|MBOAT7_uc002qdt.3_Intron	NM_024298	NP_077274	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain						phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					ttttcttttcttttttttttg	0.000													4	2	---	---	---	---	
ZNF264	9422	broad.mit.edu	37	19	57731931	57731931	+	3'UTR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57731931delT	uc002qob.2	+	4						NM_003417	NP_003408	O43296	ZN264_HUMAN	zinc finger protein 264						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		TCATTCCACCTTTTTTTTTAG	0.378													4	4	---	---	---	---	
DDRGK1	65992	broad.mit.edu	37	20	3172213	3172213	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3172213delT	uc002wic.2	-						DDRGK1_uc010gaw.2_Intron	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1 precursor							endoplasmic reticulum	protein binding				0						GGGGTTTGGGTTTTTTTTTTC	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19100825	19100825	+	IGR	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19100825delC								C20orf79 (305792 upstream) : SLC24A3 (92465 downstream)																							agcctccatgcccaggccgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23139040	23139041	+	IGR	DEL	AG	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23139040_23139041delAG								CD93 (72063 upstream) : NXT1 (192332 downstream)																							aatgagattcagagaaagcaaa	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25959743	25959744	+	IGR	DEL	GT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25959743_25959744delGT								FAM182B (110957 upstream) : LOC100134868 (30691 downstream)																							gaatgtctgcgtgtgtgtgtgt	0.119													4	2	---	---	---	---	
C20orf191	149934	broad.mit.edu	37	20	26084616	26084619	+	Intron	DEL	AAAG	-	-	rs149763253		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26084616_26084619delAAAG	uc002wvj.3	-							NR_003678				SubName: Full=Putative uncharacterized protein ENSP00000323172;												0						CAATCATGACAAAGGAAGATACCA	0.368													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29589297	29589297	+	IGR	DEL	C	-	-	rs73620372		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29589297delC								None (None upstream) : FRG1B (22582 downstream)																							cttagcacttcttttgctgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52528177	52528177	+	IGR	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52528177delG								SUMO1P1 (35929 upstream) : BCAS1 (31902 downstream)																							TCCCTGCCCTGGGCTAGCCAT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58893001	58893002	+	Intron	INS	-	C	C	rs147176185	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58893001_58893002insC	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		AGATGGAGAGGCCTGGTGCTTC	0.490													3	6	---	---	---	---	
MYT1	4661	broad.mit.edu	37	20	62845290	62845290	+	Intron	DEL	C	-	-	rs113951577		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62845290delC	uc002yii.2	+						MYT1_uc002yih.2_Intron|MYT1_uc002yij.2_Intron	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1						cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					ACATGGGGCTCTGCCTCCTTG	0.567													8	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9856378	9856380	+	IGR	DEL	CTC	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9856378_9856380delCTC								None (None upstream) : None (None downstream)																							CCTCTGCCTTCTCCTCCAGGGCA	0.581													4	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11088890	11088891	+	Intron	INS	-	A	A	rs148198939		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11088890_11088891insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GAAAAATATACAAAAAAAGTTT	0.292													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	25644799	25644799	+	IGR	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25644799delT								None (None upstream) : None (None downstream)																							gggaaggtccttggcagaact	0.104													4	2	---	---	---	---	
LCA5L	150082	broad.mit.edu	37	21	40783396	40783397	+	Intron	DEL	TT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40783396_40783397delTT	uc002yxu.2	-						LCA5L_uc002yxv.2_Intron	NM_152505	NP_689718	O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like												0		Prostate(19;1.2e-06)				CAAGCTGAAGTTATCCTTTTGC	0.391													4	2	---	---	---	---	
PDE9A	5152	broad.mit.edu	37	21	44138580	44138580	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44138580delT	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron	NM_002606	NP_002597	O76083	PDE9A_HUMAN	phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2						ttttataatcttttttttctt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44556132	44556132	+	IGR	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44556132delA								U2AF1 (28444 upstream) : CRYAA (33009 downstream)																							gagagaagacaaaaaaaagga	0.144													4	2	---	---	---	---	
TRAPPC10	7109	broad.mit.edu	37	21	45484548	45484549	+	Intron	DEL	GA	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45484548_45484549delGA	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						ATAAGCCATTGATGGGGACGGT	0.282													4	2	---	---	---	---	
MICAL3	57553	broad.mit.edu	37	22	18374023	18374024	+	Intron	DEL	AA	-	-	rs11313720		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18374023_18374024delAA	uc002zng.3	-						MICAL3_uc011agl.1_Intron|MICAL3_uc002znh.2_Intron|MICAL3_uc002znj.1_Intron|MICAL3_uc002znk.1_Intron|MICAL3_uc002znl.1_Intron|MICAL3_uc002znm.2_Intron|MICAL3_uc010grf.2_Intron	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		aTAGGAGCACAAAAAAAAAAAT	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	18843613	18843613	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18843613delG	uc002zoe.2	+											Homo sapiens cDNA FLJ76361 complete cds.																		AGGAGAGGCAGGGGCGGGGGT	0.622													2	4	---	---	---	---	
MAPK1	5594	broad.mit.edu	37	22	22130540	22130541	+	Intron	DEL	CT	-	-	rs34347426		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22130540_22130541delCT	uc002zvn.2	-						MAPK1_uc002zvo.2_Intron|MAPK1_uc010gtk.1_Intron	NM_002745	NP_002736	P28482	MK01_HUMAN	mitogen-activated protein kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)	CCTCGTGAAACTCTGACCCTGA	0.510													4	2	---	---	---	---	
PIWIL3	440822	broad.mit.edu	37	22	25152199	25152199	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25152199delA	uc003abd.1	-						PIWIL3_uc011ajx.1_Intron|PIWIL3_uc011ajy.1_Intron|PIWIL3_uc010gut.1_Intron	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3						cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						CAAATAGAATAAAAAAAAAAG	0.279													5	3	---	---	---	---	
APOL6	80830	broad.mit.edu	37	22	36054465	36054465	+	Intron	DEL	A	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36054465delA	uc003aoe.2	+						APOL6_uc003aod.2_Intron	NM_030641	NP_085144	Q9BWW8	APOL6_HUMAN	apolipoprotein L6						lipoprotein metabolic process	cytoplasm|extracellular region	lipid binding|lipid transporter activity				0						TGCCCCTCTTATGTGTTTCTT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	37941607	37941607	+	IGR	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37941607delC								CARD10 (26229 upstream) : CDC42EP1 (14864 downstream)																							CTCCAATGTGCCCCCACGGCC	0.597											OREG0026539	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PACSIN2	11252	broad.mit.edu	37	22	43359420	43359420	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43359420delG	uc003bdg.3	-							NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				ACAACACGCAGGGCAGCACTT	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48198318	48198318	+	Intron	DEL	C	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48198318delC	uc003bik.1	+											Homo sapiens cDNA FLJ35788 fis, clone TESTI2005683.																		CTTCCCTGTGCTAGTCATCTG	0.577													4	4	---	---	---	---	
CACNA1F	778	broad.mit.edu	37	X	49081792	49081792	+	Intron	DEL	G	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49081792delG	uc004dnb.2	-						CACNA1F_uc010nip.2_Intron	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	TATTCAGGCTGGGGCTGAGAT	0.274													4	2	---	---	---	---	
IQSEC2	23096	broad.mit.edu	37	X	53299994	53299996	+	Intron	DEL	CCT	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53299994_53299996delCCT	uc004dsd.2	-						IQSEC2_uc004dsc.2_Intron|IQSEC2_uc004dse.2_Intron|IQSEC2_uc004dsf.2_Intron	NM_001111125	NP_001104595	Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2 isoform1						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3						GTCATCTCCACCTCCTCCTCTCT	0.433													4	2	---	---	---	---	
BCYRN1	618	broad.mit.edu	37	X	70498353	70498353	+	Intron	DEL	T	-	-			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70498353delT	uc011mpt.1	-							NR_001568				Homo sapiens brain cytoplasmic RNA 1 (non-protein coding) (BCYRN1), non-coding RNA.												0						tcctaggttgttttttttttt	0.005													4	3	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101097232	101097233	+	Intron	INS	-	T	T			TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101097232_101097233insT	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						ttctttctttcttccatttctt	0.149													4	4	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101097235	101097236	+	Intron	INS	-	TTT	TTT	rs5986863	by1000genomes	TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101097235_101097236insTTT	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						tttctttcttccatttctttct	0.144													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13486779	13486779	+	IGR	DEL	C	-	-	rs77302109		TCGA-BP-4162-01A-02D-1386-10	TCGA-BP-4162-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13486779delC								None (None upstream) : None (None downstream)																							gtcacaatgtccccataggca	0.000													5	3	---	---	---	---	
