Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
UBR4	23352	broad.mit.edu	37	1	19488213	19488213	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19488213C>T	uc001bbi.2	-	37	5049	c.5045G>A	c.(5044-5046)TGT>TAT	p.C1682Y	UBR4_uc001bbm.1_Missense_Mutation_p.C893Y	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1682	UBR-type.				interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CACCATTTTACAGGTGTGACA	0.463													16	23	---	---	---	---	PASS
ZBTB40	9923	broad.mit.edu	37	1	22828055	22828055	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22828055A>G	uc001bft.2	+	5	1413	c.902A>G	c.(901-903)GAG>GGG	p.E301G	ZBTB40_uc001bfu.2_Missense_Mutation_p.E301G|ZBTB40_uc009vqi.1_Intron|ZBTB40_uc001bfv.1_5'Flank	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	301					bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		AAAGTAAGAGAGGAAAGCCTG	0.418													16	36	---	---	---	---	PASS
SLC25A24	29957	broad.mit.edu	37	1	108700179	108700179	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108700179C>T	uc001dvn.3	-	5	788	c.574G>A	c.(574-576)GGA>AGA	p.G192R	SLC25A24_uc001dvm.2_Missense_Mutation_p.G173R	NM_013386	NP_037518	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 member 24 isoform 1	192	Solcar 1.|Mitochondrial intermembrane (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)	1		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		CACCATTGTCCGGATTTTTTT	0.463													28	77	---	---	---	---	PASS
SYPL2	284612	broad.mit.edu	37	1	110020593	110020593	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110020593G>C	uc001dxp.2	+	5	976	c.610G>C	c.(610-612)GGG>CGG	p.G204R	SYPL2_uc001dxo.2_Missense_Mutation_p.G204R|SYPL2_uc010ovk.1_Intron|SYPL2_uc001dxq.2_Missense_Mutation_p.G112R	NM_001040709	NP_001035799	Q5VXT5	SYPL2_HUMAN	mitsugumin 29	204	Vesicular (Potential).|MARVEL.					integral to membrane|synaptic vesicle	transporter activity			ovary(1)	1		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		GTGCAGTGCCGGGGCCACGCC	0.647													12	26	---	---	---	---	PASS
ABL2	27	broad.mit.edu	37	1	179090792	179090792	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179090792C>T	uc001gmj.3	-	5	1185	c.898G>A	c.(898-900)GGA>AGA	p.G300R	ABL2_uc010pnf.1_Missense_Mutation_p.G300R|ABL2_uc010png.1_Missense_Mutation_p.G279R|ABL2_uc010pnh.1_Missense_Mutation_p.G279R|ABL2_uc009wxe.2_Missense_Mutation_p.G279R|ABL2_uc001gmg.3_Missense_Mutation_p.G285R|ABL2_uc001gmi.3_Missense_Mutation_p.G285R|ABL2_uc001gmh.3_Missense_Mutation_p.G264R|ABL2_uc010pne.1_Missense_Mutation_p.G264R|ABL2_uc009wxf.1_Missense_Mutation_p.G285R|ABL2_uc001gmk.2_Missense_Mutation_p.G264R	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	300	ATP (By similarity).|Protein kinase.				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TAAACCTCTCCATACTGACCG	0.448			T	ETV6	AML								65	104	---	---	---	---	PASS
SLC45A3	85414	broad.mit.edu	37	1	205632093	205632093	+	Missense_Mutation	SNP	C	T	T	rs138897809		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205632093C>T	uc001hda.1	-	3	1165	c.826G>A	c.(826-828)GTG>ATG	p.V276M	SLC45A3_uc010prn.1_5'Flank|SLC45A3_uc010pro.1_Missense_Mutation_p.V110M|SLC45A3_uc010prp.1_Intron|ELK4_uc010prq.1_Intron	NM_033102	NP_149093	Q96JT2	S45A3_HUMAN	prostein	276	Helical; Name=7; (Potential).				transmembrane transport	integral to membrane			SLC45A3/BRAF(2)	ovary(2)|prostate(2)	4	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			AGCTCAGCCACGAAGAGCCGG	0.672			T	ETV1|ETV5|ELK4|ERG	prostate 								10	20	---	---	---	---	PASS
TAF5L	27097	broad.mit.edu	37	1	229738593	229738593	+	Silent	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229738593C>A	uc001htq.2	-	4	487	c.321G>T	c.(319-321)CTG>CTT	p.L107L	TAF5L_uc001htr.2_Silent_p.L107L	NM_014409	NP_055224	O75529	TAF5L_HUMAN	PCAF associated factor 65 beta isoform a	107					histone H3 acetylation|transcription from RNA polymerase II promoter	STAGA complex|transcription factor TFTC complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				TGTTTTGGACCAGGTTGAGAT	0.448													34	46	---	---	---	---	PASS
KCNS3	3790	broad.mit.edu	37	2	18113665	18113665	+	Missense_Mutation	SNP	G	A	A	rs150320186		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18113665G>A	uc002rcv.2	+	3	1841	c.1390G>A	c.(1390-1392)GAT>AAT	p.D464N	KCNS3_uc002rcw.2_Missense_Mutation_p.D464N	NM_002252	NP_002243	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel	464	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity	p.D464N(1)		ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGTGGTGAGCGATCCTGACTC	0.453													15	81	---	---	---	---	PASS
KLRAQ1	129285	broad.mit.edu	37	2	48687267	48687267	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48687267G>T	uc002rwm.2	+	6	759	c.574G>T	c.(574-576)GAA>TAA	p.E192*	KLRAQ1_uc002rwi.1_Nonsense_Mutation_p.E192*|KLRAQ1_uc002rwj.2_Nonsense_Mutation_p.E192*|KLRAQ1_uc002rwl.2_Nonsense_Mutation_p.E146*|KLRAQ1_uc002rwk.2_Nonsense_Mutation_p.E192*|KLRAQ1_uc010yok.1_Nonsense_Mutation_p.E192*	NM_001135629	NP_001129101	Q6ZMI0	KLRAQ_HUMAN	KLRAQ motif containing 1 isoform 1	192	Potential.									ovary(1)	1						GGAAGCCAAGGAATGTCGACT	0.423													10	24	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89278126	89278126	+	Intron	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89278126T>C	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GGATGCACCATAGATGAGGAG	0.577													24	36	---	---	---	---	PASS
PAX8	7849	broad.mit.edu	37	2	114002144	114002144	+	Silent	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114002144C>T	uc010yxt.1	-	4	415	c.249G>A	c.(247-249)GTG>GTA	p.V83V	PAX8_uc010yxu.1_Silent_p.V83V|PAX8_uc010yxv.1_Silent_p.V83V|PAX8_uc002tjm.2_Silent_p.V83V|PAX8_uc002tjn.2_Silent_p.V83V|PAX8_uc010fku.1_Silent_p.V83V|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A	83	Paired.				branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						TGGGGGTGGCCACCTTGGGCT	0.567			T	PPARG	follicular thyroid		Thyroid dysgenesis 						10	238	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141032077	141032077	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141032077C>A	uc002tvj.1	-	85	14030	c.13058G>T	c.(13057-13059)GGA>GTA	p.G4353V		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4353	Extracellular (Potential).|EGF-like 13.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACATTTTGGTCCTTCATAGCG	0.433										TSP Lung(27;0.18)			30	72	---	---	---	---	PASS
UBR3	130507	broad.mit.edu	37	2	170863656	170863656	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170863656A>G	uc010zdi.1	+	28	4186	c.4186A>G	c.(4186-4188)ATA>GTA	p.I1396V	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Missense_Mutation_p.I217V|UBR3_uc002uft.3_Missense_Mutation_p.I249V|UBR3_uc010zdj.1_Missense_Mutation_p.I58V	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1396					sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						ACAAGATCTCATAAAGGAAGT	0.453													6	23	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179437362	179437362	+	Silent	SNP	T	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179437362T>A	uc010zfg.1	-	275	66017	c.65793A>T	c.(65791-65793)CTA>CTT	p.L21931L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L15626L|TTN_uc010zfi.1_Silent_p.L15559L|TTN_uc010zfj.1_Silent_p.L15434L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22858							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTACAGTTAGTATATATT	0.403													34	70	---	---	---	---	PASS
RUFY4	285180	broad.mit.edu	37	2	218954028	218954028	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218954028A>C	uc002vgw.2	+	13	2881	c.1037A>C	c.(1036-1038)GAG>GCG	p.E346A	RUFY4_uc002vgy.1_RNA|RUFY4_uc010fvl.1_Missense_Mutation_p.E346A	NM_198483	NP_940885	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	519	FYVE-type.						metal ion binding			pancreas(1)	1		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		ATGGCTCCCGAGTGCTGTGTG	0.507													6	14	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225721605	225721605	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225721605G>C	uc010fwz.1	-	15	2019	c.1780C>G	c.(1780-1782)CTA>GTA	p.L594V	DOCK10_uc002vob.2_Missense_Mutation_p.L588V	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	594							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGTTTAACTAGGTCCTCAGTT	0.313													13	11	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9785380	9785380	+	Silent	SNP	C	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9785380C>G	uc003bse.2	+	8	2811	c.2412C>G	c.(2410-2412)GGC>GGG	p.G804G	BRPF1_uc003bsf.2_Silent_p.G810G|BRPF1_uc003bsg.2_Silent_p.G803G|BRPF1_uc011ati.1_Silent_p.G804G	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	804	Required for RUNX1 and RUNX2 transcriptional activation.|Interaction with MEAF6 and ING5.				histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					AGAGTGTGGGCCGCTCACGGC	0.587													18	4	---	---	---	---	PASS
VIPR1	7433	broad.mit.edu	37	3	42568970	42568970	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42568970C>T	uc003clf.2	+	5	609	c.485C>T	c.(484-486)GCT>GTT	p.A162V	VIPR1_uc011azl.1_Missense_Mutation_p.A114V|VIPR1_uc011azm.1_Intron|VIPR1_uc011azn.1_Missense_Mutation_p.A135V	NM_004624	NP_004615	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	162	Helical; Name=1; (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|muscle contraction|positive regulation of cell proliferation|synaptic transmission	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.241)		GTCGCCACAGCTATCCTGAGC	0.617													27	11	---	---	---	---	PASS
NBEAL2	23218	broad.mit.edu	37	3	47038048	47038048	+	Silent	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47038048G>A	uc003cqp.2	+	16	2618	c.2439G>A	c.(2437-2439)CTG>CTA	p.L813L	NBEAL2_uc010hjm.1_Silent_p.L374L	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	813							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		ACGAAGCCCTGCAGGCGACGG	0.662													3	3	---	---	---	---	PASS
ZNF595	152687	broad.mit.edu	37	4	59391	59391	+	Silent	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59391C>T	uc003fzv.1	+	2	228	c.72C>T	c.(70-72)GCC>GCT	p.A24A	ZNF595_uc003fzu.1_RNA|ZNF718_uc003fzt.3_Silent_p.S24S|ZNF595_uc010iay.1_RNA|ZNF595_uc011bus.1_5'UTR|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595	24					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TGGACCCTGCCCAGCAGAATT	0.428													40	597	---	---	---	---	PASS
POLR2B	5431	broad.mit.edu	37	4	57876947	57876947	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57876947T>G	uc003hcl.1	+	12	1625	c.1582T>G	c.(1582-1584)TTG>GTG	p.L528V	POLR2B_uc011cae.1_Missense_Mutation_p.L521V|POLR2B_uc011caf.1_Missense_Mutation_p.L453V|POLR2B_uc003hcm.1_Missense_Mutation_p.L21V	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B	528					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					GAATTTAGCCTTGATGGCGTA	0.343													58	124	---	---	---	---	PASS
AIMP1	9255	broad.mit.edu	37	4	107252948	107252948	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107252948G>A	uc011cfg.1	+	5	563	c.511G>A	c.(511-513)GCA>ACA	p.A171T	AIMP1_uc003hyg.2_Missense_Mutation_p.A171T|AIMP1_uc003hyh.2_Missense_Mutation_p.A195T	NM_001142415	NP_001135887	Q12904	AIMP1_HUMAN	small inducible cytokine subfamily E, member 1	171	tRNA-binding.|Interaction with HSP90B1 (By similarity).|Required for endothelial cell migration.				angiogenesis|apoptosis|cell adhesion|cell-cell signaling|chemotaxis|glucose metabolic process|inflammatory response|leukocyte migration|negative regulation of endothelial cell proliferation|signal transduction|tRNA aminoacylation for protein translation	aminoacyl-tRNA synthetase multienzyme complex|cytosol|endoplasmic reticulum|extracellular space|Golgi apparatus|nucleus|transport vesicle	cell surface binding|cytokine activity|protein homodimerization activity|tRNA binding				0						ACACCCTGATGCAGATTCTTT	0.448													82	127	---	---	---	---	PASS
ZFR	51663	broad.mit.edu	37	5	32403288	32403288	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32403288G>A	uc003jhr.1	-	8	1519	c.1439C>T	c.(1438-1440)ACA>ATA	p.T480I		NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	480					multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		AGTGTTAGATGTGCTATTAAG	0.358													37	171	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35065723	35065723	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35065723G>A	uc003jjm.2	-	10	1867	c.1337C>T	c.(1336-1338)GCA>GTA	p.A446V	PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Missense_Mutation_p.A345V	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	446	Cytoplasmic (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	AGTGGCCGGTGCACCTGCAGG	0.507													74	74	---	---	---	---	PASS
CXCL14	9547	broad.mit.edu	37	5	134907401	134907401	+	3'UTR	SNP	A	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134907401A>G	uc003lay.2	-	4						NM_004887	NP_004878	O95715	CXL14_HUMAN	small inducible cytokine B14 precursor						cell-cell signaling|chemotaxis|immune response|signal transduction	extracellular space|Golgi apparatus	chemokine activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ACAATATATAATTTGTGTCTT	0.323													5	14	---	---	---	---	PASS
TGFBI	7045	broad.mit.edu	37	5	135385220	135385220	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135385220C>G	uc003lbf.3	+	7	1025	c.864C>G	c.(862-864)ATC>ATG	p.I288M	TGFBI_uc003lbg.3_Missense_Mutation_p.I21M|TGFBI_uc003lbh.3_Missense_Mutation_p.I114M|TGFBI_uc011cyb.1_Missense_Mutation_p.I114M|TGFBI_uc010jed.2_Missense_Mutation_p.I21M	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	288	FAS1 2.				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCGAGAAGATCCCTAGTGAGA	0.567													18	27	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169494675	169494675	+	Silent	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169494675C>T	uc003maf.2	+	45	4709	c.4629C>T	c.(4627-4629)TTC>TTT	p.F1543F	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.F1035F|DOCK2_uc003mah.2_Silent_p.F99F	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1543	DHR-2.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGGAGGCTTCGCCAAGTATG	0.552													56	57	---	---	---	---	PASS
GRK6	2870	broad.mit.edu	37	5	176863393	176863393	+	Splice_Site	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176863393G>T	uc011dfz.1	+	13	1427	c.1267_splice	c.e13-1	p.L423_splice	GRK6_uc003mgp.2_Splice_Site_p.L423_splice|GRK6_uc003mgq.2_Splice_Site_p.L423_splice|GRK6_uc003mgs.1_Splice_Site_p.L393_splice	NM_002082	NP_002073	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6 isoform B						regulation of G-protein coupled receptor protein signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)|stomach(1)|breast(1)	3	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCTGCCACAGCTCCTCTGCA	0.662													3	24	---	---	---	---	PASS
PRPF4B	8899	broad.mit.edu	37	6	4032532	4032532	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4032532G>T	uc003mvv.2	+	2	872	c.781G>T	c.(781-783)GAT>TAT	p.D261Y	PRPF4B_uc011dhv.1_RNA	NM_003913	NP_003904	Q13523	PRP4B_HUMAN	serine/threonine-protein kinase PRP4K	261	Arg/Lys-rich (basic).					catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(5)	5	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TCCTACTGATGATAAGGTTAA	0.353													54	107	---	---	---	---	PASS
TMEM14B	81853	broad.mit.edu	37	6	10756854	10756854	+	3'UTR	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10756854C>T	uc003mzk.3	+	6					SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jor.2_3'UTR|TMEM14B_uc010jos.1_Intron	NM_030969	NP_112231	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B isoform a							integral to membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TTGCATCTGACATTTTACCTA	0.373													3	9	---	---	---	---	PASS
SLC26A8	116369	broad.mit.edu	37	6	35987387	35987387	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35987387T>A	uc003olm.2	-	2	209	c.98A>T	c.(97-99)GAG>GTG	p.E33V	SLC26A8_uc003oln.2_Missense_Mutation_p.E33V|SLC26A8_uc003oll.2_Missense_Mutation_p.E33V	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	33	Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						TTGAAAGGTCTCCTCATTGTA	0.498													13	20	---	---	---	---	PASS
CPNE5	57699	broad.mit.edu	37	6	36742765	36742765	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36742765C>A	uc003omr.1	-	10	777	c.710G>T	c.(709-711)AGA>ATA	p.R237I	CPNE5_uc003oms.1_Missense_Mutation_p.R216I	NM_020939	NP_065990	Q9HCH3	CPNE5_HUMAN	copine V	237	C2 2.									skin(1)	1						GCAGAGGGCTCTCACGGGAAT	0.522													11	14	---	---	---	---	PASS
TTBK1	84630	broad.mit.edu	37	6	43237449	43237449	+	Intron	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43237449C>T	uc003ouq.1	+						TTBK1_uc011dvg.1_Silent_p.S208S	NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1							cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TGGCGTCCTCCGTGTTCTCCT	0.657													6	8	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159659602	159659602	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159659602G>A	uc010kjv.2	+	13	4285	c.4085G>A	c.(4084-4086)CGT>CAT	p.R1362H	FNDC1_uc010kjw.1_Missense_Mutation_p.R1247H	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1362						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GACCTTGATCGTGGGTTAGTA	0.373													3	9	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160461597	160461597	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160461597G>T	uc003qta.2	+	11	1469	c.1321G>T	c.(1321-1323)GAT>TAT	p.D441Y		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	441	Lumenal (Potential).|3.				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		TGCAGGTAACGATGGGAAAGG	0.463													47	68	---	---	---	---	PASS
C7orf27	221927	broad.mit.edu	37	7	2577853	2577853	+	Silent	SNP	C	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2577853C>G	uc003smi.2	-	14	2358	c.2316G>C	c.(2314-2316)GTG>GTC	p.V772V	C7orf27_uc003smh.3_Silent_p.V204V	NM_152743	NP_689956	Q6PJG6	BRAT1_HUMAN	hypothetical protein LOC221927 precursor	772					response to ionizing radiation	nucleus	protein binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)		GCATGGCCAGCACAGCCTCAG	0.706													16	13	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37955990	37955990	+	Silent	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37955990C>A	uc003tfo.3	-	1	536	c.150G>T	c.(148-150)ACG>ACT	p.T50T		NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor	50	FZ.				brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						CGTTCTCCTGCGTGCTGTGGT	0.667													16	28	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51098700	51098700	+	Intron	SNP	A	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51098700A>T	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron|COBL_uc003tpo.3_5'UTR	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					AACAGCTCATACTCAAATTCA	0.348													7	8	---	---	---	---	PASS
SAMD9	54809	broad.mit.edu	37	7	92732506	92732506	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92732506T>G	uc003umf.2	-	3	3161	c.2905A>C	c.(2905-2907)AAA>CAA	p.K969Q	SAMD9_uc003umg.2_Missense_Mutation_p.K969Q	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	969						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			ACCTCTGTTTTTATCAGAATT	0.398													44	83	---	---	---	---	PASS
IMPDH1	3614	broad.mit.edu	37	7	128049515	128049515	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128049515T>C	uc003vmu.2	-	2	251	c.170A>G	c.(169-171)CAC>CGC	p.H57R	IMPDH1_uc003vmw.2_Intron|IMPDH1_uc011kon.1_Missense_Mutation_p.H57R|IMPDH1_uc003vmv.2_Intron|IMPDH1_uc003vmx.2_Intron|IMPDH1_uc003vmy.2_Intron	NM_000883	NP_000874	P20839	IMDH1_HUMAN	inosine monophosphate dehydrogenase 1 isoform a	Error:Variant_position_missing_in_P20839_after_alignment					GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	DNA binding|IMP dehydrogenase activity|metal ion binding			skin(2)|lung(1)|central_nervous_system(1)	4					Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)	TGTCGTCGGGTGTGTAGCGAG	0.557													37	94	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151962234	151962234	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151962234A>C	uc003wla.2	-	8	1292	c.1073T>G	c.(1072-1074)TTT>TGT	p.F358C		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	358	PHD-type 1.|RING-type.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AGTAGTACAAAAGAACTGATC	0.433			N		medulloblastoma								10	262	---	---	---	---	PASS
FAM86B1	85002	broad.mit.edu	37	8	12044016	12044016	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12044016T>A	uc010lse.2	-	5	530	c.485A>T	c.(484-486)CAG>CTG	p.Q162L	FAM66D_uc011kxp.1_Intron|FAM86B1_uc003wvf.3_Intron|FAM86B1_uc003wvi.3_Intron|FAM86B1_uc010lsd.2_Intron|FAM86B1_uc003wvh.3_Intron|FAM86B1_uc011kxq.1_Intron|FAM86B1_uc010lsf.2_Intron|FAM86B1_uc003wvj.3_Missense_Mutation_p.Q96L|FAM86B1_uc003wvk.3_Missense_Mutation_p.Q196L|FAM86B1_uc010lsg.2_Intron|FAM86B1_uc003wvl.3_Intron	NM_001083537	NP_001077006	Q8N7N1	F86B1_HUMAN	hypothetical protein LOC85002	162											0			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		CCCTCGGAGCTGCTCGAGGAC	0.617													5	46	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	12950255	12950255	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12950255C>G	uc003wwm.2	-	13	4050	c.3606G>C	c.(3604-3606)CAG>CAC	p.Q1202H	DLC1_uc003wwk.1_Missense_Mutation_p.Q765H|DLC1_uc003wwl.1_Missense_Mutation_p.Q799H|DLC1_uc011kxx.1_Missense_Mutation_p.Q691H	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	1202	Rho-GAP.				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						AAAGCAGGGTCTGCAGAACCT	0.572													6	15	---	---	---	---	PASS
PLEKHA2	59339	broad.mit.edu	37	8	38775521	38775521	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38775521T>A	uc003xmi.3	+	2	308	c.74T>A	c.(73-75)TTT>TAT	p.F25Y	PLEKHA2_uc011lce.1_Intron	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A	25	PH 1.				positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			AGCGGCAAGTTTCTGCGGAGG	0.567													8	20	---	---	---	---	PASS
CPA6	57094	broad.mit.edu	37	8	68658368	68658368	+	5'UTR	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68658368G>A	uc003xxq.3	-	1					CPA6_uc003xxr.3_5'UTR|CPA6_uc003xxs.2_5'UTR	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			ACTTCATAGTGTTAAGAAGAG	0.562													16	17	---	---	---	---	PASS
WWP1	11059	broad.mit.edu	37	8	87464827	87464827	+	Silent	SNP	A	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87464827A>G	uc003ydt.2	+	21	2593	c.2313A>G	c.(2311-2313)GAA>GAG	p.E771E		NM_007013	NP_008944	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase	771	HECT.				central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			lung(1)|liver(1)	2						GAGTACAAGAACAGACCAAAG	0.318													33	62	---	---	---	---	PASS
ZNF623	9831	broad.mit.edu	37	8	144733697	144733697	+	3'UTR	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144733697G>T	uc003yzd.2	+	1					ZNF623_uc011lkp.1_3'UTR|ZNF623_uc003yzc.2_3'UTR	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGAAATGCGTGGAATTAGGAT	0.453													14	23	---	---	---	---	PASS
ZNF16	7564	broad.mit.edu	37	8	146156465	146156465	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146156465G>T	uc003zet.2	-	4	1895	c.1708C>A	c.(1708-1710)CTG>ATG	p.L570M	ZNF16_uc003zeu.2_Missense_Mutation_p.L570M	NM_001029976	NP_001025147	P17020	ZNF16_HUMAN	zinc finger protein 16	570					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		TGGGGCTTCAGCCCATTATGA	0.473													19	23	---	---	---	---	PASS
JAK2	3717	broad.mit.edu	37	9	5073717	5073717	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5073717G>T	uc010mhm.2	+	13	1909	c.1796G>T	c.(1795-1797)AGT>ATT	p.S599I	JAK2_uc003ziw.2_Missense_Mutation_p.S599I	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	599	Protein kinase 1.				actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		GAAGCAGCAAGTATGATGAGC	0.338		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				46	94	---	---	---	---	PASS
TUBAL3	79861	broad.mit.edu	37	10	5436080	5436080	+	Silent	SNP	G	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5436080G>C	uc001ihy.2	-	4	781	c.741C>G	c.(739-741)GCC>GCG	p.A247A	TUBAL3_uc001ihz.2_Silent_p.A207A	NM_024803	NP_079079	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	247					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			skin(1)	1						ACCGGAGGGAGGCAGTGATGG	0.493													6	74	---	---	---	---	PASS
ITIH2	3698	broad.mit.edu	37	10	7759749	7759749	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7759749G>C	uc001ijs.2	+	6	790	c.628G>C	c.(628-630)GAG>CAG	p.E210Q		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	210					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						CAAACACTTAGAGGTAAGCCT	0.507													39	72	---	---	---	---	PASS
FAM21C	253725	broad.mit.edu	37	10	46272804	46272804	+	Silent	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46272804G>A	uc001jcu.2	+	22	2325	c.2226G>A	c.(2224-2226)GTG>GTA	p.V742V	FAM21C_uc001jcs.1_Intron|FAM21C_uc001jct.2_Silent_p.V740V|FAM21C_uc010qfi.1_Intron|FAM21C_uc010qfj.1_5'UTR|FAM21C_uc010qfk.1_5'UTR	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725	742										ovary(1)	1						TGAAGTCTGTGGATAAGAAGG	0.423													23	60	---	---	---	---	PASS
SEC24C	9632	broad.mit.edu	37	10	75520026	75520026	+	Silent	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75520026C>T	uc001juw.2	+	6	911	c.732C>T	c.(730-732)CCC>CCT	p.P244P	SEC24C_uc010qkn.1_RNA|SEC24C_uc009xrj.1_Silent_p.P102P|SEC24C_uc001jux.2_Silent_p.P244P|SEC24C_uc010qko.1_Silent_p.P102P|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	NM_004922	NP_004913	P53992	SC24C_HUMAN	SEC24-related protein C	244					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding			skin(2)|central_nervous_system(1)	3	Prostate(51;0.0112)					TGAGCCAGCCCAACCATGTGT	0.642													29	77	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127824195	127824195	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127824195T>A	uc001ljk.2	-	5	796	c.383A>T	c.(382-384)TAT>TTT	p.Y128F	ADAM12_uc010qul.1_Missense_Mutation_p.Y125F|ADAM12_uc001ljm.2_Missense_Mutation_p.Y128F|ADAM12_uc001ljn.2_Missense_Mutation_p.Y125F|ADAM12_uc001ljl.3_Missense_Mutation_p.Y125F	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	128					cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TGAATCAGAATATCCCCGTAC	0.468													9	29	---	---	---	---	PASS
FAM160A2	84067	broad.mit.edu	37	11	6233063	6233063	+	Silent	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6233063G>T	uc001mcl.3	-	12	2951	c.2592C>A	c.(2590-2592)CTC>CTA	p.L864L	FAM160A2_uc001mck.3_Silent_p.L878L	NM_001098794	NP_001092264	Q8N612	F16A2_HUMAN	hypothetical protein LOC84067 isoform 2	864					early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|protein transport	FHF complex	protein binding			skin(2)	2						CATGCCGCAGGAGTAACTCCC	0.617													42	83	---	---	---	---	PASS
CTNND1	1500	broad.mit.edu	37	11	57571149	57571149	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57571149G>A	uc001nmc.3	+	8	2048	c.1477G>A	c.(1477-1479)GCA>ACA	p.A493T	CTNND1_uc001nlh.1_Missense_Mutation_p.A493T|CTNND1_uc001nlu.3_Missense_Mutation_p.A392T|CTNND1_uc001nlt.3_Missense_Mutation_p.A392T|CTNND1_uc001nls.3_Missense_Mutation_p.A392T|CTNND1_uc001nlw.3_Missense_Mutation_p.A392T|CTNND1_uc001nmf.3_Missense_Mutation_p.A493T|CTNND1_uc001nmd.3_Missense_Mutation_p.A439T|CTNND1_uc001nlk.3_Missense_Mutation_p.A439T|CTNND1_uc001nme.3_Missense_Mutation_p.A493T|CTNND1_uc001nll.3_Missense_Mutation_p.A439T|CTNND1_uc001nmg.3_Missense_Mutation_p.A439T|CTNND1_uc001nlj.3_Missense_Mutation_p.A439T|CTNND1_uc001nlr.3_Missense_Mutation_p.A439T|CTNND1_uc001nlp.3_Missense_Mutation_p.A439T|CTNND1_uc001nlx.3_Missense_Mutation_p.A170T|CTNND1_uc001nlz.3_Missense_Mutation_p.A170T|CTNND1_uc009ymn.2_Missense_Mutation_p.A170T|CTNND1_uc001nlm.3_Missense_Mutation_p.A493T|CTNND1_uc001nly.3_Missense_Mutation_p.A170T|CTNND1_uc001nmb.3_Missense_Mutation_p.A170T|CTNND1_uc001nma.3_Missense_Mutation_p.A170T|CTNND1_uc001nmi.3_Missense_Mutation_p.A392T|CTNND1_uc001nmh.3_Missense_Mutation_p.A493T|CTNND1_uc001nlq.3_Missense_Mutation_p.A392T|CTNND1_uc001nln.3_Missense_Mutation_p.A493T|CTNND1_uc001nli.3_Missense_Mutation_p.A493T|CTNND1_uc001nlo.3_Missense_Mutation_p.A392T|CTNND1_uc001nlv.3_Missense_Mutation_p.A392T	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC	493	ARM 4.				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				TGTGGACCATGCACTGCATGC	0.468													13	16	---	---	---	---	PASS
SLC15A3	51296	broad.mit.edu	37	11	60714170	60714170	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60714170G>T	uc001nqn.2	-	2	916	c.682C>A	c.(682-684)CTG>ATG	p.L228M	SLC15A3_uc001nqo.2_Missense_Mutation_p.L228M	NM_016582	NP_057666	Q8IY34	S15A3_HUMAN	solute carrier family 15, member 3	228					oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0						CTGTAGCCCAGCAGGAAGCTG	0.572													35	67	---	---	---	---	PASS
MUS81	80198	broad.mit.edu	37	11	65629418	65629418	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65629418G>C	uc001ofv.3	+	4	705	c.352G>C	c.(352-354)GTT>CTT	p.V118L	CFL1_uc001oft.2_5'Flank|MUS81_uc001ofw.3_RNA|MUS81_uc001ofx.3_5'Flank	NM_025128	NP_079404	Q96NY9	MUS81_HUMAN	MUS81 endonuclease homolog	118					DNA recombination|DNA repair	nucleolus	3'-flap endonuclease activity|DNA binding|metal ion binding|protein binding				0				READ - Rectum adenocarcinoma(159;0.166)		TACCTTTCAGGTTCCTGCCCA	0.443								Homologous_recombination					3	3	---	---	---	---	PASS
GPR152	390212	broad.mit.edu	37	11	67219269	67219269	+	Silent	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67219269C>A	uc001olm.2	-	1	932	c.927G>T	c.(925-927)GTG>GTT	p.V309V	uc009yrw.1_5'Flank|CABP4_uc001oln.2_5'Flank	NM_206997	NP_996880	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	309	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			AGGACGAGAGCACGGAGCGCA	0.647													16	25	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70201888	70201888	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70201888G>A	uc001opo.2	+	18	2657	c.2459G>A	c.(2458-2460)GGA>GAA	p.G820E	PPFIA1_uc001opn.1_Missense_Mutation_p.G820E|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	820					cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GGCCGACCTGGACAAACTGGC	0.542													18	40	---	---	---	---	PASS
AQP11	282679	broad.mit.edu	37	11	77314713	77314713	+	Silent	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77314713T>C	uc001oyj.2	+	2	1090	c.732T>C	c.(730-732)TCT>TCC	p.S244S	AQP11_uc009yuu.2_RNA	NM_173039	NP_766627	Q8NBQ7	AQP11_HUMAN	aquaporin 11	244	Helical; Name=6; (Potential).					cell surface|integral to membrane	transporter activity				0	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			TGGCTCCTTCTTTAGGTAAGC	0.338													61	102	---	---	---	---	PASS
NLRX1	79671	broad.mit.edu	37	11	119045325	119045325	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119045325C>T	uc001pvu.2	+	6	1228	c.1013C>T	c.(1012-1014)TCA>TTA	p.S338L	NLRX1_uc010rzc.1_Missense_Mutation_p.S160L|NLRX1_uc001pvv.2_Missense_Mutation_p.S338L|NLRX1_uc001pvw.2_Missense_Mutation_p.S338L|NLRX1_uc001pvx.2_Missense_Mutation_p.S338L	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	338	Required for interaction with MAVS.|NACHT.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GTTGGCGGTTCAGGTGTCTCT	0.612													32	74	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6690827	6690827	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6690827C>T	uc001qpo.2	-	31	4833	c.4669G>A	c.(4669-4671)GTC>ATC	p.V1557I	CHD4_uc001qpn.2_Missense_Mutation_p.V1550I|CHD4_uc001qpp.2_Missense_Mutation_p.V1582I|uc001qpq.1_Intron|SCARNA11_uc001qpr.1_5'Flank	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1557					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						GCAGGTGGGACAGGTGCAGGA	0.542													24	36	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46318555	46318555	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46318555G>T	uc001rox.2	-	12	4149	c.3862C>A	c.(3862-3864)CAA>AAA	p.Q1288K	SFRS2IP_uc001row.2_Missense_Mutation_p.Q973K	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	1288					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		TAGTTGACTTGTTGGGATGGT	0.473													15	51	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46318557	46318557	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46318557T>C	uc001rox.2	-	12	4147	c.3860A>G	c.(3859-3861)CAA>CGA	p.Q1287R	SFRS2IP_uc001row.2_Missense_Mutation_p.Q972R	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	1287					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		GTTGACTTGTTGGGATGGTGG	0.478													15	52	---	---	---	---	PASS
KRT6C	286887	broad.mit.edu	37	12	52864378	52864378	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52864378C>G	uc001sal.3	-	6	1162	c.1114G>C	c.(1114-1116)GAC>CAC	p.D372H		NM_173086	NP_775109	P48668	K2C6C_HUMAN	keratin 6C	372	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0828)		CGCAGGTCGTCCCCATGTCTG	0.557													14	41	---	---	---	---	PASS
KRT72	140807	broad.mit.edu	37	12	52979562	52979562	+	3'UTR	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52979562C>A	uc001sar.2	-	10					KRT72_uc001saq.2_3'UTR|KRT72_uc010sns.1_3'UTR	NM_001146225	NP_001139697	Q14CN4	K2C72_HUMAN	keratin 72 isoform 1							keratin filament	structural molecule activity			ovary(5)|pancreas(1)	6				BRCA - Breast invasive adenocarcinoma(357;0.195)		GAAACGGGACCAAGAAGGAGG	0.542													5	5	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57112266	57112266	+	Intron	SNP	A	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57112266A>G	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Silent_p.P1016P|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Intron|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						TGGGGGAGGGAGGAGTCACAG	0.647			T	BCL6	NHL								6	26	---	---	---	---	PASS
GEFT	115557	broad.mit.edu	37	12	58007969	58007969	+	Intron	SNP	A	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58007969A>C	uc001spb.2	+						GEFT_uc009zpy.2_Intron|GEFT_uc001soz.1_Intron|GEFT_uc001spa.2_Intron|uc001spc.2_Intron|GEFT_uc001spd.2_5'UTR	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1						regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					CTGTATCCTAACATCAGCCCA	0.537													6	24	---	---	---	---	PASS
HELB	92797	broad.mit.edu	37	12	66731858	66731858	+	Silent	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66731858G>A	uc001sti.2	+	13	3268	c.3240G>A	c.(3238-3240)AAG>AAA	p.K1080K	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	1080					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		AACTTTTCAAGCCCACCGATA	0.343													27	41	---	---	---	---	PASS
CLLU1OS	574016	broad.mit.edu	37	12	92818886	92818886	+	Intron	SNP	T	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92818886T>G	uc001tcb.1	-						CLLU1_uc001tcc.2_Intron|CLLU1_uc001tcd.2_Intron|CLLU1_uc001tce.1_Intron|CLLU1_uc001tcf.2_RNA	NM_001025232	NP_001020403	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1												0						TTAAACATATTCCTCGTACCA	0.328													9	16	---	---	---	---	PASS
MTERFD3	80298	broad.mit.edu	37	12	107371722	107371722	+	Silent	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107371722T>C	uc001tme.1	-	2	2590	c.771A>G	c.(769-771)CAA>CAG	p.Q257Q	MTERFD3_uc001tmf.1_Silent_p.Q257Q|MTERFD3_uc001tmg.1_Silent_p.Q257Q|MTERFD3_uc001tmh.1_Silent_p.Q257Q	NM_025198	NP_079474	Q49AM1	MTER3_HUMAN	transcription termination factor-like protein	257					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	transcription regulatory region DNA binding				0						TTGGGCAAAGTTGAAAAAGAA	0.373													35	89	---	---	---	---	PASS
SSH1	54434	broad.mit.edu	37	12	109186220	109186220	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109186220C>T	uc001tnm.2	-	14	1822	c.1735G>A	c.(1735-1737)GGT>AGT	p.G579S	SSH1_uc001tnl.2_Missense_Mutation_p.G267S|SSH1_uc010sxg.1_Missense_Mutation_p.G590S|SSH1_uc001tnn.3_Missense_Mutation_p.G579S	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1	579					actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						CCGCTCCGACCTTTGGGACTC	0.607													24	41	---	---	---	---	PASS
ANAPC7	51434	broad.mit.edu	37	12	110815266	110815266	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110815266A>T	uc001tqo.2	-	9	1392	c.1391T>A	c.(1390-1392)TTA>TAA	p.L464*	ANAPC7_uc001tqp.3_Nonsense_Mutation_p.L464*	NM_016238	NP_057322	Q9UJX3	APC7_HUMAN	anaphase-promoting complex subunit 7 isoform a	464	TPR 5.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding				0						TTTATCTAATAATGTTTTGGC	0.418													56	98	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112186993	112186993	+	Silent	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112186993C>T	uc001tsq.2	+	18	2861	c.2661C>T	c.(2659-2661)GTC>GTT	p.V887V	ACAD10_uc001tsp.2_3'UTR|ACAD10_uc009zvx.2_Silent_p.V918V|ACAD10_uc001tss.1_Intron	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	887							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						ATGGTGAAGTCCGATTTGAGC	0.547													68	132	---	---	---	---	PASS
C13orf1	57213	broad.mit.edu	37	13	50495711	50495711	+	Silent	SNP	A	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50495711A>G	uc001vdl.2	-	4	658	c.396T>C	c.(394-396)ATT>ATC	p.I132I	C13orf1_uc001vdm.2_Silent_p.I93I|C13orf1_uc010tgm.1_RNA|C13orf1_uc010adj.2_Silent_p.I132I	NM_020456	NP_065189	Q5W111	SPRY7_HUMAN	chromosome 13 open reading frame 1 isoform 1	132	B30.2/SPRY.										0		Lung NSC(96;7.5e-06)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Acute lymphoblastic leukemia(7;0.117)		GBM - Glioblastoma multiforme(99;1.72e-10)|COAD - Colon adenocarcinoma(199;0.208)		GGTCATAAGTAATACCCTAGG	0.393													29	41	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	55004493	55004493	+	Silent	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55004493C>T	uc001xay.2	+	5	715	c.624C>T	c.(622-624)TGC>TGT	p.C208C	CGRRF1_uc010tra.1_Silent_p.C208C|CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	208					cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						AACTATCCTGCAGAATATTGT	0.318													15	45	---	---	---	---	PASS
C14orf45	80127	broad.mit.edu	37	14	74489763	74489763	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74489763A>T	uc010tup.1	+	2	324	c.201A>T	c.(199-201)TTA>TTT	p.L67F		NM_025057	NP_079333	Q8ND07	CN045_HUMAN	hypothetical protein LOC80127	67											0				BRCA - Breast invasive adenocarcinoma(234;0.00351)		ATGAGGACTTAAAGAAAAAGC	0.398													6	9	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105418187	105418187	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105418187A>C	uc010axc.1	-	7	3721	c.3601T>G	c.(3601-3603)TCC>GCC	p.S1201A	AHNAK2_uc001ypx.2_Missense_Mutation_p.S1101A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1201						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCTGCATGGAGGGGAGACTC	0.637													7	92	---	---	---	---	PASS
SERF2	10169	broad.mit.edu	37	15	44087848	44087848	+	3'UTR	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44087848G>T	uc001zsz.3	+	3					ELL3_uc001zsx.1_Intron|C15orf63_uc001ztb.2_Intron|MIR1282_hsa-mir-1282|MI0006429_5'Flank|SERINC4_uc001ztc.1_Intron|SERINC4_uc001ztd.1_Intron|SERINC4_uc010bds.1_Intron|SERINC4_uc001zte.1_Intron	NM_001018108	NP_001018118	P84101	SERF2_HUMAN	small EDRK-rich factor 2							cytosol|nucleus					0		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		ACTCCACAGAGATCTACCACT	0.512													44	80	---	---	---	---	PASS
MPV17L	255027	broad.mit.edu	37	16	15501886	15501886	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15501886A>T	uc002ddn.2	+	4	652	c.508A>T	c.(508-510)AGT>TGT	p.S170C	MPV17L_uc002ddm.2_Missense_Mutation_p.E146V	NM_001128423	NP_001121895	Q2QL34	MP17L_HUMAN	MPV17 mitochondrial membrane protein-like	170	Cytoplasmic.					integral to membrane|peroxisomal membrane					0						TTCCCAGCAGAGTGGTGACGG	0.488													19	27	---	---	---	---	PASS
METTL9	51108	broad.mit.edu	37	16	21666709	21666709	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21666709T>A	uc002dje.2	+	5	1112	c.913T>A	c.(913-915)TAC>AAC	p.Y305N	uc002diq.3_Intron|METTL9_uc002djf.2_Missense_Mutation_p.Y304N|IGSF6_uc002djg.1_5'Flank|IGSF6_uc010vbi.1_5'Flank	NM_016025	NP_057109	Q9H1A3	METL9_HUMAN	methyltransferase like 9 isoform 1	305										ovary(1)	1				GBM - Glioblastoma multiforme(48;0.0759)		GTATAATGACTACTACGTTCT	0.463													20	52	---	---	---	---	PASS
COQ9	57017	broad.mit.edu	37	16	57490826	57490826	+	Intron	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57490826T>C	uc002elq.2	+						COQ9_uc010vhn.1_3'UTR|COQ9_uc010vho.1_Intron|COQ9_uc010vhp.1_Intron|COQ9_uc002elr.2_Intron|COQ9_uc002els.2_5'Flank	NM_020312	NP_064708	O75208	COQ9_HUMAN	coenzyme Q9 homolog precursor						ubiquinone biosynthetic process	mitochondrion				breast(1)	1						CACACTGTTTTCTTTTCCCTC	0.557													15	23	---	---	---	---	PASS
CIRH1A	84916	broad.mit.edu	37	16	69177074	69177074	+	Intron	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69177074T>C	uc002ews.3	+						CIRH1A_uc002ewr.2_Intron|CIRH1A_uc002ewt.3_Intron|CIRH1A_uc010cfi.2_Intron|CIRH1A_uc010cfj.1_5'UTR	NM_032830	NP_116219	Q969X6	CIR1A_HUMAN	cirhin							nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)		CTTTTCTGATTTTTCAGGCAG	0.373													42	48	---	---	---	---	PASS
ALOXE3	59344	broad.mit.edu	37	17	8018347	8018347	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8018347A>C	uc010cnr.2	-	5	833	c.463T>G	c.(463-465)TGC>GGC	p.C155G	ALOXE3_uc002gka.2_Missense_Mutation_p.C311G|ALOXE3_uc010vuo.1_Missense_Mutation_p.C287G|ALOXE3_uc010vup.1_RNA	NM_021628	NP_067641	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3 isoform 2	155	Lipoxygenase.			C -> R (in Ref. 1; CAC12843).	leukotriene biosynthetic process		iron ion binding|lipoxygenase activity			skin(3)|lung(1)|central_nervous_system(1)	5						TCTACCATGCAGGGGAAGCCA	0.493													62	109	---	---	---	---	PASS
SGK494	124923	broad.mit.edu	37	17	26940338	26940338	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26940338G>C	uc002hbr.1	-	3	382	c.350C>G	c.(349-351)TCC>TGC	p.S117C	SGK494_uc010waq.1_Missense_Mutation_p.S117C|SGK494_uc010war.1_RNA|uc010crq.1_5'Flank|uc002hbs.1_Intron	NM_144610	NP_653211			uncharacterized serine/threonine-protein kinase												0						AGTTCCAAAGGAGCCTTTAGC	0.473											OREG0024279	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	39	---	---	---	---	PASS
GJC1	10052	broad.mit.edu	37	17	42882647	42882647	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42882647T>A	uc002ihj.2	-	2	1050	c.539A>T	c.(538-540)CAG>CTG	p.Q180L	GJC1_uc002ihk.2_Missense_Mutation_p.Q180L|GJC1_uc002ihl.2_Missense_Mutation_p.Q180L|GJC1_uc010czx.2_Missense_Mutation_p.Q180L|GJC1_uc010czy.1_Missense_Mutation_p.Q41L	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	180	Helical; (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				TGCCAGCAACTGCAGCACATA	0.478													60	126	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7032162	7032162	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7032162C>T	uc002knm.2	-	16	2271	c.2177G>A	c.(2176-2178)GGC>GAC	p.G726D	LAMA1_uc010wzj.1_Missense_Mutation_p.G202D	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	726	Laminin EGF-like 5; second part.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCGGTAATAGCCAGAGAGGCA	0.463													9	13	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14542952	14542952	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14542952C>A	uc010dln.2	-	1	648	c.194G>T	c.(193-195)TGC>TTC	p.C65F	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	65										skin(3)	3						GCAGTGGTGGCAACACTTGCC	0.572													7	198	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31324962	31324962	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31324962A>C	uc010dmg.1	+	12	5205	c.5150A>C	c.(5149-5151)GAA>GCA	p.E1717A	ASXL3_uc002kxq.2_Missense_Mutation_p.E1424A	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1717					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						AGTCCCATGGAAGAGGCTATT	0.567													15	53	---	---	---	---	PASS
SMAD7	4092	broad.mit.edu	37	18	46474803	46474803	+	Silent	SNP	A	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46474803A>G	uc002ldg.2	-	2	905	c.618T>C	c.(616-618)TCT>TCC	p.S206S	SMAD7_uc010xde.1_5'UTR	NM_005904	NP_005895	O15105	SMAD7_HUMAN	SMAD family member 7	206	MH1.				adherens junction assembly|artery morphogenesis|BMP signaling pathway|cellular protein complex localization|negative regulation of BMP signaling pathway|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of peptidyl-serine phosphorylation|negative regulation of peptidyl-threonine phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of ubiquitin-protein ligase activity|pathway-restricted SMAD protein phosphorylation|positive regulation of anti-apoptosis|positive regulation of cell-cell adhesion|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein stabilization|regulation of activin receptor signaling pathway|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	centrosome|cytosol|nucleolus|plasma membrane|transcription factor complex	activin binding|beta-catenin binding|I-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding				0	Colorectal(1;0.0518)					GAGGGGGGGGAGACTCTGAAA	0.383													5	18	---	---	---	---	PASS
APC2	10297	broad.mit.edu	37	19	1453570	1453570	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1453570C>T	uc002lsr.1	+	4	581	c.373C>T	c.(373-375)CGG>TGG	p.R125W	APC2_uc002lss.1_5'UTR|APC2_uc002lst.1_Missense_Mutation_p.R125W|APC2_uc002lsu.1_Missense_Mutation_p.R125W	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	125					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGCTGAGCCGGGCCACCAT	0.736													3	5	---	---	---	---	PASS
FZR1	51343	broad.mit.edu	37	19	3533330	3533330	+	Silent	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3533330C>A	uc010dtk.2	+	11	1315	c.1281C>A	c.(1279-1281)GTC>GTA	p.V427V	FZR1_uc002lxt.2_Silent_p.V427V|FZR1_uc002lxv.2_Silent_p.V338V	NM_001136198	NP_001129670	Q9UM11	FZR_HUMAN	Fzr1 protein isoform 1	427	WD 6.				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|DNA repair|G2/M transition DNA damage checkpoint|mitosis|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	protein binding			lung(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATCCTTGTCTGGAAGTACC	0.662													18	40	---	---	---	---	PASS
RPL18A	6142	broad.mit.edu	37	19	17972160	17972160	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17972160C>A	uc002nhp.1	+	2	112	c.77C>A	c.(76-78)CCC>CAC	p.P26H	SNORA68_uc002nhq.1_5'Flank	NM_000980	NP_000971	Q02543	RL18A_HUMAN	ribosomal protein L18a	26					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0						CACACGCCGCCCCTCTACCGC	0.547													12	6	---	---	---	---	PASS
ATP1A3	478	broad.mit.edu	37	19	42490382	42490382	+	Splice_Site	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42490382C>A	uc002osg.2	-	5	512	c.358_splice	c.e5-1	p.L120_splice	ATP1A3_uc010xwf.1_Splice_Site_p.L131_splice|ATP1A3_uc010xwg.1_Splice_Site_p.L90_splice|ATP1A3_uc010xwh.1_Splice_Site_p.L133_splice|ATP1A3_uc002osh.2_Splice_Site_p.L120_splice	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit						ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2						CCAGGTACAGCTGTGGGGAGA	0.602													8	11	---	---	---	---	PASS
PHLDB3	653583	broad.mit.edu	37	19	43999463	43999463	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43999463C>T	uc002own.3	-	8	1239	c.980G>A	c.(979-981)TGC>TAC	p.C327Y	PHLDB3_uc010eit.2_Missense_Mutation_p.C31Y	NM_198850	NP_942147	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B,	327	Potential.										0		Prostate(69;0.0153)				TCCCTGAAGGCAATTGAGCTC	0.483													7	13	---	---	---	---	PASS
SIGLEC16	400709	broad.mit.edu	37	19	50474491	50474491	+	Intron	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50474491G>A	uc002prf.2	+						SIGLEC16_uc010ybj.1_RNA|uc010ybk.1_5'Flank	NR_002825				Homo sapiens cDNA FLJ50062 complete cds, highly similar to Sialic acid-binding Ig-like lectin 11 precursor.												0						GGTCCTGCAGGACAGAGTCCT	0.652													3	5	---	---	---	---	PASS
MYBPC2	4606	broad.mit.edu	37	19	50962223	50962223	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50962223G>A	uc002psf.2	+	22	2606	c.2555G>A	c.(2554-2556)CGC>CAC	p.R852H		NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	852	Ig-like C2-type 6.				cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		ACCTACATCCGCAAAGTGGGC	0.697													2	3	---	---	---	---	PASS
SIGLEC9	27180	broad.mit.edu	37	19	51628430	51628430	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51628430A>C	uc002pvu.2	+	1	266	c.199A>C	c.(199-201)AAT>CAT	p.N67H	SIGLEC9_uc010yct.1_Missense_Mutation_p.N67H	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	67	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GGAAGGGGCCAATACAGACCA	0.597													16	30	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55512270	55512270	+	3'UTR	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55512270C>T	uc002qij.2	+	13					NLRP2_uc010yfp.1_3'UTR|NLRP2_uc010esn.2_3'UTR|NLRP2_uc010eso.2_3'UTR|NLRP2_uc010esp.2_3'UTR	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GATCTGAATCCCCCCGAGTCA	0.473													20	40	---	---	---	---	PASS
ZNF343	79175	broad.mit.edu	37	20	2464152	2464152	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2464152C>G	uc002wge.1	-	6	1943	c.1455G>C	c.(1453-1455)AGG>AGC	p.R485S	ZNF343_uc010gao.1_Missense_Mutation_p.R485S|ZNF343_uc002wgd.1_Missense_Mutation_p.R395S	NM_024325	NP_077301	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	485	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						CTGAGTGTGTCCTCTGGTGGA	0.517													33	43	---	---	---	---	PASS
XRN2	22803	broad.mit.edu	37	20	21314413	21314413	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21314413G>C	uc002wsf.1	+	11	1100	c.1005G>C	c.(1003-1005)TGG>TGC	p.W335C	XRN2_uc002wsg.1_Missense_Mutation_p.W259C|XRN2_uc010zsk.1_Missense_Mutation_p.W281C	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	335					cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						TTGATGACTGGGTTTTCATGT	0.408													95	240	---	---	---	---	PASS
SRC	6714	broad.mit.edu	37	20	36024602	36024602	+	Silent	SNP	C	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36024602C>A	uc002xgx.2	+	8	1040	c.591C>A	c.(589-591)GCC>GCA	p.A197A	SRC_uc002xgy.2_Silent_p.A197A	NM_005417	NP_005408	P12931	SRC_HUMAN	proto-oncogene tyrosine-protein kinase SRC	197	SH2.				axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	TCGACAACGCCAAGGGCCTCA	0.652													23	32	---	---	---	---	PASS
FAM83D	81610	broad.mit.edu	37	20	37570842	37570842	+	Intron	SNP	C	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37570842C>G	uc002xjg.2	+						FAM83D_uc002xjf.2_3'UTR	NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610						cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)				TACAAGCTGGCTGGTGGCGGT	0.378													16	33	---	---	---	---	PASS
OPRL1	4987	broad.mit.edu	37	20	62729653	62729653	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62729653C>T	uc002yic.2	+	5	1016	c.614C>T	c.(613-615)CCT>CTT	p.P205L	OPRL1_uc002yid.2_Missense_Mutation_p.P205L|OPRL1_uc002yif.3_Missense_Mutation_p.P200L	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1	205	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					GTGGAGATCCCTACCCCTCAG	0.617													20	27	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11049561	11049561	+	3'UTR	SNP	A	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11049561A>C	uc002yit.1	-	4						NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGTAGTACAAAAGAACTGATC	0.433													9	151	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18844763	18844763	+	RNA	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18844763T>C	uc002zoe.2	+	4		c.2017T>C			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		TCACAGCCTCTGAGGGCAGCA	0.562													4	11	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26743810	26743810	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26743810G>A	uc003acb.2	+	11	2494	c.2338G>A	c.(2338-2340)GTG>ATG	p.V780M	SEZ6L_uc003acc.2_Missense_Mutation_p.V780M|SEZ6L_uc011akc.1_Missense_Mutation_p.V780M|SEZ6L_uc003acd.2_Missense_Mutation_p.V780M|SEZ6L_uc011akd.1_Missense_Mutation_p.V780M|SEZ6L_uc003ace.2_Missense_Mutation_p.V780M|SEZ6L_uc003acf.1_Missense_Mutation_p.V553M|SEZ6L_uc010gvc.1_Missense_Mutation_p.V553M|SEZ6L_uc011ake.1_RNA	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	780	Sushi 3.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						CTATGACATCGTGGGGAGTGA	0.552													18	45	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32188047	32188047	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32188047T>C	uc003als.2	+	11	795	c.653T>C	c.(652-654)GTG>GCG	p.V218A	DEPDC5_uc011als.1_Missense_Mutation_p.V218A|DEPDC5_uc011alu.1_Missense_Mutation_p.V218A|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.V218A|DEPDC5_uc003alr.1_Missense_Mutation_p.V218A|DEPDC5_uc011alt.1_Missense_Mutation_p.V190A	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	218					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						GAAGTGACAGTGGTCCTGTTT	0.403													19	44	---	---	---	---	PASS
MPST	4357	broad.mit.edu	37	22	37420797	37420797	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37420797G>T	uc003aqj.2	+	3	953	c.541G>T	c.(541-543)GTG>TTG	p.V181L	MPST_uc003aqi.1_Missense_Mutation_p.V181L|MPST_uc003aqm.2_Missense_Mutation_p.V181L|MPST_uc011amu.1_Missense_Mutation_p.V201L|MPST_uc003aql.2_Missense_Mutation_p.V181L|MPST_uc003aqn.2_Missense_Mutation_p.V181L|MPST_uc003aqo.2_Missense_Mutation_p.V181L	NM_001130517	NP_001123989	P25325	THTM_HUMAN	mercaptopyruvate sulfurtransferase isoform 2	181	Rhodanese 2.				cyanate catabolic process|response to toxin		3-mercaptopyruvate sulfurtransferase activity|thiosulfate sulfurtransferase activity				0						CTTCCAGGTGGTGGACTCCCG	0.692													3	7	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83128529	83128529	+	Silent	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128529T>C	uc004eei.1	+	4	834	c.813T>C	c.(811-813)AAT>AAC	p.N271N	CYLC1_uc004eeh.1_Silent_p.N270N	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	271					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						ACTCACAGAATAATTCAAAGA	0.323													14	13	---	---	---	---	PASS
PNMA3	29944	broad.mit.edu	37	X	152226515	152226515	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152226515T>C	uc004fhc.2	+	2	1439	c.1103T>C	c.(1102-1104)CTC>CCC	p.L368P	PNMA5_uc004fha.3_5'Flank|PNMA3_uc004fhd.2_5'Flank	NM_013364	NP_037496	Q9UL41	PNMA3_HUMAN	paraneoplastic cancer-testis-brain antigen	368					apoptosis	nucleolus	nucleic acid binding|zinc ion binding			skin(2)|large_intestine(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GCAGTACCTCTCCCTGCCTCT	0.607													3	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3609	3609	+	RNA	SNP	C	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3609C>T	uc004cos.3	+	2		c.1902C>T			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		CTCAACCTAGGCCTCCTATTT	0.542													3	0	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	31128558	31128559	+	IGR	INS	-	TGG	TGG	rs150361136	by1000genomes	TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128558_31128559insTGG								None (None upstream) : MATN1 (55567 downstream)																							ggtggtggtgatggtggtgatg	0.069													4	2	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34002919	34002919	+	Intron	DEL	G	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34002919delG	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AGGATGAGATGTTCCCTTTTG	0.527													19	11	---	---	---	---	
BTBD8	284697	broad.mit.edu	37	1	92568324	92568324	+	Intron	DEL	T	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92568324delT	uc001doo.2	+						BTBD8_uc010otc.1_Intron	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8							nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		GCTTTACTGATTTTTTTTTTA	0.284													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	102251813	102251813	+	IGR	DEL	T	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102251813delT								S1PR1 (544737 upstream) : OLFM3 (16314 downstream)																							TGCCAGTAACTTTTTTTTTTT	0.264													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	185685281	185685282	+	IGR	INS	-	CTTT	CTTT			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185685281_185685282insCTTT								IVNS1ABP (398820 upstream) : HMCN1 (18401 downstream)																							ttccttccttccttccttcctt	0.233													6	3	---	---	---	---	
CNTN2	6900	broad.mit.edu	37	1	205042968	205042969	+	3'UTR	DEL	AG	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205042968_205042969delAG	uc001hbr.2	+	23					CNTN2_uc001hbs.2_3'UTR	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor						axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCTGCTGCCAAGGTGGCCTGAC	0.554													4	6	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235944201	235944201	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235944201delA	uc001hxj.2	-	16	5353	c.5178delT	c.(5176-5178)TTTfs	p.F1726fs	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	1726					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCTTGGTCATAAAAAGTTCTC	0.259									Chediak-Higashi_syndrome				40	18	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245446118	245446118	+	Intron	DEL	A	-	-	rs34770861		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245446118delA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ccgctcctttaaaAAAAAAGA	0.179													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50755684	50755685	+	Intron	DEL	CT	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50755684_50755685delCT	uc010fbq.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATTTCTCTTGCTCTCTCTCTCT	0.312													4	2	---	---	---	---	
NAGK	55577	broad.mit.edu	37	2	71304649	71304650	+	Intron	INS	-	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71304649_71304650insA	uc002shp.3	+						NAGK_uc010fea.2_Intron|NAGK_uc002shq.3_Intron|NAGK_uc002shr.2_Intron	NM_017567	NP_060037	Q9UJ70	NAGK_HUMAN	N-Acetylglucosamine kinase						N-acetylglucosamine metabolic process|N-acetylmannosamine metabolic process		ATP binding|N-acetylglucosamine kinase activity|protein binding				0					N-Acetyl-D-glucosamine(DB00141)	CTGGAGAGGCTAGGTTGGCCCC	0.554													6	3	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107039382	107039382	+	Intron	DEL	G	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107039382delG	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						AAATATTTTAGGGGTGTTCAC	0.333													40	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	175585079	175585079	+	Intron	DEL	A	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175585079delA	uc002uiw.2	+											Homo sapiens cDNA FLJ11228 fis, clone PLACE1008329.																		TTTCATTCTCAAAAAAAAAAA	0.368											OREG0015078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225668718	225668719	+	Intron	DEL	TG	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225668718_225668719delTG	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AATAGAAATAtgtgtgtgtgtg	0.282													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188299	10188306	+	Frame_Shift_Del	DEL	TTTGCCAA	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188299_10188306delTTTGCCAA	uc003bvc.2	+	2	655_662	c.442_449delTTTGCCAA	c.(442-450)TTTGCCAATfs	p.F148fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	148_150	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.F148fs*11(12)|p.N150fs*9(3)|p.A149fs*26(3)|p.F148fs*25(3)|p.F148fs*9(1)|p.?(1)|p.I147fs*25(1)|p.I147fs*11(1)|p.A149D(1)|p.A149fs*25(1)|p.F148S(1)|p.I147fs*10(1)|p.I147_F148del(1)|p.N150fs*7(1)|p.A149P(1)|p.P146fs*23(1)|p.F148fs*26(1)|p.G144fs*19(1)|p.A149fs*24(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		ACAGCCTATTTTTGCCAATATCACACTG	0.409		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				95	47	---	---	---	---	
PROS1	5627	broad.mit.edu	37	3	93605461	93605462	+	Intron	INS	-	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93605461_93605462insT	uc003drb.3	-						PROS1_uc010hoo.2_Intron|PROS1_uc003dqz.3_Intron	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein						leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	TAAAGTAATCATTTTAATGTAA	0.252													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9385728	9385729	+	IGR	INS	-	TTT	TTT			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9385728_9385729insTTT								USP17L6P (14934 upstream) : DEFB131 (60531 downstream)																							TTTCTCCAGTGCTTGTTCTCTC	0.406													48	23	---	---	---	---	
C4orf22	255119	broad.mit.edu	37	4	81307667	81307668	+	Intron	DEL	GG	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81307667_81307668delGG	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983	Q6V702	CD022_HUMAN	hypothetical protein LOC255119											skin(2)	2						GGGCGGTGGTGGGGGGGGGGGG	0.678													6	4	---	---	---	---	
AGPAT9	84803	broad.mit.edu	37	4	84511241	84511241	+	Intron	DEL	A	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84511241delA	uc003how.2	+						AGPAT9_uc003hox.2_Intron|AGPAT9_uc003hoy.2_Intron	NM_032717	NP_116106	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9						phospholipid biosynthetic process|regulation of TOR signaling cascade|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	glycerol-3-phosphate O-acyltransferase activity			skin(1)	1		Hepatocellular(203;0.114)				gtgagacgcgaaaaaaaaaaT	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	89253967	89253970	+	IGR	DEL	TTTC	-	-	rs11275607		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89253967_89253970delTTTC								PPM1K (48079 upstream) : HERC6 (45921 downstream)																							cctccttccttttctttctttctt	0.000													4	2	---	---	---	---	
CDH12	1010	broad.mit.edu	37	5	21880723	21880724	+	Intron	INS	-	C	C			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21880723_21880724insC	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						cttccttccttccttctttctt	0.000										HNSCC(59;0.17)			4	3	---	---	---	---	
YTHDC2	64848	broad.mit.edu	37	5	112888855	112888856	+	Intron	DEL	TT	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112888855_112888856delTT	uc003kqn.2	+						YTHDC2_uc010jce.1_Intron|YTHDC2_uc010jcf.1_Intron	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		TGACTTTGTCtttttttttttt	0.337													6	3	---	---	---	---	
PRRC1	133619	broad.mit.edu	37	5	126883337	126883341	+	Intron	DEL	AGAGT	-	-	rs72094974		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126883337_126883341delAGAGT	uc003kuk.2	+						PRRC1_uc003kuj.3_Intron	NM_130809	NP_570721	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1							Golgi apparatus					0		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		GAATTAATACAGAGTAATTTTATCT	0.278													3	5	---	---	---	---	
SPINK5	11005	broad.mit.edu	37	5	147488628	147488628	+	Intron	DEL	T	-	-	rs113070270		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147488628delT	uc003lox.2	+						SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTCTCCCCTGATTGTGTCA	0.333													9	4	---	---	---	---	
GFPT2	9945	broad.mit.edu	37	5	179729287	179729288	+	Intron	DEL	AA	-	-	rs34163399		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179729287_179729288delAA	uc003mlw.1	-							NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	actcaatctcaaaaaaaaaaaa	0.124													4	6	---	---	---	---	
FAM65B	9750	broad.mit.edu	37	6	24850325	24850326	+	Intron	INS	-	T	T	rs71542702		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24850325_24850326insT	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron|FAM65B_uc003nep.2_Intron|FAM65B_uc011djt.1_Intron	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						ttttctttttcttttttttttt	0.144													2	4	---	---	---	---	
MUT	4594	broad.mit.edu	37	6	49425564	49425564	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49425564delT	uc003ozg.3	-	3	848	c.593delA	c.(592-594)AATfs	p.N198fs		NM_000255	NP_000246	P22033	MUTA_HUMAN	methylmalonyl Coenzyme A mutase precursor	198					fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity				0	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TACTATAAAATTTGCAAGAAC	0.338													61	33	---	---	---	---	
SNX14	57231	broad.mit.edu	37	6	86256928	86256928	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86256928delA	uc003pkr.2	-	12	1203	c.1010delT	c.(1009-1011)TTGfs	p.L337fs	SNX14_uc003pkp.2_Frame_Shift_Del_p.L200fs|SNX14_uc003pkq.2_Translation_Start_Site|SNX14_uc011dzg.1_Frame_Shift_Del_p.L285fs|SNX14_uc003pks.2_Frame_Shift_Del_p.L293fs|SNX14_uc003pkt.2_Frame_Shift_Del_p.L337fs	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a	337	RGS.				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		GATTTGCTTCAATTCTAACTT	0.323													22	11	---	---	---	---	
SYNCRIP	10492	broad.mit.edu	37	6	86329253	86329254	+	Intron	INS	-	A	A	rs71551488		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86329253_86329254insA	uc003pla.2	-						SYNCRIP_uc003pku.2_Intron|SYNCRIP_uc003pkw.2_Intron|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Intron|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Intron	NM_006372	NP_006363	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA						CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		TGTCAGAATATAAAAAAAAAAA	0.193													5	5	---	---	---	---	
DSE	29940	broad.mit.edu	37	6	116747616	116747617	+	Intron	INS	-	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116747616_116747617insT	uc003pws.2	+						DSE_uc011ebf.1_Intron|DSE_uc011ebg.1_Intron|DSE_uc003pwt.2_Intron	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor						dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		GTTGTGTGTCATTAAGCCCTTG	0.366													9	7	---	---	---	---	
HEBP2	23593	broad.mit.edu	37	6	138734184	138734184	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138734184delA	uc003qhw.1	+	4	884	c.587delA	c.(586-588)CAAfs	p.Q196fs		NM_014320	NP_055135	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	196						mitochondrion					0	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)		TGGTTGATTCAAAAAAATGAA	0.363													73	32	---	---	---	---	
HOXA10	3206	broad.mit.edu	37	7	27211800	27211801	+	Intron	INS	-	T	T			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27211800_27211801insT	uc011jzm.1	-						MIR196B_hsa-mir-196b|MI0001150_5'Flank|HOXA10_uc003syw.3_Intron	NM_018951	NP_061824	P31260	HXA10_HUMAN	homeobox A10 isoform a						spermatogenesis		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGCCTGGCATGTAAGAGAATAA	0.554													44	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131275575	131275576	+	IGR	INS	-	CTT	CTT			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131275575_131275576insCTT								PODXL (34199 upstream) : PLXNA4 (532516 downstream)																							ttccttccttccttccttcctt	0.069													11	6	---	---	---	---	
PARP12	64761	broad.mit.edu	37	7	139754561	139754561	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139754561delT	uc003vvl.1	-	4	1637	c.763delA	c.(763-765)AGAfs	p.R255fs	PARP12_uc003vvk.1_Frame_Shift_Del_p.R41fs|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	255						nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					CTGTCTTTTCTTTCTGCAAAG	0.423													38	17	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	146643263	146643264	+	Intron	DEL	TC	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146643263_146643264delTC	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			cccttTTCTTTCTCTCTCTCTC	0.208										HNSCC(39;0.1)			4	2	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	25902514	25902514	+	Intron	DEL	A	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25902514delA	uc003xek.2	+						EBF2_uc003xes.1_5'Flank|EBF2_uc003xet.1_5'Flank	NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		TGAGTCTTAGAAAAAAAAAAA	0.468													4	2	---	---	---	---	
ATP6V0D2	245972	broad.mit.edu	37	8	87155203	87155203	+	Intron	DEL	T	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87155203delT	uc003ydp.1	+							NM_152565	NP_689778	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex	hydrogen ion transmembrane transporter activity|protein binding				0						AGTCCTTGAATTTTGTTATGC	0.303													144	80	---	---	---	---	
MED30	90390	broad.mit.edu	37	8	118552190	118552190	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118552190delA	uc003yoj.2	+	4	661	c.510delA	c.(508-510)ATAfs	p.I170fs	MED30_uc011lib.1_Frame_Shift_Del_p.I135fs	NM_080651	NP_542382	Q96HR3	MED30_HUMAN	TRAP/Mediator complex component TRAP25	170	Potential.				androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding				0	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			TCTGGGATATAAATGCCATGT	0.313													21	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4734491	4734492	+	IGR	DEL	GT	-	-	rs71391963		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4734491_4734492delGT								LOC100216001 (14229 upstream) : AKR1E2 (133910 downstream)																							aggaaggaaggtgaaggaagga	0.149													4	2	---	---	---	---	
SEPHS1	22929	broad.mit.edu	37	10	13386847	13386848	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13386847_13386848insG	uc001imk.2	-	2	462_463	c.103_104insC	c.(103-105)CAAfs	p.Q35fs	SEPHS1_uc001imi.2_Frame_Shift_Ins_p.Q35fs|SEPHS1_uc001imj.2_Frame_Shift_Ins_p.Q35fs|SEPHS1_uc010qbt.1_Intron|SEPHS1_uc009xje.2_Frame_Shift_Ins_p.Q35fs	NM_012247	NP_036379	P49903	SPS1_HUMAN	selenophosphate synthetase 1	35					protein modification process		ATP binding|GTP binding|selenide, water dikinase activity			skin(1)	1						CAGGACATCTTGGGGCACTTTG	0.495													113	60	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													4	3	---	---	---	---	
KDM2A	22992	broad.mit.edu	37	11	66983145	66983146	+	Intron	INS	-	A	A	rs113780245	by1000genomes	TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66983145_66983146insA	uc001ojw.2	+						KDM2A_uc001ojx.2_Intron|KDM2A_uc001ojy.2_Intron	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						CAATACGGTAGAAAAAAAAAAA	0.332													4	2	---	---	---	---	
SHMT2	6472	broad.mit.edu	37	12	57626066	57626066	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57626066delT	uc001snf.1	+	5	595	c.585delT	c.(583-585)TATfs	p.Y195fs	SHMT2_uc001sng.1_Frame_Shift_Del_p.Y91fs|SHMT2_uc001snh.1_Frame_Shift_Del_p.Y34fs|SHMT2_uc009zpk.1_Frame_Shift_Del_p.Y195fs|SHMT2_uc001sni.1_Frame_Shift_Del_p.Y174fs|SHMT2_uc010srg.1_Frame_Shift_Del_p.Y204fs|SHMT2_uc001snj.1_Frame_Shift_Del_p.I90fs|SHMT2_uc010srh.1_Frame_Shift_Del_p.Y174fs|SHMT2_uc001snk.1_Frame_Shift_Del_p.I90fs|SHMT2_uc010sri.1_Frame_Shift_Del_p.Y174fs|SHMT2_uc001snl.2_Frame_Shift_Del_p.I90fs|SHMT2_uc010srj.1_5'Flank	NM_005412	NP_005403	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2	195						microtubule cytoskeleton|mitochondrial nucleoid	glycine hydroxymethyltransferase activity|methyltransferase activity			ovary(1)|central_nervous_system(1)	2					Glycine(DB00145)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	CTATGCCCTATAAGCTCAACG	0.597													77	35	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	97159188	97159191	+	IGR	DEL	ACTC	-	-	rs113446505		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97159188_97159191delACTC								C12orf63 (140 upstream) : NEDD1 (141810 downstream)																							TGTACCTGTTACTCAGTCAGCTGC	0.377													3	5	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347465	92347466	+	Intron	DEL	AC	-	-	rs140834248	by1000genomes	TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347465_92347466delAC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTTCTATTCTacacacacacac	0.193													3	3	---	---	---	---	
RASGRP1	10125	broad.mit.edu	37	15	38792549	38792549	+	Intron	DEL	G	-	-	rs12904148	by1000genomes	TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38792549delG	uc001zke.3	-						RASGRP1_uc010bbe.2_Intron|RASGRP1_uc010bbf.2_Intron|RASGRP1_uc010bbg.2_Intron|RASGRP1_uc001zkd.3_Intron	NM_005739	NP_005730	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 isoform a						cell differentiation|platelet activation|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|lipid binding|protein binding			large_intestine(1)|ovary(1)	2		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		GGttttttttgttttgttttt	0.179													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84858138	84858139	+	IGR	INS	-	T	T	rs71453232		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84858138_84858139insT								ADAMTSL3 (149547 upstream) : LOC388152 (9461 downstream)																							TGGGGAGCTGGTGCAGAGGCCT	0.599													3	3	---	---	---	---	
TERF2	7014	broad.mit.edu	37	16	69395142	69395142	+	Intron	DEL	A	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69395142delA	uc002exd.2	-							NM_005652	NP_005643	Q15554	TERF2_HUMAN	telomeric repeat binding factor 2						age-dependent telomere shortening|cell cycle|cellular senescence|negative regulation of telomere maintenance via semi-conservative replication|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|regulation of transcription, DNA-dependent|telomeric loop formation	Golgi apparatus|nuclear telomere cap complex|nucleoplasm	double-stranded telomeric DNA binding|protein C-terminus binding|protein homodimerization activity			lung(1)	1		Ovarian(137;0.101)				ctgaaaaaggaaaaaaaaaaa	0.154													5	4	---	---	---	---	
RAD51L3	5892	broad.mit.edu	37	17	33445708	33445708	+	Intron	DEL	C	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33445708delC	uc002hir.2	-						RFFL_uc002hiq.2_Intron|RAD51L3_uc010wcd.1_Intron|RAD51L3_uc002his.2_Intron|RAD51L3_uc010ctk.2_Intron|RAD51L3_uc010wce.1_Intron|RAD51L3_uc002hit.2_Intron|RAD51L3_uc002hiu.2_Intron|RAD51L3_uc010wcf.1_Intron|RAD51L3_uc002hiw.1_Intron|RAD51L3_uc002hiv.1_Intron|RAD51L3_uc010ctl.1_Intron|RAD51L3_uc010ctm.1_Intron|FNDC8_uc002hix.2_5'Flank	NM_002878	NP_002869	O75771	RA51D_HUMAN	RAD51-like 3 isoform 1						DNA repair|reciprocal meiotic recombination	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		GTGTCATTCACCCTACTTCTC	0.443								Direct_reversal_of_damage|Homologous_recombination					21	12	---	---	---	---	
SRCIN1	80725	broad.mit.edu	37	17	36734707	36734712	+	Intron	DEL	AGCCGG	-	-	rs71384243		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36734707_36734712delAGCCGG	uc002hqd.2	-						SRCIN1_uc002hqh.1_Intron	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein						exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						CCGTGGCCGCAGCCGGAGCCGCAGCC	0.684													5	4	---	---	---	---	
PIP5K1C	23396	broad.mit.edu	37	19	3648501	3648528	+	Intron	DEL	GGCGCCCACCTGTGGGGCTGCAGACCCG	-	-	rs9676740		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3648501_3648528delGGCGCCCACCTGTGGGGCTGCAGACCCG	uc002lyj.1	-						PIP5K1C_uc010xhq.1_Intron|PIP5K1C_uc010xhr.1_Intron	NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		TGCAGACCCAGGCGCCCACCTGTGGGGCTGCAGACCCGGGCGCCCACC	0.715													4	3	---	---	---	---	
SH2D3A	10045	broad.mit.edu	37	19	6760899	6760899	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6760899delC	uc002mft.2	-	3	363	c.169delG	c.(169-171)GCCfs	p.A57fs	SH2D3A_uc010xjg.1_Intron	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	57	SH2.				JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						AAATGGAGGGCTGAGCCCCGC	0.637													31	16	---	---	---	---	
RALGAPB	57148	broad.mit.edu	37	20	37182421	37182422	+	Intron	DEL	AA	-	-	rs35371902		TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37182421_37182422delAA	uc002xiw.2	+						RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						gcccagtctcaaaaaaaaaaaa	0.109													4	2	---	---	---	---	
INPP5J	27124	broad.mit.edu	37	22	31509420	31509421	+	Intron	INS	-	A	A			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31509420_31509421insA	uc010gwf.2	+						SELM_uc011alj.1_Intron			Q15735	PI5PA_HUMAN	RecName: Full=Phosphatidylinositol 4,5-bisphosphate 5-phosphatase A;          EC=3.1.3.56; AltName: Full=Inositol polyphosphate 5-phosphatase J;							cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						TGCCTACaattaaaaaaaaaaa	0.376													4	3	---	---	---	---	
PDHA1	5160	broad.mit.edu	37	X	19363864	19363865	+	Intron	DEL	CC	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19363864_19363865delCC	uc004czg.3	+						PDHA1_uc004czh.3_Intron|PDHA1_uc011mjc.1_Intron|PDHA1_uc011mjd.1_Intron|PDHA1_uc010nfk.2_Intron	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor						glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	TTTGCAGGGTCCCCCCCCCCCC	0.470													4	2	---	---	---	---	
CASK	8573	broad.mit.edu	37	X	41649373	41649373	+	Intron	DEL	T	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41649373delT	uc004dfl.3	-						CASK_uc004dfm.3_Intron|CASK_uc004dfn.3_Intron	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein						cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6						tagtagagacTTTTTTTTTTC	0.159													4	2	---	---	---	---	
NUP62CL	54830	broad.mit.edu	37	X	106410742	106410744	+	Intron	DEL	AAA	-	-			TCGA-BP-4976-01A-01D-1462-08	TCGA-BP-4976-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106410742_106410744delAAA	uc004ena.2	-						NUP62CL_uc004enb.2_Intron	NM_017681	NP_060151	Q9H1M0	N62CL_HUMAN	nucleoporin 62kDa C-terminal like						protein transport	nuclear pore	structural constituent of nuclear pore				0						TAAGCTACAGAAATCTTTCTCTT	0.271													1	5	---	---	---	---	
