Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CASP9	842	broad.mit.edu	37	1	15819331	15819331	+	3'UTR	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15819331G>A	uc001awn.2	-	9					CASP9_uc001awm.1_3'UTR|CASP9_uc001awo.2_3'UTR|CASP9_uc001awp.2_3'UTR|CASP9_uc009voi.2_3'UTR|CASP9_uc010obm.1_3'UTR|CASP9_uc001awq.2_3'UTR	NM_001229	NP_001220	P55211	CASP9_HUMAN	caspase 9 isoform alpha preproprotein						activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding			central_nervous_system(1)|kidney(1)	2		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		ACCCTGTGCCGGCTGCAAAGT	0.562													15	26	---	---	---	---	PASS
TAS1R2	80834	broad.mit.edu	37	1	19167003	19167003	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19167003G>A	uc001bba.1	-	6	1611	c.1610C>T	c.(1609-1611)GCC>GTC	p.A537V		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	537	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	ATTCGGGCAGGCCTGGCATTC	0.587													21	56	---	---	---	---	PASS
RPTN	126638	broad.mit.edu	37	1	152127163	152127163	+	3'UTR	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152127163G>A	uc001ezs.1	-	3						NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin							proteinaceous extracellular matrix	calcium ion binding				0						TCTCCTCATAGTTTTGTCTAT	0.423													55	236	---	---	---	---	PASS
IFI16	3428	broad.mit.edu	37	1	159002302	159002302	+	5'UTR	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159002302G>A	uc001fth.2	+	1					IFI16_uc001ftg.2_Intron|IFI16_uc010pis.1_Intron|IFI16_uc010pit.1_5'Flank	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16						cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					AACAGAAAATGAATACTTTCA	0.328													17	17	---	---	---	---	PASS
FCGR2C	9103	broad.mit.edu	37	1	161569613	161569613	+	3'UTR	SNP	T	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161569613T>G	uc001gav.2	+	8						NM_201563	NP_963857			Fc fragment of IgG, low affinity IIc, receptor												0	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TTATGCCATGTGGTCACACTC	0.328													46	73	---	---	---	---	PASS
ZBTB41	360023	broad.mit.edu	37	1	197159944	197159944	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197159944G>T	uc001gtx.1	-	3	1415	c.1346C>A	c.(1345-1347)GCA>GAA	p.A449E	ZBTB41_uc009wyz.1_RNA	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	449					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						AAATTCTTGTGCATTTTCAGG	0.264													14	22	---	---	---	---	PASS
CAPN9	10753	broad.mit.edu	37	1	230891141	230891141	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230891141A>G	uc001htz.1	+	2	385	c.272A>G	c.(271-273)CAG>CGG	p.Q91R	CAPN9_uc009xfg.1_Intron|CAPN9_uc001hua.1_Missense_Mutation_p.Q91R	NM_006615	NP_006606	O14815	CAN9_HUMAN	calpain 9 isoform 1	91	Calpain catalytic.				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				GATATCTGCCAGGGAGAGCTG	0.547													21	77	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32693017	32693017	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32693017T>G	uc010ezu.2	+	28	5752	c.5618T>G	c.(5617-5619)ATC>AGC	p.I1873S		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	1873					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					AGAGCCAAAATCCCATTAGGA	0.368													16	28	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109382975	109382975	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109382975G>C	uc002tem.3	+	20	6106	c.5980G>C	c.(5980-5982)GGT>CGT	p.G1994R		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1994					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						AAACACTTCCGGTGACTTTGA	0.393													216	310	---	---	---	---	PASS
NCRNA00164	554226	broad.mit.edu	37	2	132911119	132911119	+	RNA	SNP	T	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132911119T>A	uc002tti.3	-	5		c.1010A>T			NCRNA00164_uc002ttj.3_Intron	NR_027019				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						CCTTTAAATGTAAACACTTAG	0.373													10	14	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189906379	189906379	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189906379T>C	uc002uqk.2	-	50	3841	c.3566A>G	c.(3565-3567)AAC>AGC	p.N1189S	COL5A2_uc010frx.2_Missense_Mutation_p.N765S	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	1189					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TGGCCCAGGGTTTCCTTCTTT	0.468													32	158	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219894592	219894592	+	Intron	SNP	A	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219894592A>G	uc002vjl.1	-						CCDC108_uc010fwa.1_5'UTR|CCDC108_uc010zkp.1_Intron|CCDC108_uc010zkq.1_Intron	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1							integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGGGCAGCAGACACCCAGG	0.652											OREG0015211|OREG0008793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model	5	5	---	---	---	---	PASS
SERPINE2	5270	broad.mit.edu	37	2	224866441	224866441	+	Silent	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866441C>T	uc002vnu.2	-	2	420	c.177G>A	c.(175-177)GCG>GCA	p.A59A	SERPINE2_uc002vnt.2_Silent_p.A59A|SERPINE2_uc010zlr.1_Silent_p.A71A|SERPINE2_uc002vnv.2_Silent_p.A59A	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2	59					negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCAGGACCGACGCAATCCCAT	0.562													56	47	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33643976	33643976	+	Intron	SNP	A	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33643976A>T	uc003cfu.2	-						CLASP2_uc003cft.2_Intron|CLASP2_uc010hgb.2_Intron|CLASP2_uc003cfv.2_3'UTR|CLASP2_uc011axu.1_3'UTR|CLASP2_uc003cfw.2_3'UTR|CLASP2_uc011axt.1_Intron	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2											ovary(3)|central_nervous_system(1)	4						TAGACATAAAAACATGAAGAA	0.368													9	4	---	---	---	---	PASS
MBD4	8930	broad.mit.edu	37	3	129152917	129152917	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129152917A>G	uc003emh.1	-	4	1440	c.1264T>C	c.(1264-1266)TAT>CAT	p.Y422H	MBD4_uc003emi.1_Missense_Mutation_p.Y422H|MBD4_uc003emj.1_Missense_Mutation_p.Y416H|MBD4_uc003emk.1_Missense_Mutation_p.Y104H|MBD4_uc011bkw.1_Missense_Mutation_p.Y422H	NM_003925	NP_003916	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	422					depyrimidination	nucleoplasm	DNA N-glycosylase activity|endodeoxyribonuclease activity|protein binding|satellite DNA binding			ovary(1)|lung(1)	2						TCTTTGTTATATTTGCTGGAA	0.368								BER_DNA_glycosylases					21	111	---	---	---	---	PASS
TMEM165	55858	broad.mit.edu	37	4	56277929	56277929	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56277929T>C	uc003hax.2	+	2	623	c.356T>C	c.(355-357)ATC>ACC	p.I119T	TMEM165_uc011bzy.1_Missense_Mutation_p.I56T	NM_018475	NP_060945	Q9HC07	TM165_HUMAN	transmembrane protein 165	119						integral to membrane					0	Lung NSC(11;0.00545)|Glioma(25;0.08)|all_neural(26;0.101)|all_epithelial(27;0.135)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0103)			ATAGCAGCCATCATGGCAATG	0.443													26	50	---	---	---	---	PASS
SFRP2	6423	broad.mit.edu	37	4	154702558	154702558	+	3'UTR	SNP	G	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154702558G>T	uc003inv.1	-	3						NM_003013	NP_003004	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2 precursor						brain development|cardiac left ventricle morphogenesis|cell-cell signaling|dermatome development|hemopoietic stem cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|negative regulation of cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell adhesion mediated by integrin|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of fat cell differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of stem cell division|sclerotome development	cytoplasm|extracellular matrix|extracellular space|plasma membrane	fibronectin binding|integrin binding|PDZ domain binding|receptor agonist activity|Wnt receptor activity|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.093)	Renal(120;0.117)				GAAATGGTCAGCCGTGCTCTG	0.617													3	34	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127714472	127714472	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127714472G>A	uc003kuu.2	-	12	2154	c.1715C>T	c.(1714-1716)GCA>GTA	p.A572V	FBN2_uc003kuv.2_Missense_Mutation_p.A539V	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	572	EGF-like 7; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACCAATGCATGCTTGCTTGGT	0.378													65	154	---	---	---	---	PASS
SLC22A4	6583	broad.mit.edu	37	5	131671519	131671519	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131671519T>A	uc003kwq.2	+	8	1435	c.1270T>A	c.(1270-1272)TTC>ATC	p.F424I	uc003kwr.3_Intron	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4	424	Extracellular (Potential).				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	AGATTATTACTTCTTATCCAT	0.408													208	243	---	---	---	---	PASS
TNF	7124	broad.mit.edu	37	6	31545342	31545342	+	3'UTR	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31545342C>T	uc003nui.2	+	4					TNF_uc003nuj.2_Silent_p.N95N	NM_000594	NP_000585	P01375	TNFA_HUMAN	tumor necrosis factor alpha						activation of caspase activity|activation of MAPK activity|activation of MAPKKK activity|anti-apoptosis|cellular response to nicotine|chronic inflammatory response to antigenic stimulus|embryonic digestive tract development|induction of apoptosis via death domain receptors|induction of necroptosis by extracellular signals|leukocyte tethering or rolling|necrotic cell death|negative regulation of branching involved in lung morphogenesis|negative regulation of cytokine secretion involved in immune response|negative regulation of fat cell differentiation|negative regulation of interleukin-6 production|negative regulation of lipid catabolic process|negative regulation of lipid storage|negative regulation of viral genome replication|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of chemokine biosynthetic process|positive regulation of chemokine production|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of fever generation|positive regulation of heterotypic cell-cell adhesion|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of membrane protein ectodomain proteolysis|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of NFAT protein import into nucleus|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of podosome assembly|positive regulation of protein complex disassembly|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|receptor biosynthetic process|regulation of insulin secretion|response to glucocorticoid stimulus|response to salt stress|response to virus|sequestering of triglyceride|transformed cell apoptosis|tumor necrosis factor-mediated signaling pathway	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane raft|phagocytic cup|recycling endosome	cytokine activity|identical protein binding|protease binding|transcription regulatory region DNA binding|tumor necrosis factor receptor binding			ovary(1)|pancreas(1)|skin(1)	3		Ovarian(999;0.00556)			Adalimumab(DB00051)|Adenosine(DB00640)|Amrinone(DB01427)|Atorvastatin(DB01076)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Etanercept(DB00005)|Glucosamine(DB01296)|Infliximab(DB00065)|Naltrexone(DB00704)|Pranlukast(DB01411)|Procaterol(DB01366)|Saquinavir(DB01232)|Simvastatin(DB00641)|Thalidomide(DB01041)	CCTTCCCAAACGCCTCCCCTG	0.547									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				16	34	---	---	---	---	PASS
LIN28B	389421	broad.mit.edu	37	6	105526661	105526661	+	3'UTR	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105526661G>A	uc003pqv.1	+	4					LIN28B_uc010kda.1_3'UTR	NM_001004317	NP_001004317	Q6ZN17	LN28B_HUMAN	lin-28 homolog B						miRNA catabolic process|pre-miRNA processing|regulation of transcription, DNA-dependent|RNA 3'-end processing	cytoplasm|nucleus	DNA binding|protein binding|RNA binding|zinc ion binding				0		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				AGACATAACAGGTCTTCTTCA	0.433													36	66	---	---	---	---	PASS
SEC63	11231	broad.mit.edu	37	6	108227661	108227661	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108227661G>A	uc003psc.3	-	10	1221	c.952C>T	c.(952-954)CTT>TTT	p.L318F	SEC63_uc003psb.3_Missense_Mutation_p.L178F	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	318	SEC63 1.|Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		CCTTCTTCAAGGGTCTCAGGA	0.358													41	164	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31683360	31683360	+	Silent	SNP	C	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31683360C>A	uc003tcj.1	+	11	3369	c.2376C>A	c.(2374-2376)ATC>ATA	p.I792I	CCDC129_uc011kad.1_Silent_p.I802I|CCDC129_uc003tci.1_Silent_p.I643I|CCDC129_uc011kae.1_Silent_p.I818I|CCDC129_uc003tck.1_Silent_p.I700I	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	792											0						TCTCTAGTATCTGCCCAATGG	0.562													35	52	---	---	---	---	PASS
AEBP1	165	broad.mit.edu	37	7	44147521	44147521	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44147521G>A	uc003tkb.2	+	5	1158	c.853G>A	c.(853-855)GAG>AAG	p.E285K	AEBP1_uc003tkc.3_5'Flank	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	285	Pro-rich.				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AGCCCCGGAGGAGAGGATTGG	0.711													3	11	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51261213	51261213	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51261213T>A	uc003tpr.3	-	3	504	c.319A>T	c.(319-321)ATT>TTT	p.I107F	COBL_uc003tps.2_Missense_Mutation_p.I107F|COBL_uc011kcl.1_Missense_Mutation_p.I107F|COBL_uc010kzc.2_Missense_Mutation_p.I107F|COBL_uc003tpt.2_Missense_Mutation_p.I107F|COBL_uc003tpp.3_5'Flank|COBL_uc003tpq.3_Missense_Mutation_p.I23F	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	107										skin(3)|ovary(2)	5	Glioma(55;0.08)					GAAGACCGAATTTCAAGGGCA	0.413													43	76	---	---	---	---	PASS
AKR1B10	57016	broad.mit.edu	37	7	134221461	134221461	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134221461C>G	uc003vrr.2	+	5	809	c.489C>G	c.(487-489)AGC>AGG	p.S163R		NM_020299	NP_064695	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10	163					cellular aldehyde metabolic process|digestion|steroid metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|protein binding			skin(5)	5						CCAATTTCAGCCACTTCCAGA	0.483													92	139	---	---	---	---	PASS
RNF32	140545	broad.mit.edu	37	7	156450264	156450264	+	Silent	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156450264C>T	uc003wmo.2	+	5	629	c.447C>T	c.(445-447)CAC>CAT	p.H149H	RNF32_uc010lql.1_RNA|RNF32_uc010lqm.2_Silent_p.H149H|RNF32_uc003wmq.2_Silent_p.H149H|RNF32_uc003wmr.2_Silent_p.H149H|RNF32_uc003wms.2_Silent_p.H149H|RNF32_uc003wmu.2_RNA|RNF32_uc003wmt.2_Silent_p.H149H	NM_030936	NP_112198	Q9H0A6	RNF32_HUMAN	ring finger protein 32	149	RING-type 1; atypical.					aggresome|endosome	protein binding|zinc ion binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		ATGTGTTCCACAAAGTAAGTC	0.473													61	108	---	---	---	---	PASS
ZNF782	158431	broad.mit.edu	37	9	99581317	99581317	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99581317T>C	uc004awp.1	-	6	1269	c.988A>G	c.(988-990)AGA>GGA	p.R330G	ZNF782_uc011lup.1_Missense_Mutation_p.R198G	NM_001001662	NP_001001662	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	330	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				GCATGAGTTCTCTGATGCACT	0.398													135	199	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117840239	117840239	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117840239T>A	uc004bjj.3	-	7	3019	c.2657A>T	c.(2656-2658)AAA>ATA	p.K886I	TNC_uc010mvf.2_Missense_Mutation_p.K886I	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	886	Fibronectin type-III 3.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GAAGGTCTCTTTGGCTGGGTT	0.498													34	66	---	---	---	---	PASS
LHX6	26468	broad.mit.edu	37	9	124975917	124975917	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124975917G>A	uc010mvw.2	-	7	1044	c.935C>T	c.(934-936)GCG>GTG	p.A312V	LHX6_uc004blx.3_Missense_Mutation_p.A341V|LHX6_uc004bly.3_Missense_Mutation_p.A341V	NM_014368	NP_055183	Q9UPM6	LHX6_HUMAN	LIM homeobox protein 6 isoform 1	312					cell maturation|cerebral cortex GABAergic interneuron migration|cerebral cortex radially oriented cell migration|cerebral cortex tangential migration	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GACCATGCGCGCCCGCTCGGG	0.736													9	18	---	---	---	---	PASS
MAMDC4	158056	broad.mit.edu	37	9	139748706	139748706	+	Silent	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139748706C>T	uc004cjs.2	+	7	764	c.714C>T	c.(712-714)AAC>AAT	p.N238N	MAMDC4_uc011mej.1_5'UTR	NM_206920	NP_996803	Q6UXC1	AEGP_HUMAN	apical early endosomal glycoprotein precursor	238	LDL-receptor class A 2.|Extracellular (Potential).				protein transport	integral to membrane				breast(4)|upper_aerodigestive_tract(2)|central_nervous_system(1)	7	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		ACTGCCAGAACAAGGTCTGCG	0.672													8	24	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17151661	17151661	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17151661A>T	uc001ioo.2	-	10	1141	c.1089T>A	c.(1087-1089)GAT>GAA	p.D363E		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	363	EGF-like 5.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGCATGAGGCATCTGGGTGGC	0.453													33	51	---	---	---	---	PASS
C10orf107	219621	broad.mit.edu	37	10	63520664	63520664	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63520664C>T	uc010qik.1	+	6	760	c.455C>T	c.(454-456)ACT>ATT	p.T152I		NM_173554	NP_775825	Q8IVU9	CJ107_HUMAN	hypothetical protein LOC219621	152											0	Prostate(12;0.016)					CAGCCAGAAACTGACACCTCA	0.408													35	78	---	---	---	---	PASS
ATE1	11101	broad.mit.edu	37	10	123503288	123503288	+	Silent	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123503288C>T	uc001lfp.2	-	12	1546	c.1464G>A	c.(1462-1464)CAG>CAA	p.Q488Q	ATE1_uc001lfq.2_Silent_p.Q488Q|ATE1_uc010qtr.1_Silent_p.Q373Q|ATE1_uc010qts.1_Silent_p.Q392Q|ATE1_uc010qtt.1_Silent_p.Q481Q|ATE1_uc001lfr.2_Silent_p.Q189Q|ATE1_uc009xzu.2_RNA	NM_007041	NP_008972	O95260	ATE1_HUMAN	arginyltransferase 1 isoform 2	488					protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				GGTCTTTCTGCTGTTTCTTAT	0.522													26	91	---	---	---	---	PASS
MOB2	81532	broad.mit.edu	37	11	1491652	1491652	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1491652A>T	uc010qwz.1	-	5	747	c.557T>A	c.(556-558)CTG>CAG	p.L186Q	MOB2_uc001lto.1_Missense_Mutation_p.L70Q|MOB2_uc001ltp.1_5'UTR|MOB2_uc001ltq.1_Missense_Mutation_p.L149Q|MOB2_uc010qwy.1_Missense_Mutation_p.L70Q	NM_053005	NP_443731	Q70IA6	MOB2_HUMAN	HCCA2 protein	155						nucleus|perinuclear region of cytoplasm	metal ion binding				0						GATGTGTGCCAGCACGTGGAA	0.582													32	46	---	---	---	---	PASS
C11orf73	51501	broad.mit.edu	37	11	86048459	86048459	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86048459G>A	uc001pbu.2	+	3	545	c.307G>A	c.(307-309)GTC>ATC	p.V103I	C11orf73_uc001pbt.2_Missense_Mutation_p.V103I|C11orf73_uc010rto.1_RNA|C11orf73_uc010rtp.1_Missense_Mutation_p.V4I|C11orf73_uc001pbv.2_RNA	NM_016401	NP_057485	Q53FT3	CK073_HUMAN	lethal, Chr 7, Rinchik 6	103						cytoplasm					0		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)				CATGAATATTGTCCGAACTCC	0.393													127	162	---	---	---	---	PASS
PARP11	57097	broad.mit.edu	37	12	3939160	3939160	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3939160A>T	uc001qmk.1	-	1	77	c.22T>A	c.(22-24)TTA>ATA	p.L8I	PARP11_uc001qml.2_Missense_Mutation_p.L15I|PARP11_uc009zef.2_RNA|PARP11_uc001qmm.2_5'UTR|PARP11_uc001qmn.2_5'UTR	NM_020367	NP_065100	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	8							NAD+ ADP-ribosyltransferase activity			ovary(1)|central_nervous_system(1)	2			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			TTAGAAAATAATTCTTCTGCT	0.373													50	73	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31242218	31242218	+	Intron	SNP	A	G	G	rs4081648		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242218A>G	uc001rjt.1	+						DDX11_uc010sjw.1_3'UTR|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CCCCTCCCTGACCTGGCCGGC	0.597										Multiple Myeloma(12;0.14)			3	13	---	---	---	---	PASS
METTL7A	25840	broad.mit.edu	37	12	51318598	51318598	+	5'UTR	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51318598C>T	uc001rxb.2	+	1					METTL7A_uc010smv.1_5'Flank	NM_014033	NP_054752	Q9H8H3	MET7A_HUMAN	methyltransferase like 7A precursor							endoplasmic reticulum|lipid particle|membrane	methyltransferase activity				0						TGAGGAAAAGCTGGGAACCTT	0.433													3	1	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62887719	62887719	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62887719T>A	uc001sre.2	+	3	591	c.200T>A	c.(199-201)GTT>GAT	p.V67D	MON2_uc009zqj.2_Missense_Mutation_p.V67D|MON2_uc010ssl.1_Translation_Start_Site|MON2_uc010ssm.1_Missense_Mutation_p.V67D|MON2_uc010ssn.1_Missense_Mutation_p.V67D|MON2_uc001srd.1_Intron	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	67					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		AGCTCAGAGGTTGTACAGCCT	0.328													25	33	---	---	---	---	PASS
C12orf74	338809	broad.mit.edu	37	12	93100735	93100735	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93100735T>G	uc001tch.1	+	2	558	c.328T>G	c.(328-330)TCT>GCT	p.S110A	C12orf74_uc001tci.2_Missense_Mutation_p.S110A	NM_001037671	NP_001032760	Q32Q52	CL074_HUMAN	hypothetical protein LOC338809	110											0						AAGATTGACCTCTGAACCTGA	0.542													61	122	---	---	---	---	PASS
C13orf31	144811	broad.mit.edu	37	13	44458052	44458052	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44458052C>A	uc010acg.2	+	4	1372	c.887C>A	c.(886-888)GCA>GAA	p.A296E	C13orf31_uc001uzf.3_Missense_Mutation_p.A296E	NM_001128303	NP_001121775	Q8IV20	CM031_HUMAN	hypothetical protein LOC144811	296											0		Lung NSC(96;0.000163)|all_hematologic(4;0.0127)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Breast(139;0.0364)|Lung SC(185;0.0367)|Acute lymphoblastic leukemia(4;0.138)		GBM - Glioblastoma multiforme(144;0.000573)|BRCA - Breast invasive adenocarcinoma(63;0.121)		GTCAAAAAAGCATGTGGGGTT	0.348													52	82	---	---	---	---	PASS
ATP7B	540	broad.mit.edu	37	13	52511675	52511675	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52511675C>T	uc001vfw.2	-	18	3997	c.3840G>A	c.(3838-3840)ATG>ATA	p.M1280I	ATP7B_uc010adv.2_Missense_Mutation_p.M850I|ATP7B_uc001vfx.2_Missense_Mutation_p.M1073I|ATP7B_uc001vfy.2_Missense_Mutation_p.M1169I|ATP7B_uc010tgt.1_Missense_Mutation_p.M1215I|ATP7B_uc010tgu.1_Missense_Mutation_p.M1232I|ATP7B_uc010tgv.1_Missense_Mutation_p.M1202I|ATP7B_uc001vfv.2_Missense_Mutation_p.M552I|ATP7B_uc010tgs.1_Missense_Mutation_p.M491I	NM_000053	NP_000044	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1280	Cytoplasmic (Potential).				ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)		TGGCCACACCCATGTCTGCCT	0.627									Wilson_disease				24	75	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68270971	68270971	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68270971G>T	uc001xka.2	-	9	1421	c.1282C>A	c.(1282-1284)CCA>ACA	p.P428T	ZFYVE26_uc010tsz.1_Intron|ZFYVE26_uc001xkc.3_Missense_Mutation_p.P428T|ZFYVE26_uc010tta.1_Missense_Mutation_p.P428T	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	428					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCTCTCTTTGGTATGGGGTTG	0.458													7	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	29083900	29083900	+	RNA	SNP	A	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29083900A>G	uc001zcj.2	+	3		c.251A>G								Homo sapiens, Similar to hect domain and RLD 2, clone IMAGE:4581928, mRNA.																		AAAAATGAAGACGAAACTCCT	0.413													22	69	---	---	---	---	PASS
THBS1	7057	broad.mit.edu	37	15	39877708	39877708	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39877708T>C	uc001zkh.2	+	7	1243	c.1064T>C	c.(1063-1065)ATC>ACC	p.I355T		NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	355	VWFC.				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	TCCTGCCCCATCATGCCCTGC	0.498													51	57	---	---	---	---	PASS
ADCY9	115	broad.mit.edu	37	16	4165079	4165079	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4165079T>C	uc002cvx.2	-	2	904	c.365A>G	c.(364-366)TAC>TGC	p.Y122C		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	122	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						GAAGCCGATGTAGAAGAGCGC	0.627													32	53	---	---	---	---	PASS
CDH1	999	broad.mit.edu	37	16	68862136	68862136	+	Silent	SNP	C	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68862136C>T	uc002ewg.1	+	14	2348	c.2224C>T	c.(2224-2226)CTG>TTG	p.L742L	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Silent_p.L681L	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	742	Cytoplasmic (Potential).				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.L742fs*6(1)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AGAGCCCTTACTGCCCCCAGA	0.522			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				78	150	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195183	3195183	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195183G>A	uc002fvh.1	-	1	694	c.694C>T	c.(694-696)CGC>TGC	p.R232C		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						TCTACAGAGCGAATTCGCAGG	0.493													20	68	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27999019	27999019	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27999019T>G	uc002heo.1	-	8	662	c.662A>C	c.(661-663)AAT>ACT	p.N221T	SSH2_uc010wbh.1_Missense_Mutation_p.N248T|SSH2_uc002hep.1_Missense_Mutation_p.N221T	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	221					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						ATTCCATTCATTGACTGAGGA	0.468													125	154	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71429905	71429905	+	Silent	SNP	C	T	T	rs142980422	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71429905C>T	uc010dfm.2	-	10	1278	c.1278G>A	c.(1276-1278)TCG>TCA	p.S426S	SDK2_uc010dfn.2_Silent_p.S105S	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	426	Ig-like C2-type 5.|Extracellular (Potential).				cell adhesion	integral to membrane				ovary(2)	2						GGGGCGCCCCCGAGGTCTCAC	0.567													6	12	---	---	---	---	PASS
TMX3	54495	broad.mit.edu	37	18	66367641	66367641	+	Splice_Site	SNP	C	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66367641C>A	uc002lkf.2	-	6	527	c.392_splice	c.e6+1	p.G131_splice	TMX3_uc010xez.1_Splice_Site|TMX3_uc010xfa.1_Intron|TMX3_uc002lkg.3_Splice_Site_p.G131_splice	NM_019022	NP_061895	Q96JJ7	TMX3_HUMAN	thioredoxin domain containing 10 precursor						cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			skin(1)	1						TAATAACTTACCCAGATACTC	0.254													44	117	---	---	---	---	PASS
FXYD5	53827	broad.mit.edu	37	19	35651641	35651641	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35651641C>A	uc002nyg.1	+	5	315	c.229C>A	c.(229-231)CAA>AAA	p.Q77K	FXYD5_uc010xsq.1_Missense_Mutation_p.Q77K|FXYD5_uc002nyh.1_Missense_Mutation_p.Q77K	NM_014164	NP_054883	Q96DB9	FXYD5_HUMAN	FXYD domain-containing ion transport regulator 5	77	Extracellular (Potential).				microvillus assembly|negative regulation of calcium-dependent cell-cell adhesion	integral to membrane	actin binding|cadherin binding|ion channel activity				0	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)			CCAGACCCAGCAACTGGAAGG	0.493													66	165	---	---	---	---	PASS
SPHK2	56848	broad.mit.edu	37	19	49131593	49131593	+	Intron	SNP	T	C	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49131593T>C	uc002pjr.2	+						SPHK2_uc010xzt.1_Intron|SPHK2_uc002pjs.2_Intron|SPHK2_uc002pjt.2_Intron|SPHK2_uc002pju.2_Intron|SPHK2_uc002pjv.2_Intron|SPHK2_uc002pjw.2_Intron|SPHK2_uc010xzu.1_3'UTR	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		TAGGGACCCCTATATCTCCCA	0.552													15	66	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40558945	40558945	+	3'UTR	SNP	A	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40558945A>G	uc002yxk.1	-	42					BRWD1_uc010goc.1_3'UTR	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTACATTCTCATAGTCACTAT	0.353													46	146	---	---	---	---	PASS
MIR548F5	100302239	broad.mit.edu	37	X	32659673	32659673	+	RNA	SNP	A	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32659673A>G	hsa-mir-548f-5|MI0006378	-			c.4A>G			DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004dda.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron|DMD_uc010ngp.1_Intron|DMD_uc010ngq.1_Intron																	0						gcagcaacctaaTAGTAAGTA	0.149													15	18	---	---	---	---	PASS
TEX11	56159	broad.mit.edu	37	X	69825332	69825332	+	Silent	SNP	C	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69825332C>A	uc004dyl.2	-	25	2193	c.2031G>T	c.(2029-2031)CTG>CTT	p.L677L	TEX11_uc004dyk.2_Silent_p.L352L|TEX11_uc004dym.2_Silent_p.L662L	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	677							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					TCCGTGCAATCAGAATTACTT	0.388													30	13	---	---	---	---	PASS
SLC7A3	84889	broad.mit.edu	37	X	70148386	70148386	+	Silent	SNP	G	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70148386G>A	uc004dyn.2	-	4	785	c.627C>T	c.(625-627)TTC>TTT	p.F209F	SLC7A3_uc004dyo.2_Silent_p.F209F	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid	209	Helical; Name=5; (Potential).				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane				ovary(1)|kidney(1)	2	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CCCCCTTAACGAAGCCAGAGA	0.512													12	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15634	15634	+	3'UTR	SNP	A	G	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15634A>G	uc004coy.2	+	1					uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		GCCCTATTACTATCCATCCTC	0.453											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	6	3	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	37568551	37568552	+	IGR	INS	-	AAG	AAG	rs150976754	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37568551_37568552insAAG								GRIK3 (68707 upstream) : ZC3H12A (371567 downstream)																							aggaggaggaagaggaggagga	0.000													6	3	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57537738	57537739	+	Intron	DEL	AA	-	-	rs71800606		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57537738_57537739delAA	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						CCCATTAGTTaaaaaaaaaaaa	0.342													4	2	---	---	---	---	
FAM73A	374986	broad.mit.edu	37	1	78329892	78329892	+	Intron	DEL	A	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78329892delA	uc001dhx.2	+						FAM73A_uc010ork.1_Intron|FAM73A_uc010orl.1_Intron	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986							integral to membrane				ovary(1)	1				Colorectal(170;0.226)		ctaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DPYD	1806	broad.mit.edu	37	1	97596488	97596491	+	Intron	DEL	TCTA	-	-	rs71841164	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97596488_97596491delTCTA	uc001drv.2	-							NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	tttctctctctctatctatctatc	0.118													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	156325583	156325583	+	IGR	DEL	T	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156325583delT								C1orf182 (8800 upstream) : RHBG (13420 downstream)																							CACCCCCGCCTTTTTTTTTTT	0.119													11	6	---	---	---	---	
TNR	7143	broad.mit.edu	37	1	175300251	175300254	+	Intron	DEL	TTTC	-	-	rs61112088		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175300251_175300254delTTTC	uc001gkp.1	-						TNR_uc009wwu.1_Intron	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					ctctctttcttttctttctttctt	0.000													4	2	---	---	---	---	
FAM129A	116496	broad.mit.edu	37	1	184764085	184764086	+	3'UTR	INS	-	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184764085_184764086insA	uc001gra.2	-	14					FAM129A_uc001grb.1_Frame_Shift_Ins_p.F382fs	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2						negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						TTTTTTCAGAGAAAGACTTCAG	0.421													85	38	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201235502	201235533	+	IGR	DEL	TTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	-	-	rs71904187	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201235502_201235533delTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC								IGFN1 (37429 upstream) : PKP1 (17047 downstream)																							cctcacttctttccttccttccttccttccttccttccttccttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65738847	65738847	+	Intron	DEL	T	-	-	rs111377658		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65738847delT	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																		ttttTTGAAATTTTTTTTTTT	0.159													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	69220904	69220905	+	IGR	DEL	AC	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69220904_69220905delAC								GKN1 (12793 upstream) : ANTXR1 (19371 downstream)																							GCGcacgcatacacacacacac	0.347													4	2	---	---	---	---	
C2orf3	6936	broad.mit.edu	37	2	75900438	75900439	+	Intron	INS	-	A	A	rs75112825		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75900438_75900439insA	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						agtctcaaaagaaaaaaaaaaa	0.084													4	2	---	---	---	---	
TCF7L1	83439	broad.mit.edu	37	2	85529268	85529268	+	Intron	DEL	A	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85529268delA	uc002soy.2	+							NM_031283	NP_112573	Q9HCS4	TF7L1_HUMAN	HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3						aaaacaaaacaaaaaaaaaAC	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	153797785	153797788	+	IGR	DEL	CCTC	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153797785_153797788delCCTC								ARL6IP6 (180018 upstream) : RPRM (536064 downstream)																							ttcttcctttcctccctccctccc	0.000													7	4	---	---	---	---	
GALNT5	11227	broad.mit.edu	37	2	158115425	158115425	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158115425delT	uc002tzg.2	+	1	1086	c.831delT	c.(829-831)CCTfs	p.P277fs	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	277	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						CGAGTCTTCCTTTTCCTAAGT	0.428													72	73	---	---	---	---	
UPP2	151531	broad.mit.edu	37	2	158978311	158978312	+	Intron	INS	-	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158978311_158978312insT	uc002tzp.2	+						UPP2_uc002tzo.2_Intron	NM_173355	NP_775491	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform a						nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0						AATGAGCAGCAGAATGAATTTA	0.317													3	3	---	---	---	---	
XIRP2	129446	broad.mit.edu	37	2	168070770	168070771	+	Intron	DEL	AG	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168070770_168070771delAG	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Intron|XIRP2_uc010fpq.2_Intron|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						aaggaaggaaagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239667253	239667260	+	IGR	DEL	CTTCCTTC	-	-	rs71043164		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239667253_239667260delCTTCCTTC								ASB1 (306363 upstream) : TWIST2 (89413 downstream)																							ttctttctttcttccttccttccttcct	0.043													5	3	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10191611	10191612	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191611_10191612delAC	uc003bvc.2	+	3	817_818	c.604_605delAC	c.(604-606)ACAfs	p.T202fs	VHL_uc003bvd.2_Frame_Shift_Del_p.T161fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	202					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.T202fs*11(1)|p.L198fs*11(1)|p.T202fs*14(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GGAGCGGCTGACACAGGAGCGC	0.475		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				19	28	---	---	---	---	
SSR3	6747	broad.mit.edu	37	3	156261202	156261203	+	Intron	DEL	AC	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156261202_156261203delAC	uc003fau.2	-						SSR3_uc011bop.1_Intron	NM_007107	NP_009038	Q9UNL2	SSRG_HUMAN	signal sequence receptor gamma subunit						cotranslational protein targeting to membrane	integral to endoplasmic reticulum membrane|microsome|Sec61 translocon complex	protein binding|signal sequence binding				0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TTGTCTGCAAACACAATTTGCA	0.361													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	176561866	176561868	+	IGR	DEL	AAG	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176561866_176561868delAAG								None (None upstream) : TBL1XR1 (176675 downstream)																							agaagaagaaaagaagaaggagg	0.084													4	2	---	---	---	---	
GNB4	59345	broad.mit.edu	37	3	179119234	179119236	+	Intron	DEL	AAT	-	-	rs74384746		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179119234_179119236delAAT	uc003fjv.3	-						GNB4_uc003fju.3_Intron	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4						cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			TCAGttaaaaaataataataatt	0.271													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	15768933	15768933	+	IGR	DEL	T	-	-	rs111775272		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15768933delT								BST1 (29000 upstream) : CD38 (10998 downstream)																							TTTTTATCAAttttttttttt	0.209													4	2	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	40895623	40895623	+	Intron	DEL	A	-	-	rs10714456		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40895623delA	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						tttgctatttaaaaaaatgta	0.060													5	3	---	---	---	---	
SGMS2	166929	broad.mit.edu	37	4	108824281	108824282	+	Intron	INS	-	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108824281_108824282insA	uc003hyl.3	+						uc003hym.1_Intron|SGMS2_uc003hyn.2_Intron|SGMS2_uc003hyo.2_Intron	NM_001136258	NP_001129730	Q8NHU3	SMS2_HUMAN	sphingomyelin synthase 2						sphingomyelin biosynthetic process	integral to Golgi membrane|integral to plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			lung(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.95e-05)	Choline(DB00122)	AGGTTAAAAAGAAAAAAAAAAT	0.322													45	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	149676384	149676385	+	IGR	INS	-	TC	TC	rs144863566	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149676384_149676385insTC								NR3C2 (312741 upstream) : None (None downstream)																							cctcctccctttctctctctct	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475765	90475772	+	IGR	DEL	GAAGGAAG	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475765_90475772delGAAGGAAG								GPR98 (15733 upstream) : ARRDC3 (188769 downstream)																							aaggaaggaagaaggaaggaaggaagga	0.029													8	4	---	---	---	---	
CCDC90A	63933	broad.mit.edu	37	6	13794350	13794350	+	Intron	DEL	T	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13794350delT	uc003nbd.2	-						CCDC90A_uc010jpf.2_Intron	NM_001031713	NP_001026883	Q96AQ8	CC90A_HUMAN	coiled-coil domain containing 90A precursor							integral to membrane|mitochondrion					0	Breast(50;0.0027)|Ovarian(93;0.0964)	all_hematologic(90;0.117)				TTGAGGtttcttttttttttt	0.199													3	3	---	---	---	---	
KIF13A	63971	broad.mit.edu	37	6	17940279	17940280	+	Intron	INS	-	A	A	rs9383333		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17940279_17940280insA	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			tctcataaattaaaaaaaaaaa	0.005													3	4	---	---	---	---	
RXRB	6257	broad.mit.edu	37	6	33168094	33168094	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33168094delC	uc003odb.2	-	1	339	c.160delG	c.(160-162)GCAfs	p.A54fs	RXRB_uc003odc.2_Frame_Shift_Del_p.A54fs|RXRB_uc003odd.2_Frame_Shift_Del_p.W40fs|RXRB_uc011dqr.1_Intron|RXRB_uc011dqs.1_Frame_Shift_Del_p.A54fs|RXRB_uc003ode.1_5'Flank|RXRB_uc011dqt.1_Frame_Shift_Del_p.A54fs|RXRB_uc011dqu.1_Frame_Shift_Del_p.W40fs|SLC39A7_uc003odf.2_5'Flank|SLC39A7_uc003odg.2_5'Flank|SLC39A7_uc011dqv.1_5'Flank|SLC39A7_uc003odh.2_5'Flank	NM_021976	NP_068811	P28702	RXRB_HUMAN	retinoid X receptor, beta	54	Modulating (By similarity).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			ovary(3)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)	TCTccgcctgccaccgccgcc	0.597													4	2	---	---	---	---	
SLC26A8	116369	broad.mit.edu	37	6	35928441	35928441	+	Intron	DEL	A	-	-	rs68027857		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35928441delA	uc003olm.2	-						SLC26A8_uc010jwa.2_Intron|SLC26A8_uc003olk.2_Intron|SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						ctctgtctccaaaaaaaaaaa	0.184													4	2	---	---	---	---	
MRPL2	51069	broad.mit.edu	37	6	43023098	43023098	+	Intron	DEL	A	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43023098delA	uc003ots.1	-						CUL7_uc011dvb.1_5'Flank|CUL7_uc003otq.2_5'Flank|CUL7_uc010jyh.2_5'Flank|KLC4_uc003otr.1_Intron	NM_015950	NP_057034	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2 precursor						translation	mitochondrion|ribosome	structural constituent of ribosome				0		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		ctctgtctcgaaaaaaaaaaa	0.204													4	2	---	---	---	---	
KCNQ5	56479	broad.mit.edu	37	6	73651024	73651027	+	Intron	DEL	CTTC	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73651024_73651027delCTTC	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		CCCTGCTCATcttccttccttcct	0.235													3	3	---	---	---	---	
HOXA3	3200	broad.mit.edu	37	7	27151105	27151106	+	Intron	DEL	GT	-	-	rs67931563		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27151105_27151106delGT	uc011jzl.1	-						HOXA3_uc011jzk.1_Intron|HOXA3_uc003syk.2_Intron	NM_030661	NP_109377	O43365	HXA3_HUMAN	homeobox A3 isoform a						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2						AACACATtgcgtgtgtgtgtgt	0.411													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	69014157	69014158	+	IGR	DEL	TG	-	-	rs35688332		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69014157_69014158delTG								None (None upstream) : AUTS2 (49747 downstream)																							CCTCAgtgtttgtgtgtgtgtg	0.208													4	2	---	---	---	---	
MET	4233	broad.mit.edu	37	7	116395353	116395360	+	Intron	DEL	ATGTGAAA	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116395353_116395360delATGTGAAA	uc003vij.2	+						MET_uc010lkh.2_Intron|MET_uc011knc.1_Intron|MET_uc011knd.1_Intron|MET_uc011kne.1_Intron|MET_uc011knf.1_Intron|MET_uc011kng.1_Intron|MET_uc011knh.1_Intron|MET_uc011kni.1_Intron|MET_uc011knj.1_Intron	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor						axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTTCCATATATGTGAAAAATTATAATA	0.303			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				34	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	125285311	125285311	+	IGR	DEL	A	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125285311delA								POT1 (715274 upstream) : GRM8 (793341 downstream)																							AATTTTACTTAAAAATGCCTA	0.164													10	5	---	---	---	---	
KIAA1147	57189	broad.mit.edu	37	7	141386265	141386265	+	Intron	DEL	C	-	-	rs35707772		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141386265delC	uc003vwk.2	-							NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)					acacacAGCACACGAAGACCT	0.249													8	8	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100799	152100800	+	Intron	DEL	AT	-	-	rs2982753		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100799_152100800delAT	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		actgggacacatacacacacac	0.000			N		medulloblastoma								3	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	2799865	2799865	+	Intron	DEL	A	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2799865delA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		aagttgatttaaaaaaaaaaa	0.159													4	2	---	---	---	---	
ASAH1	427	broad.mit.edu	37	8	17920980	17920980	+	Intron	DEL	T	-	-	rs71894904		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17920980delT	uc003wyl.2	-						ASAH1_uc010ltb.1_Intron|ASAH1_uc003wym.2_Intron|ASAH1_uc003wyn.2_Intron|ASAH1_uc003wyo.2_Intron	NM_177924	NP_808592	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		acctggctacttttttttttt	0.000													5	3	---	---	---	---	
RECK	8434	broad.mit.edu	37	9	36112120	36112120	+	Intron	DEL	A	-	-	rs146316668		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36112120delA	uc003zyv.2	+						RECK_uc003zyw.2_Intron|RECK_uc003zyx.2_Intron	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			actccatctcaaaaaaaaaaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45362789	45362791	+	IGR	DEL	TTC	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45362789_45362791delTTC								FAM27C (371298 upstream) : FAM27A (364238 downstream)																							CTTCAGCCTGTTCTTCTTCAGTC	0.468													3	3	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77415536	77415536	+	Intron	DEL	A	-	-	rs35092699		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77415536delA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GGCTTCCTTTAAAAAAAAAAA	0.199													4	2	---	---	---	---	
CEP78	84131	broad.mit.edu	37	9	80861761	80861761	+	Intron	DEL	A	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80861761delA	uc004akx.2	+						CEP78_uc004aky.3_Intron|CEP78_uc010mpp.2_Intron|CEP78_uc011lsp.1_Intron	NM_032171	NP_115547	Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa isoform b						G2/M transition of mitotic cell cycle	centrosome|cytosol				ovary(1)	1						TTTCTCATGTATTGACAGTTT	0.289													14	7	---	---	---	---	
NOXA1	10811	broad.mit.edu	37	9	140320927	140320928	+	Intron	INS	-	GGGTC	GGGTC	rs145312088	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140320927_140320928insGGGTC	uc004cmv.2	+						C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Intron|NOXA1_uc010nch.2_Intron	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1						regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CAGGGAAACCTGAGACTGTGGC	0.426													3	5	---	---	---	---	
POLR3A	11128	broad.mit.edu	37	10	79770063	79770063	+	Intron	DEL	A	-	-	rs3832673		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79770063delA	uc001jzn.2	-							NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			aaaaaaaaagaaaaaaaaaaa	0.179													6	3	---	---	---	---	
OR8H2	390151	broad.mit.edu	37	11	55872323	55872324	+	5'Flank	INS	-	T	T	rs113669153		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872323_55872324insT	uc010riy.1	+							NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					Gtttttttttgtttgttttttg	0.109										HNSCC(53;0.14)			4	3	---	---	---	---	
C12orf59	120939	broad.mit.edu	37	12	10341142	10341147	+	Intron	DEL	AAGAAA	-	-	rs11319912		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10341142_10341147delAAGAAA	uc001qxr.2	+						C12orf59_uc001qxq.2_Intron			Q4KMG9	CL059_HUMAN	RecName: Full=Uncharacterized protein C12orf59; Flags: Precursor;							integral to membrane				ovary(1)	1						gaaggaaaagaagaaaaagaaaaaga	0.019													3	3	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72271340	72271343	+	Intron	DEL	CTTT	-	-	rs61351685	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72271340_72271343delCTTT	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						tccttccttcctttcttctttttc	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80730562	80730562	+	IGR	DEL	T	-	-	rs11300714		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80730562delT								PPP1R12A (401327 upstream) : PTPRQ (107564 downstream)																							AAAGTATTTCTTTTTTTTTTT	0.264													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	94008256	94008256	+	IGR	DEL	T	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94008256delT								SOCS2 (38278 upstream) : CRADD (62895 downstream)																							ccttccttcctttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114112062	114112065	+	IGR	DEL	TCTC	-	-	rs151323944		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114112062_114112065delTCTC								LHX5 (202185 upstream) : RBM19 (142478 downstream)																							cttccttccttctctccttccttc	0.152													6	3	---	---	---	---	
RNF17	56163	broad.mit.edu	37	13	25451475	25451476	+	Intron	INS	-	AC	AC	rs140599228	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25451475_25451476insAC	uc001upr.2	+						RNF17_uc010aab.2_Intron|RNF17_uc010tde.1_Intron|RNF17_uc001ups.2_Intron|RNF17_uc010aac.2_Intron|RNF17_uc010aad.2_Intron	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GCTTTATATATACATATAAAGC	0.272													4	4	---	---	---	---	
ENOX1	55068	broad.mit.edu	37	13	43849709	43849710	+	Intron	INS	-	AC	AC	rs140946959	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43849709_43849710insAC	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		GACTGACACCAacacacacaca	0.327													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	69835382	69835383	+	IGR	INS	-	TG	TG	rs143943013	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69835382_69835383insTG								None (None upstream) : KLHL1 (439343 downstream)																							ttattaggtattgtgtgtgtgc	0.000													4	4	---	---	---	---	
SNAPC1	6617	broad.mit.edu	37	14	62234188	62234188	+	Intron	DEL	T	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62234188delT	uc001xft.2	+							NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		GACTTTTAGCttttttttttt	0.144													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	69328777	69328778	+	IGR	INS	-	TT	TT	rs34505623		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69328777_69328778insTT								C14orf181 (65587 upstream) : ACTN1 (12063 downstream)																							GAGCACATATCttttttttttt	0.233													7	4	---	---	---	---	
MTA1	9112	broad.mit.edu	37	14	105905492	105905493	+	Intron	INS	-	T	T	rs140601392	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105905492_105905493insT	uc001yqx.2	+						MTA1_uc001yqy.2_Intron|MTA1_uc001yqz.1_Intron|MTA1_uc001yra.1_Intron	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein						signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		GAGCTCTGCCCCCACCCCTGAG	0.644													4	2	---	---	---	---	
TLE3	7090	broad.mit.edu	37	15	70347816	70347817	+	Intron	INS	-	G	G	rs72531987	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70347816_70347817insG	uc002asm.2	-						TLE3_uc002ask.2_Intron|TLE3_uc002asl.2_Intron|TLE3_uc010ukd.1_Intron|TLE3_uc010bik.1_Intron|TLE3_uc010bil.1_Intron|TLE3_uc002asn.2_Intron|TLE3_uc002asp.2_Intron|TLE3_uc002aso.2_Intron	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a						organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						CGAGGTAGACATGATTAACAGA	0.520													3	6	---	---	---	---	
SCAMP5	192683	broad.mit.edu	37	15	75311458	75311459	+	3'UTR	INS	-	TA	TA	rs138820484	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75311458_75311459insTA	uc002azk.1	+	7					SCAMP5_uc002azl.1_3'UTR|SCAMP5_uc002azm.1_3'UTR|SCAMP5_uc002azn.1_3'UTR|SCAMP5_uc010uly.1_3'UTR	NM_138967	NP_620417	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5						exocytosis|negative regulation of endocytosis|positive regulation of calcium ion-dependent exocytosis|positive regulation of cytokine secretion|protein transport|response to endoplasmic reticulum stress	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						AGGACCAGAGTtatatatatat	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97610889	97610896	+	IGR	DEL	TTCCTTCT	-	-	rs72438368		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97610889_97610896delTTCCTTCT								SPATA8 (282045 upstream) : LOC91948 (674950 downstream)																							GGCATCACGAttccttctttccttcctt	0.067													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16457063	16457065	+	IGR	DEL	ACA	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16457063_16457065delACA								LOC339047 (12626 upstream) : XYLT1 (739118 downstream)																							CAGCCTCCGTACAACGAGTCCTT	0.665													5	3	---	---	---	---	
CLEC18C	283971	broad.mit.edu	37	16	70211512	70211512	+	Intron	DEL	T	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70211512delT	uc002exy.2	+						CLEC18C_uc010vlt.1_Intron|CLEC18C_uc002eyk.2_Intron	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						TTAGttttacttttttttttt	0.219													4	2	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72163921	72163921	+	Intron	DEL	T	-	-	rs67023960		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72163921delT	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron|PMFBP1_uc010cgo.1_5'Flank	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				aatgtttgtattttttttttt	0.000													3	3	---	---	---	---	
SMARCD2	6603	broad.mit.edu	37	17	61913095	61913095	+	Intron	DEL	T	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61913095delT	uc010deb.1	-						SMARCD2_uc010wpt.1_Intron|SMARCD2_uc010dea.1_Intron|SMARCD2_uc010dec.1_Intron	NM_001098426	NP_001091896	Q92925	SMRD2_HUMAN	SWI/SNF-related matrix-associated						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	SWI/SNF complex	protein binding|transcription coactivator activity				0						agtcccagccttttttttttt	0.020													4	3	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50273337	50273339	+	Intron	DEL	GGA	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50273337_50273339delGGA	uc002lfe.1	+							NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		aagtgtaaggggaggaggaggag	0.202													4	2	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9042829	9042830	+	Intron	INS	-	A	A	rs148623183	by1000genomes	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9042829_9042830insA	uc002mkp.2	-							NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						aggaaggaaggaggaaggaagg	0.025													3	5	---	---	---	---	
APOC2	344	broad.mit.edu	37	19	45452269	45452270	+	Intron	INS	-	CCT	CCT	rs10622462		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45452269_45452270insCCT	uc002pah.2	+							NM_000483	NP_000474	P02655	APOC2_HUMAN	apolipoprotein C-II precursor						cholesterol efflux|chylomicron remnant clearance|high-density lipoprotein particle clearance|lipid catabolic process|lipoprotein metabolic process|negative regulation of cholesterol transport|negative regulation of lipid metabolic process|negative regulation of receptor-mediated endocytosis|negative regulation of very-low-density lipoprotein particle clearance|phospholipid efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of phospholipase activity|positive regulation of phospholipid catabolic process|positive regulation of triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	chylomicron|intermediate-density lipoprotein particle|low-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	lipase inhibitor activity|lipid binding|lipoprotein lipase activator activity|phospholipase activator activity|phospholipase binding|protein homodimerization activity			kidney(1)	1	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		ggcccccagcccgtcctccctc	0.015													4	3	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56755967	56755971	+	Intron	DEL	CAAGG	-	-	rs57532903		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56755967_56755971delCAAGG	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tttgttgtcacaagggggaggacag	0.117													4	4	---	---	---	---	
STK4	6789	broad.mit.edu	37	20	43607442	43607443	+	Intron	INS	-	T	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43607442_43607443insT	uc002xnb.2	+						STK4_uc010ggx.2_Intron|STK4_uc010ggy.2_Intron|STK4_uc010ggw.1_Intron	NM_006282	NP_006273	Q13043	STK4_HUMAN	serine/threonine kinase 4						apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				ttcaatttttcttttttttttt	0.114													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56518954	56518954	+	IGR	DEL	A	-	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56518954delA								PMEPA1 (232413 upstream) : C20orf85 (207029 downstream)																							cgctgcctggaaggtcctccc	0.169													4	2	---	---	---	---	
C21orf91	54149	broad.mit.edu	37	21	19167321	19167322	+	Intron	INS	-	A	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19167321_19167322insA	uc002yko.3	-						C21orf91_uc002ykm.2_5'Flank|C21orf91_uc002ykn.2_5'Flank|C21orf91_uc002ykq.3_Intron|C21orf91_uc002ykp.3_Intron	NM_001100420	NP_001093890	Q9NYK6	EURL_HUMAN	early undifferentiated retina and lens isoform											ovary(1)	1				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		gattctgtcgcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26710061	26710062	+	Intron	INS	-	ACAGAG	ACAGAG	rs55746736		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26710061_26710062insACAGAG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						cacacacacacagagagagaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28780698	28780699	+	IGR	INS	-	AG	AG			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28780698_28780699insAG								None (None upstream) : None (None downstream)																							CCCACTGATGACCTTCAAAGCA	0.426													4	3	---	---	---	---	
