Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PER3	8863	broad.mit.edu	37	1	7886603	7886603	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7886603C>A	uc001aoo.2	+	16	2172	c.1997C>A	c.(1996-1998)TCG>TAG	p.S666*	PER3_uc009vmg.1_Nonsense_Mutation_p.S674*|PER3_uc009vmh.1_Nonsense_Mutation_p.S667*|PER3_uc001aop.2_Nonsense_Mutation_p.S674*|PER3_uc010nzw.1_Nonsense_Mutation_p.S355*	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	666	CSNK1E binding domain (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CCTTTGACCTCGGAAGAATTT	0.483													17	70	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11217303	11217303	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11217303C>G	uc001asd.2	-	30	4496	c.4375G>C	c.(4375-4377)GCC>CCC	p.A1459P		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1459	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GCCACAAGGGCATCCTCCCAC	0.542													46	158	---	---	---	---	PASS
PRAMEF20	645425	broad.mit.edu	37	1	13743046	13743046	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13743046C>A	uc009voa.1	+	2	334	c.235C>A	c.(235-237)CAA>AAA	p.Q79K		NM_001099852	NP_001093322	Q5VT98	PRA20_HUMAN	PRAME family member 20	79										ovary(1)	1	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.5e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000156)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGAGACCTTCCAAGCTGTGCT	0.612													39	91	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16973179	16973179	+	5'Flank	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16973179G>A	uc001azg.1	-						CROCCL1_uc001azi.1_5'Flank|MST1P2_uc009vow.2_RNA|MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_RNA|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_5'Flank|MST1P2_uc001azm.3_5'Flank					Homo sapiens mRNA for FLJ00313 protein.												0						GGCATTCTGGGCGCTGTGACC	0.597													9	108	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24434560	24434560	+	Silent	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24434560T>C	uc001bin.3	-	3	328	c.165A>G	c.(163-165)GAA>GAG	p.E55E	MYOM3_uc001bio.2_Silent_p.E55E|MYOM3_uc001bip.1_5'UTR	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	55										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		CATGCTCTTCTTCGCTGCTCC	0.627													27	66	---	---	---	---	PASS
SPOCD1	90853	broad.mit.edu	37	1	32258019	32258019	+	Intron	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32258019A>G	uc001bts.1	-						SPOCD1_uc001btr.1_Missense_Mutation_p.L8P|SPOCD1_uc001btt.2_Intron|SPOCD1_uc001btu.2_Intron|SPOCD1_uc001btv.2_Intron	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1						transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TGGCAGGAGGAGAGCAGCTGT	0.463													9	19	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74663859	74663859	+	5'UTR	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74663859T>C	uc001dfy.3	-	1					LRRIQ3_uc001dfz.3_RNA|TNNI3K_uc001dgc.1_5'Flank|TNNI3K_uc001dgd.2_5'Flank|TNNI3K_uc001dge.1_5'Flank|FPGT_uc010oqt.1_5'Flank|FPGT_uc010oqu.1_5'Flank|FPGT_uc001dgb.1_5'Flank|FPGT_uc010oqv.1_5'Flank	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3											ovary(2)	2						GGGGGCGTGGTTACGTGGGCG	0.657													8	19	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612034	120612034	+	5'UTR	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612034T>G	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCGGTCGCCTCCTCCTccgc	0.622			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142714007	142714007	+	Intron	SNP	T	C	C	rs1694635	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142714007T>C	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		GATATCCAACTGGAGAAAAAG	0.289													5	17	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144863294	144863294	+	Intron	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144863294G>A	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron|PDE4DIP_uc001ema.2_3'UTR	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAAGCTCATGGGGTGAGGGGA	0.498			T	PDGFRB	MPD								6	303	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	148882025	148882025	+	RNA	SNP	C	T	T	rs150449871	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148882025C>T	uc009wkv.1	+	3		c.246C>T								Homo sapiens cDNA, FLJ17483.																		TGTTTTCTAGCAGTGACAAAT	0.343													12	147	---	---	---	---	PASS
SHE	126669	broad.mit.edu	37	1	154456584	154456584	+	3'UTR	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154456584C>G	uc001ffb.2	-	6					SHE_uc001ffc.2_RNA	NM_001010846	NP_001010846	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E											breast(3)|ovary(2)|central_nervous_system(1)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGATGATGCCCTTGAAGGTGC	0.493													11	28	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201013477	201013477	+	Silent	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201013477C>G	uc001gvv.2	-	39	5003	c.4776G>C	c.(4774-4776)GCG>GCC	p.A1592A		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1592	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CCTCCTCCATCGCAGCCTCCA	0.622													16	70	---	---	---	---	PASS
PRSS38	339501	broad.mit.edu	37	1	228033920	228033920	+	3'UTR	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228033920C>A	uc001hrh.2	+	5						NM_183062	NP_898885	A1L453	PRS38_HUMAN	marapsin 2 precursor						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)|pancreas(1)	2						GGTCAGGATACCCACTCTAGG	0.627													20	86	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232650976	232650976	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232650976T>A	uc001hvg.2	-	1	268	c.110A>T	c.(109-111)AAA>ATA	p.K37I		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	37					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GGCTTTAAATTTCCGAGCAAA	0.473													37	137	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233296143	233296143	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233296143C>A	uc001hvl.2	-	19	3638	c.3403G>T	c.(3403-3405)GCC>TCC	p.A1135S	PCNXL2_uc001hvm.1_RNA|PCNXL2_uc009xfu.2_RNA|PCNXL2_uc001hvp.1_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	1135	Helical; (Potential).					integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				AACCCCACGGCTCCAGCCAAG	0.493													13	57	---	---	---	---	PASS
OTX1	5013	broad.mit.edu	37	2	63283120	63283120	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63283120G>A	uc002scd.2	+	5	982	c.734G>A	c.(733-735)GGC>GAC	p.G245D	OTX1_uc010ypt.1_Missense_Mutation_p.G179D	NM_014562	NP_055377	P32242	OTX1_HUMAN	orthodenticle homeobox 1	245						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(2)	2	Lung NSC(7;0.121)|all_lung(7;0.211)					TACTTTGGCGGCGTGGACTGC	0.657													45	99	---	---	---	---	PASS
RNF103	7844	broad.mit.edu	37	2	86831681	86831681	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86831681T>A	uc002srn.2	-	4	2312	c.1343A>T	c.(1342-1344)AAT>ATT	p.N448I	VPS24_uc010ytl.1_Intron|RNF103_uc002srm.2_Missense_Mutation_p.N309I|uc002sro.2_Intron	NM_005667	NP_005658	O00237	RN103_HUMAN	ring finger protein 103	448					central nervous system development|ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(1)	1						GTTATTGGCATTGACTTCATC	0.418													40	155	---	---	---	---	PASS
ANKRD20B	729171	broad.mit.edu	37	2	95522727	95522727	+	RNA	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95522727C>A	uc010fhp.2	-	1		c.94G>T				NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0						CTGCTTGTCCCGGGCGTCCAG	0.731													3	58	---	---	---	---	PASS
UPP2	151531	broad.mit.edu	37	2	158958486	158958486	+	5'UTR	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158958486T>G	uc002tzp.2	+	1					UPP2_uc002tzo.2_Intron	NM_173355	NP_775491	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform a						nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0						GGAACTGAACTATTATGACTA	0.308													18	53	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160268963	160268963	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160268963G>T	uc002uao.2	-	14	2912	c.2560C>A	c.(2560-2562)CAA>AAA	p.Q854K	BAZ2B_uc002uap.2_Missense_Mutation_p.Q818K|BAZ2B_uc002uaq.1_Missense_Mutation_p.Q684K|BAZ2B_uc002uar.1_Missense_Mutation_p.Q427K	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	854	Arg-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CTTGCTCGTTGTCTATCTGGA	0.458													30	90	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170070231	170070231	+	Silent	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170070231G>T	uc002ues.2	-	36	6189	c.5976C>A	c.(5974-5976)GCC>GCA	p.A1992A		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1992	LDL-receptor class B 19.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CTATTTTGTTGGCCCCAGTGG	0.408													5	312	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187615886	187615886	+	Silent	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187615886T>C	uc002ups.2	+	5	862	c.750T>C	c.(748-750)CCT>CCC	p.P250P	FAM171B_uc002upr.1_Silent_p.P250P	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	250	Extracellular (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						AATTGACTCCTCTTGCTGCAA	0.308													79	176	---	---	---	---	PASS
ABCB6	10058	broad.mit.edu	37	2	220075171	220075171	+	Missense_Mutation	SNP	A	C	C	rs151051476	byFrequency	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220075171A>C	uc002vkc.1	-	17	2560	c.2283T>G	c.(2281-2283)AAT>AAG	p.N761K	ABCB6_uc010fwe.1_Missense_Mutation_p.N715K	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	761	ABC transporter.				cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGCCCTCTCATTAGATGTAT	0.572													21	41	---	---	---	---	PASS
SP100	6672	broad.mit.edu	37	2	231407658	231407658	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231407658T>G	uc002vqu.1	+	29	2796	c.2655T>G	c.(2653-2655)ATT>ATG	p.I885M	SP100_uc010fxp.1_Missense_Mutation_p.I203M	NM_001080391	NP_001073860	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 1	Error:Variant_position_missing_in_P23497_after_alignment					DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TAATGTTTATTTAGCCATTCT	0.413													20	76	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191571	10191571	+	Silent	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191571G>T	uc003bvc.2	+	3	777	c.564G>T	c.(562-564)CTG>CTT	p.L188L	VHL_uc003bvd.2_Silent_p.L147L	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	188			L -> Q (in VHLD; type I).|L -> P (in VHLD; type I-II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L188fs*14(2)|p.L188P(2)|p.D187_L188del(2)|p.L188Q(2)|p.L188V(1)|p.D187fs*14(1)|p.E189fs*27(1)|p.E189fs*25(1)|p.Y185fs*11(1)|p.L188R(1)|p.D187_N193del(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		ACGAAGATCTGGAAGACCACC	0.502		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				14	37	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191572	10191572	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191572G>T	uc003bvc.2	+	3	778	c.565G>T	c.(565-567)GAA>TAA	p.E189*	VHL_uc003bvd.2_Nonsense_Mutation_p.E148*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	189					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.E189K(3)|p.E189fs*12(2)|p.D187_N193del(1)|p.E189fs*27(1)|p.E189fs*25(1)|p.Y185fs*11(1)|p.E189fs*13(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGAAGATCTGGAAGACCACCC	0.502		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				14	38	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38595863	38595863	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38595863C>G	uc003cio.2	-	27	4914	c.4720G>C	c.(4720-4722)GAG>CAG	p.E1574Q	SCN5A_uc003cin.2_Missense_Mutation_p.E1573Q|SCN5A_uc003cil.3_Missense_Mutation_p.E1574Q|SCN5A_uc010hhi.2_Missense_Mutation_p.E1556Q|SCN5A_uc010hhk.2_Intron|SCN5A_uc011ayr.1_Missense_Mutation_p.E1520Q	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1574	Helical; Name=S2 of repeat IV; (Potential).				blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	ACAATACACTCGCCTGTGAAG	0.498													4	120	---	---	---	---	PASS
IP6K2	51447	broad.mit.edu	37	3	48725685	48725685	+	3'UTR	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48725685G>T	uc003cup.2	-	6					NCKIPSD_uc003cum.2_5'Flank|NCKIPSD_uc003cun.2_5'Flank|NCKIPSD_uc010hkh.1_5'Flank|IP6K2_uc003cuq.2_3'UTR	NM_001005909	NP_001005909	Q9UHH9	IP6K2_HUMAN	inositol hexaphosphate kinase 2 isoform a						negative regulation of cell growth|phosphatidylinositol phosphorylation|positive regulation of apoptosis|type I interferon-mediated signaling pathway	intermediate filament cytoskeleton|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity				0						TCGCTCTCAAGTACTGGAGCA	0.577													49	86	---	---	---	---	PASS
RRP9	9136	broad.mit.edu	37	3	51971260	51971260	+	Silent	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51971260G>T	uc003dbw.1	-	6	504	c.465C>A	c.(463-465)ACC>ACA	p.T155T		NM_004704	NP_004695	O43818	U3IP2_HUMAN	RNA, U3 small nucleolar interacting protein 2	155	WD 1.				rRNA processing	nucleolus|small nuclear ribonucleoprotein complex|small nucleolar ribonucleoprotein complex	RNA binding			breast(2)|ovary(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		AGTCATCGGGGGTGACGACCA	0.602													58	100	---	---	---	---	PASS
ZNF148	7707	broad.mit.edu	37	3	124952230	124952230	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124952230A>G	uc003ehx.3	-	9	1826	c.1340T>C	c.(1339-1341)GTT>GCT	p.V447A	SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Missense_Mutation_p.V447A|ZNF148_uc010hsa.2_Missense_Mutation_p.V447A|ZNF148_uc003eia.3_Missense_Mutation_p.V447A|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	447					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						CAAATTATCAACCTGATCAAT	0.403													6	142	---	---	---	---	PASS
RAB43	339122	broad.mit.edu	37	3	128813982	128813982	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128813982G>A	uc003eln.1	-	2	522	c.235C>T	c.(235-237)CGG>TGG	p.R79W	RAB43_uc003elo.1_Silent_p.S294S|RAB43_uc010hsy.1_Missense_Mutation_p.R79W	NM_198490	NP_940892	Q86YS6	RAB43_HUMAN	RAB43 protein	79					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						GTGCGGAACCGCTCCTGGCCG	0.592													15	60	---	---	---	---	PASS
CDV3	55573	broad.mit.edu	37	3	133306843	133306843	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133306843T>C	uc003epq.2	+	5	1185	c.730T>C	c.(730-732)TAT>CAT	p.Y244H	CDV3_uc003epp.3_3'UTR|CDV3_uc003epr.2_3'UTR	NM_017548	NP_060018	Q9UKY7	CDV3_HUMAN	carnitine deficiency-associated gene expressed	244					cell proliferation	cytoplasm					0						AGACAACCAATATGCTGTGCT	0.408													30	72	---	---	---	---	PASS
GK5	256356	broad.mit.edu	37	3	141884596	141884596	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141884596C>A	uc003euq.1	-	16	1589	c.1458G>T	c.(1456-1458)AAG>AAT	p.K486N	GK5_uc003eup.1_Missense_Mutation_p.K207N|GK5_uc010hus.1_RNA	NM_001039547	NP_001034636	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)	486					glycerol metabolic process		ATP binding|glycerol kinase activity				0						TTAGTTCCTCCTTGTCAGTCC	0.363													4	154	---	---	---	---	PASS
GPR171	29909	broad.mit.edu	37	3	150916820	150916820	+	Silent	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150916820G>A	uc003eyq.3	-	3	594	c.354C>T	c.(352-354)CAC>CAT	p.H118H	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_013308	NP_037440	O14626	GP171_HUMAN	G protein-coupled receptor 171	118	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTTGCAGCTGTGTGTCAGCT	0.408													45	114	---	---	---	---	PASS
KCNAB1	7881	broad.mit.edu	37	3	156249255	156249255	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156249255A>T	uc003far.2	+	13	1203	c.1139A>T	c.(1138-1140)GAA>GTA	p.E380V	KCNAB1_uc011bon.1_Missense_Mutation_p.E351V|KCNAB1_uc003fas.2_Missense_Mutation_p.E369V|KCNAB1_uc003fat.2_Missense_Mutation_p.E362V|KCNAB1_uc010hvt.1_Missense_Mutation_p.E333V|KCNAB1_uc011boo.1_Missense_Mutation_p.E256V	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related	380						cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TCCACTCCTGAACAACTCATT	0.502													51	180	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197410178	197410178	+	Silent	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197410178C>T	uc003fyc.2	-	13	2163	c.1980G>A	c.(1978-1980)AAG>AAA	p.K660K	KIAA0226_uc003fyd.3_Silent_p.K615K|KIAA0226_uc003fye.1_Silent_p.K392K	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	660					autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		AAGGACCTACCTTCTGAGGGG	0.592													15	80	---	---	---	---	PASS
PDE6B	5158	broad.mit.edu	37	4	648522	648522	+	Intron	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:648522C>T	uc003gap.2	+						PDE6B_uc003gao.3_Intron|PDE6B_uc011buy.1_Intron|PDE6B_uc010ibg.2_3'UTR|uc003gaq.1_Intron	NM_000283	NP_000274	P35913	PDE6B_HUMAN	phosphodiesterase 6B isoform 1						cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0						atgcgtgtggctgtgtgtagc	0.393													4	89	---	---	---	---	PASS
SCARB2	950	broad.mit.edu	37	4	77082897	77082897	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77082897G>A	uc003hju.1	-	12	1745	c.1406C>T	c.(1405-1407)GCG>GTG	p.A469V	SCARB2_uc011cbu.1_Missense_Mutation_p.A326V	NM_005506	NP_005497	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	469	Cytoplasmic (Potential).				cell adhesion|protein targeting to lysosome	integral to plasma membrane|lysosomal lumen|lysosomal membrane|membrane fraction	enzyme binding|receptor activity				0			Lung(101;0.196)			TCTTTCATCCGCTGTTCCCTG	0.493													25	70	---	---	---	---	PASS
RASGEF1B	153020	broad.mit.edu	37	4	82380577	82380577	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82380577C>T	uc003hmi.1	-	2	230	c.86G>A	c.(85-87)GGA>GAA	p.G29E	RASGEF1B_uc003hmj.1_Missense_Mutation_p.G29E|RASGEF1B_uc010ijq.1_Missense_Mutation_p.G29E|RASGEF1B_uc003hmk.2_Missense_Mutation_p.G29E	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	29					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						ATACAACCCTCCACAGCTGTC	0.453													57	104	---	---	---	---	PASS
IL15	3600	broad.mit.edu	37	4	142651079	142651079	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142651079T>G	uc003iis.2	+	7	689	c.320T>G	c.(319-321)ATT>AGT	p.I107S	IL15_uc003iit.2_Missense_Mutation_p.I107S|IL15_uc010iol.2_RNA|IL15_uc003iiu.2_RNA	NM_000585	NP_000576	P40933	IL15_HUMAN	interleukin 15 preproprotein	107					cell-cell signaling|immune response|positive regulation of interleukin-17 production	endosome|extracellular space|Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	cytokine activity|cytokine receptor binding|signal transducer activity				0	all_hematologic(180;0.158)					GATGCAAGTATTCATGATACA	0.358													78	174	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13692053	13692053	+	3'UTR	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13692053T>C	uc003jfd.2	-	79					DNAH5_uc003jfc.2_3'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ATTTAGATCTTGCATTTTCCA	0.463									Kartagener_syndrome				28	68	---	---	---	---	PASS
PARP8	79668	broad.mit.edu	37	5	50120778	50120778	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50120778C>G	uc003jon.3	+	19	2079	c.1897C>G	c.(1897-1899)CAG>GAG	p.Q633E	PARP8_uc011cpz.1_Missense_Mutation_p.Q525E|PARP8_uc003joo.2_Missense_Mutation_p.Q633E|PARP8_uc003jop.2_Missense_Mutation_p.Q591E	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	633	PARP catalytic.					intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				AATGGATAAACAGGACCCCCT	0.323													6	147	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101631681	101631681	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101631681G>A	uc003knm.2	-	1	573	c.286C>T	c.(286-288)CAA>TAA	p.Q96*		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	96	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TGGAGACATTGAGGATGGAAG	0.592													22	63	---	---	---	---	PASS
SEPT8	23176	broad.mit.edu	37	5	132098316	132098316	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132098316C>T	uc003kxr.2	-	5	794	c.556G>A	c.(556-558)GCC>ACC	p.A186T	SEPT8_uc003kxs.1_Missense_Mutation_p.A186T|SEPT8_uc003kxu.2_Missense_Mutation_p.A186T|SEPT8_uc011cxi.1_Missense_Mutation_p.A184T|SEPT8_uc003kxv.2_Missense_Mutation_p.A184T|SEPT8_uc003kxt.2_Missense_Mutation_p.A126T	NM_001098811	NP_001092281	Q92599	SEPT8_HUMAN	septin 8 isoform a	186					cell cycle	septin complex	GTP binding|protein binding			ovary(2)	2		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCAGCCTTGGCGATGATGGGA	0.552													4	173	---	---	---	---	PASS
SPOCK1	6695	broad.mit.edu	37	5	136328254	136328254	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136328254G>A	uc003lbo.2	-	6	816	c.625C>T	c.(625-627)CGG>TGG	p.R209W	SPOCK1_uc003lbp.2_Missense_Mutation_p.R209W	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains	209					cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCCTTCAGCCGGGAGGCAAGG	0.527													47	116	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140773214	140773214	+	Silent	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140773214A>G	uc003lkd.1	+	1	1732	c.834A>G	c.(832-834)GCA>GCG	p.A278A	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Silent_p.A278A	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	278	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAAAGTGGCATACAAATTCC	0.423													46	119	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150901058	150901058	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150901058A>T	uc003lue.3	-	18	11109	c.11096T>A	c.(11095-11097)CTA>CAA	p.L3699Q	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.L392Q	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	3699	Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATGGATGCTAGCTCCTGAAA	0.582													34	79	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169483602	169483602	+	Intron	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169483602G>T	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron|DOCK2_uc003mah.2_5'UTR	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTACTGTAATGAACCTCCCTG	0.522													8	21	---	---	---	---	PASS
ZNF354C	30832	broad.mit.edu	37	5	178506605	178506605	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178506605G>A	uc003mju.2	+	5	1287	c.1172G>A	c.(1171-1173)AGA>AAA	p.R391K		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	391	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		GAATGTGGGAGAACCTTCACA	0.428													91	230	---	---	---	---	PASS
BTNL9	153579	broad.mit.edu	37	5	180483000	180483000	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180483000G>T	uc003mmt.2	+	9	1171	c.940G>T	c.(940-942)GCT>TCT	p.A314S		NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor	314	Cytoplasmic (Potential).|B30.2/SPRY.|Potential.					integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGGAGACGGGCTGAAGGCCA	0.527													43	216	---	---	---	---	PASS
BTNL9	153579	broad.mit.edu	37	5	180483001	180483001	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180483001C>G	uc003mmt.2	+	9	1172	c.941C>G	c.(940-942)GCT>GGT	p.A314G		NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor	314	Cytoplasmic (Potential).|B30.2/SPRY.|Potential.					integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGAGACGGGCTGAAGGCCAG	0.527													43	212	---	---	---	---	PASS
TDP2	51567	broad.mit.edu	37	6	24658816	24658816	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24658816G>T	uc003nej.2	-	3	423	c.398C>A	c.(397-399)GCT>GAT	p.A133D	TDP2_uc003nei.2_Missense_Mutation_p.A21D|TDP2_uc010jpu.1_Missense_Mutation_p.A133D	NM_016614	NP_057698	O95551	TYDP2_HUMAN	TRAF and TNF receptor-associated protein	133					cell surface receptor linked signaling pathway|double-strand break repair	PML body	5'-tyrosyl-DNA phosphodiesterase activity|magnesium ion binding|nuclease activity|protein binding|transcription corepressor activity			ovary(1)|lung(1)	2						CACCCCTCGAGCCCTCTCTGA	0.383								Direct_reversal_of_damage|Editing_and_processing_nucleases					4	108	---	---	---	---	PASS
TULP1	7287	broad.mit.edu	37	6	35471404	35471404	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35471404G>A	uc003okv.3	-	13	1267	c.1255C>T	c.(1255-1257)CGG>TGG	p.R419W	TULP1_uc003okw.3_Missense_Mutation_p.R366W	NM_003322	NP_003313	O00294	TULP1_HUMAN	tubby like protein 1	419					dendrite development|eye photoreceptor cell development|phagocytosis|photoreceptor cell maintenance|positive regulation of phagocytosis	cell junction|cytoplasm|extracellular region|photoreceptor inner segment|photoreceptor outer segment|synapse	actin filament binding|phosphatidylinositol-4,5-bisphosphate binding			ovary(2)|central_nervous_system(1)	3						GTCATGCGCCGGGGGCCACGG	0.662													5	13	---	---	---	---	PASS
GPR111	222611	broad.mit.edu	37	6	47650019	47650019	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47650019C>T	uc010jzj.1	+	6	1725	c.1724C>T	c.(1723-1725)GCT>GTT	p.A575V	GPR111_uc010jzk.1_Missense_Mutation_p.A507V|GPR111_uc003oyy.2_RNA	NM_153839	NP_722581	Q8IZF7	GP111_HUMAN	G-protein coupled receptor 111	575	Helical; Name=4; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						TTGGCCATTGCTGCCATCACT	0.517													16	39	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144768773	144768773	+	Silent	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144768773A>T	uc003qkt.2	+	15	1850	c.1758A>T	c.(1756-1758)ACA>ACT	p.T586T	UTRN_uc010khq.1_Silent_p.T586T	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	586	Interaction with SYNM.|Spectrin 4.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AGCGTCAAACATTGGATCAGC	0.393													44	143	---	---	---	---	PASS
SERAC1	84947	broad.mit.edu	37	6	158541585	158541585	+	Silent	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158541585T>C	uc003qrc.2	-	11	1180	c.1038A>G	c.(1036-1038)GAA>GAG	p.E346E	SERAC1_uc003qrb.2_Silent_p.E74E	NM_032861	NP_116250	Q96JX3	SRAC1_HUMAN	serine active site containing 1	346					GPI anchor metabolic process|intracellular protein transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	binding|hydrolase activity, acting on ester bonds				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		ATTTCATTGCTTCTGCCATGA	0.448													43	87	---	---	---	---	PASS
TBL2	26608	broad.mit.edu	37	7	72985071	72985071	+	Silent	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72985071C>A	uc003tyh.2	-	7	1244	c.1110G>T	c.(1108-1110)CGG>CGT	p.R370R	TBL2_uc011kex.1_Silent_p.R334R|TBL2_uc010lbg.2_Silent_p.R275R|TBL2_uc003tyi.2_Silent_p.R205R|TBL2_uc011key.1_Silent_p.R241R|TBL2_uc010lbh.2_Silent_p.R275R	NM_012453	NP_036585	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	370											0		Lung NSC(55;0.0659)|all_lung(88;0.152)				CGCCATGGACCCGCTCAAAGC	0.607													38	126	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81346622	81346622	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81346622T>G	uc003uhl.2	-	11	1496	c.1331A>C	c.(1330-1332)GAT>GCT	p.D444A	HGF_uc003uhm.2_Missense_Mutation_p.D439A	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	444	Kringle 4.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						AGCATCATCATCTGGATTTCG	0.448													44	135	---	---	---	---	PASS
CAV1	857	broad.mit.edu	37	7	116164929	116164929	+	5'UTR	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116164929A>T	uc003vif.1	+	1					CAV1_uc010lkd.1_Intron|CAV1_uc010lke.1_Intron|CAV1_uc003vig.1_5'Flank|CAV1_uc003vih.2_5'Flank|CAV1_uc010lkf.1_5'Flank	NM_001753	NP_001744	Q03135	CAV1_HUMAN	caveolin 1						blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			GACCCGGCGCAGCACACGTCC	0.692													7	19	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119914961	119914961	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119914961T>C	uc003vjj.1	+	1	1240	c.275T>C	c.(274-276)TTC>TCC	p.F92S		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	92	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					CCAGACATCTTCCGCCACATC	0.512													72	238	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142032047	142032047	+	Intron	SNP	A	C	C	rs150998656	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142032047A>C	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krs.1_Silent_p.T3T					SubName: Full=V_segment translation product; Flags: Fragment;																		CCATGGGCACAAGGCTCCTCT	0.488													3	46	---	---	---	---	PASS
ZNF862	643641	broad.mit.edu	37	7	149559035	149559035	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149559035T>C	uc010lpn.2	+	7	2978	c.2786T>C	c.(2785-2787)ATT>ACT	p.I929T	ZNF862_uc003wgm.2_RNA	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862	929					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1						CTGACGGGGATTGAGTACCTC	0.582													47	152	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150558103	150558103	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150558103C>G	uc003why.1	+	6	6280	c.2062C>G	c.(2062-2064)CCT>GCT	p.P688A	ABP1_uc003whz.1_Missense_Mutation_p.P688A|ABP1_uc003wia.1_Missense_Mutation_p.P707A	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	688					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	CACAGCCACACCTGGGAACTC	0.622													23	46	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2020501	2020501	+	Silent	SNP	G	A	A	rs137913055		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2020501G>A	uc003wpx.3	+	9	1008	c.870G>A	c.(868-870)AGG>AGA	p.R290R	MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	290	Ig-like C2-type 2.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCTTCAGGAGGGAAGGCGAGA	0.587													13	63	---	---	---	---	PASS
CTSB	1508	broad.mit.edu	37	8	11706684	11706684	+	Intron	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11706684G>A	uc003wum.2	-						CTSB_uc003wul.2_5'Flank|CTSB_uc011kxl.1_Intron|CTSB_uc003wun.2_Intron|CTSB_uc003wuo.2_Intron|CTSB_uc003wup.2_Intron|CTSB_uc003wuq.2_Intron|CTSB_uc010lsc.2_Intron|CTSB_uc003wur.2_Intron|CTSB_uc003wus.1_Intron|CTSB_uc003wut.1_Intron|CTSB_uc003wuu.2_5'UTR	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein						proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		CTGCAGGAACGAGCCCCACCG	0.652													5	22	---	---	---	---	PASS
CTSB	1508	broad.mit.edu	37	8	11706685	11706685	+	Intron	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11706685A>G	uc003wum.2	-						CTSB_uc003wul.2_5'Flank|CTSB_uc011kxl.1_Intron|CTSB_uc003wun.2_Intron|CTSB_uc003wuo.2_Intron|CTSB_uc003wup.2_Intron|CTSB_uc003wuq.2_Intron|CTSB_uc010lsc.2_Intron|CTSB_uc003wur.2_Intron|CTSB_uc003wus.1_Intron|CTSB_uc003wut.1_Intron|CTSB_uc003wuu.2_5'UTR	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein						proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		TGCAGGAACGAGCCCCACCGG	0.647													5	22	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25744310	25744310	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25744310G>C	uc003xes.1	-	10	987	c.970C>G	c.(970-972)CAG>GAG	p.Q324E	PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	324	IPT/TIG.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TTGCAGAACTGTTTAGATTTA	0.488													24	124	---	---	---	---	PASS
ZNF395	55893	broad.mit.edu	37	8	28209195	28209195	+	Silent	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28209195G>T	uc003xgq.2	-	7	1138	c.1050C>A	c.(1048-1050)ACC>ACA	p.T350T	ZNF395_uc003xgt.2_Silent_p.T350T|ZNF395_uc003xgr.2_Silent_p.T350T|ZNF395_uc003xgs.2_Silent_p.T350T	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	350					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CTGGCTCGGAGGTGGGAGTCC	0.537													4	75	---	---	---	---	PASS
ZNF703	80139	broad.mit.edu	37	8	37556057	37556057	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37556057C>A	uc003xjy.1	+	2	1835	c.1638C>A	c.(1636-1638)CAC>CAA	p.H546Q		NM_025069	NP_079345	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	546					adherens junction assembly|mammary gland epithelial cell differentiation|negative regulation of homotypic cell-cell adhesion|negative regulation of transcription, DNA-dependent|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of mammary gland epithelial cell proliferation|regulation of canonical Wnt receptor signaling pathway|regulation of cell cycle|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			breast(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			GCCGGTACCACCCCTATGGCA	0.507													7	26	---	---	---	---	PASS
ADAM2	2515	broad.mit.edu	37	8	39624434	39624434	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39624434A>C	uc003xnj.2	-	14	1515	c.1440T>G	c.(1438-1440)AAT>AAG	p.N480K	ADAM2_uc003xnk.2_Missense_Mutation_p.N461K|ADAM2_uc011lck.1_Missense_Mutation_p.N480K|ADAM2_uc003xnl.2_Missense_Mutation_p.N354K	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	480	Extracellular (Potential).|Cys-rich.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		AGATCCATTGATTCAGTCCAC	0.403													79	183	---	---	---	---	PASS
SDCBP	6386	broad.mit.edu	37	8	59488529	59488529	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59488529G>A	uc003xtn.2	+	5	461	c.311G>A	c.(310-312)CGT>CAT	p.R104H	SDCBP_uc003xto.2_Missense_Mutation_p.R103H|SDCBP_uc003xtr.2_Missense_Mutation_p.R103H|SDCBP_uc003xtp.2_Missense_Mutation_p.R98H|SDCBP_uc003xtq.2_Missense_Mutation_p.R104H|SDCBP_uc003xts.2_Missense_Mutation_p.R110H|SDCBP_uc011led.1_Intron	NM_005625	NP_005616	O00560	SDCB1_HUMAN	syntenin isoform 1	104					actin cytoskeleton organization|axon guidance|positive regulation of phosphorylation|protein targeting to membrane|substrate-dependent cell migration, cell extension|synaptic transmission	cytoskeleton|cytosol|endoplasmic reticulum membrane|focal adhesion|interleukin-5 receptor complex|melanosome|nucleus	cytoskeletal adaptor activity|frizzled binding|interleukin-5 receptor binding|protein heterodimerization activity|protein N-terminus binding|syndecan binding				0		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				GTTGGAATTCGTAGAGCAGAA	0.358													12	242	---	---	---	---	PASS
C8orf45	157777	broad.mit.edu	37	8	67790811	67790811	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67790811T>A	uc003xwz.3	+	6	655	c.484T>A	c.(484-486)TTT>ATT	p.F162I	C8orf45_uc003xwv.2_Missense_Mutation_p.F162I|C8orf45_uc011lev.1_Missense_Mutation_p.F162I|C8orf45_uc011lew.1_Missense_Mutation_p.F93I|C8orf45_uc011lex.1_5'UTR|C8orf45_uc003xwy.3_Missense_Mutation_p.F162I	NM_173518	NP_775789	Q4G0Z9	CH045_HUMAN	minichromosome maintenance complex	162					DNA replication		ATP binding|DNA binding			ovary(1)	1	Breast(64;0.186)		Epithelial(68;0.00384)|OV - Ovarian serous cystadenocarcinoma(28;0.00913)|all cancers(69;0.0175)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCTTTCAGGATTTCAGTATAT	0.274													61	143	---	---	---	---	PASS
TMEM70	54968	broad.mit.edu	37	8	74894661	74894661	+	3'UTR	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74894661C>A	uc003yab.2	+	3					TMEM70_uc003yac.2_3'UTR	NM_017866	NP_060336	Q9BUB7	TMM70_HUMAN	transmembrane protein 70 isoform a						mitochondrial proton-transporting ATP synthase complex assembly	integral to mitochondrial membrane|mitochondrial inner membrane				ovary(1)	1	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			TTACTTCCATCAGTATTGAGC	0.393													11	40	---	---	---	---	PASS
PEX2	5828	broad.mit.edu	37	8	77896064	77896064	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77896064T>A	uc003yax.2	-	4	809	c.351A>T	c.(349-351)GAA>GAT	p.E117D	PEX2_uc003yay.2_Missense_Mutation_p.E117D|PEX2_uc003yaz.2_Missense_Mutation_p.E117D	NM_000318	NP_000309	P28328	PEX2_HUMAN	peroxin 2	117					peroxisome organization	integral to peroxisomal membrane	protein binding|zinc ion binding			ovary(1)	1						AGCATCGTTCTTCTAACCACC	0.378													36	96	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87738806	87738806	+	Silent	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87738806T>C	uc003ydx.2	-	3	337	c.291A>G	c.(289-291)ACA>ACG	p.T97T		NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	97	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						GCTCTGGCACTGTTCCAGTTG	0.423													13	489	---	---	---	---	PASS
IFNA21	3452	broad.mit.edu	37	9	21166125	21166125	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21166125C>A	uc003zom.2	-	1	535	c.487G>T	c.(487-489)GCC>TCC	p.A163S		NM_002175	NP_002166	P01568	IFN21_HUMAN	interferon, alpha 21 precursor	163					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding			central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(5;1.93e-187)|Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		ACCTCCCAGGCACAAGGGCTG	0.413													127	390	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35396577	35396577	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35396577G>C	uc003zwq.2	+	26	3458	c.3166G>C	c.(3166-3168)GGG>CGG	p.G1056R	UNC13B_uc003zwr.2_Missense_Mutation_p.G1056R	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	1056	MHD1.				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TGTCCTCCAGGGGCAGGTGCC	0.547													25	103	---	---	---	---	PASS
FAM166B	730112	broad.mit.edu	37	9	35563218	35563218	+	Silent	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35563218T>G	uc010mkr.2	-	2	302	c.231A>C	c.(229-231)CTA>CTC	p.L77L	FAM166B_uc011lov.1_Silent_p.L77L|FAM166B_uc011low.1_Silent_p.L77L|FAM166B_uc003zwy.2_Silent_p.L77L	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN	hypothetical protein LOC730112 isoform 1	77											0						GCCTGACAGGTAGACTCTCCC	0.607													45	156	---	---	---	---	PASS
FAM166B	730112	broad.mit.edu	37	9	35563221	35563221	+	Silent	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35563221A>G	uc010mkr.2	-	2	299	c.228T>C	c.(226-228)AGT>AGC	p.S76S	FAM166B_uc011lov.1_Silent_p.S76S|FAM166B_uc011low.1_Silent_p.S76S|FAM166B_uc003zwy.2_Silent_p.S76S	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN	hypothetical protein LOC730112 isoform 1	76											0						TGACAGGTAGACTCTCCCTGG	0.612													44	154	---	---	---	---	PASS
C9orf125	84302	broad.mit.edu	37	9	104238257	104238257	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104238257T>A	uc004bbm.2	-	2	1440	c.1118A>T	c.(1117-1119)AAG>ATG	p.K373M	uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	373						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				CCTCTCTCCCTTGGCCCTCAA	0.602													25	68	---	---	---	---	PASS
FKTN	2218	broad.mit.edu	37	9	108337348	108337348	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108337348T>C	uc004bcr.2	+	3	251	c.35T>C	c.(34-36)CTT>CCT	p.L12P	FKTN_uc011lvx.1_Missense_Mutation_p.L12P|FKTN_uc004bcs.2_Missense_Mutation_p.L12P|FKTN_uc011lvy.1_Missense_Mutation_p.L12P|FKTN_uc010mtm.2_5'UTR	NM_001079802	NP_001073270	O75072	FKTN_HUMAN	fukutin	12	Helical; Signal-anchor for type II membrane protein; (Potential).				muscle organ development|negative regulation of cell proliferation|negative regulation of JNK cascade|nervous system development|regulation of protein glycosylation	cis-Golgi network|endoplasmic reticulum|extracellular space|Golgi membrane|integral to membrane|nucleus	transferase activity			breast(2)|ovary(1)	3						GTTTTGGCCCTTTTAACGCTG	0.358													3	178	---	---	---	---	PASS
SEC16A	9919	broad.mit.edu	37	9	139360547	139360547	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139360547G>T	uc004chx.2	-	8	4479	c.4170C>A	c.(4168-4170)TAC>TAA	p.Y1390*	SEC16A_uc004chv.3_Nonsense_Mutation_p.Y780*|SEC16A_uc004chw.2_Nonsense_Mutation_p.Y1390*|SEC16A_uc010nbn.2_Nonsense_Mutation_p.Y1390*	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	1212	Required for endoplasmic reticulum localization.				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GCGGGGCCTCGTAGGAACCGG	0.532													16	65	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16979763	16979763	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16979763A>C	uc001ioo.2	-	39	5806	c.5754T>G	c.(5752-5754)ATT>ATG	p.I1918M		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1918	CUB 13.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGCGGGCGTGAATGCTAGGCC	0.348													16	67	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	49239538	49239538	+	5'UTR	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49239538A>T	uc001jgd.2	-	1										RecName: Full=Arf-GAP, GTPase, ANK repeat and PH domain-containing protein 11; AltName: Full=Centaurin-gamma-like protein KIAA1975;																		TCAGATTCAGAGGGACACACC	0.597													35	91	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61829377	61829377	+	Silent	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61829377T>C	uc001jky.2	-	37	11454	c.11262A>G	c.(11260-11262)GGA>GGG	p.G3754G	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	3754					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						CATTTTCTAATCCCTGACAAC	0.368													85	249	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64950737	64950737	+	Silent	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64950737G>A	uc001jmn.2	-	17	6508	c.6208C>T	c.(6208-6210)CTG>TTG	p.L2070L	JMJD1C_uc001jml.2_Silent_p.L1833L|JMJD1C_uc001jmm.2_Silent_p.L1782L|JMJD1C_uc010qiq.1_Silent_p.L1888L|JMJD1C_uc009xpi.2_Silent_p.L1888L|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmo.2_5'UTR	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	2070	LXXLL motif.				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					GTTGTAGTCAGCAAATCCCGT	0.463													4	188	---	---	---	---	PASS
GOT1	2805	broad.mit.edu	37	10	101163595	101163595	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101163595G>A	uc001kpr.2	-	6	887	c.679C>T	c.(679-681)CAG>TAG	p.Q227*	GOT1_uc009xwh.2_RNA|GOT1_uc001kpq.1_Intron	NM_002079	NP_002070	P17174	AATC_HUMAN	aspartate aminotransferase 1	227					aspartate catabolic process|cellular response to insulin stimulus|gluconeogenesis|response to glucocorticoid stimulus	cytosol	L-aspartate:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding				0		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GCGAAGCCCTGATAGGCTGAG	0.542													18	53	---	---	---	---	PASS
HBB	3043	broad.mit.edu	37	11	5248211	5248211	+	Missense_Mutation	SNP	G	T	T	rs35203747		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5248211G>T	uc001mae.1	-	1	91	c.41C>A	c.(40-42)GCC>GAC	p.A14D		NM_000518	NP_000509	P68871	HBB_HUMAN	beta globin	14					blood coagulation|hydrogen peroxide catabolic process|nitric oxide transport|positive regulation of cell death|positive regulation of nitric oxide biosynthetic process|protein heterooligomerization|regulation of blood pressure|regulation of blood vessel size	haptoglobin-hemoglobin complex|hemoglobin complex	heme binding|hemoglobin binding|oxygen binding|oxygen transporter activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	Iron Dextran(DB00893)	GCCCCACAGGGCAGTAACGGC	0.493									Sickle_Cell_Trait		OREG0003733	type=REGULATORY REGION|Gene=HBB|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	88	---	---	---	---	PASS
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5618060	5618060	+	5'UTR	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5618060T>G	uc001mbf.2	+	1					HBG2_uc001mak.1_Intron|TRIM6_uc009yeo.1_Intron|TRIM6_uc010qzj.1_Intron|TRIM6_uc001mbc.1_Intron|TRIM6_uc001mbe.2_5'UTR|TRIM6_uc010qzk.1_5'UTR|TRIM6_uc010qzl.1_5'UTR|TRIM6_uc001mbd.2_5'UTR	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite							intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		GTGCCTTGGATTGCTCTGAAG	0.483													29	111	---	---	---	---	PASS
C11orf46	120534	broad.mit.edu	37	11	30352900	30352900	+	Silent	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30352900G>A	uc001mso.1	+	2	569	c.405G>A	c.(403-405)CAG>CAA	p.Q135Q		NM_152316	NP_689529	Q8N8R7	CK046_HUMAN	hypothetical protein LOC120534	135											0						AAGACCGCCAGAAAAGGAAAC	0.358													30	109	---	---	---	---	PASS
NPAS4	266743	broad.mit.edu	37	11	66191067	66191067	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66191067T>G	uc001ohx.1	+	6	1003	c.827T>G	c.(826-828)ATT>AGT	p.I276S	NPAS4_uc010rpc.1_Missense_Mutation_p.I66S	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	276					transcription, DNA-dependent		DNA binding|signal transducer activity				0						AGTGGAGATATTCAGGCAGAG	0.532													51	115	---	---	---	---	PASS
P2RY6	5031	broad.mit.edu	37	11	73008033	73008033	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73008033C>A	uc001otm.2	+	4	875	c.470C>A	c.(469-471)ACC>AAC	p.T157N	P2RY6_uc001otn.2_Missense_Mutation_p.T157N|P2RY6_uc001oto.2_Missense_Mutation_p.T157N|P2RY6_uc001otp.2_Missense_Mutation_p.T157N|P2RY6_uc001otq.2_Missense_Mutation_p.T157N|P2RY6_uc001otr.2_Missense_Mutation_p.T157N|P2RY6_uc001ots.2_Missense_Mutation_p.T157N	NM_176796	NP_789766	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y6	157	Helical; Name=4; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1						GCCGTGACAACCCAGTGCCTG	0.667													10	74	---	---	---	---	PASS
DNAJB13	374407	broad.mit.edu	37	11	73681196	73681196	+	3'UTR	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73681196C>T	uc001ouo.2	+	8						NM_153614	NP_705842	P59910	DJB13_HUMAN	testis spermatogenesis apoptosis-related protein						apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding				0	Breast(11;7.42e-05)					AGGAGGCTAGCCGGGCCTCAC	0.637													3	11	---	---	---	---	PASS
RNF169	254225	broad.mit.edu	37	11	74546695	74546695	+	Silent	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74546695A>T	uc001ovl.3	+	6	1060	c.1047A>T	c.(1045-1047)CTA>CTT	p.L349L	XRRA1_uc001ovm.2_Intron	NM_001098638	NP_001092108	Q8NCN4	RN169_HUMAN	ring finger protein 169	349							zinc ion binding			ovary(1)	1						AAAAGCGTCTACCCTTCAGCT	0.512													39	110	---	---	---	---	PASS
DLAT	1737	broad.mit.edu	37	11	111930750	111930750	+	Silent	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111930750C>G	uc001pmo.2	+	12	2297	c.1638C>G	c.(1636-1638)ACC>ACG	p.T546T	DLAT_uc009yyk.1_Silent_p.T441T|DLAT_uc010rwr.1_Silent_p.T419T	NM_001931	NP_001922	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase precursor	546	Catalytic (By similarity).				glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial pyruvate dehydrogenase complex	dihydrolipoyllysine-residue acetyltransferase activity|protein binding				0		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)	NADH(DB00157)	CTTTAGCAACCAAAGCAAGAG	0.358													37	133	---	---	---	---	PASS
OR8B12	219858	broad.mit.edu	37	11	124413531	124413531	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124413531G>A	uc010sam.1	-	1	20	c.20C>T	c.(19-21)TCT>TTT	p.S7F		NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		CTCTGTCACAGAAGAGTTTTT	0.517													22	67	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134029917	134029917	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134029917T>C	uc001qhd.1	-	29	4343	c.3737A>G	c.(3736-3738)AAA>AGA	p.K1246R	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA|NCAPD3_uc001qhc.1_Missense_Mutation_p.K196R	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1246	Potential.				cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TGCCAGCTGTTTGTCAACTGC	0.488													30	96	---	---	---	---	PASS
ETNK1	55500	broad.mit.edu	37	12	22812052	22812052	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22812052T>A	uc001rft.2	+	3	810	c.788T>A	c.(787-789)ATT>AAT	p.I263N	ETNK1_uc009ziz.2_Missense_Mutation_p.I263N	NM_018638	NP_061108	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1 isoform A	263					phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|ethanolamine kinase activity				0						TTCTCTCTCATTCCCACAGGA	0.343													26	105	---	---	---	---	PASS
DBX2	440097	broad.mit.edu	37	12	45410178	45410178	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45410178T>A	uc001rok.1	-	4	1083	c.911A>T	c.(910-912)CAG>CTG	p.Q304L		NM_001004329	NP_001004329	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	304						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		TGAACTCTCCTGGATTAGTCT	0.488													4	145	---	---	---	---	PASS
FAM113B	91523	broad.mit.edu	37	12	47629733	47629733	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47629733C>A	uc001rpn.2	+	4	1618	c.887C>A	c.(886-888)TCC>TAC	p.S296Y	FAM113B_uc010slj.1_Missense_Mutation_p.S176Y|FAM113B_uc001rpq.2_Missense_Mutation_p.S296Y	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	296	Pro-rich.						hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					cccttaccttcccccacatac	0.239													19	33	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57589705	57589705	+	Missense_Mutation	SNP	C	A	A	rs148336699		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57589705C>A	uc001snd.2	+	54	9086	c.8620C>A	c.(8620-8622)CGC>AGC	p.R2874S		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2874	Extracellular (Potential).|LDL-receptor class A 19.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCTGAGCTCCCGCCAGTGGGA	0.652													21	45	---	---	---	---	PASS
NUDT4	11163	broad.mit.edu	37	12	93793101	93793101	+	Silent	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93793101T>C	uc001tcm.2	+	5	887	c.489T>C	c.(487-489)AAT>AAC	p.N163N	NUDT4_uc010sup.1_Silent_p.N163N|NUDT4_uc001tcn.2_Silent_p.N111N|NUDT4_uc010suq.1_Silent_p.N112N|NUDT4_uc001tco.2_Silent_p.N111N	NM_019094	NP_061967	Q9NZJ9	NUDT4_HUMAN	nudix-type motif 4 isoform alpha	163					calcium-mediated signaling|cyclic nucleotide metabolic process|cyclic-nucleotide-mediated signaling|intracellular transport|regulation of RNA export from nucleus	cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0						CGGATAATAATGCCTTGTTTG	0.488													24	228	---	---	---	---	PASS
TPCN1	53373	broad.mit.edu	37	12	113727990	113727990	+	Silent	SNP	C	A	A	rs150639944		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113727990C>A	uc001tuw.2	+	22	2151	c.1854C>A	c.(1852-1854)ACC>ACA	p.T618T	TPCN1_uc001tux.2_Silent_p.T690T	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	618	Extracellular (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						GCAACAGGACCGTGGTGGAGG	0.562													4	20	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117665305	117665305	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117665305T>G	uc001twm.1	-	23	4233	c.3547A>C	c.(3547-3549)AGC>CGC	p.S1183R		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1183	FAD-binding FR-type.|FAD (By similarity).				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	GGGGAGGAGCTGATGGAATAG	0.617													32	103	---	---	---	---	PASS
RNF10	9921	broad.mit.edu	37	12	121013684	121013684	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121013684T>C	uc001typ.3	+	16	2773	c.2290T>C	c.(2290-2292)TCC>CCC	p.S764P	RNF10_uc010szk.1_RNA|RNF10_uc001tyq.3_Missense_Mutation_p.S675P	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10	764					negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTTTCAAAATTCCTTCAGCCA	0.483													119	241	---	---	---	---	PASS
TRPC4	7223	broad.mit.edu	37	13	38210914	38210914	+	3'UTR	SNP	A	T	T	rs142677581	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38210914A>T	uc001uws.2	-	11					TRPC4_uc010abv.2_3'UTR|TRPC4_uc001uwt.2_3'UTR|TRPC4_uc010tey.1_3'UTR|TRPC4_uc010abw.2_3'UTR|TRPC4_uc010abx.2_3'UTR|TRPC4_uc010aby.2_3'UTR	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,						axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TACAGGTAATATGCCACAGCT	0.338													5	10	---	---	---	---	PASS
AKAP11	11215	broad.mit.edu	37	13	42891796	42891796	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42891796A>T	uc001uys.1	+	12	5712	c.5537A>T	c.(5536-5538)CAT>CTT	p.H1846L		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	1846					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		CTTTATTTTCATGACTCTGCA	0.408													34	80	---	---	---	---	PASS
PRMT5	10419	broad.mit.edu	37	14	23393369	23393369	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23393369T>A	uc001whm.1	-	12	1314	c.1223A>T	c.(1222-1224)GAA>GTA	p.E408V	PRMT5_uc001whl.1_Missense_Mutation_p.E391V|PRMT5_uc010akd.1_RNA|PRMT5_uc010tnf.1_Missense_Mutation_p.E302V|PRMT5_uc010tng.1_Missense_Mutation_p.E347V|PRMT5_uc010tnh.1_Missense_Mutation_p.E364V|PRMT5_uc001whn.1_Missense_Mutation_p.E237V	NM_006109	NP_006100	O14744	ANM5_HUMAN	protein arginine methyltransferase 5 isoform a	408					cell proliferation|histone H4-R3 methylation|ncRNA metabolic process|regulation of mitosis|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	histone-arginine N-methyltransferase activity|protein binding|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding			ovary(1)	1	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		GCTTCCCCATTCTTCAAACTG	0.468													40	116	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33292170	33292170	+	Silent	SNP	G	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33292170G>C	uc001wrq.2	+	13	5321	c.5151G>C	c.(5149-5151)TCG>TCC	p.S1717S		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1717					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CGAATGCATCGTTCAGGAAGC	0.468													51	151	---	---	---	---	PASS
ATP5S	27109	broad.mit.edu	37	14	50790719	50790719	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50790719G>A	uc001wxw.1	+	4	1110	c.418G>A	c.(418-420)GAC>AAC	p.D140N	ATP5S_uc001wxx.1_Intron|ATP5S_uc010ant.1_Missense_Mutation_p.D112N	NM_001003803	NP_001003803	Q99766	ATP5S_HUMAN	ATP synthase, H+ transporting, mitochondrial F0	140					ATP biosynthetic process	mitochondrial inner membrane|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity			ovary(1)|skin(1)	2	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)		TATCGAGGATGACTGTTTGCT	0.368													49	129	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52478273	52478273	+	Silent	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52478273T>C	uc001wzo.2	-	17	3783	c.3549A>G	c.(3547-3549)TCA>TCG	p.S1183S	NID2_uc010tqs.1_Silent_p.S1135S|NID2_uc010tqt.1_Silent_p.S1183S	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	1183	LDL-receptor class B 1.					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					GCTGCTGACCTGAATTCACGA	0.512													4	170	---	---	---	---	PASS
OTX2	5015	broad.mit.edu	37	14	57271023	57271023	+	Silent	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57271023C>A	uc001xcp.2	-	2	303	c.132G>T	c.(130-132)ACG>ACT	p.T44T	OTX2_uc010aou.2_Silent_p.T44T|OTX2_uc001xcq.2_Silent_p.T52T	NM_172337	NP_758840	P32243	OTX2_HUMAN	orthodenticle homeobox 2 isoform b	44	Homeobox.				axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding			ovary(1)	1	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					CCCGAGTGAACGTCGTCCTCT	0.597													13	63	---	---	---	---	PASS
DICER1	23405	broad.mit.edu	37	14	95557550	95557550	+	Silent	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95557550C>A	uc001ydw.2	-	26	5699	c.5517G>T	c.(5515-5517)CGG>CGT	p.R1839R	DICER1_uc010avh.1_Silent_p.R737R|DICER1_uc001ydv.2_Silent_p.R1829R|DICER1_uc001ydx.2_Silent_p.R1839R	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1839					negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CTATTAGTGGCCGCATCATGG	0.398			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				97	248	---	---	---	---	PASS
HSP90AA1	3320	broad.mit.edu	37	14	102568335	102568335	+	Silent	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102568335G>T	uc001ykv.3	-	2	588	c.243C>A	c.(241-243)CTC>CTA	p.L81L		NM_001017963	NP_001017963	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 1	Error:Variant_position_missing_in_P07900_after_alignment					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)	GCTGTTTCCAGAGACAGAGTA	0.537													4	157	---	---	---	---	PASS
PPP1R13B	23368	broad.mit.edu	37	14	104208276	104208276	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104208276G>A	uc001yof.1	-	11	1956	c.1673C>T	c.(1672-1674)GCT>GTT	p.A558V	PPP1R13B_uc010awv.1_RNA|PPP1R13B_uc001yog.1_Missense_Mutation_p.A425V	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	558	Pro-rich.				apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				CCCTTTATCAGCCAGGAAAGG	0.567													58	143	---	---	---	---	PASS
ACTC1	70	broad.mit.edu	37	15	35085454	35085454	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35085454C>T	uc001ziu.1	-	3	689	c.446G>A	c.(445-447)CGT>CAT	p.R149H	uc001zit.1_Intron	NM_005159	NP_005150	P68032	ACTC_HUMAN	cardiac muscle alpha actin 1 proprotein	149					apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ACCTGTGGTACGGCCAGAAGC	0.517													32	74	---	---	---	---	PASS
INO80	54617	broad.mit.edu	37	15	41364204	41364204	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41364204G>T	uc001zni.2	-	12	1661	c.1448C>A	c.(1447-1449)GCA>GAA	p.A483E	INO80_uc010ucu.1_RNA	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1	483	Assembles INO80 complex module consisting of conserved components ACTR8, ACTL6A and YY1.				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						CTTGTTTGCTGCCCGTAGGGC	0.398													78	184	---	---	---	---	PASS
PLA2G4F	255189	broad.mit.edu	37	15	42439928	42439928	+	Silent	SNP	A	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42439928A>C	uc001zoz.2	-	12	1155	c.1092T>G	c.(1090-1092)GGT>GGG	p.G364G	PLA2G4F_uc010bcq.2_5'Flank|PLA2G4F_uc001zoy.2_5'UTR|PLA2G4F_uc010bcr.2_Silent_p.G115G|PLA2G4F_uc001zpa.2_Silent_p.G115G|PLA2G4F_uc010bcs.2_Silent_p.G151G	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	364	PLA2c.				phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity			ovary(4)	4		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CTCGGGTTCCACCCCCGGAAC	0.522													7	54	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43699486	43699486	+	3'UTR	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43699486G>T	uc001zrs.2	-	28					TP53BP1_uc010udp.1_3'UTR|TP53BP1_uc001zrq.3_3'UTR|TP53BP1_uc001zrr.3_3'UTR|TP53BP1_uc001zrp.2_3'UTR	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3						double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CAAGATCCATGCAAGGAATCC	0.328								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					12	33	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63944712	63944712	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63944712T>G	uc002amp.2	-	52	10467	c.10319A>C	c.(10318-10320)AAA>ACA	p.K3440T		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	3440	WD 4.				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CAAAAGACCTTTTTTATTACA	0.348													3	25	---	---	---	---	PASS
LCTL	197021	broad.mit.edu	37	15	66853375	66853375	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66853375C>A	uc002aqc.2	-	6	806	c.674G>T	c.(673-675)GGC>GTC	p.G225V	LCTL_uc002aqd.3_Missense_Mutation_p.G52V|LCTL_uc010bhw.2_Intron	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN	lactase-like precursor	225	Extracellular (Potential).				carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(2)	2						CTTGTACAGGCCGGTGCCGCG	0.602													9	102	---	---	---	---	PASS
LMAN1L	79748	broad.mit.edu	37	15	75111763	75111763	+	Intron	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75111763G>A	uc002ayt.1	+						LMAN1L_uc010bkd.2_3'UTR|LMAN1L_uc010ulo.1_3'UTR|LMAN1L_uc010bke.1_Intron	NM_021819	NP_068591	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like precursor							ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding				0						tgtctgccttgagacttgcaa	0.308													9	15	---	---	---	---	PASS
USP7	7874	broad.mit.edu	37	16	9010986	9010986	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9010986C>T	uc002czl.2	-	7	947	c.748G>A	c.(748-750)GAT>AAT	p.D250N	USP7_uc010uyk.1_Missense_Mutation_p.D151N|USP7_uc010uyj.1_Missense_Mutation_p.D151N|USP7_uc002czk.2_Missense_Mutation_p.D234N|USP7_uc010uyl.1_RNA	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	250					interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						GACGAATCATCCCCCTCGGTT	0.343													61	184	---	---	---	---	PASS
FAM18A	780776	broad.mit.edu	37	16	10861923	10861923	+	3'UTR	SNP	C	A	A	rs2302710		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10861923C>A	uc010buo.1	-	8					FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|FAM18A_uc002daf.1_RNA|NUBP1_uc002daa.1_Intron|NUBP1_uc002dab.1_Intron|FAM18A_uc002dae.1_3'UTR	NM_001079512	NP_001072980	A6NH52	FA18A_HUMAN	hypothetical protein LOC780776							integral to membrane					0						ATGCAGATGCCTGTGGGGCAG	0.527													22	73	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15221853	15221853	+	Intron	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15221853G>A	uc002ddc.2	+						uc010uzs.1_RNA|uc002ddh.2_Silent_p.A382A|uc002ddi.2_Silent_p.A158A|uc010uzt.1_Silent_p.A382A	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	CCTTACTCGCGGCCAGCACCT	0.657													4	33	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20451770	20451770	+	3'UTR	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20451770C>T	uc002dhe.2	+	14						NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						AGGAAGGCCCCGTAGACCTCC	0.507													25	27	---	---	---	---	PASS
ACSM1	116285	broad.mit.edu	37	16	20651789	20651789	+	Silent	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20651789C>T	uc002dhm.1	-	7	1178	c.1110G>A	c.(1108-1110)TCG>TCA	p.S370S	ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Silent_p.S370S	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	370					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						CTACCGTTTCCGACTGCCCAT	0.333													38	76	---	---	---	---	PASS
CD19	930	broad.mit.edu	37	16	28944420	28944420	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28944420C>T	uc002drs.2	+	3	606	c.544C>T	c.(544-546)CAG>TAG	p.Q182*	uc010vct.1_Intron|CD19_uc010byo.1_Nonsense_Mutation_p.Q182*	NM_001770	NP_001761	P15391	CD19_HUMAN	CD19 antigen precursor	182	Extracellular (Potential).|Ig-like C2-type 2.				cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity			ovary(2)|central_nervous_system(1)	3						CAGCCTGAACCAGAGCCTCAG	0.617													12	64	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49557609	49557609	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49557609C>A	uc002efs.2	-	8	4049	c.3751G>T	c.(3751-3753)GTG>TTG	p.V1251L	ZNF423_uc010vgn.1_Missense_Mutation_p.V1134L	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1251	C2H2-type 29.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				TGCCCGTGCACGGCAAAGATG	0.602													14	50	---	---	---	---	PASS
HERPUD1	9709	broad.mit.edu	37	16	56974151	56974151	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56974151T>C	uc002eke.1	+	6	1308	c.899T>C	c.(898-900)ATG>ACG	p.M300T	HERPUD1_uc002ekf.1_Missense_Mutation_p.M299T|HERPUD1_uc002ekg.1_Missense_Mutation_p.M275T|HERPUD1_uc010cco.1_Intron|HERPUD1_uc010ccp.1_Intron|HERPUD1_uc002ekh.1_Missense_Mutation_p.M118T	NM_014685	NP_055500	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum	300	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane	protein binding				0						ACCGTTGTTATGTACCTGTAA	0.348			T	ERG	prostate								60	112	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90162462	90162462	+	3'UTR	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90162462A>G	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		ACTGGTACACAGGCGAGGGCA	0.522													5	167	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5036864	5036864	+	Intron	SNP	C	T	T	rs76269146	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5036864C>T	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|USP6_uc002gaw.2_Intron|uc002gay.1_5'Flank|uc002gba.2_RNA	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						AGCCAGAGCACAACAAACAGG	0.592			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								11	89	---	---	---	---	PASS
TMEM107	84314	broad.mit.edu	37	17	8076788	8076788	+	3'UTR	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8076788C>A	uc002gkg.3	-	5					TMEM107_uc002gkh.3_3'UTR|TMEM107_uc002gki.3_3'UTR|TMEM107_uc002gkj.3_RNA	NM_183065	NP_898888	Q6UX40	TM107_HUMAN	transmembrane protein 107 isoform 2							integral to membrane					0						caggagcaatcagggtgttgc	0.159													46	103	---	---	---	---	PASS
SLC47A2	146802	broad.mit.edu	37	17	19582221	19582221	+	Intron	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19582221T>C	uc002gwe.3	-						SLC47A2_uc002gwg.3_Intron|SLC47A2_uc002gwf.3_Intron|SLC47A2_uc002gwh.3_Intron|SLC47A2_uc002gwi.2_Intron	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN	solute carrier family 47, member 2 isoform 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)					CTGTAGCCACTGCGGAAGCAA	0.413													6	1	---	---	---	---	PASS
TP53I13	90313	broad.mit.edu	37	17	27896080	27896080	+	Silent	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27896080G>A	uc002hee.2	+	2	155	c.117G>A	c.(115-117)GAG>GAA	p.E39E	ABHD15_uc002hed.1_5'Flank	NM_138349	NP_612358	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	39	Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane					0				READ - Rectum adenocarcinoma(3;0.236)		ATTGTCCCGAGAGCCTGTGGC	0.687													4	10	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29684022	29684022	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29684022A>G	uc002hgg.2	+	53	8116	c.7783A>G	c.(7783-7785)AAA>GAA	p.K2595E	NF1_uc002hgh.2_Missense_Mutation_p.K2574E|NF1_uc010cso.2_Missense_Mutation_p.K783E|NF1_uc010wbt.1_Missense_Mutation_p.K73E|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2595					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.K2595fs*5(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACATTTACGTAAAGTTTCAGT	0.418			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			99	268	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587569	43587569	+	Intron	SNP	G	C	C	rs149697015	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587569G>C	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						aactccgtctgaaaagaaaag	0.144													3	107	---	---	---	---	PASS
TMEM92	162461	broad.mit.edu	37	17	48356271	48356271	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48356271T>A	uc002iqn.1	+	4	310	c.280T>A	c.(280-282)TGC>AGC	p.C94S		NM_153229	NP_694961	Q6UXU6	TMM92_HUMAN	transmembrane protein 92 precursor	94	Pro-rich.|Cytoplasmic (Potential).					integral to membrane					0						CCCAGTGGATTGCCGGGGGCC	0.607													31	102	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56082624	56082624	+	3'UTR	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56082624G>A	uc002ivi.2	-	4					SFRS1_uc002ivj.2_3'UTR	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		TAGATGTTAGGAGCAAGGGGA	0.313													9	19	---	---	---	---	PASS
MRPS7	51081	broad.mit.edu	37	17	73258412	73258412	+	Intron	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73258412C>T	uc002jnm.3	+						GGA3_uc002jni.1_5'Flank|GGA3_uc002jnj.1_5'Flank|GGA3_uc010wrw.1_5'UTR|GGA3_uc002jnk.1_5'Flank|GGA3_uc010wrx.1_5'Flank|GGA3_uc010wry.1_5'UTR|GGA3_uc010wrz.1_5'Flank|MRPS7_uc002jnl.2_Intron|MRPS7_uc002jnn.3_Missense_Mutation_p.S2F	NM_015971	NP_057055	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7 precursor						translation	cytosolic small ribosomal subunit|mitochondrion	protein binding|RNA binding|structural constituent of ribosome			central_nervous_system(1)	1	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			TGGGGAATGTCCTCCTACTTG	0.597													12	48	---	---	---	---	PASS
LOC644669	644669	broad.mit.edu	37	18	15323276	15323276	+	RNA	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15323276A>T	uc002ktd.1	-	3		c.183T>A				NR_027417				Homo sapiens cDNA FLJ40312 fis, clone TESTI2029880.												0						ATCAACTGCAATTGCATTTGC	0.308													9	20	---	---	---	---	PASS
SMAD2	4087	broad.mit.edu	37	18	45395769	45395769	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45395769C>A	uc002lcy.2	-	4	613	c.365G>T	c.(364-366)GGA>GTA	p.G122V	SMAD2_uc002lcz.2_Missense_Mutation_p.G122V|SMAD2_uc010xdc.1_Missense_Mutation_p.G92V|SMAD2_uc010xdd.1_Missense_Mutation_p.G92V	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1	122	MH1.				anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			large_intestine(3)|lung(1)|central_nervous_system(1)	5						ATGTGGCAATCCTTTTCGATG	0.403													21	62	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56204268	56204268	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56204268A>G	uc002lhj.3	-	5	3365	c.3151T>C	c.(3151-3153)TTT>CTT	p.F1051L	ALPK2_uc002lhk.1_Missense_Mutation_p.F382L	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1051							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						TGGGAAGGAAATTGGGAAACC	0.498													53	95	---	---	---	---	PASS
SOCS6	9306	broad.mit.edu	37	18	67992983	67992983	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67992983C>T	uc002lkr.1	+	2	1395	c.1079C>T	c.(1078-1080)TCA>TTA	p.S360L	SOCS6_uc010dqq.2_Missense_Mutation_p.S360L	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	360					defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GTTTATGACTCAGTGCAAAGT	0.493													32	90	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72346444	72346444	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72346444A>C	uc002llw.2	+	1	3526	c.3469A>C	c.(3469-3471)AAT>CAT	p.N1157H	ZNF407_uc010xfc.1_Missense_Mutation_p.N1157H|ZNF407_uc010dqu.1_Missense_Mutation_p.N1157H|ZNF407_uc002llu.2_Missense_Mutation_p.N1156H	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	1157					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AGAAGAATCTAATTTCAATGA	0.388													33	92	---	---	---	---	PASS
C19orf36	113177	broad.mit.edu	37	19	2098586	2098586	+	Intron	SNP	G	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2098586G>C	uc002luw.1	+						C19orf36_uc002lux.1_Intron|C19orf36_uc010xgw.1_3'UTR	NM_001039846	NP_001034935	Q1ZYL8	IZUM4_HUMAN	hypothetical protein LOC113177 isoform 3							extracellular region					0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCAACCCAGCTCTGCGCAG	0.622													5	30	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9073639	9073639	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9073639G>A	uc002mkp.2	-	3	14011	c.13807C>T	c.(13807-13809)CGA>TGA	p.R4603*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4605	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	p.R4603Q(1)		lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCTCTTTTCGTCCAGCAGTC	0.498													4	101	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14627690	14627690	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627690A>C	uc002myz.1	-	2	420	c.380T>G	c.(379-381)ATT>AGT	p.I127S	DNAJB1_uc010xnr.1_Missense_Mutation_p.I27S	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	127					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		TGGGTCATCAATGTCCATGCC	0.557													44	97	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19351391	19351391	+	Intron	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19351391C>G	uc002nlz.2	+						NCAN_uc002nma.2_5'UTR	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor						axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			ACACCCAGACCCACAACCCCC	0.612													19	68	---	---	---	---	PASS
ERF	2077	broad.mit.edu	37	19	42754274	42754274	+	Intron	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42754274T>C	uc002ote.3	-						ERF_uc002otd.3_5'UTR	NM_006494	NP_006485	P50548	ERF_HUMAN	Ets2 repressor factor						cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	4		Prostate(69;0.00682)				AAGGCAGGACTAGAGGATCCA	0.393													3	10	---	---	---	---	PASS
PSG8	440533	broad.mit.edu	37	19	43258643	43258643	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43258643G>C	uc002ouo.2	-	5	1183	c.1085C>G	c.(1084-1086)GCA>GGA	p.A362G	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Missense_Mutation_p.A201G|PSG8_uc002ouh.2_Missense_Mutation_p.A362G|PSG8_uc010ein.2_Missense_Mutation_p.A240G|PSG8_uc002ouj.3_Missense_Mutation_p.A144G|PSG8_uc002ouk.3_Missense_Mutation_p.A201G|PSG8_uc002oul.3_Missense_Mutation_p.A362G|PSG8_uc002oum.3_Missense_Mutation_p.A269G|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.A269G	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	362	Ig-like C2-type 3.					extracellular region					0		Prostate(69;0.00899)				AGAATACTGTGCCGGTGGGTT	0.468													15	442	---	---	---	---	PASS
SLC1A5	6510	broad.mit.edu	37	19	47280552	47280552	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47280552G>A	uc002pfs.2	-	6	1789	c.1169C>T	c.(1168-1170)GCC>GTC	p.A390V	SLC1A5_uc010xyh.1_Missense_Mutation_p.A188V|SLC1A5_uc002pfq.2_Missense_Mutation_p.A214V|SLC1A5_uc002pfr.2_Missense_Mutation_p.A162V	NM_005628	NP_005619	Q15758	AAAT_HUMAN	solute carrier family 1 member 5 isoform 1	390	Helical; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane|melanosome|membrane fraction	neutral amino acid transmembrane transporter activity|protein binding|receptor activity|sodium:dicarboxylate symporter activity				0		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	GAAGAGCGCGGCACCGTCCAT	0.587													4	71	---	---	---	---	PASS
KLK2	3817	broad.mit.edu	37	19	51378153	51378153	+	Intron	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51378153G>T	uc002ptv.2	+						KLK2_uc010eog.2_Intron|KLK2_uc010yck.1_Intron|KLK2_uc002ptu.2_Intron|KLK2_uc002ptt.2_Intron|KLK2_uc010ycl.1_Missense_Mutation_p.G29V|KLK2_uc010ycm.1_Intron|KLK2_uc010eoh.2_5'Flank	NM_005551	NP_005542	P20151	KLK2_HUMAN	kallikrein 2, prostatic isoform 1						proteolysis		serine-type endopeptidase activity			ovary(1)|skin(1)	2		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		AGGACCCTGGGATCTGGGGAG	0.572			T	ETV4	prostate								14	30	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	52196178	52196178	+	RNA	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52196178C>T	uc002pxg.1	-	1		c.532G>A			uc002pxj.1_5'Flank|MIR125A_hsa-mir-125a|MI0000469_5'Flank|NCRNA00085_uc002pxk.3_5'Flank|NCRNA00085_uc002pxl.3_5'Flank					Homo sapiens cDNA FLJ44008 fis, clone TESTI4023942.																		GGACCCTTAGCCCCACTGGGC	0.657													11	27	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54754843	54754843	+	Intron	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54754843A>G	uc002qex.2	-						LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.S598P|LILRB5_uc002qey.2_Intron|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGGGTGGGGAGGCCTGGGGG	0.607													4	54	---	---	---	---	PASS
CDS2	8760	broad.mit.edu	37	20	5154171	5154171	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5154171G>T	uc002wls.2	+	2	317	c.60G>T	c.(58-60)GAG>GAT	p.E20D	CDS2_uc002wlr.1_5'UTR|CDS2_uc010zqt.1_RNA|CDS2_uc002wlu.2_Intron|CDS2_uc010zqu.1_Intron|CDS2_uc002wlv.2_5'Flank	NM_003818	NP_003809	O95674	CDS2_HUMAN	phosphatidate cytidylyltransferase 2	20					phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphatidate cytidylyltransferase activity				0						CCACTTAGGAGTCAGAGTCAG	0.443													93	266	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44684805	44684805	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44684805A>T	uc010zxl.1	+	22	2949	c.2873A>T	c.(2872-2874)GAT>GTT	p.D958V	SLC12A5_uc002xrb.2_Missense_Mutation_p.D935V	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	958	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	AGTATCACAGATGAGTCACGA	0.522													15	51	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57485057	57485057	+	Silent	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57485057C>T	uc002xzw.2	+	11	3105	c.2820C>T	c.(2818-2820)CTC>CTT	p.L940L	GNAS_uc002xzt.2_3'UTR|GNAS_uc010gjq.2_Silent_p.L238L|GNAS_uc002xzx.2_Silent_p.L238L|GNAS_uc010gjr.2_Silent_p.L188L|GNAS_uc002xzy.2_Silent_p.L223L|GNAS_uc002yaa.2_Silent_p.L283L|GNAS_uc010zzt.1_Silent_p.L298L|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_Silent_p.L188L|GNAS_uc002yae.2_Silent_p.L222L	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	297					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			AAGATCTGCTCGCTGAGAAAG	0.512			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			41	149	---	---	---	---	PASS
PPP1R3D	5509	broad.mit.edu	37	20	58514505	58514505	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58514505G>A	uc002ybb.2	-	1	848	c.482C>T	c.(481-483)CCG>CTG	p.P161L	C20orf177_uc002yba.2_Intron|C20orf177_uc010zzx.1_5'Flank|C20orf177_uc002ybc.2_5'Flank	NM_006242	NP_006233	O95685	PPR3D_HUMAN	protein phosphatase 1, regulatory subunit 3D	161					glycogen metabolic process		protein binding|protein serine/threonine phosphatase activity				0	all_lung(29;0.00391)		BRCA - Breast invasive adenocarcinoma(7;5.12e-09)			CTCGACGGGCGGCGGGAAATC	0.677													6	26	---	---	---	---	PASS
GABPA	2551	broad.mit.edu	37	21	27141472	27141472	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27141472C>A	uc002ylx.3	+	10	1821	c.1294C>A	c.(1294-1296)CAT>AAT	p.H432N	GABPA_uc002yly.3_Missense_Mutation_p.H432N	NM_002040	NP_002031	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha	432					positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)|central_nervous_system(1)	2						GATGCAGCTCCATGGAATTGC	0.473													27	54	---	---	---	---	PASS
IFNAR1	3454	broad.mit.edu	37	21	34721421	34721421	+	Silent	SNP	A	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34721421A>T	uc002yrn.2	+	7	960	c.813A>T	c.(811-813)GGA>GGT	p.G271G	IFNAR1_uc011adv.1_Silent_p.G202G	NM_000629	NP_000620	P17181	INAR1_HUMAN	interferon-alpha receptor 1 precursor	271	Fibronectin type-III 2.|Extracellular (Potential).				JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	integral to plasma membrane	type I interferon receptor activity			central_nervous_system(1)|skin(1)	2					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	GGAATCCTGGAAACCATTTGT	0.234													54	159	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24451598	24451598	+	Silent	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24451598C>T	uc002zzi.1	+	9	1196	c.1069C>T	c.(1069-1071)CTG>TTG	p.L357L	CABIN1_uc002zzj.1_Silent_p.L307L|CABIN1_uc002zzl.1_Silent_p.L357L|CABIN1_uc010guk.1_Silent_p.L312L|CABIN1_uc002zzk.1_Silent_p.L312L	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	357					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CAGTCCTGGTCTGTTGGAGAC	0.617													21	82	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26388405	26388405	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26388405C>T	uc003abz.1	+	40	6483	c.6233C>T	c.(6232-6234)GCC>GTC	p.A2078V	MYO18B_uc003aca.1_Missense_Mutation_p.A1959V|MYO18B_uc010guy.1_Missense_Mutation_p.A1960V|MYO18B_uc010guz.1_Missense_Mutation_p.A1958V|MYO18B_uc011aka.1_Missense_Mutation_p.A1232V|MYO18B_uc011akb.1_Missense_Mutation_p.A1591V|MYO18B_uc010gva.1_Missense_Mutation_p.A76V	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2078	Tail.|Potential.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CGGCGGATTGCCGACCTGCAG	0.592													3	39	---	---	---	---	PASS
SCUBE1	80274	broad.mit.edu	37	22	43616536	43616536	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43616536C>T	uc003bdt.1	-	14	1695	c.1607G>A	c.(1606-1608)CGT>CAT	p.R536H		NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	536					adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				CTTGCGGCCACGGCGCCTCTT	0.577													5	157	---	---	---	---	PASS
VCX3B	425054	broad.mit.edu	37	X	8433401	8433401	+	5'UTR	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8433401T>C	uc010ndo.2	+	2					VCX3B_uc011mht.1_5'UTR|VCX3B_uc004csd.1_5'UTR	NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B							nucleolus					0						GGGGCGTGATTGTCTCGTCCT	0.567													6	31	---	---	---	---	PASS
VCX3B	425054	broad.mit.edu	37	X	8433432	8433432	+	5'UTR	SNP	T	C	C			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8433432T>C	uc010ndo.2	+	2					VCX3B_uc011mht.1_5'UTR|VCX3B_uc004csd.1_5'UTR	NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B							nucleolus					0						GAGGTGTATATACAGGGAGGC	0.607													6	74	---	---	---	---	PASS
CXorf58	254158	broad.mit.edu	37	X	23929902	23929902	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23929902A>G	uc004daz.1	+	3	489	c.145A>G	c.(145-147)ATA>GTA	p.I49V	CXorf58_uc011mju.1_Missense_Mutation_p.I49V	NM_152761	NP_689974	Q96LI9	CX058_HUMAN	hypothetical protein LOC254158	49											0						AGCTCAAATAATACAGAGGGC	0.303													9	240	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31792262	31792262	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31792262C>G	uc004dda.1	-	51	7601	c.7357G>C	c.(7357-7359)GAA>CAA	p.E2453Q	DMD_uc004dcr.1_5'UTR|DMD_uc004dcs.1_5'UTR|DMD_uc004dct.1_5'UTR|DMD_uc004dcu.1_5'UTR|DMD_uc004dcv.1_5'UTR|DMD_uc004dcw.2_Missense_Mutation_p.E1109Q|DMD_uc004dcx.2_Missense_Mutation_p.E1112Q|DMD_uc004dcz.2_Missense_Mutation_p.E2330Q|DMD_uc004dcy.1_Missense_Mutation_p.E2449Q|DMD_uc004ddb.1_Missense_Mutation_p.E2445Q|DMD_uc004ddd.1_5'UTR	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2453					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATGGCAGTTTCCTTAGTAACC	0.413													23	78	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54957820	54957820	+	3'UTR	SNP	C	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54957820C>T	uc004dtq.2	+	13					TRO_uc004dts.2_3'UTR|TRO_uc004dtr.2_3'UTR|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_RNA|TRO_uc004dtv.2_3'UTR|TRO_uc011mok.1_3'UTR|TRO_uc004dtw.2_3'UTR|TRO_uc004dtx.2_3'UTR	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5						embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						TTTCTGTGTGCTGTCATATTT	0.398													25	52	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106109183	106109183	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106109183C>G	uc004emo.2	+	16	2747	c.2582C>G	c.(2581-2583)TCA>TGA	p.S861*	MORC4_uc004emp.3_Intron	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	861	EF-hand.					intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AATAAAGACTCACTAGCTTTA	0.393													60	237	---	---	---	---	PASS
TARDBP	23435	broad.mit.edu	37	1	11077260	11077260	+	Intron	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11077260delT	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		GTTACCtttcttttttttttt	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22569928	22569929	+	IGR	DEL	AG	-	-	rs142077239		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22569928_22569929delAG								WNT4 (99543 upstream) : ZBTB40 (208415 downstream)																							tcaaaaaaaaagaagaagaagg	0.064													3	3	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45407037	45407038	+	Intron	INS	-	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45407037_45407038insT	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					actgtgtcttatttgactttat	0.163													15	13	---	---	---	---	
LRRC39	127495	broad.mit.edu	37	1	100625161	100625162	+	Intron	DEL	CC	-	-	rs7521791		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100625161_100625162delCC	uc001dsw.1	-						LRRC39_uc001dsx.1_Intron|LRRC39_uc001dsy.1_Intron|LRRC39_uc001dsz.1_Intron	NM_144620	NP_653221	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39											ovary(2)|skin(1)	3		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		tttttcttttcctttttttttt	0.272													4	2	---	---	---	---	
LRRC39	127495	broad.mit.edu	37	1	100625163	100625163	+	Intron	DEL	T	-	-	rs66843977		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100625163delT	uc001dsw.1	-						LRRC39_uc001dsx.1_Intron|LRRC39_uc001dsy.1_Intron|LRRC39_uc001dsz.1_Intron	NM_144620	NP_653221	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39											ovary(2)|skin(1)	3		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		tttcttttccttttttttttt	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855840	148855842	+	IGR	DEL	GGT	-	-	rs60282471		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855840_148855842delGGT								NBPF16 (97529 upstream) : LOC645166 (72444 downstream)																							aagccgcggcggtggcggcggag	0.335													9	5	---	---	---	---	
USP39	10713	broad.mit.edu	37	2	85872401	85872401	+	Intron	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85872401delT	uc002sqe.2	+						USP39_uc002sqb.2_Intron|USP39_uc010ysu.1_Intron|USP39_uc010ysv.1_Intron|USP39_uc002sqf.2_Intron|USP39_uc002sqg.2_Intron|USP39_uc010fgo.2_Intron	NM_006590	NP_006581	Q53GS9	SNUT2_HUMAN	ubiquitin specific protease 39						spliceosome assembly|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1						ccttgggagcttttttttttt	0.124													4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	142231570	142231577	+	Intron	DEL	TTCCTTCC	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142231570_142231577delTTCCTTCC	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTTTACTAAAttccttccttccttcctt	0.111										TSP Lung(27;0.18)			5	4	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179613182	179613182	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179613182delT	uc002unb.2	-	46	14169	c.13945delA	c.(13945-13947)ATTfs	p.I4649fs	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGCTAGGAATTTTTTCTTTA	0.363													247	106	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218668979	218668980	+	3'UTR	INS	-	TCTC	TCTC	rs148936266	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218668979_218668980insTCTC	uc002vgt.2	-	33					TNS1_uc002vgr.2_3'UTR|TNS1_uc002vgs.2_3'UTR|TNS1_uc002vgq.2_3'UTR	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TCCTCCAtctttctctctctct	0.431													4	3	---	---	---	---	
SATB1	6304	broad.mit.edu	37	3	18457303	18457303	+	Intron	DEL	G	-	-	rs112868614		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18457303delG	uc003cbh.2	-						SATB1_uc003cbi.2_Intron|SATB1_uc003cbj.2_Intron	NM_002971	NP_002962	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1						cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						TTGTGTGTGTGGGGGGGGGGA	0.348													4	2	---	---	---	---	
OSBPL10	114884	broad.mit.edu	37	3	32022334	32022335	+	Intron	DEL	CA	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32022334_32022335delCA	uc003cev.2	-						OSBPL10_uc011axf.1_Intron|ZNF860_uc011axg.1_5'Flank	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10						lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)		cacacgcacgcacacacacaca	0.485													3	3	---	---	---	---	
VPRBP	9730	broad.mit.edu	37	3	51467042	51467042	+	Intron	DEL	T	-	-	rs78350648		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51467042delT	uc003dbe.1	-							NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		CATATTCTGCTTATGTATCAG	0.284													1	6	---	---	---	---	
HPS3	84343	broad.mit.edu	37	3	148890105	148890106	+	3'UTR	INS	-	CA	CA	rs72453449		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148890105_148890106insCA	uc003ewu.1	+	17					CP_uc011bnr.1_Intron|HPS3_uc011bnq.1_3'UTR|HPS3_uc003ewv.1_RNA	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein							cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ATTTTATATATcacacacacac	0.243									Hermansky-Pudlak_syndrome				7	4	---	---	---	---	
GOLIM4	27333	broad.mit.edu	37	3	167764595	167764595	+	Intron	DEL	A	-	-	rs66983386		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167764595delA	uc003ffe.2	-						GOLIM4_uc011bpe.1_Intron|GOLIM4_uc011bpf.1_Intron|GOLIM4_uc011bpg.1_Intron	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4						transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						TTTGGCAGCCAAAAAAAAAAA	0.323													6	3	---	---	---	---	
IL1RAP	3556	broad.mit.edu	37	3	190321881	190321883	+	Intron	DEL	TCA	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190321881_190321883delTCA	uc003fsm.1	+						IL1RAP_uc003fsk.2_Intron|IL1RAP_uc003fsl.2_Intron|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Intron|IL1RAP_uc003fsn.1_Intron|IL1RAP_uc003fso.1_Intron|IL1RAP_uc003fsp.1_Intron|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform						inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		GTAAAATGACTCATCTGCCCCTT	0.468													35	17	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195490839	195490845	+	Intron	DEL	TCCAGAT	-	-	rs63306962		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195490839_195490845delTCCAGAT	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTACTCCTTATCCAGATGCCACCTCCC	0.628													3	8	---	---	---	---	
HERC6	55008	broad.mit.edu	37	4	89360995	89360995	+	Intron	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89360995delT	uc011cdi.1	+						HERC6_uc011cdj.1_Intron|HERC6_uc011cdk.1_Intron|HERC6_uc011cdl.1_Intron	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		ccttcctttcttttttttttt	0.249													8	5	---	---	---	---	
KLHL2	11275	broad.mit.edu	37	4	166218560	166218560	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166218560delA	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		TTGGGTAAATAAAAAAAAAAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	180509055	180509058	+	IGR	DEL	GTTG	-	-	rs60959478		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180509055_180509058delGTTG								None (None upstream) : None (None downstream)																							gtgtgtgtgtgttgtgtgtgtgtg	0.000													4	3	---	---	---	---	
DDX4	54514	broad.mit.edu	37	5	55055879	55055879	+	Intron	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55055879delT	uc003jqg.3	+						DDX4_uc010ivz.2_Intron|DDX4_uc003jqh.3_Intron	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform						multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				CATGTAGCCATTTTTTTTTTT	0.318													11	6	---	---	---	---	
DND1	373863	broad.mit.edu	37	5	140052285	140052285	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140052285delT	uc003lgt.2	-	3	393	c.349delA	c.(349-351)ACGfs	p.T117fs		NM_194249	NP_919225	Q8IYX4	DND1_HUMAN	dead end homolog 1	117	RRM 1.				multicellular organismal development|negative regulation of gene silencing by miRNA	cytoplasm|nucleus	AU-rich element binding|nucleotide binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGTGCAGCGTGGCGATGGCG	0.682													9	5	---	---	---	---	
SPINK6	404203	broad.mit.edu	37	5	147585796	147585803	+	Intron	DEL	ACCTAACC	-	-	rs62388546		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147585796_147585803delACCTAACC	uc003lpa.2	+							NM_205841	NP_995313	Q6UWN8	ISK6_HUMAN	serine protease inhibitor, Kazal type 6							extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTAAAAGAACCTAACCACACATTCTC	0.216													14	9	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	156184532	156184532	+	Intron	DEL	C	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156184532delC	uc003lwd.3	+						SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCATGAACTTCCTTTTGTATT	0.388													11	5	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32487006	32487007	+	Intron	INS	-	CCCAGTAG	CCCAGTAG			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32487006_32487007insCCCAGTAG	uc003obj.2	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						ACAGGGCTACCCCCAGTGACCT	0.475													4	2	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	168948021	168948021	+	Intron	DEL	A	-	-	rs67307076		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168948021delA	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		gaatctctttaaaaaaaacaa	0.070													4	3	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38543102	38543103	+	Intron	DEL	GT	-	-	rs67603609		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38543102_38543103delGT	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						GGGCGGGGGGGTGGGTGGTGGA	0.426													4	3	---	---	---	---	
URGCP	55665	broad.mit.edu	37	7	43926978	43926979	+	Intron	INS	-	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43926978_43926979insT	uc003tiw.2	-						URGCP_uc003tiu.2_Intron|URGCP_uc003tiv.2_Intron|URGCP_uc003tix.2_Intron|URGCP_uc003tiy.2_Intron|URGCP_uc003tiz.2_Intron|URGCP_uc011kbj.1_Intron	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3						cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						TACTTCAGCTCCAGAGTGGGCC	0.465													31	16	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74160435	74160436	+	Intron	INS	-	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74160435_74160436insT	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|GTF2I_uc003uba.2_5'Flank	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						AACTATTTTTCTTTTTTTTTTT	0.347													4	2	---	---	---	---	
CUX1	1523	broad.mit.edu	37	7	101883019	101883020	+	Intron	INS	-	TTTTC	TTTTC	rs10634900		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101883019_101883020insTTTTC	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						TAGGGTtttttttttcttttct	0.332													7	4	---	---	---	---	
SLC26A3	1811	broad.mit.edu	37	7	107427059	107427059	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107427059delA	uc003ver.2	-						SLC26A3_uc003ves.2_Intron	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3						excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						TGGGGAGGCGAAAAAAAAAAA	0.463													4	3	---	---	---	---	
WDR91	29062	broad.mit.edu	37	7	134880706	134880706	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134880706delA	uc003vsp.2	-						WDR91_uc010lmq.2_Intron|WDR91_uc010lmr.2_Intron	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91											breast(2)|ovary(1)|skin(1)	4						ctcaataaggaaaaaaaaaaa	0.274													6	3	---	---	---	---	
STRA8	346673	broad.mit.edu	37	7	134936765	134936766	+	Intron	INS	-	GT	GT	rs142941773	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134936765_134936766insGT	uc011kpx.1	+							NM_182489	NP_872295	Q7Z7C7	STRA8_HUMAN	STRA8						DNA replication|regulation of transcription, DNA-dependent	cytoplasm|nucleus					0						agagagagagagtgtgtgtgtg	0.183													6	3	---	---	---	---	
FAM66E	100132103	broad.mit.edu	37	8	7833816	7833817	+	Intron	DEL	GT	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7833816_7833817delGT	uc011kws.1	+							NR_027424				Homo sapiens family with sequence similarity 66, member E (FAM66E), non-coding RNA.												0						TTGTTTGGGGgtgtgtgtgtgt	0.332													4	2	---	---	---	---	
ASAH1	427	broad.mit.edu	37	8	17924613	17924642	+	Intron	DEL	CCTGTGCTGTATATCTAAGACATACAGCAC	-	-	rs146985683		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17924613_17924642delCCTGTGCTGTATATCTAAGACATACAGCAC	uc003wyl.2	-						ASAH1_uc010ltb.1_Intron|ASAH1_uc003wym.2_Intron|ASAH1_uc003wyn.2_Intron|ASAH1_uc003wyo.2_Intron	NM_177924	NP_808592	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		gacctgtgcacctgtgctgtatatCTAAGACATACAGCACCTGTGCTGTA	0.152													9	8	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	25277142	25277142	+	Intron	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25277142delT	uc003xek.2	+						GNRH1_uc003xem.3_Intron|GNRH1_uc003xen.3_Intron	NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		gtttttctggttttttttttt	0.149													6	3	---	---	---	---	
ZNF658	26149	broad.mit.edu	37	9	40772272	40772272	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40772272delT	uc004abs.2	-	5	3155	c.3003delA	c.(3001-3003)AAAfs	p.K1001fs	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Frame_Shift_Del_p.K1001fs	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	1001	C2H2-type 23.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GGGCAAAAGCTTTTCCGCATT	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	91131649	91131650	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs62580715		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91131649_91131650insTTCCTTCC								SPIN1 (38029 upstream) : NXNL2 (18366 downstream)																							accaCATTTTGttccttccttc	0.010													6	4	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92286637	92286645	+	Intron	DEL	ATGGTGGTT	-	-	rs138909303	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92286637_92286645delATGGTGGTT	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						ggtggtggtgatggtggttatggtggtga	0.033													5	3	---	---	---	---	
HIATL1	84641	broad.mit.edu	37	9	97221855	97221855	+	3'UTR	DEL	T	-	-	rs34087557		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97221855delT	uc004aur.2	+	12					HIATL1_uc011luh.1_3'UTR	NM_032558	NP_115947	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1						transmembrane transport	integral to membrane|plasma membrane	protein binding|transporter activity			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				CCTCCTCCTGTTTTTTTTTTT	0.403													6	3	---	---	---	---	
SPTAN1	6709	broad.mit.edu	37	9	131347294	131347294	+	Intron	DEL	C	-	-	rs11382658		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131347294delC	uc004bvl.3	+						SPTAN1_uc011mbg.1_Intron|SPTAN1_uc011mbh.1_Intron|SPTAN1_uc004bvm.3_Intron|SPTAN1_uc004bvn.3_Intron	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1						actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						gcctgaatttctttttttttt	0.045													5	3	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	53080211	53080211	+	Intron	DEL	G	-	-	rs34370245		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53080211delG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CTGGTCAGAAGAAGGTATGCA	0.478													0	6	---	---	---	---	
DNA2	1763	broad.mit.edu	37	10	70228169	70228169	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70228169delA	uc001jof.2	-						DNA2_uc001jog.1_Intron|DNA2_uc001joh.1_Intron	NM_001080449	NP_001073918	P51530	DNA2L_HUMAN	DNA replication helicase 2 homolog						base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0						TCTGAAGAAGAAAAAAATATT	0.284													4	3	---	---	---	---	
ABCC2	1244	broad.mit.edu	37	10	101553163	101553173	+	Intron	DEL	TCTGTGTGCTC	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101553163_101553173delTCTGTGTGCTC	uc001kqf.2	+							NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	CAACCTGGCATCTGTGTGCTCTCTACCTGGC	0.517													29	13	---	---	---	---	
GBF1	8729	broad.mit.edu	37	10	104121807	104121808	+	Intron	INS	-	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104121807_104121808insT	uc001kux.1	+						GBF1_uc001kuy.1_Intron|GBF1_uc001kuz.1_Intron	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine						COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		cttttcttttcttttttttttt	0.183													8	4	---	---	---	---	
CPXM2	119587	broad.mit.edu	37	10	125540252	125540255	+	Intron	DEL	CCTT	-	-	rs66915589		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125540252_125540255delCCTT	uc001lhk.1	-						CPXM2_uc001lhj.2_Intron	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2						cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CATTCATTCCccttccttccttcc	0.343													2	4	---	---	---	---	
TCERG1L	256536	broad.mit.edu	37	10	133055212	133055215	+	Intron	DEL	GAAG	-	-	rs141999228		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133055212_133055215delGAAG	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		ggaagagaaagaaggaaggaagga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	642849	642850	+	IGR	INS	-	AGGGTCAGAGGA	AGGGTCAGAGGA	rs71464103		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:642849_642850insAGGGTCAGAGGA								DRD4 (2146 upstream) : DEAF1 (1375 downstream)																							CAGGCGGGGTGAGGGACAGGCG	0.693													3	3	---	---	---	---	
RRM1	6240	broad.mit.edu	37	11	4132641	4132641	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4132641delA	uc001lyw.3	+						RRM1_uc009yeh.1_Intron|RRM1_uc009yei.2_Intron|RRM1_uc010qyc.1_Intron	NM_001033	NP_001024	P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	actctgtctcaaaaaaaaaaa	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109894779	109894786	+	IGR	DEL	AGGAAGGG	-	-	rs56252437	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109894779_109894786delAGGAAGGG								C11orf87 (594941 upstream) : ZC3H12C (69140 downstream)																							gaaggaaggaaggaagggagggaagtgg	0.091													3	4	---	---	---	---	
IKZF4	64375	broad.mit.edu	37	12	56420474	56420474	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56420474delA	uc001sjb.1	+						IKZF4_uc010sqa.1_Intron|IKZF4_uc001sjc.1_Intron|IKZF4_uc001sjd.1_Intron|IKZF4_uc009zoi.1_Intron|IKZF4_uc001sje.1_Intron	NM_022465	NP_071910	Q9H2S9	IKZF4_HUMAN	zinc finger protein, subfamily 1A, 4						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			attccatctcaaaaaaaaaaa	0.229													13	6	---	---	---	---	
CPM	1368	broad.mit.edu	37	12	69252513	69252514	+	Intron	INS	-	T	T	rs59986141		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69252513_69252514insT	uc001sup.2	-						CPM_uc001sur.2_Intron|CPM_uc001suq.2_Intron	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			AATTTTTGTGGTTTTTTTTTTT	0.322													4	2	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123024333	123024333	+	Intron	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123024333delT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		tttgaatgacttttttttttt	0.164													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22409518	22409523	+	Intron	DEL	TCTCTC	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22409518_22409523delTCTCTC	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010ajb.1_Intron|uc001wck.2_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GCTAAACAGAtctctctctctctctc	0.359													27	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	71328817	71328818	+	IGR	INS	-	AGGGAGGA	AGGGAGGA			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71328817_71328818insAGGGAGGA								MAP3K9 (52929 upstream) : PCNX (45304 downstream)																							gggagaaagggagggaggaagg	0.035													3	3	---	---	---	---	
TRIP11	9321	broad.mit.edu	37	14	92439369	92439370	+	Intron	INS	-	T	T	rs142203489		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92439369_92439370insT	uc001xzy.2	-						TRIP11_uc010auf.1_Intron	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11						transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		AATACTGGCACttttttttttt	0.119			T	PDGFRB	AML								9	4	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106825288	106825294	+	Intron	DEL	TTGTCTT	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106825288_106825294delTTGTCTT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ATCCCCCAGGTTGTCTTGGGTCCTCTC	0.531													4	3	---	---	---	---	
PTPLAD1	51495	broad.mit.edu	37	15	65844283	65844283	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65844283delA	uc002apc.2	+						PTPLAD1_uc002apb.1_Intron|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain						activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0						acagtgaaggaaaaaaaaaaa	0.124													4	3	---	---	---	---	
FLYWCH1	84256	broad.mit.edu	37	16	2988609	2988609	+	Intron	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2988609delT	uc002csd.2	+						FLYWCH1_uc002csb.2_Intron|FLYWCH1_uc002csc.2_Intron|FLYWCH1_uc010bsv.2_Intron|FLYWCH1_uc002cse.2_Intron	NM_032296	NP_115672	Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1 isoform a							nucleus	DNA binding|metal ion binding				0						CCAGtctttgttttttttttt	0.224													6	3	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4939260	4939261	+	Intron	INS	-	GG	GG			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4939260_4939261insGG	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						tttttttttttttttttttttt	0.139													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15198270	15198270	+	Intron	DEL	C	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198270delC	uc002ddc.2	+						uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGGGAGGTGTCTTGAGATTAT	0.463													68	31	---	---	---	---	
ATP2A1	487	broad.mit.edu	37	16	28898314	28898315	+	Intron	DEL	AA	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28898314_28898315delAA	uc002dro.1	+						uc010vct.1_Intron|ATP2A1_uc002drn.1_Intron|ATP2A1_uc002drp.1_Intron|ATP2A1_uc010bym.1_5'Flank	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform						apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						actctgtctcaaaaaaaaaaaa	0.228													4	2	---	---	---	---	
SRCAP	10847	broad.mit.edu	37	16	30725222	30725222	+	Intron	DEL	T	-	-	rs66608116		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30725222delT	uc002dze.1	+						SRCAP_uc002dzf.2_Intron|SRCAP_uc002dzg.1_Intron|SRCAP_uc010bzz.1_Intron	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein						interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			ATCAAttctgttttttttttt	0.219													5	3	---	---	---	---	
PAFAH1B1	5048	broad.mit.edu	37	17	2568584	2568585	+	Intron	INS	-	A	A			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2568584_2568585insA	uc002fuw.3	+						PAFAH1B1_uc010ckb.1_Intron	NM_000430	NP_000421	P43034	LIS1_HUMAN	platelet-activating factor acetylhydrolase,						acrosome assembly|actin cytoskeleton organization|adult locomotory behavior|brain morphogenesis|corpus callosum morphogenesis|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|hippocampus development|layer formation in cerebral cortex|learning or memory|lipid catabolic process|microtubule organizing center organization|mitotic prometaphase|neuroblast proliferation|neuromuscular process controlling balance|neuron migration|platelet activating factor metabolic process|regulation of Rho GTPase activity|retrograde axon cargo transport|synaptic transmission|vesicle transport along microtubule	astral microtubule|cell cortex|centrosome|cytosol|kinetochore|motile primary cilium|nuclear membrane|perinuclear region of cytoplasm	dynactin binding|heparin binding|microtubule binding|phospholipase binding|phosphoprotein binding|protein homodimerization activity			skin(1)	1						TCTTCAGGGTTAATGAGATTTT	0.332													17	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21408420	21408420	+	IGR	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21408420delA								KCNJ12 (85241 upstream) : C17orf51 (23152 downstream)																							TCTGGGCTGTAAAAAAAAAAG	0.353													4	2	---	---	---	---	
FTSJ3	117246	broad.mit.edu	37	17	61904465	61904466	+	5'Flank	INS	-	G	G	rs72528040		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61904465_61904466insG	uc002jbz.2	-						FTSJ3_uc002jca.2_5'UTR|PSMC5_uc002jcb.2_5'Flank|PSMC5_uc010ddy.2_5'Flank|PSMC5_uc010ddz.2_5'Flank|PSMC5_uc002jcc.2_5'Flank|PSMC5_uc002jcd.2_5'Flank	NM_017647	NP_060117	Q8IY81	RRMJ3_HUMAN	FtsJ homolog 3						RNA methylation|rRNA processing	nucleolus	methyltransferase activity|nucleic acid binding			ovary(1)	1						ATGCAGCTAACTACTTCCGCTT	0.569													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75921951	75921952	+	IGR	INS	-	AAGG	AAGG	rs28641037		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75921951_75921952insAAGG								FLJ45079 (41782 upstream) : TNRC6C (78366 downstream)																							aaaaagaaagaaaggaaggaag	0.144													6	5	---	---	---	---	
PSTPIP2	9050	broad.mit.edu	37	18	43573479	43573479	+	Intron	DEL	G	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43573479delG	uc002lbp.3	-						PSTPIP2_uc002lbq.3_Intron	NM_024430	NP_077748	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting							membrane				ovary(1)	1						acttcaccaagGGCAAAGTGA	0.234													15	8	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50589416	50589416	+	Intron	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50589416delT	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATTATGTATGTTTTTTTTTTC	0.313													4	2	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67807195	67807195	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67807195delA	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TTTCGAATTTAAAAAAAAAAA	0.289													6	3	---	---	---	---	
ZFR2	23217	broad.mit.edu	37	19	3813874	3813874	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3813874delT	uc002lyw.2	-	14	2198	c.2186delA	c.(2185-2187)CAGfs	p.Q729fs		NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1	729						intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		TATGGTGACCTGCATCCTGGG	0.587													77	45	---	---	---	---	
FSD1	79187	broad.mit.edu	37	19	4311683	4311683	+	Intron	DEL	A	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4311683delA	uc002lzy.2	+						FSD1_uc002lzz.2_Intron|FSD1_uc002maa.2_5'UTR	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing						cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		ctctgtctctaaaaaaaaaaa	0.264													4	2	---	---	---	---	
CD22	933	broad.mit.edu	37	19	35837704	35837705	+	3'UTR	DEL	CA	-	-	rs35529786	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35837704_35837705delCA	uc010edt.2	+	14					CD22_uc010xst.1_3'UTR|CD22_uc010edu.2_3'UTR|CD22_uc010edv.2_3'UTR|CD22_uc002nzb.3_3'UTR|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor						cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	CGCATGTGCGcacacacacaca	0.510													4	2	---	---	---	---	
RCN3	57333	broad.mit.edu	37	19	50046226	50046227	+	Intron	INS	-	AG	AG	rs140477388	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50046226_50046227insAG	uc002poj.2	+							NM_020650	NP_065701	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain							endoplasmic reticulum lumen	calcium ion binding|protein binding			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		gggaccaagacggggacagatt	0.213													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54843564	54843565	+	IGR	INS	-	C	C	rs144647366	by1000genomes	TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54843564_54843565insC								LILRA5 (19155 upstream) : LILRA4 (1128 downstream)																							CGGCTGCTCCTCCCCAGGCTGC	0.723													3	3	---	---	---	---	
C20orf160	140706	broad.mit.edu	37	20	30616695	30616697	+	Intron	DEL	GGA	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30616695_30616697delGGA	uc002wxf.2	+						C20orf160_uc002wxg.2_Intron	NM_080625	NP_542192	Q9NUG4	CT160_HUMAN	hypothetical protein LOC140706											central_nervous_system(3)|ovary(1)	4						gcgaGGCCTTGGAGGCCAGCATG	0.350													13	6	---	---	---	---	
RBL1	5933	broad.mit.edu	37	20	35696195	35696195	+	Intron	DEL	C	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35696195delC	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron|RBL1_uc010gfv.1_Intron	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				aaaaaaaaaaCAACAACAGAA	0.124													4	3	---	---	---	---	
C21orf81	391267	broad.mit.edu	37	21	15347257	15347258	+	Intron	INS	-	A	A	rs80199214		TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15347257_15347258insA	uc002yji.2	-							NR_027270				Homo sapiens C21orf81 protein (C21orf81) mRNA, complete cds.												0						ACCCTGCACAGAAAAAAAGTTG	0.307													4	2	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47410424	47410424	+	Intron	DEL	C	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47410424delC	uc002zhu.1	+							NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	gtgaaggtgacccggggaggg	0.104													7	8	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53656611	53656611	+	Intron	DEL	C	-	-			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53656611delC	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						AGGCAGTGGTCAAGCCACTGC	0.413													56	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	115826705	115826706	+	IGR	INS	-	T	T			TCGA-BP-5176-01A-01D-1429-08	TCGA-BP-5176-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115826705_115826706insT								CXorf61 (232568 upstream) : None (None downstream)																							CTTTTGAACTGTTTTTTTTCTA	0.248													4	3	---	---	---	---	
