Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TPRG1L	127262	broad.mit.edu	37	1	3545224	3545224	+	3'UTR	SNP	G	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3545224G>C	uc001akm.2	+	5					TPRG1L_uc009vlj.2_3'UTR	NM_182752	NP_877429	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like							cell junction|synaptic vesicle					0	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		TCCCCAGAAGGCCAAGGGATG	0.612													10	13	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16975947	16975947	+	RNA	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16975947C>T	uc010och.1	+	11		c.1969C>T			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						AGAGCCAGGCCTACAGCGGGT	0.577													4	60	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21186921	21186921	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21186921T>A	uc001bec.2	-	19	3289	c.3033A>T	c.(3031-3033)CAA>CAT	p.Q1011H	EIF4G3_uc010odi.1_Missense_Mutation_p.Q615H|EIF4G3_uc010odj.1_Missense_Mutation_p.Q1010H|EIF4G3_uc009vpz.2_Missense_Mutation_p.Q731H|EIF4G3_uc001bed.2_Missense_Mutation_p.Q1011H|EIF4G3_uc001bef.2_Missense_Mutation_p.Q1047H|EIF4G3_uc001bee.2_Missense_Mutation_p.Q1017H	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4	1011	eIF3/EIF4A-binding (By similarity).|Potential.				interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GGACCTTCCTTTGCTCTTCTT	0.423													137	201	---	---	---	---	PASS
KIAA1522	57648	broad.mit.edu	37	1	33237688	33237688	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33237688G>A	uc001bvv.2	+	6	2867	c.2731G>A	c.(2731-2733)GCC>ACC	p.A911T	KIAA1522_uc001bvu.1_Missense_Mutation_p.A970T|KIAA1522_uc010ohm.1_Missense_Mutation_p.A922T|KIAA1522_uc010ohn.1_Intron	NM_020888	NP_065939	Q9P206	K1522_HUMAN	hypothetical protein LOC57648	911	Pro-rich.										0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				TGCCTCAACGGCCAGTTTCAT	0.652													3	39	---	---	---	---	PASS
MYCL1	4610	broad.mit.edu	37	1	40363241	40363241	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40363241G>A	uc001cer.1	-	3	1115	c.898C>T	c.(898-900)CGA>TGA	p.R300*	MYCL1_uc001ces.1_Nonsense_Mutation_p.R300*	NM_001033082	NP_001028254	P12524	MYCL1_HUMAN	l-myc-1 proto-oncogene isoform 1	300	Helix-loop-helix motif.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|liver(1)	2	all_cancers(7;1.73e-14)|all_lung(5;2.77e-17)|all_epithelial(6;6.81e-17)|Lung SC(1;2.85e-13)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.51e-19)|Epithelial(16;3.36e-18)|all cancers(16;8.43e-17)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCCAAGAATCGCGAACGCAGG	0.567			A		small cell lung 								74	118	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109793167	109793167	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109793167C>T	uc001dxa.3	+	1	527	c.466C>T	c.(466-468)CTC>TTC	p.L156F		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	156	Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GGCCCCCGGGCTCAGGGCAGG	0.637													28	55	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148017563	148017563	+	Silent	SNP	A	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148017563A>G	uc001eqf.2	-	12	1775	c.1740T>C	c.(1738-1740)TCT>TCC	p.S580S	LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_RNA|NBPF14_uc001eqq.2_Silent_p.S240S|NBPF14_uc001eqs.1_Silent_p.S119S	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672	580	NBPF 3.					cytoplasm					0						TGCTGCTGTAAGACTTGTACG	0.478													46	422	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149901785	149901785	+	Silent	SNP	G	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149901785G>C	uc001etl.3	-	16	1922	c.1671C>G	c.(1669-1671)CCC>CCG	p.P557P	SF3B4_uc001etj.1_5'Flank|SF3B4_uc001etk.1_5'Flank|SF3B4_uc009wll.1_5'Flank|MTMR11_uc001etm.1_Silent_p.P485P	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	557	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CAGAACTGGGGGGTCCAGGAA	0.522													37	100	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158646048	158646048	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158646048A>C	uc001fst.1	-	8	1194	c.995T>G	c.(994-996)CTT>CGT	p.L332R		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	332	Spectrin 4.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGGATGGGAAAGTGTCAGCTT	0.473													129	259	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171765964	171765964	+	3'UTR	SNP	A	G	G	rs1801898	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171765964A>G	uc001ghz.2	+	8					METTL13_uc001gia.2_3'UTR|METTL13_uc001gib.2_3'UTR|METTL13_uc010pml.1_3'UTR|METTL13_uc001gic.1_RNA	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1								methyltransferase activity|protein binding			kidney(1)	1						AGAATGAAGAAATACAACGCA	0.473													3	55	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201843415	201843415	+	Silent	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201843415G>A	uc001gwz.2	+	21	2798	c.2748G>A	c.(2746-2748)AAG>AAA	p.K916K		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	916				K -> R (in Ref. 4; BAC11173).	protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						TGCTGGTCAAGATCCTAAAGC	0.522													61	99	---	---	---	---	PASS
TMCC2	9911	broad.mit.edu	37	1	205238292	205238292	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205238292C>T	uc001hbz.1	+	4	1406	c.962C>T	c.(961-963)GCC>GTC	p.A321V	TMCC2_uc010prf.1_Missense_Mutation_p.A243V|TMCC2_uc001hca.2_Missense_Mutation_p.A96V|TMCC2_uc001hcb.1_Missense_Mutation_p.A81V|TMCC2_uc001hcc.1_5'UTR|TMCC2_uc001hcd.2_Missense_Mutation_p.A88V	NM_014858	NP_055673	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	321						integral to membrane	protein binding			pancreas(1)	1	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTGAAACTGGCCAACAACGCG	0.542													5	76	---	---	---	---	PASS
RAD51AP2	729475	broad.mit.edu	37	2	17697415	17697415	+	Silent	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17697415T>A	uc002rcl.1	-	1	2292	c.2268A>T	c.(2266-2268)GTA>GTT	p.V756V	RAD51AP2_uc010exn.1_Silent_p.V747V	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	756										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGTGCATATTTACTTCATAAA	0.323													67	120	---	---	---	---	PASS
EMILIN1	11117	broad.mit.edu	37	2	27305278	27305278	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27305278C>A	uc002rii.3	+	4	1267	c.839C>A	c.(838-840)GCC>GAC	p.A280D	EMILIN1_uc010eyq.1_Missense_Mutation_p.A280D|EMILIN1_uc002rik.3_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	280					cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ccagccccagcctcagccccT	0.607													7	7	---	---	---	---	PASS
DCTN1	1639	broad.mit.edu	37	2	74598753	74598753	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74598753G>T	uc002skx.2	-	8	867	c.556C>A	c.(556-558)CCG>ACG	p.P186T	DCTN1_uc002skv.2_Missense_Mutation_p.P52T|DCTN1_uc002sku.2_Missense_Mutation_p.P52T|DCTN1_uc002skw.1_Missense_Mutation_p.P162T|DCTN1_uc010ffd.2_Missense_Mutation_p.P166T|DCTN1_uc002sky.2_Missense_Mutation_p.P149T	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	186	Ser-rich.				cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						GTCTGAGCCGGGGTGCTGGGC	0.687													7	11	---	---	---	---	PASS
CKAP2L	150468	broad.mit.edu	37	2	113514506	113514506	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113514506T>C	uc002tie.2	-	4	521	c.442A>G	c.(442-444)AAA>GAA	p.K148E	CKAP2L_uc002tif.2_5'UTR|CKAP2L_uc010yxp.1_5'UTR|CKAP2L_uc010yxq.1_5'UTR	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	148						centrosome					0						TTTGTAGTTTTCAATTGCTCT	0.358													82	143	---	---	---	---	PASS
GLI2	2736	broad.mit.edu	37	2	121748151	121748151	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121748151C>G	uc010flp.2	+	13	4691	c.4661C>G	c.(4660-4662)CCC>CGC	p.P1554R	GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Missense_Mutation_p.P1226R|GLI2_uc002tmu.3_Missense_Mutation_p.P1209R	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	1554			P -> L (in HPE9).		axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				TTGACCCTGCCCTCCATCCCC	0.617													103	160	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170081963	170081963	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170081963C>A	uc002ues.2	-	33	5608	c.5395G>T	c.(5395-5397)GGT>TGT	p.G1799C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1799	LDL-receptor class B 15.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TGAATTTCACCCTGGAAAGAA	0.473													56	103	---	---	---	---	PASS
C2orf77	129881	broad.mit.edu	37	2	170505718	170505718	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170505718C>A	uc002ufe.2	-	8	1385	c.1291G>T	c.(1291-1293)GTT>TTT	p.V431F		NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN	hypothetical protein LOC129881	431											0						GCATCTTGAACCTCTTGATGT	0.333													19	34	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196720578	196720578	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196720578G>A	uc002utj.3	-	45	8653	c.8552C>T	c.(8551-8553)ACA>ATA	p.T2851I		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2851	Stalk (By similarity).|Potential.				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TAATTCAAGTGTGTCTTGAAG	0.428													212	414	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202598155	202598155	+	Silent	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202598155G>A	uc002uyo.2	-	13	2780	c.2424C>T	c.(2422-2424)TTC>TTT	p.F808F	ALS2_uc002uyp.3_Silent_p.F808F|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	808	DH.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						TTTTATTTAGGAAATCACTAG	0.303													42	75	---	---	---	---	PASS
FZD5	7855	broad.mit.edu	37	2	208632143	208632143	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208632143C>G	uc002vcj.2	-	2	1731	c.1321G>C	c.(1321-1323)GAC>CAC	p.D441H		NM_003468	NP_003459	Q13467	FZD5_HUMAN	frizzled 5 precursor	441	Cytoplasmic (Potential).				angiogenesis|anterior/posterior axis specification, embryo|axonogenesis|brain development|canonical Wnt receptor signaling pathway|cellular response to molecule of bacterial origin|embryonic camera-type eye development|gonad development|labyrinthine layer blood vessel development|positive regulation of interferon-gamma production|positive regulation of transcription from RNA polymerase II promoter|post-embryonic camera-type eye development|Spemann organizer formation|T cell differentiation in thymus|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell projection|cell surface|Golgi membrane|integral to membrane|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|protein kinase binding|Wnt-protein binding			ovary(2)|lung(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		TCCAGCTTGTCCGTCTTGGTG	0.622													25	48	---	---	---	---	PASS
SERPINE2	5270	broad.mit.edu	37	2	224840438	224840438	+	3'UTR	SNP	A	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224840438A>G	uc002vnu.2	-	9					SERPINE2_uc002vnt.2_3'UTR|SERPINE2_uc010zlr.1_3'UTR|SERPINE2_uc002vnv.2_3'UTR	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GAACAGAAACACTTGCATCGA	0.388													4	13	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183776	10183776	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183776G>C	uc003bvc.2	+	1	458	c.245G>C	c.(244-246)CGC>CCC	p.R82P	VHL_uc003bvd.2_Missense_Mutation_p.R82P	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	82			Missing (in VHLD).|R -> P (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.R82P(3)|p.S72_V87>L(1)|p.S80fs*73(1)|p.R82fs*77(1)|p.R60fs*35(1)|p.R82C(1)|p.V74fs*77(1)|p.P81fs*49(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGCAGTCCGCGCGTCGTGCTG	0.716		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				5	8	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52649438	52649438	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52649438A>T	uc003des.2	-	15	1865	c.1853T>A	c.(1852-1854)CTC>CAC	p.L618H	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.L618H|PBRM1_uc003der.2_Missense_Mutation_p.L586H|PBRM1_uc003det.2_Missense_Mutation_p.L633H|PBRM1_uc003deu.2_Missense_Mutation_p.L633H|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.L618H|PBRM1_uc010hmk.1_Missense_Mutation_p.L618H|PBRM1_uc003dey.2_Missense_Mutation_p.L618H|PBRM1_uc003dez.1_Missense_Mutation_p.L618H|PBRM1_uc003dfb.1_Missense_Mutation_p.L531H|PBRM1_uc003dfc.2_5'UTR	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	618					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTTCTCCTTGAGTAACTTCTC	0.373			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								59	46	---	---	---	---	PASS
ALG1L	200810	broad.mit.edu	37	3	125648143	125648143	+	3'UTR	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125648143C>T	uc003eig.1	-	6					LOC100125556_uc003eif.3_RNA|LOC100125556_uc003eid.3_RNA|LOC100125556_uc003eie.3_RNA	NM_001015050	NP_001015050	Q6GMV1	ALG1L_HUMAN	asparagine-linked glycosylation 1-like								transferase activity, transferring glycosyl groups				0						AATTCATTCACCAGGCGGCAC	0.557													4	51	---	---	---	---	PASS
ALG1L	200810	broad.mit.edu	37	3	125648160	125648160	+	3'UTR	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125648160C>T	uc003eig.1	-	6					LOC100125556_uc003eif.3_RNA|LOC100125556_uc003eid.3_RNA|LOC100125556_uc003eie.3_RNA	NM_001015050	NP_001015050	Q6GMV1	ALG1L_HUMAN	asparagine-linked glycosylation 1-like								transferase activity, transferring glycosyl groups				0						GCACCACTGCCGTCATTTCAG	0.572													4	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	129127513	129127513	+	Silent	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129127513C>T	uc003emg.2	-	6	1387	c.1224G>A	c.(1222-1224)CCG>CCA	p.P408P		NM_207307	NP_997190			hypothetical protein LOC90288																		CCTCTGTCAGCGGGAGGCCAT	0.587													7	4	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147131448	147131448	+	3'UTR	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147131448C>G	uc003ewe.2	+	3						NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1						behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						ACACAGACCCCGCAATCCTTT	0.378													8	11	---	---	---	---	PASS
CLRN1	7401	broad.mit.edu	37	3	150645593	150645593	+	3'UTR	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150645593T>C	uc003eyk.1	-	3					CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Intron	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a						equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AGTACGTAATTTGTAAACATT	0.388													9	22	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160227602	160227602	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160227602C>A	uc003fdn.2	-	14	1501	c.1195G>T	c.(1195-1197)GGA>TGA	p.G399*		NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4	399	ARM 8.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TCTTTCCTTCCACTAATTGTT	0.308													91	196	---	---	---	---	PASS
PROL1	58503	broad.mit.edu	37	4	71275489	71275489	+	Silent	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71275489C>T	uc003hfi.2	+	3	618	c.444C>T	c.(442-444)ACC>ACT	p.T148T		NM_021225	NP_067048	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	148	Thr-rich.				regulation of sensory perception of pain	extracellular region	endopeptidase inhibitor activity			large_intestine(1)	1		all_hematologic(202;0.196)				ACATCACCACCGCAGATACAA	0.448													76	126	---	---	---	---	PASS
CXCL10	3627	broad.mit.edu	37	4	76943924	76943924	+	Silent	SNP	A	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76943924A>G	uc003hjl.3	-	2	178	c.108T>C	c.(106-108)AGT>AGC	p.S36S	ART3_uc003hji.2_Intron|ART3_uc003hjj.2_Intron|ART3_uc003hjk.2_Intron	NM_001565	NP_001556	P02778	CXL10_HUMAN	small inducible cytokine B10 precursor	36					blood circulation|cell surface receptor linked signaling pathway|cell-cell signaling|chemotaxis|inflammatory response|muscle organ development|positive regulation of cell proliferation	extracellular space	cAMP-dependent protein kinase regulator activity|chemokine activity				0			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CAGGTTGATTACTAATGCTGA	0.408													68	104	---	---	---	---	PASS
BMP2K	55589	broad.mit.edu	37	4	79808404	79808404	+	Silent	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79808404T>C	uc003hlk.2	+	15	2194	c.2028T>C	c.(2026-2028)GAT>GAC	p.D676D	PAQR3_uc003hlm.2_RNA|PAQR3_uc003hln.2_RNA	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	676						nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						CTCCAGAAGATCCTTTTGGTT	0.363													12	33	---	---	---	---	PASS
METTL14	57721	broad.mit.edu	37	4	119626961	119626961	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119626961A>T	uc003icf.2	+	10	1167	c.1051A>T	c.(1051-1053)AGT>TGT	p.S351C	METTL14_uc003icg.2_Missense_Mutation_p.S313C	NM_020961	NP_066012	Q9HCE5	MTL14_HUMAN	methyltransferase like 14	351						nucleus	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity				0						TGGAAGAGATAGTACAATTCG	0.343													65	119	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33576548	33576548	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576548G>A	uc003jia.1	-	19	3746	c.3583C>T	c.(3583-3585)CCA>TCA	p.P1195S	ADAMTS12_uc010iuq.1_Missense_Mutation_p.P1110S	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1195	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						GGTGCAAGTGGCATTTCTGTA	0.507										HNSCC(64;0.19)			89	158	---	---	---	---	PASS
DDX46	9879	broad.mit.edu	37	5	134131704	134131704	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134131704C>A	uc003kzw.2	+	15	1986	c.1818C>A	c.(1816-1818)TTC>TTA	p.F606L	DDX46_uc003kzv.1_RNA	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	606	Helicase C-terminal.				mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAAAGAAATTCTTGAAGTTAC	0.338													50	155	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140559547	140559547	+	Silent	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559547G>A	uc011dai.1	+	1	2118	c.1932G>A	c.(1930-1932)CTG>CTA	p.L644L	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	644	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTGGTGCTGGTCAAGGACA	0.701													31	70	---	---	---	---	PASS
TTC1	7265	broad.mit.edu	37	5	159437682	159437682	+	Silent	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159437682T>C	uc003lxu.2	+	2	197	c.147T>C	c.(145-147)GAT>GAC	p.D49D		NM_003314	NP_003305	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	49					protein folding		unfolded protein binding			skin(1)	1	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		TCAGGGATGATGAGGCCCATC	0.517													39	35	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169174444	169174444	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169174444G>T	uc003maf.2	+	23	2392	c.2312G>T	c.(2311-2313)AGA>ATA	p.R771I	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.R263I	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	771					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAATCCATGAGACGGCTCTTT	0.358													39	100	---	---	---	---	PASS
TSPAN17	26262	broad.mit.edu	37	5	176084597	176084597	+	Silent	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176084597G>A	uc003met.2	+	9	1126	c.897G>A	c.(895-897)CAG>CAA	p.Q299Q	TSPAN17_uc003mes.3_3'UTR|TSPAN17_uc003meu.2_Silent_p.Q296Q|TSPAN17_uc003mev.2_3'UTR|TSPAN17_uc003mew.2_3'UTR	NM_012171	NP_036303	Q96FV3	TSN17_HUMAN	transmembrane 4 superfamily member 17 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGGGGCCTCAGcagaactctc	0.169													26	65	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17794626	17794626	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17794626C>A	uc003ncg.3	-	25	3181	c.3076G>T	c.(3076-3078)GGT>TGT	p.G1026C	KIF13A_uc003ncf.2_Missense_Mutation_p.G1026C|KIF13A_uc003nch.3_Missense_Mutation_p.G1026C|KIF13A_uc003nci.3_Missense_Mutation_p.G1026C	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	1026					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CGGGAATGACCCTGAAGAGGG	0.463													36	35	---	---	---	---	PASS
GPRC6A	222545	broad.mit.edu	37	6	117113259	117113259	+	3'UTR	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117113259C>G	uc003pxj.1	-	6					GPRC6A_uc003pxk.1_3'UTR|GPRC6A_uc003pxl.1_3'UTR	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,						response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GATGCAAAGACCCTGGAAACA	0.343													119	76	---	---	---	---	PASS
SEMA3C	10512	broad.mit.edu	37	7	80433459	80433459	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80433459G>A	uc003uhj.2	-	8	1326	c.764C>T	c.(763-765)ACG>ATG	p.T255M	SEMA3C_uc011kgw.1_Missense_Mutation_p.T273M|SEMA3C_uc011kgx.1_Missense_Mutation_p.T107M	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	255	Sema.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						AATCTGTTTCGTGCTCCTGTT	0.368													67	109	---	---	---	---	PASS
ZNF3	7551	broad.mit.edu	37	7	99668580	99668580	+	3'UTR	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99668580T>C	uc003usq.2	-	6					ZNF3_uc003usp.2_Intron|ZNF3_uc003usr.2_3'UTR|ZNF3_uc010lgj.2_3'UTR|ZNF3_uc003uss.2_3'UTR|ZNF3_uc003ust.3_3'UTR	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2						cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			CGCCATCCACTTGCCTTGACG	0.458													9	11	---	---	---	---	PASS
ATXN7L1	222255	broad.mit.edu	37	7	105401704	105401704	+	Intron	SNP	G	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105401704G>C	uc003vde.2	-						ATXN7L1_uc003vdi.2_3'UTR	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						TGCAGTGAATGGAAGcttgtc	0.259													30	44	---	---	---	---	PASS
PTN	5764	broad.mit.edu	37	7	136938351	136938351	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136938351C>A	uc003vtq.2	-	3	512	c.149G>T	c.(148-150)TGG>TTG	p.W50L	PTN_uc010lmx.2_Missense_Mutation_p.W50L|PTN_uc003vtr.1_Missense_Mutation_p.W50L	NM_002825	NP_002816	P21246	PTN_HUMAN	pleiotrophin	50					nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2						ACTCCACTGCCATTCTCCACA	0.483													3	61	---	---	---	---	PASS
GIMAP2	26157	broad.mit.edu	37	7	150390508	150390508	+	3'UTR	SNP	A	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150390508A>G	uc003who.2	+	3					GIMAP1_uc003whp.2_Intron	NM_015660	NP_056475	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2							integral to membrane	GTP binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AAATCTGAACATCACTCCAAT	0.294													3	9	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150558149	150558149	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150558149C>G	uc003why.1	+	6	6326	c.2108C>G	c.(2107-2109)CCA>CGA	p.P703R	ABP1_uc003whz.1_Missense_Mutation_p.P703R|ABP1_uc003wia.1_Missense_Mutation_p.P722R	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	703					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	AACTTCTTCCCAGAGGACCCC	0.622													44	73	---	---	---	---	PASS
HR	55806	broad.mit.edu	37	8	21986313	21986313	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21986313G>T	uc003xas.2	-	2	1036	c.371C>A	c.(370-372)CCT>CAT	p.P124H	HR_uc003xat.2_Missense_Mutation_p.P124H|HR_uc010lts.2_Missense_Mutation_p.P124H	NM_005144	NP_005135	O43593	HAIR_HUMAN	hairless protein isoform a	124							DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		ACTATGCTCAGGCATCAGGGG	0.637													10	31	---	---	---	---	PASS
KCNU1	157855	broad.mit.edu	37	8	36746044	36746044	+	Intron	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36746044C>A	uc003xjw.2	+						KCNU1_uc010lvw.2_Intron|uc003xjx.2_Missense_Mutation_p.D4E			A8MYU2	KCNU1_HUMAN	Homo sapiens cDNA FLJ50072 complete cds, moderately similar to Mus musculus potassium channel, subfamily U, member 1 (Kcnu1), mRNA.							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TGTTCTCTGACATTTACAAGA	0.488													19	23	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41792289	41792289	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41792289T>G	uc010lxb.2	-	18	3993	c.3449A>C	c.(3448-3450)AAG>ACG	p.K1150T	MYST3_uc010lxc.2_Missense_Mutation_p.K1150T|MYST3_uc003xon.3_Missense_Mutation_p.K1150T	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1150	Poly-Lys.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			GGGCCATCCCTTTTTCTTTTT	0.433													156	310	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62577779	62577779	+	Intron	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62577779G>T	uc003xuj.2	-						ASPH_uc011leg.1_Intron|ASPH_uc003xuo.2_Intron|ASPH_uc011leh.1_Intron|ASPH_uc003xul.2_Intron|ASPH_uc011lei.1_Intron|ASPH_uc011lej.1_Intron|ASPH_uc003xun.2_Intron|ASPH_uc011lek.1_Intron|ASPH_uc003xum.2_Intron|ASPH_uc011lel.1_3'UTR|ASPH_uc011lem.1_3'UTR	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TCTGGAACATGACCATGTTCT	0.388													120	219	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97342498	97342498	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97342498C>A	uc003yht.1	+	11	1333	c.1231C>A	c.(1231-1233)CAC>AAC	p.H411N	PTDSS1_uc003yhu.1_Missense_Mutation_p.H265N	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	411					phosphatidylserine biosynthetic process	integral to membrane	transferase activity	p.H411Q(1)		ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	ACACTATGGTCACCGAGAAAA	0.453													27	56	---	---	---	---	PASS
MTBP	27085	broad.mit.edu	37	8	121500410	121500410	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121500410G>A	uc003ypc.1	+	12	1222	c.1177G>A	c.(1177-1179)GAA>AAA	p.E393K	MTBP_uc011lie.1_RNA	NM_022045	NP_071328	Q96DY7	MTBP_HUMAN	Mdm2, transformed 3T3 cell double minute 2, p53	393					cell cycle arrest					skin(2)|ovary(1)	3	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TCCAGATGTTGAAGTGAAAGG	0.343													51	105	---	---	---	---	PASS
WDR67	93594	broad.mit.edu	37	8	124138304	124138304	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124138304T>A	uc003ypp.1	+	12	1669	c.1579T>A	c.(1579-1581)TGT>AGT	p.C527S	WDR67_uc011lig.1_Missense_Mutation_p.C527S|WDR67_uc011lih.1_Missense_Mutation_p.C417S|WDR67_uc003ypq.1_RNA|WDR67_uc003yps.1_Missense_Mutation_p.C240S|WDR67_uc003ypt.1_5'UTR|WDR67_uc003ypu.1_5'UTR	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1	527	Rab-GAP TBC.					centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AGTCAATTGGTGTCAACACTG	0.299													43	96	---	---	---	---	PASS
SLC45A4	57210	broad.mit.edu	37	8	142228421	142228421	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142228421A>G	uc003ywd.1	-	4	1473	c.1165T>C	c.(1165-1167)TAC>CAC	p.Y389H	SLC45A4_uc003ywc.1_Missense_Mutation_p.Y389H|SLC45A4_uc010meq.1_Missense_Mutation_p.Y387H	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4	440					transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GCGCGCCGGTAGCGGTAGCAG	0.687													25	38	---	---	---	---	PASS
RGP1	9827	broad.mit.edu	37	9	35752830	35752830	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35752830T>A	uc011lpf.1	+	9	1276	c.1135T>A	c.(1135-1137)TAT>AAT	p.Y379N	GBA2_uc011lpd.1_5'Flank|RGP1_uc011lpe.1_Missense_Mutation_p.Y419N	NM_001080496	NP_001073965	Q92546	RGP1_HUMAN	RGP1 retrograde golgi transport homolog	379										ovary(1)	1	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCTGGCCTCATATGCTGCCCC	0.587													18	28	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790138	78790138	+	Intron	SNP	A	G	G	rs11999771		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790138A>G	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.K665E|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						gaatggaatgaaatggaatgg	0.199													3	36	---	---	---	---	PASS
WNK2	65268	broad.mit.edu	37	9	96070760	96070760	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96070760T>C	uc004ati.1	+	28	6521	c.6521T>C	c.(6520-6522)GTG>GCG	p.V2174A	WNK2_uc011lud.1_Missense_Mutation_p.V2137A|WNK2_uc004atj.2_Missense_Mutation_p.V2137A|WNK2_uc004atk.2_Missense_Mutation_p.V1662A	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2174					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						AGCAAGACGGTGGGGGCCGCG	0.647													3	6	---	---	---	---	PASS
ANAPC2	29882	broad.mit.edu	37	9	140075307	140075307	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140075307A>T	uc004clr.1	-	8	1616	c.1543T>A	c.(1543-1545)TTC>ATC	p.F515I	ANAPC2_uc004clq.1_Missense_Mutation_p.F371I	NM_013366	NP_037498	Q9UJX6	ANC2_HUMAN	anaphase-promoting complex subunit 2	515					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		TCATTGATGAAGAGGTCCTTG	0.637													29	70	---	---	---	---	PASS
IL2RA	3559	broad.mit.edu	37	10	6067797	6067797	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6067797C>G	uc001iiz.1	-	2	415	c.256G>C	c.(256-258)GCC>CCC	p.A86P	IL2RA_uc009xih.1_Missense_Mutation_p.A86P|IL2RA_uc001ija.1_Missense_Mutation_p.A48P	NM_000417	NP_000408	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha chain precursor	86	Extracellular (Potential).				cell proliferation	integral to membrane	interleukin-2 receptor activity			ovary(1)|skin(1)	2					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GGACACTTACCAGAGCTTGTG	0.478													58	87	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24910118	24910118	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24910118C>T	uc001isb.2	-	9	1193	c.706G>A	c.(706-708)GTA>ATA	p.V236I	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Missense_Mutation_p.V236I|ARHGAP21_uc010qdc.1_Missense_Mutation_p.V71I|ARHGAP21_uc001isc.1_Missense_Mutation_p.V226I	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	235					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						TGTGTCAGTACTGGTGTACTG	0.478													54	108	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30315665	30315665	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30315665G>A	uc001iux.2	-	2	3471	c.3412C>T	c.(3412-3414)CCC>TCC	p.P1138S	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.P1000S|KIAA1462_uc009xle.1_Missense_Mutation_p.P1138S	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	1138										ovary(4)	4						GACACCCTGGGGACATCTGCC	0.627													55	94	---	---	---	---	PASS
CCAR1	55749	broad.mit.edu	37	10	70507264	70507264	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70507264C>A	uc001joo.2	+	8	886	c.767C>A	c.(766-768)TCT>TAT	p.S256Y	CCAR1_uc001jol.1_RNA|CCAR1_uc001jom.1_Missense_Mutation_p.S61Y|CCAR1_uc009xpx.1_Missense_Mutation_p.S230Y|CCAR1_uc001jon.1_Missense_Mutation_p.S202Y|CCAR1_uc010qiz.1_Missense_Mutation_p.S241Y|CCAR1_uc010qja.1_Missense_Mutation_p.S241Y|CCAR1_uc010qjb.1_RNA	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1	256					apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						TCAGCAGCTTCTATTACACCA	0.463													122	187	---	---	---	---	PASS
MOB2	81532	broad.mit.edu	37	11	1492592	1492592	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1492592G>T	uc010qwz.1	-	4	613	c.423C>A	c.(421-423)TAC>TAA	p.Y141*	MOB2_uc001lto.1_Nonsense_Mutation_p.Y25*|MOB2_uc001ltp.1_5'UTR|MOB2_uc001ltq.1_Nonsense_Mutation_p.Y104*|MOB2_uc010qwy.1_Nonsense_Mutation_p.Y25*	NM_053005	NP_443731	Q70IA6	MOB2_HUMAN	HCCA2 protein	110						nucleus|perinuclear region of cytoplasm	metal ion binding				0						CGAAGTCAACGTACTGTGGGG	0.592													37	68	---	---	---	---	PASS
SLC5A12	159963	broad.mit.edu	37	11	26694953	26694953	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26694953T>A	uc001mra.2	-	14	2016	c.1703A>T	c.(1702-1704)GAG>GTG	p.E568V	SLC5A12_uc001mrb.2_RNA	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	568	Cytoplasmic (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						GCTCACCTGCTCTGTCCCACT	0.423													159	256	---	---	---	---	PASS
BEST1	7439	broad.mit.edu	37	11	61725623	61725623	+	Silent	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61725623G>A	uc001nss.2	+	7	1300	c.720G>A	c.(718-720)GTG>GTA	p.V240V	BEST1_uc010rlp.1_Silent_p.V180V|BEST1_uc001nsq.2_Silent_p.V134V|BEST1_uc010rlq.1_Silent_p.V180V|BEST1_uc010rlr.1_Intron|BEST1_uc010rls.1_Intron|BEST1_uc001nsr.2_Silent_p.V180V|BEST1_uc009ynt.2_RNA|BEST1_uc010rlt.1_Silent_p.V180V|BEST1_uc001nst.2_Silent_p.V180V|BEST1_uc010rlu.1_Silent_p.V134V|BEST1_uc010rlv.1_Silent_p.V134V	NM_004183	NP_004174	O76090	BEST1_HUMAN	bestrophin 1 isoform 1	240					response to stimulus|transepithelial chloride transport|visual perception	basolateral plasma membrane|chloride channel complex|cytosol|membrane fraction	chloride channel activity			central_nervous_system(1)	1						CCCAGGTGGTGACTGTGGCGG	0.587													87	83	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92534186	92534186	+	Silent	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92534186G>T	uc001pdj.3	+	9	8024	c.8007G>T	c.(8005-8007)CTG>CTT	p.L2669L		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2669	Cadherin 24.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTAACCAGCTGAAAAATACAG	0.478										TCGA Ovarian(4;0.039)			24	42	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92616488	92616488	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92616488T>C	uc001pdj.3	+	23	12883	c.12866T>C	c.(12865-12867)CTC>CCC	p.L4289P	FAT3_uc001pdi.3_Missense_Mutation_p.L729P	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	4289	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCCCCCAACCTCCCCGCCGTG	0.652										TCGA Ovarian(4;0.039)			6	48	---	---	---	---	PASS
ST14	6768	broad.mit.edu	37	11	130064609	130064609	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130064609A>T	uc001qfw.2	+	9	1283	c.1090A>T	c.(1090-1092)ATT>TTT	p.I364F	ST14_uc010sca.1_Missense_Mutation_p.I174F	NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase	364	CUB 2.|Extracellular (Potential).				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CCCACCCAACATTGACTGCAC	0.413													34	44	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	280284	280284	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:280284G>A	uc001qhw.1	+	10	2168	c.2162G>A	c.(2161-2163)AGG>AAG	p.R721K	IQSEC3_uc001qhu.1_Missense_Mutation_p.R721K	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	1024					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		AAAGCCAAAAGGGAAGCCGCG	0.617													40	62	---	---	---	---	PASS
COPS7A	50813	broad.mit.edu	37	12	6833732	6833732	+	Intron	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6833732C>A	uc001qqj.2	+						COPS7A_uc009zex.2_Intron|COPS7A_uc001qqk.2_Intron|COPS7A_uc001qql.2_Intron|COPS7A_uc001qqh.2_Intron|COPS7A_uc001qqi.2_Intron|COPS7A_uc001qqm.2_Intron|COPS7A_uc001qqn.3_5'UTR|COPS7A_uc001qqo.2_Intron	NM_001164094	NP_001157566	Q9UBW8	CSN7A_HUMAN	COP9 complex subunit 7a						cullin deneddylation	cytoplasm|signalosome				ovary(1)	1						TGCTTCCCATCCGACCAGCCA	0.537													63	67	---	---	---	---	PASS
BICD1	636	broad.mit.edu	37	12	32491840	32491840	+	Silent	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32491840C>A	uc001rku.2	+	8	2772	c.2691C>A	c.(2689-2691)GGC>GGA	p.G897G	BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_RNA	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1	897					anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TTCTGAAGGGCCCCCCTTCCA	0.502													71	148	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57591375	57591375	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57591375G>A	uc001snd.2	+	58	9676	c.9210G>A	c.(9208-9210)ATG>ATA	p.M3070I		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3070	Extracellular (Potential).|LDL-receptor class B 26.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAGAGCAGATGATCTACTGGA	0.587													66	104	---	---	---	---	PASS
MYF6	4618	broad.mit.edu	37	12	81101549	81101549	+	Silent	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81101549G>T	uc001szf.1	+	1	104	c.51G>T	c.(49-51)GGG>GGT	p.G17G		NM_002469	NP_002460	P23409	MYF6_HUMAN	myogenic factor 6	17					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						ACTTGGATGGGGAAAATGTTA	0.502													38	83	---	---	---	---	PASS
MYF6	4618	broad.mit.edu	37	12	81101620	81101620	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81101620T>A	uc001szf.1	+	1	175	c.122T>A	c.(121-123)TTG>TAG	p.L41*		NM_002469	NP_002460	P23409	MYF6_HUMAN	myogenic factor 6	41					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						GATGGTACCTTGTCCCCCTGC	0.592													42	99	---	---	---	---	PASS
GNPTAB	79158	broad.mit.edu	37	12	102179968	102179968	+	Silent	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102179968T>C	uc001tit.2	-	5	572	c.393A>G	c.(391-393)ACA>ACG	p.T131T	GNPTAB_uc001tiu.1_Silent_p.T131T|GNPTAB_uc001tiv.3_5'UTR	NM_024312	NP_077288	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase	131					cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity			ovary(1)|skin(1)	2						TAATGCAGTGTGTTAGCAAAC	0.433													23	30	---	---	---	---	PASS
PAH	5053	broad.mit.edu	37	12	103311031	103311031	+	5'UTR	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103311031G>A	uc001tjq.1	-	2					PAH_uc010swc.1_5'UTR	NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase						catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	GTTACAAAGGGTGTCTCTTGC	0.592													6	8	---	---	---	---	PASS
RIC8B	55188	broad.mit.edu	37	12	107209026	107209026	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107209026G>T	uc001tlx.2	+	3	810	c.685G>T	c.(685-687)GAG>TAG	p.E229*	RIC8B_uc001tlw.2_Nonsense_Mutation_p.E229*|RIC8B_uc001tly.2_Nonsense_Mutation_p.E189*|RIC8B_uc001tlz.2_RNA	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8	229					regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						CTGTGCCATTGAGGCCCTCAA	0.463													79	136	---	---	---	---	PASS
CCDC62	84660	broad.mit.edu	37	12	123282648	123282648	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123282648A>C	uc001udc.2	+	8	1023	c.878A>C	c.(877-879)CAG>CCG	p.Q293P	CCDC62_uc010tah.1_RNA|CCDC62_uc001udf.2_Missense_Mutation_p.Q293P|CCDC62_uc001ude.2_Missense_Mutation_p.Q54P	NM_201435	NP_958843	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62 isoform b	293	Potential.					cytoplasm|nucleus				ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		GTAAAACAACAGAGTGATCTG	0.343													25	45	---	---	---	---	PASS
FZD10	11211	broad.mit.edu	37	12	130648663	130648663	+	Missense_Mutation	SNP	C	A	A	rs145130520		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130648663C>A	uc001uii.2	+	1	1632	c.1176C>A	c.(1174-1176)AAC>AAA	p.N392K	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	392	Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		TGGACGTCAACGCGCTCACCG	0.662													42	64	---	---	---	---	PASS
PABPC3	5042	broad.mit.edu	37	13	25670549	25670549	+	Silent	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25670549C>G	uc001upy.2	+	1	274	c.213C>G	c.(211-213)ACC>ACG	p.T71T		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	71	RRM 1.				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CTCTGGACACCATGAATTTTG	0.493													55	68	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28903895	28903895	+	Intron	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28903895G>T	uc001usb.3	-						FLT1_uc010aaq.2_5'UTR|FLT1_uc001usa.3_Intron	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	GAGTCAGGGCGACAGGACAAT	0.552													9	13	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92051340	92051340	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92051340C>T	uc010tif.1	+	1	406	c.40C>T	c.(40-42)CTC>TTC	p.L14F		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	14						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TCGCTGCCTCCTCCTTCTGGC	0.682													3	10	---	---	---	---	PASS
TMTC4	84899	broad.mit.edu	37	13	101277820	101277820	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101277820T>C	uc001vou.2	-	14	1908	c.1748A>G	c.(1747-1749)TAC>TGC	p.Y583C	TMTC4_uc001vot.2_Missense_Mutation_p.Y602C|TMTC4_uc010tja.1_Missense_Mutation_p.Y472C|TMTC4_uc001vov.1_Missense_Mutation_p.Y328C|TMTC4_uc001vow.1_Missense_Mutation_p.Y366C	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	583	TPR 4.					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ACAGTCTGGGTATTTCCTTCT	0.468													56	95	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22592208	22592208	+	Intron	SNP	G	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22592208G>C	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Missense_Mutation_p.R98T|uc010ajj.1_Missense_Mutation_p.R98T|uc001wde.1_Missense_Mutation_p.R72T|uc010aji.1_Missense_Mutation_p.R98T					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GCTACGCTGAGAGACACTGCT	0.502													27	40	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30132919	30132919	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30132919C>T	uc001wqh.2	-	4	863	c.682G>A	c.(682-684)GAT>AAT	p.D228N		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	228					cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AGGGGCTCATCAGGGGCACTT	0.527													112	171	---	---	---	---	PASS
PLD4	122618	broad.mit.edu	37	14	105396381	105396381	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105396381T>C	uc001ypu.1	+	6	797	c.656T>C	c.(655-657)GTT>GCT	p.V219A	PLD4_uc010tyl.1_Missense_Mutation_p.V226A	NM_138790	NP_620145	Q96BZ4	PLD4_HUMAN	phospholipase D4	219	PLD phosphodiesterase 1.				lipid catabolic process	integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity			central_nervous_system(1)|skin(1)	2		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)		Choline(DB00122)	AAATTCTGGGTTGTGGATGGA	0.572													30	81	---	---	---	---	PASS
RPUSD2	27079	broad.mit.edu	37	15	40865743	40865743	+	Silent	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40865743G>T	uc001zmd.1	+	3	921	c.921G>T	c.(919-921)GTG>GTT	p.V307V		NM_152260	NP_689473	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing	307					pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding			skin(1)	1		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		AGGAGTACGTGTGCCGGGTGG	0.512													31	77	---	---	---	---	PASS
PIGB	9488	broad.mit.edu	37	15	55621962	55621962	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55621962G>A	uc002act.2	+	5	879	c.563G>A	c.(562-564)TGT>TAT	p.C188Y	PIGB_uc010ugg.1_5'UTR	NM_004855	NP_004846	Q92521	PIGB_HUMAN	phosphatidylinositol glycan, class B	188					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	integral to membrane|intrinsic to endoplasmic reticulum membrane	glycolipid mannosyltransferase activity				0				all cancers(107;0.0255)		TGGTATTGCTGTACCAGAACC	0.353													100	142	---	---	---	---	PASS
DYX1C1	161582	broad.mit.edu	37	15	55722880	55722880	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55722880T>A	uc002adc.2	-	10	1619	c.1251A>T	c.(1249-1251)GAA>GAT	p.E417D	CCPG1_uc002acy.2_Intron|DYX1C1_uc010ugh.1_Intron|DYX1C1_uc010ugi.1_Intron|DYX1C1_uc002adb.2_Intron|DYX1C1_uc002add.2_3'UTR	NM_130810	NP_570722	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1 isoform a	417					neuron migration|regulation of estrogen receptor signaling pathway|regulation of proteasomal protein catabolic process	cytoplasm|nucleus	estrogen receptor binding			skin(1)	1				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		AAGATTTTAGTTCTGTTCCTT	0.333													78	142	---	---	---	---	PASS
FOXB1	27023	broad.mit.edu	37	15	60297463	60297463	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60297463A>T	uc002agj.1	+	2	780	c.301A>T	c.(301-303)AGC>TGC	p.S101C	FOXB1_uc010bgh.1_Intron	NM_012182	NP_036314	Q99853	FOXB1_HUMAN	forkhead box B1	101	Fork-head.				axon target recognition|cell migration in diencephalon|epithelial cell differentiation involved in mammary gland alveolus development|floor plate development|hypothalamus cell migration|inferior colliculus development|lactation|mammillothalamic axonal tract development|negative regulation of neuron apoptosis|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|telencephalon cell migration|visual learning	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|central_nervous_system(1)	2						CGAGAACGGCAGCTTCCTGCG	0.667													30	35	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62352506	62352506	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62352506T>C	uc002agz.2	-	1	142	c.68A>G	c.(67-69)AAC>AGC	p.N23S	VPS13C_uc002aha.2_Missense_Mutation_p.N23S|VPS13C_uc002ahb.1_Missense_Mutation_p.N23S|VPS13C_uc002ahc.1_Missense_Mutation_p.N23S|uc002ahe.2_5'Flank	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	23					protein localization					ovary(2)	2						CTGGGACTTGTTCAGGTTCTC	0.682													16	31	---	---	---	---	PASS
KIAA1199	57214	broad.mit.edu	37	15	81166242	81166242	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81166242G>A	uc002bfw.1	+	2	282	c.22G>A	c.(22-24)GAC>AAC	p.D8N	KIAA1199_uc010unn.1_Missense_Mutation_p.D8N	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN	KIAA1199 precursor	8										upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						TGGGAGGCAGGACTTCCTCTT	0.577													2	3	---	---	---	---	PASS
C15orf26	161502	broad.mit.edu	37	15	81440807	81440807	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81440807A>T	uc002bgb.2	+	7	866	c.839A>T	c.(838-840)GAT>GTT	p.D280V		NM_173528	NP_775799	Q6P656	CO026_HUMAN	hypothetical protein LOC161502	280											0						TCCATGTTGGATCTGCCCAAA	0.552													40	125	---	---	---	---	PASS
BLM	641	broad.mit.edu	37	15	91295052	91295052	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91295052G>A	uc002bpr.2	+	4	932	c.835G>A	c.(835-837)GAA>AAA	p.E279K	BLM_uc010uqh.1_Missense_Mutation_p.E279K|BLM_uc010uqi.1_5'UTR|BLM_uc010bnx.2_Missense_Mutation_p.E279K	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	279					double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			GGAAGAAGCTGAATTACATTC	0.328			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				57	116	---	---	---	---	PASS
SOX8	30812	broad.mit.edu	37	16	1034895	1034895	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1034895G>A	uc002ckn.2	+	3	965	c.850G>A	c.(850-852)GAG>AAG	p.E284K		NM_014587	NP_055402	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	284					adipose tissue development|enteric nervous system development|fat cell differentiation|in utero embryonic development|metanephric nephron tubule formation|morphogenesis of a branching epithelium|negative regulation of apoptosis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|neural crest cell migration|oligodendrocyte differentiation|osteoblast differentiation|peripheral nervous system development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of gliogenesis|positive regulation of osteoblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone levels|renal vesicle induction|retinal rod cell differentiation|Sertoli cell development|signal transduction|spermatogenesis|ureter morphogenesis	cytoplasm|nucleus				central_nervous_system(1)|skin(1)	2		Hepatocellular(780;0.00308)				CGACGTCCACGAGTTCGACCA	0.701													9	18	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2481270	2481270	+	Silent	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2481270C>T	uc002cqd.1	+	2	244	c.156C>T	c.(154-156)ATC>ATT	p.I52I	CCNF_uc002cqe.1_5'UTR	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	52	F-box.				cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				TAGAGGACATCCTGGCCGTCC	0.478													42	92	---	---	---	---	PASS
XYLT1	64131	broad.mit.edu	37	16	17202533	17202533	+	3'UTR	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17202533C>A	uc002dfa.2	-	12						NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						CTGCTGTGGCCCACTCCTCGT	0.662													11	15	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24816069	24816069	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24816069C>T	uc002dmm.2	+	13	3995	c.3881C>T	c.(3880-3882)TCC>TTC	p.S1294F	TNRC6A_uc010bxs.2_Missense_Mutation_p.S1041F|TNRC6A_uc002dmn.2_Intron|TNRC6A_uc002dmo.2_Intron|TNRC6A_uc002dmp.2_Intron|TNRC6A_uc002dmq.2_5'UTR	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1294	Sufficient for interaction with EIF2C1 and EIF2C4.				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		CAGTTTATGTCCAGTCAAAGC	0.468													86	154	---	---	---	---	PASS
MVP	9961	broad.mit.edu	37	16	29858549	29858549	+	Missense_Mutation	SNP	G	A	A	rs3815823		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29858549G>A	uc002dui.2	+	14	2381	c.2297G>A	c.(2296-2298)CGA>CAA	p.R766Q	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MVP_uc002duj.2_Missense_Mutation_p.R766Q|MVP_uc010vea.1_Missense_Mutation_p.R360Q	NM_005115	NP_005106	Q14764	MVP_HUMAN	major vault protein	766					mRNA transport|protein transport|response to drug|transmembrane transport	cytoplasm|nuclear pore|ribonucleoprotein complex	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						CAGAAGGTCCGAGAGCTGGAA	0.448													66	127	---	---	---	---	PASS
ZFP90	146198	broad.mit.edu	37	16	68598080	68598080	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68598080G>A	uc010cff.2	+	5	1682	c.1390G>A	c.(1390-1392)GAC>AAC	p.D464N	ZFP90_uc002ewb.2_3'UTR|ZFP90_uc002ewc.2_3'UTR|ZFP90_uc002ewd.2_Missense_Mutation_p.D464N|ZFP90_uc002ewe.2_Missense_Mutation_p.D464N	NM_133458	NP_597715	Q8TF47	ZFP90_HUMAN	zinc finger protein 90	464	C2H2-type 8.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		TCACATTACAGACTTTACTGA	0.433													100	155	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74445808	74445808	+	Intron	SNP	T	C	C	rs146209466	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74445808T>C	uc002fct.2	-						CLEC18B_uc002fcu.2_Intron|CLEC18B_uc010vmu.1_3'UTR|CLEC18B_uc010vmv.1_Intron	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region	sugar binding				0						GGGTcaggagtgagctggtca	0.294													5	33	---	---	---	---	PASS
SPAG7	9552	broad.mit.edu	37	17	4863167	4863167	+	Silent	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4863167A>T	uc002gae.2	-	6	495	c.462T>A	c.(460-462)CCT>CCA	p.P154P	SPAG7_uc002gad.2_Silent_p.P103P|SPAG7_uc002gaf.2_Silent_p.P154P	NM_004890	NP_004881	O75391	SPAG7_HUMAN	sperm associated antigen 7	154						nucleus	nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)	2						TCACCACCACAGGCCCCTGCT	0.642													51	121	---	---	---	---	PASS
SOX15	6665	broad.mit.edu	37	17	7491645	7491645	+	3'UTR	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7491645G>T	uc002ghy.1	-	3					MPDU1_uc010vuc.1_Intron|SOX15_uc002ghz.1_3'UTR	NM_006942	NP_008873	O60248	SOX15_HUMAN	SRY-box 15						chromatin organization|male gonad development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						GATGCTGCTGGATTAAAAAAG	0.592													60	82	---	---	---	---	PASS
PIK3R6	146850	broad.mit.edu	37	17	8738616	8738616	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8738616C>A	uc002glq.1	-	8	859	c.619G>T	c.(619-621)GCA>TCA	p.A207S	PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	207					platelet activation	cytosol					0						AGAGCGCCTGCGTGACAGGCC	0.667													5	10	---	---	---	---	PASS
CPD	1362	broad.mit.edu	37	17	28750570	28750570	+	Silent	SNP	G	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28750570G>C	uc002hfb.1	+	6	1719	c.1704G>C	c.(1702-1704)GTG>GTC	p.V568V	CPD_uc010wbo.1_Silent_p.V321V|CPD_uc010wbp.1_RNA	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor	568	Extracellular (Potential).|Carboxypeptidase-like 2.				proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						GAAATGAAGTGGTTGGAAGAG	0.358													40	97	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29664584	29664584	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29664584T>C	uc002hgg.2	+	43	6959	c.6626T>C	c.(6625-6627)TTG>TCG	p.L2209S	NF1_uc002hgh.2_Missense_Mutation_p.L2188S|NF1_uc010cso.2_Missense_Mutation_p.L397S|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2209					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACAGAAGCTTTGTTGGAGATC	0.358			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			67	132	---	---	---	---	PASS
KRTAP4-9	100132386	broad.mit.edu	37	17	39261882	39261882	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39261882G>A	uc010wfp.1	+	1	242	c.242G>A	c.(241-243)CGC>CAC	p.R81H		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	81	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].					keratin filament					0						ACCTGCTACCGCCCCAGCTGT	0.657													17	27	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41243622	41243622	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41243622T>A	uc002icq.2	-	10	4158	c.3926A>T	c.(3925-3927)AAT>ATT	p.N1309I	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.N1238I|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.N1262I|BRCA1_uc002ict.2_Missense_Mutation_p.N1309I|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.N1309I|BRCA1_uc002ide.1_Missense_Mutation_p.N1140I|BRCA1_uc010cyy.1_Missense_Mutation_p.N1309I|BRCA1_uc010whs.1_Missense_Mutation_p.N1309I|BRCA1_uc010cyz.2_Missense_Mutation_p.N1262I|BRCA1_uc010cza.2_Missense_Mutation_p.N1283I|BRCA1_uc010wht.1_Missense_Mutation_p.N1013I	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1309					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGTGTTTGTATTTGCAGTCAA	0.428			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			127	194	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41243623	41243623	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41243623T>G	uc002icq.2	-	10	4157	c.3925A>C	c.(3925-3927)AAT>CAT	p.N1309H	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.N1238H|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.N1262H|BRCA1_uc002ict.2_Missense_Mutation_p.N1309H|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.N1309H|BRCA1_uc002ide.1_Missense_Mutation_p.N1140H|BRCA1_uc010cyy.1_Missense_Mutation_p.N1309H|BRCA1_uc010whs.1_Missense_Mutation_p.N1309H|BRCA1_uc010cyz.2_Missense_Mutation_p.N1262H|BRCA1_uc010cza.2_Missense_Mutation_p.N1283H|BRCA1_uc010wht.1_Missense_Mutation_p.N1013H	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1309					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GTGTTTGTATTTGCAGTCAAG	0.428			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			123	196	---	---	---	---	PASS
GNA13	10672	broad.mit.edu	37	17	63049764	63049764	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63049764C>G	uc002jfc.2	-	2	575	c.366G>C	c.(364-366)ATG>ATC	p.M122I	GNA13_uc010wqh.1_Missense_Mutation_p.M27I	NM_006572	NP_006563	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein),	122					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase D activity|cellular component movement|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex|melanosome	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity|type 1 angiotensin receptor binding				0						CAAACGACATCATCTTATCTC	0.453													106	189	---	---	---	---	PASS
KIF19	124602	broad.mit.edu	37	17	72347133	72347133	+	Intron	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72347133G>T	uc002jkm.3	+						KIF19_uc002jkj.2_3'UTR|KIF19_uc002jkk.2_3'UTR|KIF19_uc002jkl.2_Intron	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						cagggtgggggtagccgtgag	0.204													9	25	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42281379	42281379	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42281379C>G	uc010dni.2	+	2	364	c.68C>G	c.(67-69)TCC>TGC	p.S23C	SETBP1_uc002lay.2_Missense_Mutation_p.S23C	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	23						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CTGCCGGTCTCCTCAGCCAAG	0.612									Schinzel-Giedion_syndrome				3	8	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42281380	42281380	+	Silent	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42281380C>G	uc010dni.2	+	2	365	c.69C>G	c.(67-69)TCC>TCG	p.S23S	SETBP1_uc002lay.2_Silent_p.S23S	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	23						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGCCGGTCTCCTCAGCCAAGC	0.617									Schinzel-Giedion_syndrome				3	8	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46284644	46284644	+	Silent	SNP	A	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46284644A>C	uc002ldc.2	+	8	1224	c.939A>C	c.(937-939)CCA>CCC	p.P313P	KIAA0427_uc002ldd.2_Silent_p.P313P|KIAA0427_uc002lde.3_5'Flank	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	313					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GGCTGCCCCCACAGCAGTCAG	0.632													13	129	---	---	---	---	PASS
SYCN	342898	broad.mit.edu	37	19	39694580	39694580	+	Silent	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39694580G>T	uc002okr.2	-	1	327	c.315C>A	c.(313-315)GCC>GCA	p.A105A		NM_001080468	NP_001073937	Q0VAF6	SYCN_HUMAN	syncollin precursor	105					exocytosis	transport vesicle membrane					0	all_cancers(60;7.32e-07)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|all_epithelial(25;8.97e-07)|Ovarian(47;0.0454)		Epithelial(26;1.34e-25)|all cancers(26;9.31e-23)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GGTAGGTGCCGGCAGAGAACT	0.672													7	7	---	---	---	---	PASS
MACROD2	140733	broad.mit.edu	37	20	16021897	16021897	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16021897A>T	uc002wou.2	+	16	1469	c.1205A>T	c.(1204-1206)GAC>GTC	p.D402V	MACROD2_uc002wot.2_Missense_Mutation_p.D402V|MACROD2_uc002woz.2_Missense_Mutation_p.D167V|MACROD2_uc002wpb.2_Missense_Mutation_p.D167V|MACROD2_uc002wpd.2_Missense_Mutation_p.D53V	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	402											0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GGCTCCAGTGACCTAGAAAAT	0.443													28	53	---	---	---	---	PASS
NKX2-2	4821	broad.mit.edu	37	20	21492858	21492858	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21492858C>G	uc002wsi.2	-	2	882	c.525G>C	c.(523-525)TGG>TGC	p.W175C		NM_002509	NP_002500	O95096	NKX22_HUMAN	NK2 transcription factor related, locus 2	175	Homeobox.				brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity			pancreas(1)|skin(1)	2						GGTTCTGGAACCAGATCTTGA	0.692													25	44	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33585398	33585398	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33585398G>C	uc002xbi.1	+	30	3920	c.3828G>C	c.(3826-3828)GAG>GAC	p.E1276D		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	1234	Potential.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TGCGCATGGAGGTGGACGACC	0.652													8	15	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40126775	40126775	+	Intron	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40126775C>T	uc002xka.1	-						CHD6_uc002xkd.2_Intron|CHD6_uc002xkc.2_Missense_Mutation_p.G371D	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				TCATATAAAACCCAAATACAG	0.378													15	57	---	---	---	---	PASS
PIGT	51604	broad.mit.edu	37	20	44050027	44050027	+	Silent	SNP	C	T	T	rs141166012		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44050027C>T	uc002xoh.1	+	9	1111	c.1038C>T	c.(1036-1038)GCC>GCT	p.A346A	PIGT_uc010ghd.1_Silent_p.A253A|PIGT_uc010ghc.1_RNA|PIGT_uc010ghe.1_Silent_p.A309A|PIGT_uc010ghf.1_Silent_p.A299A|PIGT_uc002xoj.1_Intron|PIGT_uc002xok.1_Silent_p.A311A|PIGT_uc010zwu.1_Silent_p.A84A|PIGT_uc002xoi.1_RNA|PIGT_uc010zwv.1_Silent_p.A84A|PIGT_uc010zww.1_Silent_p.A290A|PIGT_uc010zwx.1_Silent_p.A181A|PIGT_uc010zwy.1_Silent_p.A244A|PIGT_uc010zwz.1_Silent_p.A84A|PIGT_uc010zxa.1_Silent_p.A184A|PIGT_uc002xol.1_Intron|PIGT_uc010zxb.1_Silent_p.A22A|PIGT_uc002xom.1_5'Flank	NM_015937	NP_057021	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	346	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)				ACACAGAGGCCCCCCCAGTGC	0.577													11	34	---	---	---	---	PASS
CD40	958	broad.mit.edu	37	20	44752027	44752027	+	Intron	SNP	A	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44752027A>T	uc002xrg.1	+						CD40_uc002xrf.1_3'UTR|CD40_uc002xrh.1_Intron|CD40_uc002xri.1_Intron|CD40_uc002xrj.1_Intron|CD40_uc002xrk.1_Intron	NM_001250	NP_001241	P25942	TNR5_HUMAN	CD40 antigen isoform 1 precursor						B cell proliferation|cellular response to mechanical stimulus|inflammatory response|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein complex assembly	CD40 receptor complex|extracellular region	enzyme binding|receptor activity			lung(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)			Simvastatin(DB00641)	ACATTTCCACATTTTTTTTGC	0.488									Immune_Deficiency_with_Hyper-IgM				12	25	---	---	---	---	PASS
C22orf24	25775	broad.mit.edu	37	22	32330002	32330002	+	3'UTR	SNP	C	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32330002C>T	uc003aly.2	-	3					C22orf24_uc003alx.2_RNA	NM_015372	NP_056187	Q9Y442	CV024_HUMAN	hypothetical protein LOC25775							integral to membrane				central_nervous_system(1)	1						CCCGCTGTGACGTCAATTACG	0.582													5	11	---	---	---	---	PASS
MKL1	57591	broad.mit.edu	37	22	40831553	40831553	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40831553T>C	uc003ayv.1	-	2	220	c.13A>G	c.(13-15)AAA>GAA	p.K5E	MKL1_uc003ayw.1_Missense_Mutation_p.K5E|MKL1_uc010gye.1_Missense_Mutation_p.K5E|MKL1_uc010gyf.1_Missense_Mutation_p.K5E	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	5	Mediates interaction with SCAI and ACTB (By similarity).				positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GCTGGACTTTTCAAAGCTGTT	0.458			T	RBM15	acute megakaryocytic leukemia								50	94	---	---	---	---	PASS
C22orf9	23313	broad.mit.edu	37	22	45601754	45601754	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45601754C>A	uc003bfx.1	-	3	322	c.256G>T	c.(256-258)GAC>TAC	p.D86Y	C22orf9_uc010gzw.1_5'UTR|C22orf9_uc003bfv.1_Missense_Mutation_p.D95Y|C22orf9_uc003bfw.1_Missense_Mutation_p.D91Y|C22orf9_uc010gzx.2_Missense_Mutation_p.D68Y	NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b	86							protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		TTCTTGGAGTCCCGCCGGTAC	0.627													55	68	---	---	---	---	PASS
TLR8	51311	broad.mit.edu	37	X	12938126	12938126	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12938126T>A	uc004cve.2	+	2	1035	c.967T>A	c.(967-969)TTA>ATA	p.L323I	TLR8_uc004cvd.2_Missense_Mutation_p.L341I	NM_138636	NP_619542	Q9NR97	TLR8_HUMAN	toll-like receptor 8 precursor	323	LRR 8.|Extracellular (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity			ovary(4)|lung(2)|large_intestine(1)	7						ATTCAACTATTTAGTGGGAGA	0.413													106	48	---	---	---	---	PASS
SSX5	6758	broad.mit.edu	37	X	48053635	48053635	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48053635G>T	uc004dja.1	-	4	263	c.210C>A	c.(208-210)TTC>TTA	p.F70L	SSX5_uc004diz.1_Missense_Mutation_p.F111L	NM_175723	NP_783729	O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5 isoform b	70	KRAB-related.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						TATTACGCATGAAAGGTGGGA	0.393													64	39	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50556986	50556986	+	Silent	SNP	G	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50556986G>A	uc004dpe.2	-	1	59	c.33C>T	c.(31-33)GTC>GTT	p.V11V	SHROOM4_uc004dpd.3_RNA	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	11	PDZ.				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					GCTGCACAGGGACGTACTGGA	0.662													14	2	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73962314	73962314	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73962314T>C	uc004eby.2	-	3	2695	c.2078A>G	c.(2077-2079)GAC>GGC	p.D693G		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	693					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						GCCTGTGATGTCATTTAAATG	0.438													60	18	---	---	---	---	PASS
SLC25A5	292	broad.mit.edu	37	X	118605114	118605114	+	3'UTR	SNP	C	A	A	rs75063279	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118605114C>A	uc004erh.3	+	4					LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_5'Flank	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2						chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)	CTGTCAGTTTCTCAGTGGCAA	0.378													3	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	12344	12344	+	RNA	SNP	T	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:12344T>C	uc004cox.3	+	1		c.8T>C			uc004coy.2_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		AGTAATAACCATGCACACTAC	0.403													6	1	---	---	---	---	PASS
THAP3	90326	broad.mit.edu	37	1	6694078	6694079	+	Splice_Site	DEL	AG	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6694078_6694079delAG	uc001aoe.1	+	5	487	c.460_splice	c.e5-1	p.A154_splice		NM_138350	NP_612359	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated								DNA binding|metal ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TTTATTTCTCAGGCAATGTTGT	0.401													23	10	---	---	---	---	
HP1BP3	50809	broad.mit.edu	37	1	21091669	21091670	+	Intron	DEL	AA	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21091669_21091670delAA	uc001bdw.1	-						HP1BP3_uc001bdv.1_Intron|HP1BP3_uc010odh.1_Intron|HP1BP3_uc001bdy.1_Intron|HP1BP3_uc001bdz.2_Intron|HP1BP3_uc001bea.2_Intron|HP1BP3_uc010odf.1_Intron|HP1BP3_uc010odg.1_Intron	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74						nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		tcaaaaaactaaaaaaaaaaaa	0.084													5	4	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67517487	67517487	+	Intron	DEL	A	-	-	rs66531736		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67517487delA	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	AAACAAAAACAAAAAACTCCT	0.284													3	3	---	---	---	---	
LRRIQ3	127255	broad.mit.edu	37	1	74648559	74648559	+	Intron	DEL	A	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74648559delA	uc001dfy.3	-						LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3											ovary(2)	2						AAATATTATTAAAAATCTTTT	0.264													41	22	---	---	---	---	
FCRL3	115352	broad.mit.edu	37	1	157665676	157665677	+	Intron	DEL	TC	-	-	rs59508932		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157665676_157665677delTC	uc001frb.2	-						FCRL3_uc001fqx.3_Intron|FCRL3_uc001fqy.3_Intron|FCRL3_uc001fqz.3_Intron|FCRL3_uc009wsn.2_Intron|FCRL3_uc009wso.2_Intron|FCRL3_uc001fra.2_Intron|FCRL3_uc001frc.1_Intron	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					CTTTTAAATAtctctctctctc	0.401													4	2	---	---	---	---	
NPL	80896	broad.mit.edu	37	1	182772728	182772728	+	Intron	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182772728delT	uc009wyb.2	+						NPL_uc010pnx.1_Intron|NPL_uc010pny.1_Intron|NPL_uc001gpo.1_Intron|NPL_uc009wyc.2_Intron|NPL_uc001gpp.3_Intron|NPL_uc001gpq.1_Intron	NM_030769	NP_110396	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase						carbohydrate metabolic process	cytoplasm	N-acetylneuraminate lyase activity			ovary(1)|central_nervous_system(1)|skin(1)	3						ATTGAGTGGATTTTTAATAAC	0.363													11	5	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233135198	233135198	+	Intron	DEL	C	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233135198delC	uc001hvl.2	-						PCNXL2_uc001hvk.1_Intron|PCNXL2_uc001hvm.1_Intron	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				ttttctttttctttttttttt	0.219													9	4	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17959525	17959526	+	Intron	INS	-	CG	CG	rs144937348	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17959525_17959526insCG	uc010exo.2	-						GEN1_uc002rct.2_Intron|GEN1_uc010yjs.1_Intron|GEN1_uc002rcu.2_Intron	NM_024624	NP_078900	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					gtatacacacatatgtgtgtac	0.000													4	2	---	---	---	---	
ASXL2	55252	broad.mit.edu	37	2	26079232	26079233	+	Intron	INS	-	TTTTTT	TTTTTT	rs143352675		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26079232_26079233insTTTTTT	uc002rgs.2	-							NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ctggccTATACttttttttttt	0.218													8	4	---	---	---	---	
PRKD3	23683	broad.mit.edu	37	2	37496680	37496680	+	Intron	DEL	A	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37496680delA	uc002rqd.2	-						PRKD3_uc002rqe.1_Intron|PRKD3_uc002rqf.1_3'UTR	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				ATGAGATGACAAAACAGCTGG	0.358													32	21	---	---	---	---	
SLC3A1	6519	broad.mit.edu	37	2	44508298	44508299	+	Intron	INS	-	T	T	rs67090188		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44508298_44508299insT	uc002ruc.3	+						SLC3A1_uc002rty.2_Intron|SLC3A1_uc002rtz.2_Intron|SLC3A1_uc002rua.2_Intron|SLC3A1_uc002rub.2_Intron	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1						carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	cctttccCTGCttttttttttt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89875872	89875873	+	IGR	INS	-	GGAATCTTCC	GGAATCTTCC			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89875872_89875873insGGAATCTTCC								FLJ40330 (769747 upstream) : None (None downstream)																							tgcaatggaatggaatggaatg	0.000													4	2	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	116593676	116593677	+	Intron	DEL	TG	-	-	rs10549769		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116593676_116593677delTG	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						tgtgtgtgtatgtgtgtgtgtg	0.257													8	4	---	---	---	---	
PTPN18	26469	broad.mit.edu	37	2	131129929	131129934	+	In_Frame_Del	DEL	GACGGG	-	-	rs112040677		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131129929_131129934delGACGGG	uc002trc.2	+	13	1214_1219	c.1113_1118delGACGGG	c.(1111-1119)CAGACGGGG>CAG	p.TG378del	PTPN18_uc002trd.2_In_Frame_Del_p.TG357del|PTPN18_uc002trb.2_In_Frame_Del_p.TG271del|PTPN18_uc002tre.2_In_Frame_Del_p.TG29del	NM_014369	NP_055184	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type	378_379				Missing (in Ref. 1; CAA56105).		cytoplasm|nucleus	non-membrane spanning protein tyrosine phosphatase activity			ovary(3)|kidney(1)	4	Colorectal(110;0.1)					gtgggacgcagacggggacggggacg	0.568													4	2	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	160076489	160076490	+	Intron	DEL	GT	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160076489_160076490delGT	uc002uag.2	+						TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc010fon.2_Intron	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						TCATCAGAGAgtgtgtgtgtgt	0.381													5	4	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179591818	179591818	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179591818delT	uc010zfg.1	-	66	16766	c.16542delA	c.(16540-16542)AAAfs	p.K5514fs	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Frame_Shift_Del_p.K2175fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6441							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGTCTACCTTTTACTATAA	0.388													184	84	---	---	---	---	
DBR1	51163	broad.mit.edu	37	3	137888782	137888783	+	Intron	INS	-	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137888782_137888783insA	uc003erv.2	-						DBR1_uc003eru.2_Intron	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1							nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						ctcaaaaaaagaaaaaaaaaaG	0.149													8	4	---	---	---	---	
ZDHHC19	131540	broad.mit.edu	37	3	195937315	195937316	+	Intron	INS	-	A	A	rs59406858		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195937315_195937316insA	uc003fwc.2	-						ZDHHC19_uc010hzz.2_Intron|ZDHHC19_uc010iaa.2_Intron|ZDHHC19_uc010iab.2_Intron	NM_001039617	NP_001034706	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC domain containing 19							integral to membrane	acyltransferase activity|zinc ion binding			ovary(3)	3	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		gagaaagaaagaaagaaaagag	0.233													4	2	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	99996377	99996377	+	Intron	DEL	T	-	-	rs112636325		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99996377delT	uc003hui.2	-						ADH5_uc003huk.1_3'UTR|ADH5_uc003huj.2_Intron	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	ttttttgttgttttttttttt	0.119													7	9	---	---	---	---	
EGF	1950	broad.mit.edu	37	4	110897230	110897230	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110897230delT	uc003hzy.3	+	13	2344	c.1892delT	c.(1891-1893)CTTfs	p.L631fs	EGF_uc011cfu.1_Frame_Shift_Del_p.L589fs|EGF_uc011cfv.1_Frame_Shift_Del_p.L631fs	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	631	Extracellular (Potential).|LDL-receptor class B 8.				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	CTCCAAGGCCTTGGCCGTCTG	0.428													239	136	---	---	---	---	
EGF	1950	broad.mit.edu	37	4	110925365	110925368	+	Intron	DEL	CATA	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110925365_110925368delCATA	uc003hzy.3	+						EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Intron|EGF_uc010imk.2_Intron	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	CATACATGGGcatacatacacaca	0.186													6	4	---	---	---	---	
METTL14	57721	broad.mit.edu	37	4	119613381	119613382	+	Intron	INS	-	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119613381_119613382insT	uc003icf.2	+						METTL14_uc003icg.2_Intron	NM_020961	NP_066012	Q9HCE5	MTL14_HUMAN	methyltransferase like 14							nucleus	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity				0						cttttcttttcttttttttttt	0.139													16	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4119852	4119853	+	IGR	DEL	TC	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4119852_4119853delTC								IRX1 (518336 upstream) : LOC340094 (914619 downstream)																							tttctttctttctctttctttc	0.134													4	2	---	---	---	---	
FAM105B	90268	broad.mit.edu	37	5	14692788	14692789	+	Intron	INS	-	T	T	rs144619199		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14692788_14692789insT	uc003jfk.2	+							NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)					TGATTATCTGCttttttttttt	0.233													4	2	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	90445829	90445830	+	Intron	INS	-	TC	TC	rs35858094		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90445829_90445830insTC	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjw.2_Intron|GPR98_uc003kjx.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ttcttttctttttttttttttt	0.277													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475765	90475772	+	IGR	DEL	GAAGGAAG	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475765_90475772delGAAGGAAG								GPR98 (15733 upstream) : ARRDC3 (188769 downstream)																							aaggaaggaagaaggaaggaaggaagga	0.029													4	2	---	---	---	---	
SLC12A2	6558	broad.mit.edu	37	5	127470085	127470096	+	Intron	DEL	TTTTCACAAATG	-	-	rs150545999	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127470085_127470096delTTTTCACAAATG	uc003kus.2	+						SLC12A2_uc010jdf.2_Intron|SLC12A2_uc010jdg.2_Intron	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12						potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TAAGTGGCCATTTTCACAAATGTTTATGTATA	0.325													31	19	---	---	---	---	
HSPA9	3313	broad.mit.edu	37	5	137896597	137896598	+	Intron	INS	-	T	T	rs111382273		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137896597_137896598insT	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTCCAGGTTCATTTTTTTTTTT	0.262													4	2	---	---	---	---	
TCOF1	6949	broad.mit.edu	37	5	149751413	149751414	+	Intron	INS	-	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149751413_149751414insA	uc003lry.2	+						TCOF1_uc003lrw.2_Intron|TCOF1_uc011dch.1_Intron|TCOF1_uc003lrz.2_Intron|TCOF1_uc003lrx.2_Intron|TCOF1_uc003lsa.2_Intron	NM_001135243	NP_001128715	Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1						skeletal system development	nucleolus	protein binding|transporter activity			ovary(2)|large_intestine(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			tacttttctggaaaatggatct	0.000													2	5	---	---	---	---	
LSM11	134353	broad.mit.edu	37	5	157175002	157175003	+	Intron	DEL	TG	-	-	rs112046680		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157175002_157175003delTG	uc003lxe.1	+							NM_173491	NP_775762	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated						histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACCACACTGCtgtgtgtgtgtg	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25261582	25261582	+	RNA	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25261582delT	uc003nex.3	-	1		c.54delA								Homo sapiens cDNA clone IMAGE:5297808.																		AAAGGTGATATTGCAGACATC	0.408													16	34	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	49540187	49540188	+	IGR	INS	-	TCCTTCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCTTCCT			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49540187_49540188insTCCTTCCTTCCTTCCTTCCT								C6orf141 (10562 upstream) : RHAG (32705 downstream)																							TATcttccttctccttccttcc	0.109													4	2	---	---	---	---	
BCKDHB	594	broad.mit.edu	37	6	81053717	81053719	+	Intron	DEL	TTG	-	-	rs142572622		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81053717_81053719delTTG	uc003pjd.2	+						BCKDHB_uc003pje.2_3'UTR	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		ATTTACAtttttgttgttgttgt	0.118													4	4	---	---	---	---	
REPS1	85021	broad.mit.edu	37	6	139228922	139228922	+	Intron	DEL	A	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139228922delA	uc003qii.2	-						REPS1_uc003qig.3_Intron|REPS1_uc011edr.1_Intron|REPS1_uc003qij.2_Intron|REPS1_uc003qik.2_Intron	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1							coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		AGGAAAGGttaaaaaaaaaaa	0.284													4	2	---	---	---	---	
TMEM181	57583	broad.mit.edu	37	6	159044795	159044795	+	Intron	DEL	T	-	-	rs67157899		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159044795delT	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		TTTGGGGAAAttttttttttt	0.184													4	2	---	---	---	---	
GLI3	2737	broad.mit.edu	37	7	42263043	42263043	+	Intron	DEL	A	-	-	rs35625471		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42263043delA	uc011kbh.1	-							NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3						negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GTTTTCTGGCAAAAAAAAAAG	0.373									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				3	5	---	---	---	---	
RFC2	5982	broad.mit.edu	37	7	73271843	73271844	+	Intron	DEL	TT	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73271843_73271844delTT	uc011kfa.1	-							NM_181471		P35250	RFC2_HUMAN	replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2						ccttccCttctttttttttttt	0.064													4	2	---	---	---	---	
COG5	10466	broad.mit.edu	37	7	106871361	106871361	+	Intron	DEL	A	-	-	rs67589272		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106871361delA	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						TCATGAAAATAAAAAAAAAAC	0.264													6	3	---	---	---	---	
FAM40B	57464	broad.mit.edu	37	7	129098488	129098488	+	Intron	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129098488delT	uc011koy.1	+						FAM40B_uc003vow.2_Intron|FAM40B_uc011koz.1_Intron	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a												0						GCCCGGAAAGTTTTTCTCTCT	0.478													16	13	---	---	---	---	
XKR6	286046	broad.mit.edu	37	8	11058892	11058892	+	5'Flank	DEL	C	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11058892delC	uc003wtk.1	-							NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		ggagggacggcgggggggggg	0.249													4	3	---	---	---	---	
MTMR9	66036	broad.mit.edu	37	8	11172782	11172782	+	Intron	DEL	A	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11172782delA	uc003wtm.2	+						MTMR9_uc010lrx.2_Intron|MTMR9_uc011kxa.1_Intron	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9							cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		TTCACTTAGGAAACTCCTGTT	0.423													6	5	---	---	---	---	
PIWIL2	55124	broad.mit.edu	37	8	22165710	22165711	+	Intron	INS	-	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22165710_22165711insT	uc003xbn.2	+						PIWIL2_uc011kzf.1_Intron|PIWIL2_uc010ltv.2_Intron	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2						DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		ATTTTTCTAAGTTTTTTTTTTT	0.322													6	3	---	---	---	---	
C8orf80	389643	broad.mit.edu	37	8	27890928	27890932	+	Intron	DEL	GACTA	-	-	rs5890397		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27890928_27890932delGACTA	uc003xgm.3	-							NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN	speckled-like pattern in the germinal center							nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)		TTTTGCCAAGGACTAAGGTTTCCTT	0.395													4	4	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250862	86250889	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	-	rs56255763	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250862_86250889delTTTCTTTCTTTCTTTCTTTCTTTCTTTC	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	tttccttctttttctttctttctttctttctttctttctttctttctt	0.092													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136010887	136010888	+	IGR	DEL	GT	-	-	rs72276307		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136010887_136010888delGT								MIR30D (193699 upstream) : LOC286094 (235486 downstream)																							TGGCATATGAgtgtgtgtgtgt	0.158													4	2	---	---	---	---	
KDM4C	23081	broad.mit.edu	37	9	6805465	6805465	+	Intron	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6805465delT	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc010mhw.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc010mhv.2_Intron	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						AATATTCATCTTTTTTTTTTT	0.169													5	4	---	---	---	---	
PRUNE2	158471	broad.mit.edu	37	9	79251925	79251926	+	Intron	INS	-	TA	TA	rs10781368	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79251925_79251926insTA	uc010mpk.2	-						PRUNE2_uc011lsk.1_Intron|PRUNE2_uc011lsl.1_Intron|PRUNE2_uc011lsm.1_Intron|PRUNE2_uc004akj.3_Intron	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2						apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						gtgtgtgtgtgtATAATTTTAG	0.183													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	91131649	91131650	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs62580715		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91131649_91131650insTTCCTTCC								SPIN1 (38029 upstream) : NXNL2 (18366 downstream)																							accaCATTTTGttccttccttc	0.010													4	2	---	---	---	---	
HIATL1	84641	broad.mit.edu	37	9	97221855	97221855	+	3'UTR	DEL	T	-	-	rs34087557		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97221855delT	uc004aur.2	+	12					HIATL1_uc011luh.1_3'UTR	NM_032558	NP_115947	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1						transmembrane transport	integral to membrane|plasma membrane	protein binding|transporter activity			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				CCTCCTCCTGTTTTTTTTTTT	0.403													3	3	---	---	---	---	
TRDMT1	1787	broad.mit.edu	37	10	17203599	17203603	+	Intron	DEL	AAAGT	-	-	rs3833985		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17203599_17203603delAAAGT	uc001iop.2	-						TRDMT1_uc001ioq.2_Intron|TRDMT1_uc001ior.2_Intron|TRDMT1_uc001ios.2_Intron|TRDMT1_uc009xjt.2_Intron|TRDMT1_uc010qcc.1_Intron|TRDMT1_uc010qcd.1_Intron|TRDMT1_uc009xjs.1_Intron|TRDMT1_uc009xju.1_Intron	NM_004412	NP_004403	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1 isoform						tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding			ovary(1)	1						CTAAGAAGAAAAAGTAAAGAAAATC	0.234													10	7	---	---	---	---	
MTPAP	55149	broad.mit.edu	37	10	30638278	30638279	+	5'Flank	INS	-	G	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30638278_30638279insG	uc001iva.3	-						MTPAP_uc001ivb.3_Intron|MTPAP_uc001ivc.2_5'Flank	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor						cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1						GCGCATGCGTCGGGGGGGAGGG	0.520													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45566276	45566276	+	Intron	DEL	G	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45566276delG	uc001jbx.1	-											Homo sapiens zinc finger protein 22 (KOX 15), mRNA (cDNA clone IMAGE:4826621).																		GAGGAACCCAGGGCCAGGGGA	0.328													7	8	---	---	---	---	
C10orf79	80217	broad.mit.edu	37	10	105924158	105924158	+	Intron	DEL	T	-	-	rs140844875		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105924158delT	uc001kxw.2	-						C10orf79_uc009xxq.2_Intron	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217												0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		ATTCCACAAAttttttttttt	0.149													4	2	---	---	---	---	
FAR1	84188	broad.mit.edu	37	11	13722198	13722199	+	Intron	INS	-	TCT	TCT	rs137872059	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13722198_13722199insTCT	uc001mld.2	+						FAR1_uc009ygp.2_Intron	NM_032228	NP_115604	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1						ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2						TAAAAGAATTCTCTTCTTCTTC	0.317													7	6	---	---	---	---	
SLC1A2	6506	broad.mit.edu	37	11	35333689	35333689	+	Intron	DEL	A	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35333689delA	uc001mwd.2	-						SLC1A2_uc001mwe.2_Intron|SLC1A2_uc010rev.1_Intron	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2						D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	CTCTTAAGTTATCGCCTTGAT	0.408													220	111	---	---	---	---	
CTNND1	1500	broad.mit.edu	37	11	57571337	57571337	+	Intron	DEL	A	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57571337delA	uc001nmc.3	+						CTNND1_uc001nlh.1_Intron|CTNND1_uc001nlu.3_Intron|CTNND1_uc001nlt.3_Intron|CTNND1_uc001nls.3_Intron|CTNND1_uc001nlw.3_Intron|CTNND1_uc001nmf.3_Intron|CTNND1_uc001nmd.3_Intron|CTNND1_uc001nlk.3_Intron|CTNND1_uc001nme.3_Intron|CTNND1_uc001nll.3_Intron|CTNND1_uc001nmg.3_Intron|CTNND1_uc001nlj.3_Intron|CTNND1_uc001nlr.3_Intron|CTNND1_uc001nlp.3_Intron|CTNND1_uc001nlx.3_Intron|CTNND1_uc001nlz.3_Intron|CTNND1_uc009ymn.2_Intron|CTNND1_uc001nlm.3_Intron|CTNND1_uc001nly.3_Intron|CTNND1_uc001nmb.3_Intron|CTNND1_uc001nma.3_Intron|CTNND1_uc001nmi.3_Intron|CTNND1_uc001nmh.3_Intron|CTNND1_uc001nlq.3_Intron|CTNND1_uc001nln.3_Intron|CTNND1_uc001nli.3_Intron|CTNND1_uc001nlo.3_Intron|CTNND1_uc001nlv.3_Intron	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC						adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				TAAATTTCCtaaaaaaaaaaa	0.358													9	5	---	---	---	---	
EED	8726	broad.mit.edu	37	11	85975481	85975482	+	Intron	INS	-	TATT	TATT	rs138959322	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85975481_85975482insTATT	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron|EED_uc010rtn.1_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AGTAAAGACtatatttatttat	0.312													5	3	---	---	---	---	
MMP12	4321	broad.mit.edu	37	11	102737277	102737283	+	Intron	DEL	TTTCCAT	-	-	rs28381683		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102737277_102737283delTTTCCAT	uc001phk.2	-							NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein						positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	CCAATATTTCTTTCCATTGTCTTCACA	0.353													6	3	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	102996096	102996096	+	Intron	DEL	T	-	-	rs34114270		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102996096delT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGCTAAAGGCTTTTTTTTTTT	0.289													4	2	---	---	---	---	
SNX19	399979	broad.mit.edu	37	11	130750250	130750250	+	Intron	DEL	C	-	-	rs147279864		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130750250delC	uc001qgk.3	-						SNX19_uc009zcw.2_Intron|SNX19_uc010sce.1_Intron|SNX19_uc010scf.1_Intron|SNX19_uc010scg.1_Intron	NM_014758	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|lung(2)	4	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		AAGTTATTAACCTAAATATCT	0.468													8	4	---	---	---	---	
RHEBL1	121268	broad.mit.edu	37	12	49463357	49463374	+	Intron	DEL	CCAATCCTCCACTCTTCC	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49463357_49463374delCCAATCCTCCACTCTTCC	uc001rtc.1	-						RHEBL1_uc001rtd.1_Intron|RHEBL1_uc009zlc.1_Intron	NM_144593	NP_653194	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1 precursor						positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding			lung(1)|breast(1)	2						ACCAACTCTTCCAATCCTCCACTCTTCCATTCCTCCAC	0.569													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54282976	54282977	+	IGR	INS	-	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54282976_54282977insC								CALCOCO1 (161669 upstream) : HOXC13 (49599 downstream)																							tcctttcctttcttccttcctt	0.000													4	2	---	---	---	---	
DCTN2	10540	broad.mit.edu	37	12	57928327	57928328	+	Intron	INS	-	A	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57928327_57928328insA	uc001som.1	-						DCTN2_uc009zpu.1_Intron|DCTN2_uc009zpv.1_Intron|DCTN2_uc009zpw.1_Intron|DCTN2_uc001soo.1_Intron|DCTN2_uc001son.1_Intron|DCTN2_uc001sop.1_Intron|DCTN2_uc001soq.1_Intron|DCTN2_uc009zpx.1_Intron	NM_006400	NP_006391	Q13561	DCTN2_HUMAN	dynactin 2						cell proliferation|G2/M transition of mitotic cell cycle|mitosis	centrosome|cytosol|dynactin complex|dynein complex|kinetochore|membrane|microtubule|vesicle	motor activity|protein binding			ovary(1)	1						GTTGTAGCTGGAGGTCACTGGG	0.436													13	10	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													4	3	---	---	---	---	
PRDM4	11108	broad.mit.edu	37	12	108145796	108145797	+	Frame_Shift_Ins	INS	-	C	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108145796_108145797insC	uc001tmp.2	-	5	958_959	c.521_522insG	c.(520-522)GGTfs	p.G174fs	PRDM4_uc001tmq.2_RNA	NM_012406	NP_036538	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	174					cell proliferation|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						GACTTTGGGCACCATGTGTGTT	0.470													209	93	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123089080	123089081	+	Intron	INS	-	TTTA	TTTA			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123089080_123089081insTTTA	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GCCTGTAAATCtttatttattt	0.248													16	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19532389	19532389	+	IGR	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19532389delT								LOC284232 (86280 upstream) : LOC348021 (50010 downstream)																							TTTGGGAGCCTTTTTTTTTTG	0.542													6	3	---	---	---	---	
SUGT1L1	283507	broad.mit.edu	37	13	41486862	41486862	+	Intron	DEL	A	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41486862delA	uc001uxp.1	-						SUGT1L1_uc001uxq.2_Intron	NR_003365				Homo sapiens cDNA FLJ35913 fis, clone TESTI2010239.												0						cgtctctactaaaaaaaaaat	0.000													4	2	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64457262	64457262	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64457262delT	uc001xgm.2	+	20	2677	c.2447delT	c.(2446-2448)ATTfs	p.I816fs	SYNE2_uc001xgl.2_Frame_Shift_Del_p.I816fs	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	816	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CAGGCAAAGATTCAAGAAGCT	0.398													148	90	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	74288731	74288731	+	IGR	DEL	T	-	-	rs71395619		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74288731delT								C14orf43 (34835 upstream) : PTGR2 (29803 downstream)																							tccttccttctctttctttct	0.000													3	3	---	---	---	---	
ADCK1	57143	broad.mit.edu	37	14	78307272	78307273	+	Intron	INS	-	AGGA	AGGA			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78307272_78307273insAGGA	uc001xui.2	+						ADCK1_uc010tvo.1_Intron|ADCK1_uc001xuj.2_Intron	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a							extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		gggagggagggagggaggaagg	0.054													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	83956980	83956987	+	IGR	DEL	GAAGGAAG	-	-	rs71110916		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83956980_83956987delGAAGGAAG								None (None upstream) : None (None downstream)																							aggagggaaagaaggaaggaaggaagga	0.038													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103770193	103770194	+	IGR	DEL	AA	-	-	rs35374634		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103770193_103770194delAA								TNFAIP2 (166417 upstream) : EIF5 (30299 downstream)																							accccacctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21366464	21366466	+	IGR	DEL	ATG	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21366464_21366466delATG								NF1P1 (231839 upstream) : LOC646214 (566048 downstream)																							GATGTGGAATATGATGAAGGAGA	0.369													4	2	---	---	---	---	
UBE3A	7337	broad.mit.edu	37	15	25585478	25585478	+	Intron	DEL	G	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25585478delG	uc001zaq.2	-						uc001zae.2_Intron|UBE3A_uc001zar.2_Intron|UBE3A_uc001zas.2_Intron|UBE3A_uc001zat.2_Intron	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2						brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		GAGACAACTTGGAAGTTAATT	0.284													32	15	---	---	---	---	
STRC	161497	broad.mit.edu	37	15	43895397	43895397	+	Intron	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43895397delT	uc001zsf.2	-						STRC_uc010bdl.2_Intron|STRC_uc001zse.2_Intron	NM_153700	NP_714544	Q7RTU9	STRC_HUMAN	stereocilin precursor						sensory perception of sound	cell surface					0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		CACACCCAAATAGCTTCCTCA	0.522													30	22	---	---	---	---	
DAPK2	23604	broad.mit.edu	37	15	64217874	64217875	+	Intron	INS	-	GCGC	GCGC	rs147933961	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64217874_64217875insGCGC	uc002amr.2	-						DAPK2_uc010uim.1_Intron	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		GCTGACTTGTAGCGcacacaca	0.327													4	4	---	---	---	---	
WDR61	80349	broad.mit.edu	37	15	78585309	78585309	+	Intron	DEL	T	-	-	rs71947790		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78585309delT	uc002bdn.2	-						WDR61_uc002bdo.2_Intron|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						GACTTTAAGATTTTTTTTTTT	0.333													8	4	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85449805	85449820	+	Intron	DEL	CTTCCTTCCTTCCTTC	-	-	rs62021373		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85449805_85449820delCTTCCTTCCTTCCTTC	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ctctttctttcttccttccttccttccttccttcct	0.000													5	5	---	---	---	---	
PCSK6	5046	broad.mit.edu	37	15	101938736	101938737	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101938736_101938737delTT	uc002bwy.2	-	8	1182_1183	c.868_869delAA	c.(868-870)AAGfs	p.K290fs	PCSK6_uc010bpd.2_Frame_Shift_Del_p.K160fs|PCSK6_uc010bpe.2_Frame_Shift_Del_p.K290fs|PCSK6_uc002bxa.2_Frame_Shift_Del_p.K290fs|PCSK6_uc002bxb.2_Frame_Shift_Del_p.K290fs|PCSK6_uc002bxc.1_Frame_Shift_Del_p.K290fs|PCSK6_uc002bxd.1_Frame_Shift_Del_p.K290fs|PCSK6_uc002bxe.2_Frame_Shift_Del_p.K290fs|PCSK6_uc002bxg.1_Frame_Shift_Del_p.K290fs	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	290	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCCCAGCGACTTTGCCTCGACC	0.649													94	61	---	---	---	---	
BAIAP3	8938	broad.mit.edu	37	16	1396789	1396806	+	Intron	DEL	GCAGGTGGGGCCAGCGGG	-	-	rs3215518		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1396789_1396806delGCAGGTGGGGCCAGCGGG	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvc.1_Intron	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				AGGCCATTCTGCAGGTGGGGCCAGCGGGGCAGGTGGGG	0.716													8	4	---	---	---	---	
CLN3	1201	broad.mit.edu	37	16	28493308	28493308	+	Intron	DEL	A	-	-	rs2520416		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28493308delA	uc002dpo.2	-						uc010vct.1_Intron|CLN3_uc002dpl.2_Intron|CLN3_uc010vcu.1_Intron|CLN3_uc002dpn.2_Intron|CLN3_uc002dpm.2_Intron|CLN3_uc010vcv.1_Intron|CLN3_uc010byd.2_Intron|CLN3_uc002dpp.2_Intron|CLN3_uc002dpt.1_Intron|CLN3_uc002dpq.1_Intron|CLN3_uc010bye.1_Intron|CLN3_uc002dpr.1_Intron|CLN3_uc010byf.1_Intron|CLN3_uc002dps.1_Intron|CLN3_uc002dpu.1_Intron	NM_000086	NP_000077	Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3						amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding				0						actctgtctcaaaaaaaaaaa	0.129													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49511613	49511615	+	IGR	DEL	GAA	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49511613_49511615delGAA								C16orf78 (78296 upstream) : ZNF423 (12907 downstream)																							ggaagaacaggaagaagaagaag	0.000													4	2	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57919481	57919484	+	Intron	DEL	TCTT	-	-	rs5817124	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919481_57919484delTCTT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						tctctctctctctttctttctttc	0.000													4	4	---	---	---	---	
CALB2	794	broad.mit.edu	37	16	71416027	71416028	+	Intron	INS	-	AAGGAAGGAAGGAAAG	AAGGAAGGAAGGAAAG	rs67540929		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71416027_71416028insAAGGAAGGAAGGAAAG	uc002faa.3	+						CALB2_uc010vme.1_Intron|CALB2_uc002fac.3_Intron	NM_001740	NP_001731	P22676	CALB2_HUMAN	calbindin 2 isoform 1								calcium ion binding				0		Ovarian(137;0.125)				aaaggaagaaaaaggaaggaag	0.054													6	4	---	---	---	---	
HIC1	3090	broad.mit.edu	37	17	1961130	1961130	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1961130delG	uc010cjy.2	+	2	1203	c.1203delG	c.(1201-1203)GAGfs	p.E401fs	HIC1_uc002fty.3_Frame_Shift_Del_p.E382fs|HIC1_uc002ftz.3_Frame_Shift_Del_p.E382fs	NM_001098202	NP_001091672	Q14526	HIC1_HUMAN	hypermethylated in cancer 1 isoform 2	401					multicellular organismal development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)	1				READ - Rectum adenocarcinoma(1115;0.236)		GCAGCAGCGAGGAGACCGGTA	0.597													3	6	---	---	---	---	
CHRNB1	1140	broad.mit.edu	37	17	7359369	7359380	+	Intron	DEL	TTTTTTTTTTTT	-	-	rs67180661		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7359369_7359380delTTTTTTTTTTTT	uc002ghb.2	+						CHRNB1_uc010vty.1_Intron	NM_000747	NP_000738	P11230	ACHB_HUMAN	nicotinic acetylcholine receptor beta 1 subunit						behavioral response to nicotine|muscle contraction|muscle fiber development|neuromuscular synaptic transmission|postsynaptic membrane organization|regulation of membrane potential|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine binding|receptor activity			ovary(2)	2		Prostate(122;0.157)				tttttttggctttttttttttttttttttttt	0.241													11	7	---	---	---	---	
POLR2A	5430	broad.mit.edu	37	17	7402879	7402881	+	Intron	DEL	AGA	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7402879_7402881delAGA	uc002ghf.3	+						POLR2A_uc002ghe.2_3'UTR	NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				TGGAGGCTAGAGAGGAAGAGCTG	0.517													12	10	---	---	---	---	
CPD	1362	broad.mit.edu	37	17	28771163	28771163	+	Intron	DEL	A	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28771163delA	uc002hfb.1	+						CPD_uc010wbo.1_Intron|CPD_uc010wbp.1_Intron	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor						proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						AGAGTACACGAAAAAAAAAAA	0.378													10	6	---	---	---	---	
CCDC45	90799	broad.mit.edu	37	17	62530886	62530888	+	Intron	DEL	AAG	-	-	rs145444747		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62530886_62530888delAAG	uc002jem.2	+						CCDC45_uc002jen.2_Intron|CCDC45_uc010wqb.1_Intron|CCDC45_uc002jeo.1_In_Frame_Del_p.K134del	NM_138363	NP_612372	Q96GE4	CEP95_HUMAN	coiled-coil domain containing 45							centrosome|spindle pole	protein binding				0	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CAGCCCTGTTAAGAAGGTGAACT	0.389													9	12	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78674266	78674267	+	Intron	INS	-	T	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674266_78674267insT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						ggtggtggtggtggtggtggtg	0.000													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3742950	3742965	+	Intron	DEL	CTTCCTTCCTTCCTTC	-	-	rs36220699		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3742950_3742965delCTTCCTTCCTTCCTTC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				ATCAATTTATcttccttccttccttccttccttcct	0.236													8	4	---	---	---	---	
MC5R	4161	broad.mit.edu	37	18	13825564	13825564	+	5'Flank	DEL	A	-	-	rs33981843		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13825564delA	uc010xaf.1	+							NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6						cctgtctcttaaaaaaaaaaa	0.224													4	3	---	---	---	---	
NPC1	4864	broad.mit.edu	37	18	21118262	21118262	+	Intron	DEL	G	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21118262delG	uc002kum.3	-						NPC1_uc010xaz.1_Intron	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor						autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CTCATGCCCAGGGGGCCAGGA	0.512													6	5	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67818117	67818120	+	Intron	DEL	CTGT	-	-	rs146554691		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67818117_67818120delCTGT	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				AAAGATTCTCCTGTCTAACAGTTT	0.294													5	5	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16620643	16620643	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16620643delC	uc002neh.1	+	5	1556	c.1483delC	c.(1483-1485)CTGfs	p.L495fs	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Frame_Shift_Del_p.L495fs|C19orf44_uc002neg.2_Frame_Shift_Del_p.L495fs|C19orf44_uc010eai.1_RNA	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	495											0						TGACAGAACACTGGACGCTTT	0.493													140	79	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31443058	31443059	+	IGR	INS	-	CTCC	CTCC	rs144141390	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31443058_31443059insCTCC								ZNF536 (394093 upstream) : DKFZp566F0947 (197724 downstream)																							tccctccctctctccctccctc	0.005													7	5	---	---	---	---	
EPS8L1	54869	broad.mit.edu	37	19	55599029	55599029	+	3'UTR	DEL	C	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55599029delC	uc002qis.3	+	20					EPS8L1_uc010yfr.1_3'UTR|EPS8L1_uc002qiu.2_3'UTR|EPS8L1_uc002qiv.2_3'UTR|EPS8L1_uc002qiw.2_3'UTR	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway							cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CGTGGGAGAACGGACTCCTCA	0.572													20	10	---	---	---	---	
TNNT1	7138	broad.mit.edu	37	19	55652162	55652163	+	Intron	INS	-	TAA	TAA	rs148036599	by1000genomes	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55652162_55652163insTAA	uc002qjb.3	-						TNNT1_uc002qiz.3_Intron|TNNT1_uc002qja.3_Intron|TNNT1_uc002qjc.3_Intron|TNNT1_uc002qje.3_Intron|TNNT1_uc002qjd.3_Intron|TNNT1_uc002qjf.2_Intron	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a						muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		aataataatagtaataataata	0.218													5	4	---	---	---	---	
SEC23B	10483	broad.mit.edu	37	20	18485751	18485751	+	5'Flank	DEL	A	-	-	rs74180905		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18485751delA	uc002wqz.1	+						SEC23B_uc002wra.1_5'Flank|SEC23B_uc002wrb.1_5'Flank|SEC23B_uc010zsb.1_5'Flank|SEC23B_uc002wrc.1_5'Flank	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B						ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						CCTCATTCAGAAAAAAAAAAA	0.373													7	4	---	---	---	---	
PCIF1	63935	broad.mit.edu	37	20	44575022	44575022	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44575022delG	uc002xqs.2	+	14	1926	c.1612delG	c.(1612-1614)GGGfs	p.G538fs	PCIF1_uc002xqt.2_Frame_Shift_Del_p.G118fs|PCIF1_uc002xqu.2_5'Flank	NM_022104	NP_071387	Q9H4Z3	PCIF1_HUMAN	phosphorylated CTD interacting factor 1	538						nucleus				skin(1)	1						TGGCTCCCGCGGGTGAGGGCC	0.557													123	57	---	---	---	---	
SLMO2	51012	broad.mit.edu	37	20	57609945	57609946	+	3'UTR	INS	-	A	A	rs138739647		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57609945_57609946insA	uc002yam.2	-	6					ATP5E_uc002yal.2_5'Flank|SLMO2_uc010zzv.1_3'UTR	NM_016045	NP_057129	Q9Y3B1	SLMO2_HUMAN	slowmo homolog 2											skin(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)			ACCAACTTATCAAAAAAAAAAA	0.297													6	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085539	11085540	+	Intron	INS	-	ACC	ACC			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085539_11085540insACC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ctaaaaccacgaccaccaccac	0.000													4	2	---	---	---	---	
TMPRSS6	164656	broad.mit.edu	37	22	37469387	37469390	+	Intron	DEL	GATG	-	-	rs111916270		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37469387_37469390delGATG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						GAGACCAGAAgatggatggatgga	0.162													4	2	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467599	1467600	+	Intron	INS	-	TTTC	TTTC			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467599_1467600insTTTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ctttctttctgtttctgtttct	0.045													3	3	---	---	---	---	
USP9X	8239	broad.mit.edu	37	X	41029628	41029628	+	Intron	DEL	T	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41029628delT	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						TAGCATGTAGTCTTTCGGATT	0.174													6	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	155051861	155051863	+	IGR	DEL	AGA	-	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155051861_155051863delAGA								SPRY3 (39744 upstream) : VAMP7 (59084 downstream)																							gaggagaagcagaagaaggagaa	0.000													4	2	---	---	---	---	
