Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
WDR8	49856	broad.mit.edu	37	1	3551670	3551670	+	Intron	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3551670G>A	uc001ako.2	-						WDR8_uc001akn.3_Intron|WDR8_uc010nzi.1_3'UTR	NM_017818	NP_060288	Q9P2S5	WRP73_HUMAN	WD repeat domain 8							centrosome	protein binding				0	all_cancers(77;0.0128)|all_epithelial(69;0.00526)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;4.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.16e-22)|GBM - Glioblastoma multiforme(42;1.05e-14)|Colorectal(212;1.19e-05)|BRCA - Breast invasive adenocarcinoma(365;2.67e-05)|COAD - Colon adenocarcinoma(227;5.82e-05)|Kidney(185;0.000364)|KIRC - Kidney renal clear cell carcinoma(229;0.00223)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		AGGTGAGGCAGGGCCCGGCCC	0.577													14	50	---	---	---	---	PASS
PRAMEF22	653606	broad.mit.edu	37	1	13036613	13036613	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13036613T>C	uc009vnq.1	+	2	685	c.685T>C	c.(685-687)TAC>CAC	p.Y229H	PRAMEF5_uc001aur.2_Intron	NM_001100631	NP_001094101	A3QJZ6	PRA22_HUMAN	PRAME family member 22	229											0						GTTTAGCCGTTACCTGAGCCA	0.433													60	253	---	---	---	---	PASS
PRDM2	7799	broad.mit.edu	37	1	14149505	14149505	+	Intron	SNP	C	A	A	rs2697970	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14149505C>A	uc001avi.2	+						PRDM2_uc001avg.2_Intron|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron|PRDM2_uc001avl.1_RNA	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger							Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		tcactgtgaacattcatcaag	0.100													3	13	---	---	---	---	PASS
RCC1	1104	broad.mit.edu	37	1	28861585	28861585	+	Silent	SNP	G	A	A	rs141534722		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28861585G>A	uc001bqg.1	+	5	550	c.465G>A	c.(463-465)CTG>CTA	p.L155L	SNHG3-RCC1_uc001bqa.1_Silent_p.L155L|SNHG3-RCC1_uc001bqb.1_Silent_p.L155L|SNHG3-RCC1_uc001bqc.1_Silent_p.L155L|RCC1_uc001bqe.1_Silent_p.L172L|RCC1_uc001bqf.1_Silent_p.L186L	NM_001269	NP_001260	P18754	RCC1_HUMAN	regulator of chromosome condensation 1 isoform	155	RCC1 3.				cell division|chromosome segregation|G1/S transition of mitotic cell cycle|mitosis|mitotic spindle organization|regulation of mitosis|regulation of S phase of mitotic cell cycle|spindle assembly|viral reproduction	condensed nuclear chromosome|cytoplasm|nuclear chromatin|nuclear membrane|nucleoplasm	histone binding|nucleosomal DNA binding|Ran guanyl-nucleotide exchange factor activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		TGATTGGACTGTTGGAGCCCA	0.592													13	107	---	---	---	---	PASS
ALG6	29929	broad.mit.edu	37	1	63836513	63836513	+	5'UTR	SNP	C	G	G	rs34542411	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63836513C>G	uc010oow.1	+	2					ALG6_uc001daz.2_RNA|ALG6_uc009waj.2_RNA	NM_013339	NP_037471	Q9Y672	ALG6_HUMAN	dolichyl pyrophosphate Man9GlcNAc2						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity				0						CTCTCAAACTCCTAATTGCGA	0.219													10	109	---	---	---	---	PASS
ABCD3	5825	broad.mit.edu	37	1	94982785	94982785	+	3'UTR	SNP	A	T	T	rs77888949	byFrequency	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94982785A>T	uc001dqn.3	+	23					ABCD3_uc010oto.1_3'UTR|ABCD3_uc010otp.1_3'UTR|ABCD3_uc009wdr.2_3'UTR|ABCD3_uc001dqo.3_3'UTR	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		AGTTTTTTTTAAAAAAAAAAA	0.254													9	26	---	---	---	---	PASS
RTCD1	8634	broad.mit.edu	37	1	100736139	100736139	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100736139C>T	uc001dtc.2	+	4	535	c.317C>T	c.(316-318)TCA>TTA	p.S106L	RTCD1_uc010ouh.1_Missense_Mutation_p.S106L|RTCD1_uc001dtd.2_Missense_Mutation_p.S119L	NM_003729	NP_003720	O00442	RTC1_HUMAN	RNA terminal phosphate cyclase domain 1 isoform	106					RNA processing	mitochondrion|nucleoplasm	ATP binding|protein binding|RNA binding|RNA-3'-phosphate cyclase activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0513)|all cancers(265;0.0902)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)		ATGCAGGTCTCAATGCCGTGT	0.403													68	256	---	---	---	---	PASS
SLC16A4	9122	broad.mit.edu	37	1	110921750	110921750	+	Nonsense_Mutation	SNP	A	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110921750A>C	uc001dzo.1	-	6	937	c.755T>G	c.(754-756)TTA>TGA	p.L252*	SLC16A4_uc009wfs.1_Nonsense_Mutation_p.L204*|SLC16A4_uc001dzp.1_Intron|SLC16A4_uc010ovy.1_Nonsense_Mutation_p.L190*|SLC16A4_uc001dzq.1_Intron|SLC16A4_uc010ovz.1_Nonsense_Mutation_p.L142*	NM_004696	NP_004687	O15374	MOT5_HUMAN	solute carrier family 16, member 4	252	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			ovary(3)	3		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	TGAGACTGTTAAATTTTTGCT	0.423													90	345	---	---	---	---	PASS
OVGP1	5016	broad.mit.edu	37	1	111957023	111957023	+	3'UTR	SNP	C	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111957023C>A	uc001eba.2	-	11					OVGP1_uc001eaz.2_3'UTR|OVGP1_uc010owb.1_3'UTR	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor						chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GATGAGAAGGCTTCCAACATG	0.453													13	38	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144620091	144620091	+	Missense_Mutation	SNP	C	T	T	rs151155946		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144620091C>T	uc009wig.1	+	8	851	c.775C>T	c.(775-777)CCA>TCA	p.P259S	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.P259S|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.P190S|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Missense_Mutation_p.P190S|NBPF9_uc010oyg.1_Missense_Mutation_p.P224S|NBPF9_uc009wii.1_5'UTR	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	259	NBPF 1.					cytoplasm					0						AAACATTCTCCCAGGTAGCCT	0.393													8	66	---	---	---	---	PASS
C1orf66	51093	broad.mit.edu	37	1	156702120	156702120	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156702120C>T	uc001fpu.2	+	3	918	c.284C>T	c.(283-285)GCG>GTG	p.A95V	C1orf66_uc001fpv.2_Missense_Mutation_p.A95V	NM_015997	NP_057081	Q96FB5	RRNAD_HUMAN	hypothetical protein LOC51093 isoform 1	95						integral to membrane	rRNA (adenine-N6,N6-)-dimethyltransferase activity				0	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AAGTCCACGGCGTGTGCCCTG	0.592													4	31	---	---	---	---	PASS
FCRL4	83417	broad.mit.edu	37	1	157545231	157545231	+	3'UTR	SNP	G	T	T	rs849827	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157545231G>T	uc001fqw.2	-	12					FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor							integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TCATTCCAGGGGCCGCAAGGA	0.448													10	92	---	---	---	---	PASS
OR10J3	441911	broad.mit.edu	37	1	159283829	159283829	+	Silent	SNP	G	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159283829G>T	uc010piu.1	-	1	621	c.621C>A	c.(619-621)GTC>GTA	p.V207V		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)					GTAGAACAAGGACACAGACGC	0.478													42	139	---	---	---	---	PASS
TIPRL	261726	broad.mit.edu	37	1	168169452	168169452	+	3'UTR	SNP	G	A	A	rs2072776	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168169452G>A	uc001gfg.2	+	7					TIPRL_uc001gfh.2_3'UTR	NM_152902	NP_690866	O75663	TIPRL_HUMAN	TIP41, TOR signalling pathway regulator-like						DNA damage checkpoint|negative regulation of protein phosphatase type 2A activity	cytoplasm	protein binding			ovary(1)	1	all_hematologic(923;0.215)					CTCAACTGCTGTTTGTACTGT	0.323													3	4	---	---	---	---	PASS
TROVE2	6738	broad.mit.edu	37	1	193038546	193038546	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193038546T>A	uc001gss.2	+	2	537	c.362T>A	c.(361-363)ATT>AAT	p.I121N	TROVE2_uc001gst.1_Intron|TROVE2_uc001gsu.1_Intron|TROVE2_uc001gsv.1_Missense_Mutation_p.I121N|TROVE2_uc001gsw.2_Missense_Mutation_p.I121N|TROVE2_uc009wyp.2_Missense_Mutation_p.I121N|TROVE2_uc009wyq.2_Missense_Mutation_p.I121N|TROVE2_uc001gsx.1_Missense_Mutation_p.I121N	NM_004600	NP_004591	P10155	RO60_HUMAN	TROVE domain family, member 2 isoform 2	121	TROVE.				transcription from RNA polymerase III promoter	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0						GTTTGTCGCATTCCTACCCAT	0.453													23	93	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227261648	227261648	+	Silent	SNP	C	T	T	rs35017425	byFrequency	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227261648C>T	uc001hqr.2	-	19	3595	c.2652G>A	c.(2650-2652)TCG>TCA	p.S884S	CDC42BPA_uc001hqq.2_Silent_p.S148S|CDC42BPA_uc001hqs.2_Silent_p.S803S|CDC42BPA_uc009xes.2_Silent_p.S884S|CDC42BPA_uc010pvs.1_Silent_p.S884S|CDC42BPA_uc001hqp.2_Silent_p.S40S|CDC42BPA_uc001hqu.1_Silent_p.S40S	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	884	Potential.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				CATCCAGAGCCGACTGCAACT	0.388													13	170	---	---	---	---	PASS
FAM36A	116228	broad.mit.edu	37	1	245005373	245005373	+	Intron	SNP	A	G	G	rs10927335	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245005373A>G	uc001iar.2	+						FAM36A_uc001ias.2_Intron|FAM36A_uc001iat.2_Intron|NCRNA00201_uc001iav.2_RNA	NM_198076	NP_932342	Q5RI15	FA36A_HUMAN	hypothetical protein LOC116228							integral to membrane					0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			GAGTATCTGTATTTTTTATTT	0.313													27	312	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25470479	25470479	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25470479C>T	uc002rgc.2	-	8	1252	c.995G>A	c.(994-996)GGA>GAA	p.G332E	DNMT3A_uc002rgd.2_Missense_Mutation_p.G332E|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.G143E	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	332	Interaction with DNMT1 and DNMT3B.|PWWP.				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTGCCGTCTCCGAACCACAT	0.617			Mis|F|N|S		AML								30	146	---	---	---	---	PASS
PREB	10113	broad.mit.edu	37	2	27353754	27353754	+	3'UTR	SNP	G	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27353754G>T	uc002rix.1	-	9					PREB_uc002riy.1_3'UTR|PREB_uc002riz.1_RNA|PREB_uc002rja.1_3'UTR	NM_013388	NP_037520	Q9HCU5	PREB_HUMAN	prolactin regulatory element binding protein						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|nucleus	DNA binding|guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTAGGCCAGCTGGCTTAGT	0.478													3	10	---	---	---	---	PASS
ACTR2	10097	broad.mit.edu	37	2	65496018	65496018	+	3'UTR	SNP	C	G	G	rs11424	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65496018C>G	uc002sdq.2	+	9					ACTR2_uc002sdp.2_3'UTR|ACTR2_uc010yqg.1_3'UTR	NM_005722	NP_005713	P61160	ARP2_HUMAN	actin-related protein 2 isoform b						cellular component movement	Arp2/3 protein complex|cell projection|cytoplasm	actin binding|ATP binding				0						CTTGGGGAAGCTTTGTTAAAT	0.408													3	7	---	---	---	---	PASS
AAK1	22848	broad.mit.edu	37	2	69708002	69708002	+	Silent	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69708002C>T	uc002sfp.2	-	19	3064	c.2559G>A	c.(2557-2559)TCG>TCA	p.S853S		NM_014911	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	853						coated pit|mitochondrion|plasma membrane	ATP binding|protein serine/threonine kinase activity				0						CTGTGCGATTCGAGGTCACAG	0.557													18	64	---	---	---	---	PASS
NAT8B	51471	broad.mit.edu	37	2	73928184	73928184	+	Silent	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73928184C>T	uc002sjk.1	-	2	284	c.249G>A	c.(247-249)ACG>ACA	p.T83T		NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN	N-acetyltransferase 8B	83	N-acetyltransferase.				gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity				0						CTACATACCGCGTCCAGGGTT	0.552													24	74	---	---	---	---	PASS
FLJ40330	645784	broad.mit.edu	37	2	89102464	89102464	+	Intron	SNP	A	G	G	rs113574892	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89102464A>G	uc010fhg.2	+						FLJ40330_uc010fhh.2_RNA|FLJ40330_uc010fhi.1_Intron	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						TACTAATTTTAGTGGATGGCT	0.269													3	11	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125555870	125555870	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125555870T>G	uc002tno.2	+	19	3551	c.3187T>G	c.(3187-3189)TTC>GTC	p.F1063V	CNTNAP5_uc010flu.2_Missense_Mutation_p.F1064V	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1063	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTCTCAGGACTTCGTGGTTGT	0.502													58	225	---	---	---	---	PASS
LOC440905	440905	broad.mit.edu	37	2	130798128	130798128	+	RNA	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130798128C>T	uc002tpz.2	-	6		c.2283G>A				NR_026758				Homo sapiens cDNA FLJ43933 fis, clone TESTI4013685.												0						TCAATAATGGCGTTGTCTATA	0.413													4	5	---	---	---	---	PASS
CXCR4	7852	broad.mit.edu	37	2	136872415	136872415	+	3'UTR	SNP	A	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136872415A>G	uc002tuz.2	-	2					CXCR4_uc002tuy.2_3'UTR|CXCR4_uc010fnk.2_3'UTR	NM_003467	NP_003458	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4 isoform b						activation of MAPK activity|apoptosis|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|entry into host cell|inflammatory response|initiation of viral infection|regulation of chemotaxis|response to hypoxia|response to virus	cell leading edge|cell surface|cytoplasmic membrane-bounded vesicle|integral to membrane|plasma membrane	actin binding|C-X-C chemokine receptor activity|coreceptor activity|myosin light chain binding|ubiquitin binding|ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)	TTTATCGTATAAAAAAAAGTC	0.328													6	36	---	---	---	---	PASS
HNMT	3176	broad.mit.edu	37	2	138771760	138771760	+	3'UTR	SNP	A	G	G	rs1050891	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138771760A>G	uc002tvc.2	+	7					HNMT_uc002tvf.2_3'UTR	NM_006895	NP_008826	P50135	HNMT_HUMAN	histamine N-methyltransferase isoform 1						respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	TCACTCATTTATTTCCATATT	0.279													8	55	---	---	---	---	PASS
INO80D	54891	broad.mit.edu	37	2	206872126	206872126	+	Silent	SNP	C	T	T	rs116331438	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206872126C>T	uc002vaz.3	-	10	2205	c.1800G>A	c.(1798-1800)CCG>CCA	p.P600P		NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	600					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						CAATGTCATCCGGCAACTCAT	0.498													8	105	---	---	---	---	PASS
PTH2R	5746	broad.mit.edu	37	2	209358369	209358369	+	Silent	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209358369T>C	uc002vdb.2	+	13	1851	c.1638T>C	c.(1636-1638)ACT>ACC	p.T546T	PTH2R_uc010zjb.1_Silent_p.T557T|PTH2R_uc010fuo.1_Intron	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor	546	Cytoplasmic (Potential).					integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		AAGGAGAAACTGAGGATGTTC	0.493													12	39	---	---	---	---	PASS
SPAG16	79582	broad.mit.edu	37	2	214182100	214182100	+	Intron	SNP	A	T	T	rs10183630	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214182100A>T	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron|SPAG16_uc002veo.2_3'UTR|SPAG16_uc002vep.1_Intron|SPAG16_uc002ves.1_Intron	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TTTTTAAATGACATTTTCTTC	0.284													12	49	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64592714	64592714	+	Silent	SNP	C	T	T	rs36103059		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64592714C>T	uc003dmg.2	-	23	3428	c.3396G>A	c.(3394-3396)GTG>GTA	p.V1132V	ADAMTS9_uc011bfo.1_Silent_p.V1104V|ADAMTS9_uc003dmh.1_Silent_p.V961V|ADAMTS9_uc011bfp.1_Silent_p.V43V	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1132	TSP type-1 6.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TGATGCATTTCACTGCTCTTA	0.423													10	114	---	---	---	---	PASS
ALCAM	214	broad.mit.edu	37	3	105264025	105264025	+	Intron	SNP	C	T	T	rs72989914	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105264025C>T	uc003dvx.2	+						ALCAM_uc003dvw.1_Intron|ALCAM_uc003dvy.2_Intron|ALCAM_uc011bhh.1_Intron|ALCAM_uc010hpp.2_Intron|ALCAM_uc003dvz.2_5'UTR	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						GACTATCTTACATTTCAGAGT	0.318													7	56	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124732252	124732252	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124732252G>A	uc003ehs.3	-	6	2239	c.2171C>T	c.(2170-2172)ACG>ATG	p.T724M	HEG1_uc011bke.1_Missense_Mutation_p.T824M	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	724	Extracellular (Potential).|Ser-rich.					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						TGTAGATGTCGTTAAGGATAC	0.493													59	503	---	---	---	---	PASS
PLOD2	5352	broad.mit.edu	37	3	145788467	145788467	+	3'UTR	SNP	T	C	C	rs6710	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145788467T>C	uc003evs.1	-	19					PLOD2_uc003evq.1_3'UTR|PLOD2_uc011bnm.1_3'UTR|PLOD2_uc003evr.1_3'UTR	NM_000935	NP_000926	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase						protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)	CAGTCATTCATCCAAAATAAA	0.338													9	40	---	---	---	---	PASS
TM4SF1	4071	broad.mit.edu	37	3	149095470	149095470	+	5'UTR	SNP	G	A	A	rs73152606	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149095470G>A	uc003exb.1	-	1					TM4SF1_uc003exc.1_5'Flank	NM_014220	NP_055035	P30408	T4S1_HUMAN	transmembrane 4 superfamily member 1							integral to plasma membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TAAATACTGCGATTCTTAGTC	0.507													4	9	---	---	---	---	PASS
SUCNR1	56670	broad.mit.edu	37	3	151599393	151599393	+	3'UTR	SNP	C	T	T	rs13079080	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151599393C>T	uc003ezf.1	+	3						NM_033050	NP_149039	Q9BXA5	SUCR1_HUMAN	succinate receptor 1							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	TACAGTTTGCCTTAACTCATA	0.403													3	11	---	---	---	---	PASS
ECT2	1894	broad.mit.edu	37	3	172538065	172538065	+	3'UTR	SNP	C	T	T	rs76864072	byFrequency	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172538065C>T	uc003fii.2	+	24					ECT2_uc003fih.2_3'UTR|ECT2_uc003fij.1_3'UTR|ECT2_uc003fik.1_3'UTR|ECT2_uc003fil.1_3'UTR|ECT2_uc003fim.1_3'UTR	NM_018098	NP_060568	Q9H8V3	ECT2_HUMAN	epithelial cell transforming sequence 2 oncogene						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			AATGTATAGACACCTCATACT	0.318													13	57	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6066628	6066628	+	Silent	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6066628C>T	uc003giu.3	-	9	1686	c.1410G>A	c.(1408-1410)ACG>ACA	p.T470T	JAKMIP1_uc010idb.1_Silent_p.T470T|JAKMIP1_uc010idc.1_Silent_p.T285T|JAKMIP1_uc010idd.1_Silent_p.T470T|JAKMIP1_uc011bwc.1_Silent_p.T305T|JAKMIP1_uc003giv.3_Silent_p.T470T|JAKMIP1_uc010ide.2_Silent_p.T470T	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	470	Mediates interaction with TYK2 and GABBR1.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						CTTCTTCGGGCGTGGCTGGGG	0.532													23	140	---	---	---	---	PASS
FAM200B	285550	broad.mit.edu	37	4	15689632	15689632	+	Silent	SNP	G	A	A	rs11729955	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15689632G>A	uc003gof.3	+	2	1947	c.1032G>A	c.(1030-1032)GAG>GAA	p.E344E	FAM200B_uc003gog.2_Intron	NM_001145191	NP_001138663	P0CF97	F200B_HUMAN	hypothetical protein LOC285550	344							nucleic acid binding				0						atctcatggaggtattgaaaa	0.000													13	133	---	---	---	---	PASS
PROM1	8842	broad.mit.edu	37	4	15985978	15985978	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15985978T>C	uc003goo.2	-	22	2493	c.2281A>G	c.(2281-2283)ATC>GTC	p.I761V	PROM1_uc003gor.2_Missense_Mutation_p.I761V|PROM1_uc003gos.2_Missense_Mutation_p.I752V|PROM1_uc003got.2_Missense_Mutation_p.I761V|PROM1_uc003gou.2_Missense_Mutation_p.I752V|PROM1_uc003gop.2_Missense_Mutation_p.I752V|PROM1_uc003goq.3_Missense_Mutation_p.I752V	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1	761	Extracellular (Potential).				camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						TTCTCACTGATCTAGGGGGGT	0.458													17	114	---	---	---	---	PASS
HERC3	8916	broad.mit.edu	37	4	89583644	89583644	+	Silent	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89583644T>C	uc003hrw.1	+	11	1375	c.1209T>C	c.(1207-1209)AAT>AAC	p.N403N	HERC3_uc011cdn.1_Silent_p.N285N|HERC3_uc011cdo.1_Intron	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3	403					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GTTTAATAAATGATGAAACCA	0.328													97	326	---	---	---	---	PASS
BANK1	55024	broad.mit.edu	37	4	102783712	102783712	+	Silent	SNP	A	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102783712A>G	uc003hvy.3	+	4	928	c.654A>G	c.(652-654)AGA>AGG	p.R218R	BANK1_uc003hvx.3_Silent_p.R203R|BANK1_uc010ill.2_Silent_p.R85R|BANK1_uc003hvz.3_Silent_p.R188R	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	218	DBB.				B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TAATTTTGAGAGATGAAGTAA	0.343													56	175	---	---	---	---	PASS
FABP2	2169	broad.mit.edu	37	4	120240131	120240131	+	3'UTR	SNP	T	C	C	rs2964	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120240131T>C	uc003icw.2	-	4						NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						GTGAAATAAATAGTTCTGGTA	0.338													8	80	---	---	---	---	PASS
SH3RF1	57630	broad.mit.edu	37	4	170037436	170037436	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170037436G>C	uc003isa.1	-	10	2458	c.2123C>G	c.(2122-2124)CCA>CGA	p.P708R	SH3RF1_uc010irc.1_Missense_Mutation_p.P408R	NM_020870	NP_065921	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	708						Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding			breast(2)|lung(1)	3		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		ATCCTTGTCTGGTTTGGTTGC	0.458													4	9	---	---	---	---	PASS
ANKRD31	256006	broad.mit.edu	37	5	74443132	74443132	+	Missense_Mutation	SNP	C	T	T	rs1422698	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74443132C>T	uc003kdo.1	-	14	2296	c.2104G>A	c.(2104-2106)GAC>AAC	p.D702N				Q8N7Z5	ANR31_HUMAN	Homo sapiens cDNA FLJ40191 fis, clone TESTI2019280, weakly similar to Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA.	702											0						TATATCTGGTCAAGAGTTGAT	0.333													42	272	---	---	---	---	PASS
NUDT12	83594	broad.mit.edu	37	5	102886512	102886512	+	3'UTR	SNP	T	C	C	rs58006145	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102886512T>C	uc003koi.2	-	7					NUDT12_uc011cvb.1_3'UTR	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12							nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		ACTTGAGGAATGAGTGTTATT	0.289													11	89	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112175017	112175017	+	Silent	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112175017G>A	uc010jby.2	+	16	4106	c.3726G>A	c.(3724-3726)CAG>CAA	p.Q1242Q	APC_uc011cvt.1_Silent_p.Q1224Q|APC_uc003kpz.3_Silent_p.Q1242Q|APC_uc003kpy.3_Silent_p.Q1242Q|APC_uc010jbz.2_Silent_p.Q959Q|APC_uc010jca.2_Silent_p.Q542Q	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1242	Ser-rich.|Responsible for down-regulation through a process mediated by direct ubiquitination.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.K1192fs*3(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAAGTGGTCAGCCTCAAAAGG	0.398		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			26	35	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127626459	127626459	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127626459C>G	uc003kuu.2	-	50	6849	c.6410G>C	c.(6409-6411)GGG>GCG	p.G2137A		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	2137	TB 8.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACAGGGGTCCCCCCAGCCCTC	0.463													31	253	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	129072874	129072874	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129072874G>T	uc003kvb.1	+	23	3587	c.3587G>T	c.(3586-3588)AGG>ATG	p.R1196M	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1196	PLAC.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GAAACATGCAGGGACTTCTAT	0.488													19	122	---	---	---	---	PASS
TMEM173	340061	broad.mit.edu	37	5	138861070	138861070	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138861070G>A	uc003lep.2	-	3	471	c.220C>T	c.(220-222)CAC>TAC	p.H74Y		NM_198282	NP_938023	Q86WV6	TM173_HUMAN	transmembrane protein 173	74	Cytoplasmic (Potential).				activation of innate immune response|apoptosis|cellular response to exogenous dsRNA|defense response to virus|innate immune response|interferon-beta production|positive regulation of defense response to virus by host|positive regulation of protein binding|positive regulation of protein import into nucleus, translocation|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane|perinuclear region of cytoplasm|plasma membrane	protein homodimerization activity|protein kinase binding|transcription factor binding			upper_aerodigestive_tract(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CACCTGGAGTGGATGTGGCGC	0.617													4	7	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140476894	140476894	+	3'UTR	SNP	A	G	G	rs3776103	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476894A>G	uc003lil.2	+	1						NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATTCTATGCATGTTACTGGT	0.299													5	51	---	---	---	---	PASS
RPL10A	4736	broad.mit.edu	37	6	35436195	35436195	+	5'UTR	SNP	G	A	A	rs41271257	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35436195G>A	uc003okp.1	+	1					RPL10A_uc003okq.1_5'Flank|RPL10A_uc003okr.1_5'Flank|RPL10A_uc003oks.1_5'Flank	NM_007104	NP_009035	P62906	RL10A_HUMAN	ribosomal protein L10a						anatomical structure morphogenesis|endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	RNA binding|structural constituent of ribosome			ovary(1)	1						TTTCCGGTTAGCGCGGCGTGA	0.597											OREG0017378	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	31	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76604797	76604797	+	Intron	SNP	A	G	G	rs3798427	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76604797A>G	uc003pih.1	+						MYO6_uc003pig.1_Intron|MYO6_uc003pii.1_Intron|MYO6_uc003pij.1_Translation_Start_Site	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		ACTTAAAAATATATTAAAATT	0.234													5	37	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152489000	152489000	+	Intron	SNP	C	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152489000C>A	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAGAGACAACTGGAATACAG	0.438										HNSCC(10;0.0054)			48	174	---	---	---	---	PASS
VWDE	221806	broad.mit.edu	37	7	12406989	12406989	+	Missense_Mutation	SNP	C	G	G	rs6460939	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12406989C>G	uc003ssj.2	-	13	3402	c.2892G>C	c.(2890-2892)AAG>AAC	p.K964N	VWDE_uc011jxl.1_RNA|VWDE_uc011jxm.1_Missense_Mutation_p.K418N	NM_001135924	NP_001129396	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	964						extracellular region					0						ATACCTGTAGCTTAGTAACTT	0.303													20	247	---	---	---	---	PASS
VWDE	221806	broad.mit.edu	37	7	12417407	12417407	+	Missense_Mutation	SNP	C	T	T	rs7793993	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12417407C>T	uc003ssj.2	-	7	1529	c.1019G>A	c.(1018-1020)GGT>GAT	p.G340D	VWDE_uc011jxl.1_RNA|VWDE_uc011jxm.1_5'UTR	NM_001135924	NP_001129396	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	340						extracellular region					0						ATTACCTTGACCAATAGTTTT	0.294													19	236	---	---	---	---	PASS
VWDE	221806	broad.mit.edu	37	7	12419108	12419108	+	Missense_Mutation	SNP	A	T	T	rs6967241	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12419108A>T	uc003ssj.2	-	6	1384	c.874T>A	c.(874-876)TTT>ATT	p.F292I	VWDE_uc011jxl.1_RNA|VWDE_uc011jxm.1_5'UTR	NM_001135924	NP_001129396	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	292						extracellular region					0						CGTACCTTAAAGCCTGCAAAA	0.358													20	236	---	---	---	---	PASS
POMZP3	22932	broad.mit.edu	37	7	76255326	76255326	+	Missense_Mutation	SNP	C	A	A	rs143516376		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76255326C>A	uc003uft.2	-	2	803	c.56G>T	c.(55-57)CGT>CTT	p.R19L	uc003ufs.1_RNA|POMZP3_uc003ufu.2_Missense_Mutation_p.R19L|POMZP3_uc003ufv.2_RNA|POMZP3_uc011kgm.1_RNA	NM_012230	NP_036362	Q6PJE2	POZP3_HUMAN	POMZP3 fusion protein isoform 1	19											0		Myeloproliferative disorder(862;0.204)				CATCGCAGAACGCGAAAATCT	0.473													35	210	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120782027	120782027	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120782027C>G	uc003vjq.3	+	16	2334	c.1887C>G	c.(1885-1887)AGC>AGG	p.S629R	C7orf58_uc003vjs.3_Missense_Mutation_p.S629R|C7orf58_uc003vjt.3_Missense_Mutation_p.S409R	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	629						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					TTCTCTCCAGCTTTGCCAGCT	0.383													32	64	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131878932	131878932	+	Silent	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131878932C>T	uc003vra.3	-	14	2974	c.2745G>A	c.(2743-2745)GTG>GTA	p.V915V		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	915	IPT/TIG 1.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						CCATCTCACACACGATCCTGC	0.602													3	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142143833	142143833	+	Intron	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142143833G>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc003vys.1_RNA					SubName: Full=V_segment translation product; Flags: Fragment;																		GGGTCTTGTCGATACCGATAC	0.493													26	70	---	---	---	---	PASS
GTF2E2	2961	broad.mit.edu	37	8	30469919	30469919	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30469919T>C	uc003xig.2	-	5	699	c.446A>G	c.(445-447)AAG>AGG	p.K149R		NM_002095	NP_002086	P29084	T2EB_HUMAN	general transcription factor IIE, polypeptide 2,	149					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	transcription factor TFIIE complex	DNA binding|protein binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.113)|Kidney(114;0.135)		AAGTAGGGCCTTCTTATCTCT	0.423													78	403	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139601612	139601612	+	Missense_Mutation	SNP	G	A	A	rs139658465	byFrequency	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139601612G>A	uc003yvd.2	-	65	5212	c.4765C>T	c.(4765-4767)CCA>TCA	p.P1589S	COL22A1_uc011ljo.1_Missense_Mutation_p.P869S	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1589	Pro-rich.|Gly-rich.|Collagen-like 16.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TGTCCAGCTGGTCCTGTCTCC	0.622										HNSCC(7;0.00092)			15	18	---	---	---	---	PASS
KANK1	23189	broad.mit.edu	37	9	713034	713034	+	Silent	SNP	C	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:713034C>A	uc003zgl.1	+	7	2917	c.2268C>A	c.(2266-2268)ACC>ACA	p.T756T	KANK1_uc003zgm.2_Silent_p.T756T|KANK1_uc003zgn.1_Silent_p.T756T|KANK1_uc003zgo.1_Silent_p.T756T|KANK1_uc003zgp.1_Silent_p.T756T|KANK1_uc003zgq.2_Silent_p.T598T|KANK1_uc003zgr.1_Silent_p.T598T|KANK1_uc003zgs.1_Silent_p.T598T	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a	756					negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CTGTGAAGACCAAAGAGTCAG	0.502													28	92	---	---	---	---	PASS
ALDH1A1	216	broad.mit.edu	37	9	75515922	75515922	+	3'UTR	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75515922G>A	uc004ajd.2	-	13					ALDH1A1_uc011lsh.1_3'UTR|ALDH1A1_uc011lsg.1_3'UTR	NM_000689	NP_000680	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1A1						cellular aldehyde metabolic process|ethanol oxidation|xenobiotic metabolic process	cytosol	aldehyde dehydrogenase (NAD) activity|androgen binding|Ras GTPase activator activity|retinal dehydrogenase activity			ovary(3)|lung(1)	4					NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TAGGACTTGGGGGTCACATTT	0.318													3	13	---	---	---	---	PASS
PTCH1	5727	broad.mit.edu	37	9	98212006	98212006	+	Intron	SNP	G	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98212006G>T	uc004avk.3	-						PTCH1_uc010mrn.2_5'UTR|PTCH1_uc010mro.2_Intron|PTCH1_uc010mrp.2_Intron|PTCH1_uc010mrq.2_Intron|PTCH1_uc004avl.3_Intron|PTCH1_uc010mrr.2_Intron|PTCH1_uc004avm.3_Intron	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L						embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				ACTCTGAGATGTTTACTGAAG	0.527									Basal_Cell_Nevus_syndrome				3	14	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135802613	135802613	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135802613G>C	uc004cca.2	-	4	419	c.185C>G	c.(184-186)ACC>AGC	p.T62S	TSC1_uc004ccb.3_Missense_Mutation_p.T62S|TSC1_uc011mcq.1_Missense_Mutation_p.T62S|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_Intron|TSC1_uc004ccc.1_Missense_Mutation_p.T62S|TSC1_uc004ccd.2_Missense_Mutation_p.T62S|TSC1_uc004cce.1_Missense_Mutation_p.T62S	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	62					activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding			lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TTGCAAGGTGGTCAGGATGTG	0.468			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				65	224	---	---	---	---	PASS
SLC34A3	142680	broad.mit.edu	37	9	140127488	140127488	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140127488A>G	uc004cmf.1	+	6	667	c.481A>G	c.(481-483)ATG>GTG	p.M161V	SLC34A3_uc004cmc.1_Missense_Mutation_p.M18V|SLC34A3_uc004cmd.1_Missense_Mutation_p.M161V|SLC34A3_uc011met.1_Missense_Mutation_p.M161V	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	161	Cytoplasmic (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GCCCATCATCATGGGTGTCAA	0.642													4	18	---	---	---	---	PASS
AKR1C3	8644	broad.mit.edu	37	10	5139815	5139815	+	Intron	SNP	C	A	A	rs2245191	byFrequency	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5139815C>A	uc001ihr.2	+						AKR1C3_uc010qap.1_Intron|AKR1C3_uc010qaq.1_3'UTR|AKR1C3_uc001ihu.2_Intron	NM_003739	NP_003730	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3						prostaglandin metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (A-specific) activity|indanol dehydrogenase activity|prostaglandin-F synthase activity|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			skin(1)	1					Dimethyl sulfoxide(DB01093)|NADH(DB00157)	GATAGTTGAACAGAGCTTTTT	0.348													7	63	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	52390836	52390836	+	RNA	SNP	A	G	G	rs7904101	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52390836A>G	uc001jjf.1	+	2		c.1529A>G								Homo sapiens cDNA FLJ12320 fis, clone MAMMA1002082.																		TTCCGTATCCATATTCTACAA	0.512													8	68	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61829504	61829504	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61829504G>A	uc001jky.2	-	37	11327	c.11135C>T	c.(11134-11136)TCT>TTT	p.S3712F	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	3712					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						GTCAACTTTAGAGGTGTTAGT	0.498													8	39	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64937314	64937314	+	Intron	SNP	G	A	A	rs35854283	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64937314G>A	uc001jmn.2	-						JMJD1C_uc001jml.2_Intron|JMJD1C_uc001jmm.2_Intron|JMJD1C_uc010qiq.1_Intron|JMJD1C_uc009xpi.2_Intron|JMJD1C_uc009xpj.1_Intron|JMJD1C_uc001jmk.2_5'Flank|JMJD1C_uc001jmo.2_3'UTR	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					TTTCAAAGAGGAGCAAGAGAA	0.363													4	31	---	---	---	---	PASS
ECD	11319	broad.mit.edu	37	10	74899074	74899074	+	Silent	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74899074G>A	uc001jtn.2	-	11	1657	c.1414C>T	c.(1414-1416)CTG>TTG	p.L472L	ECD_uc009xqx.2_Silent_p.L505L|ECD_uc009xqy.2_Silent_p.L429L|ECD_uc001jto.2_Silent_p.L171L	NM_007265	NP_009196	O95905	SGT1_HUMAN	suppressor of S. cerevisiae gcr2 isoform 1	472					regulation of glycolysis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	transcription coactivator activity			pancreas(1)	1	Prostate(51;0.0119)					TACCGAGGCAGCTCTGCTCCC	0.368													49	144	---	---	---	---	PASS
C10orf116	10974	broad.mit.edu	37	10	88730374	88730374	+	3'UTR	SNP	C	T	T	rs7960	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88730374C>T	uc001ked.2	+	3					AGAP11_uc001kee.2_5'Flank|uc001kec.1_Intron	NM_006829	NP_006820	Q15847	APM2_HUMAN	adipose specific 2												0						CCTGAAATGACAGCAGGGAGA	0.587													4	23	---	---	---	---	PASS
TM9SF3	56889	broad.mit.edu	37	10	98281896	98281896	+	3'UTR	SNP	G	C	C	rs78610910	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98281896G>C	uc001kmm.3	-	15					TM9SF3_uc010qot.1_3'UTR	NM_020123	NP_064508	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3 precursor							integral to membrane	binding				0		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		CGACGAAAGAGAGACCCACAA	0.413													5	20	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104687266	104687266	+	Intron	SNP	C	T	T	rs34086358		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104687266C>T	uc001kwm.2	+						CNNM2_uc001kwn.2_Intron|CNNM2_uc001kwl.2_3'UTR	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1						ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		cctgtaatcccggcactttgg	0.144													6	45	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105165797	105165797	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105165797G>T	uc001kwy.1	+	6	707	c.620G>T	c.(619-621)GGT>GTT	p.G207V		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	207	S1 motif 2.				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GTGGACATTGGTGTTGATGGG	0.493													14	74	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112361507	112361507	+	Silent	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112361507T>C	uc001kze.2	+	24	2883	c.2757T>C	c.(2755-2757)ACT>ACC	p.T919T		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	919					cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		ATCATGATACTAAAGAACTGG	0.378													48	182	---	---	---	---	PASS
SLC22A24	283238	broad.mit.edu	37	11	62848445	62848445	+	Silent	SNP	A	G	G	rs11231340	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62848445A>G	uc009yop.2	-	9	1987	c.1545T>C	c.(1543-1545)CTT>CTC	p.L515L		NM_001136506	NP_001129978			solute carrier family 22, member 24												0						TGGTTTCTGGAAGGAGGAGGA	0.507													16	176	---	---	---	---	PASS
CCDC89	220388	broad.mit.edu	37	11	85396982	85396982	+	Silent	SNP	A	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85396982A>T	uc001pau.1	-	1	339	c.192T>A	c.(190-192)GCT>GCA	p.A64A		NM_152723	NP_689936	Q8N998	CCD89_HUMAN	coiled-coil domain containing 89	64	Potential.					cytoplasm|nucleus					0		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				AGCGAAGCATAGCCTTCTCGC	0.582													7	37	---	---	---	---	PASS
EED	8726	broad.mit.edu	37	11	85989284	85989284	+	Intron	SNP	A	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85989284A>C	uc001pbp.2	+						EED_uc001pbq.2_3'UTR|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				tctaaattttataaaatttGA	0.289													4	8	---	---	---	---	PASS
MMP20	9313	broad.mit.edu	37	11	102465487	102465487	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102465487T>C	uc001phc.2	-	7	968	c.955A>G	c.(955-957)ATT>GTT	p.I319V		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	319	Hemopexin-like 1.				proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		CTCCAGAAAATCCTATGGGAC	0.418													12	47	---	---	---	---	PASS
TMPRSS13	84000	broad.mit.edu	37	11	117789147	117789147	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117789147G>C	uc001prs.1	-	2	521	c.428C>G	c.(427-429)ACC>AGC	p.T143S	TMPRSS13_uc009yzr.1_5'UTR|TMPRSS13_uc001prt.1_5'UTR|TMPRSS13_uc001pru.1_Missense_Mutation_p.T143S	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	138	Cytoplasmic (Potential).				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		GGTGGCCCTGGTTGCTGGTGC	0.602													18	33	---	---	---	---	PASS
DPPA3	359787	broad.mit.edu	37	12	7869817	7869817	+	3'UTR	SNP	A	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7869817A>T	uc001qtf.2	+	4						NM_199286	NP_954980	Q6W0C5	DPPA3_HUMAN	stella							cytoplasm|nucleus					0				Kidney(36;0.0887)		TCTTCCTACTATGATACTAGT	0.318													6	18	---	---	---	---	PASS
KLRK1	22914	broad.mit.edu	37	12	10525644	10525644	+	3'UTR	SNP	A	G	G	rs1351113	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10525644A>G	uc009zhj.2	-	8					uc001qya.1_Intron|KLRK1_uc001qyb.2_RNA|KLRK1_uc001qyc.2_3'UTR|KLRK1_uc009zhk.2_3'UTR|KLRK1_uc001qyd.2_3'UTR	NM_007360	NP_031386	P26718	NKG2D_HUMAN	NKG2-D type II integral membrane protein						natural killer cell activation|T cell costimulation	integral to plasma membrane	sugar binding				0						ctttagtctcagttggcagtg	0.075													32	427	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21358851	21358851	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21358851T>A	uc001req.3	+	11	1485	c.1381T>A	c.(1381-1383)TCA>ACA	p.S461T		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	461	Extracellular (Potential).|Kazal-like.				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	TTATTGCAACTCAGACTGCAA	0.333													26	89	---	---	---	---	PASS
FAM186A	121006	broad.mit.edu	37	12	50744581	50744581	+	Missense_Mutation	SNP	A	T	T	rs73108300	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50744581A>T	uc001rwl.2	-	4	6172	c.6034T>A	c.(6034-6036)TTT>ATT	p.F2012I	FAM186A_uc010smt.1_Missense_Mutation_p.F1790I	NM_001145475	NP_001138947	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	2012											0						AATGTTCTAAATGATTCTATA	0.428													36	429	---	---	---	---	PASS
PTPRQ	374462	broad.mit.edu	37	12	80899901	80899901	+	Missense_Mutation	SNP	C	A	A	rs11114486	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80899901C>A	uc001sze.2	+	12	2371	c.2371C>A	c.(2371-2373)CAA>AAA	p.Q791K		NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						TGGAATCATACAAAAATATAC	0.328													10	70	---	---	---	---	PASS
DCN	1634	broad.mit.edu	37	12	91552079	91552079	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91552079C>T	uc001tbs.2	-	3	626	c.532G>A	c.(532-534)GTC>ATC	p.V178I	DCN_uc001tbo.2_Intron|DCN_uc001tbp.2_Intron|DCN_uc001tbq.2_Intron|DCN_uc001tbr.2_Intron|DCN_uc001tbt.2_Missense_Mutation_p.V178I|DCN_uc001tbu.2_Missense_Mutation_p.V178I	NM_133503	NP_598010	P07585	PGS2_HUMAN	decorin isoform a preproprotein	178	LRR 5.				organ morphogenesis	extracellular space				central_nervous_system(2)|ovary(1)|lung(1)	4						GTACCTATGACAATCATCTGG	0.378													19	138	---	---	---	---	PASS
PRDM4	11108	broad.mit.edu	37	12	108127965	108127965	+	3'UTR	SNP	A	G	G	rs17306603	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108127965A>G	uc001tmp.2	-	12					PRDM4_uc010sww.1_3'UTR|PRDM4_uc001tmq.2_RNA	NM_012406	NP_036538	Q9UKN5	PRDM4_HUMAN	PR domain containing 4						cell proliferation|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						TTTTCATCCAAAATTGCTTGT	0.333													15	181	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120614003	120614003	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120614003C>T	uc001txo.2	-	10	869	c.856G>A	c.(856-858)GCA>ACA	p.A286T		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	286	HEAT 1.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTCACTGATGCCAGCAGACTA	0.493													31	55	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19425704	19425704	+	RNA	SNP	A	G	G	rs150020638	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19425704A>G	uc010tcj.1	-	1		c.20406T>C				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						ACATTAAAAGAGAAACATCTG	0.254													5	29	---	---	---	---	PASS
NOVA1	4857	broad.mit.edu	37	14	26939474	26939474	+	Intron	SNP	T	A	A	rs1245213	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26939474T>A	uc001wpy.2	-						NOVA1_uc001wpz.2_Intron|NOVA1_uc001wqa.2_Intron|NOVA1_uc001wqb.2_3'UTR	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1						locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		CAAAGCTAAATTAATCAGGAC	0.308													5	48	---	---	---	---	PASS
ACTN1	87	broad.mit.edu	37	14	69378925	69378925	+	Silent	SNP	G	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69378925G>T	uc001xkl.2	-	4	685	c.375C>A	c.(373-375)GGC>GGA	p.G125G	ACTN1_uc010ttb.1_Silent_p.G60G|ACTN1_uc001xkm.2_Silent_p.G125G|ACTN1_uc001xkn.2_Silent_p.G125G|ACTN1_uc001xko.1_Silent_p.G60G|ACTN1_uc010ttd.1_Silent_p.G104G	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	125	CH 1.|Actin-binding.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TCCAGATCATGCCCAGGGTCA	0.537											OREG0022758	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	32	115	---	---	---	---	PASS
SPINT1	6692	broad.mit.edu	37	15	41145781	41145781	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41145781C>T	uc001zna.2	+	4	902	c.698C>T	c.(697-699)ACG>ATG	p.T233M	SPINT1_uc001znb.2_Missense_Mutation_p.T233M|SPINT1_uc001znc.2_Missense_Mutation_p.T233M|SPINT1_uc010ucs.1_Missense_Mutation_p.T233M	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	233						extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		CCAGAGGACACGGCCAACGTC	0.607													7	26	---	---	---	---	PASS
WDR76	79968	broad.mit.edu	37	15	44127303	44127303	+	Silent	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44127303C>T	uc001zti.1	+	3	530	c.507C>T	c.(505-507)AAC>AAT	p.N169N		NM_024908	NP_079184	Q9H967	WDR76_HUMAN	WD repeat domain 76	169											0		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		GACTGAAGAACATATCAGAAA	0.323													91	326	---	---	---	---	PASS
AP4E1	23431	broad.mit.edu	37	15	51237857	51237857	+	Intron	SNP	C	G	G	rs3784303	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51237857C>G	uc001zyx.1	+						AP4E1_uc010ufi.1_Intron|AP4E1_uc010ufj.1_Intron|AP4E1_uc010ufk.1_Intron|LOC100132724_uc010ufl.1_RNA	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1						intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		GTGTAAAATGCACTTCTGACA	0.363													27	270	---	---	---	---	PASS
AP4E1	23431	broad.mit.edu	37	15	51238175	51238175	+	Intron	SNP	T	C	C	rs7162209	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51238175T>C	uc001zyx.1	+						AP4E1_uc010ufi.1_Intron|AP4E1_uc010ufj.1_Intron|AP4E1_uc010ufk.1_Intron|LOC100132724_uc010ufl.1_RNA	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1						intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		AGAAGAAACATGTAGGGGCAG	0.368													20	135	---	---	---	---	PASS
NARG2	79664	broad.mit.edu	37	15	60745693	60745693	+	Intron	SNP	T	C	C	rs12324091	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60745693T>C	uc002agp.2	-						NARG2_uc002ago.2_Intron|NARG2_uc002agq.3_Intron|NARG2_uc010bgk.2_3'UTR	NM_024611	NP_078887	Q659A1	NARG2_HUMAN	NMDA receptor regulated 2 isoform a							nucleus				ovary(1)|lung(1)	2						agtttgaatctaaagcctgta	0.139													6	26	---	---	---	---	PASS
PIF1	80119	broad.mit.edu	37	15	65108479	65108479	+	3'UTR	SNP	T	C	C	rs8036568	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65108479T>C	uc002ant.2	-	13					PIF1_uc002anr.2_3'UTR|PIF1_uc002ans.2_3'UTR|PIF1_uc010uiq.1_3'UTR	NM_025049	NP_079325	Q9H611	PIF1_HUMAN	DNA helicase homolog PIF1						negative regulation of telomerase activity|regulation of telomere maintenance|viral genome replication	nuclear chromosome, telomeric region	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' DNA/RNA helicase activity|magnesium ion binding|single-stranded DNA-dependent ATP-dependent DNA helicase activity|telomeric DNA binding				0						CCCTTTGTCTTCTCTTTGTGG	0.592													9	66	---	---	---	---	PASS
CCDC33	80125	broad.mit.edu	37	15	74628249	74628249	+	Intron	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74628249C>T	uc002axo.2	+						CCDC33_uc002axp.2_Intron|CCDC33_uc002axq.2_3'UTR|CCDC33_uc002axr.2_3'UTR	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1								protein binding			ovary(3)|skin(2)	5						TCACGCACCCCGCTTTGCACA	0.597													4	20	---	---	---	---	PASS
EDC3	80153	broad.mit.edu	37	15	74948394	74948394	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74948394C>T	uc002ayn.2	-	7	988	c.500G>A	c.(499-501)AGG>AAG	p.R167K	EDC3_uc002ayo.2_Missense_Mutation_p.R167K|EDC3_uc002aym.2_Missense_Mutation_p.R167K	NM_001142443	NP_001135915	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	167					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1						ATTTGGGTGCCTGCTACTAGA	0.438													43	131	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2812813	2812813	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2812813C>T	uc002crk.2	+	11	2833	c.2284C>T	c.(2284-2286)CTC>TTC	p.L762F	SRRM2_uc002crj.1_Missense_Mutation_p.L666F|SRRM2_uc002crl.1_Missense_Mutation_p.L762F|SRRM2_uc010bsu.1_Missense_Mutation_p.L666F	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	762	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GAGCAGGTCTCTCTCTTCACC	0.483													6	49	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21053411	21053411	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21053411C>T	uc010vbe.1	-	32	4576	c.4576G>A	c.(4576-4578)GCT>ACT	p.A1526T		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1526	AAA 1 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	p.A1526T(1)		ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ATGAACACAGCGCAGGTTGGG	0.507													16	130	---	---	---	---	PASS
PLA2G15	23659	broad.mit.edu	37	16	68289313	68289313	+	Intron	SNP	C	A	A	rs8062085	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68289313C>A	uc002evr.2	+						PLA2G15_uc010vld.1_Intron|PLA2G15_uc010vle.1_Intron|PLA2G15_uc010vlf.1_Intron|PLA2G15_uc002evs.2_5'UTR	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase A2)						fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1						CCCTCCCTGACGTCTCGGGAG	0.637													5	31	---	---	---	---	PASS
MBTPS1	8720	broad.mit.edu	37	16	84135547	84135547	+	5'UTR	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84135547T>C	uc002fhi.2	-	2						NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1						cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						TCCCATGGCCTTTTGTGGTTC	0.408													2	0	---	---	---	---	PASS
ZNF469	84627	broad.mit.edu	37	16	88501034	88501034	+	Missense_Mutation	SNP	G	C	C	rs12598474	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88501034G>C	uc002fku.2	+	2	7072	c.7072G>C	c.(7072-7074)GGG>CGG	p.G2358R		NM_001127464	NP_001120936	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2358					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCCTGAGACCGGGCGCTCTGG	0.662													3	7	---	---	---	---	PASS
NTN1	9423	broad.mit.edu	37	17	9142994	9142994	+	Silent	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9142994G>A	uc002glw.3	+	7	1631	c.1524G>A	c.(1522-1524)GGG>GGA	p.G508G		NM_004822	NP_004813	O95631	NET1_HUMAN	netrin 1 precursor	508	NTR.				apoptosis|axon guidance		protein binding				0						ACAAGGCGGGGGACTGGTGGA	0.647													7	20	---	---	---	---	PASS
USP22	23326	broad.mit.edu	37	17	20922454	20922454	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20922454G>T	uc002gym.3	-	4	667	c.463C>A	c.(463-465)CTT>ATT	p.L155I	USP22_uc002gyn.3_Missense_Mutation_p.L143I|USP22_uc002gyl.3_Missense_Mutation_p.L50I	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	155					cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						AGCAGTTCAAGCTCCCGTTTG	0.488													93	344	---	---	---	---	PASS
TOB1	10140	broad.mit.edu	37	17	48941457	48941457	+	5'Flank	SNP	A	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48941457A>G	uc002isw.2	-						TOB1_uc010wmy.1_5'UTR|TOB1_uc010wmz.1_5'UTR|uc002isy.2_5'Flank	NM_005749	NP_005740	P50616	TOB1_HUMAN	transducer of ERBB2, 1						negative regulation of cell proliferation		SH3/SH2 adaptor activity			large_intestine(1)	1			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			AGTTTGTGGCAGAGAAACAAA	0.338													4	6	---	---	---	---	PASS
PSMD12	5718	broad.mit.edu	37	17	65341770	65341770	+	Intron	SNP	T	C	C	rs62086001	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65341770T>C	uc002jfy.2	-						PSMD12_uc002jga.2_Intron|PSMD12_uc002jfz.2_Intron|PSMD12_uc010det.1_3'UTR	NM_002816	NP_002807	O00232	PSD12_HUMAN	proteasome 26S non-ATPase subunit 12 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					aaaaaagaaGTATACACAGAA	0.159													17	200	---	---	---	---	PASS
BAIAP2	10458	broad.mit.edu	37	17	79084825	79084825	+	Intron	SNP	C	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79084825C>A	uc002jzg.2	+						BAIAP2_uc002jzd.2_Intron|BAIAP2_uc002jzf.2_Intron|BAIAP2_uc002jze.2_Intron|BAIAP2_uc010wuh.1_Intron|BAIAP2_uc002jzh.2_Intron|uc010dhy.2_3'UTR	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2						axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GCCCTCTGGCCTCAGTCACGC	0.647													7	25	---	---	---	---	PASS
CCDC57	284001	broad.mit.edu	37	17	80059566	80059566	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80059566T>C	uc002kdx.1	-	17	2777	c.2740A>G	c.(2740-2742)ATG>GTG	p.M914V		NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	915										ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			AGTCAGTCCATAATGTTGTAG	0.617													11	23	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	109401	109401	+	RNA	SNP	C	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:109401C>G	uc002kke.2	+	1		c.337C>G								Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		caactcttctctgtgctctgc	0.000													2	1	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14534912	14534912	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14534912T>C	uc010dln.2	-	4	1359	c.905A>G	c.(904-906)GAT>GGT	p.D302G	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	302										skin(3)	3						TCCATATCTATCAAGTGCATT	0.299													72	551	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50942653	50942653	+	Intron	SNP	C	T	T	rs2270951	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50942653C>T	uc002lfe.1	+						DCC_uc010xdr.1_Missense_Mutation_p.T887M|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ACTGGCGTGACGATTAATCTT	0.403													4	33	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7805951	7805951	+	3'UTR	SNP	A	T	T	rs11465413	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7805951A>T	uc002mht.2	-	7					CD209_uc010xju.1_3'UTR|CD209_uc010dvp.2_3'UTR|CD209_uc002mhr.2_3'UTR|CD209_uc002mhs.2_3'UTR|CD209_uc002mhu.2_3'UTR|CD209_uc010dvq.2_3'UTR|CD209_uc002mhq.2_3'UTR|CD209_uc002mhv.2_3'UTR|CD209_uc002mhx.2_3'UTR|CD209_uc002mhw.2_3'UTR|CD209_uc010dvr.2_3'UTR	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1						cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						GTGTTTGGAAAGGAGCAGTGC	0.448													13	131	---	---	---	---	PASS
GTPBP3	84705	broad.mit.edu	37	19	17452527	17452527	+	3'UTR	SNP	G	T	T	rs919333	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17452527G>T	uc010eas.2	+	9					GTPBP3_uc010xpo.1_3'UTR|GTPBP3_uc002ngh.3_3'UTR|GTPBP3_uc002ngg.3_3'UTR|GTPBP3_uc002ngi.3_3'UTR	NM_032620	NP_116009	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial) isoform V						tRNA modification	mitochondrion	GTP binding|GTPase activity			skin(1)	1						ATCCAGGGAAGTCGCACCCAA	0.577													5	44	---	---	---	---	PASS
LILRP2	79166	broad.mit.edu	37	19	55224785	55224785	+	RNA	SNP	G	A	A	rs2296370	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55224785G>A	uc002qgs.1	+	1		c.5185G>A			LILRP2_uc002qgt.1_RNA	NR_003061				Homo sapiens leukocyte immunoglobulin-like receptor pseudogene 2 (LILRP2), non-coding RNA.												0						TTGGCAATGAGTCTGATAGTC	0.502													3	10	---	---	---	---	PASS
KIR3DL2	3812	broad.mit.edu	37	19	55361905	55361905	+	5'UTR	SNP	G	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55361905G>C	uc002qho.3	+	1					KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc002qhn.1_Intron|KIR3DL2_uc010esh.2_5'UTR	NM_006737	NP_006728	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three						cellular defense response|regulation of immune response	integral to plasma membrane	receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0192)		GCTGGGGCGCGGCCTCCTGTC	0.612													49	17	---	---	---	---	PASS
ZNF584	201514	broad.mit.edu	37	19	58929020	58929020	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58929020G>C	uc002qsp.2	+	4	1587	c.1135G>C	c.(1135-1137)GAG>CAG	p.E379Q	ZNF584_uc010yia.1_RNA|ZNF584_uc002qsr.2_Missense_Mutation_p.E334Q|ZNF584_uc010yib.1_3'UTR	NM_173548	NP_775819	Q8IVC4	ZN584_HUMAN	zinc finger protein 584	379					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		CCACACTGAAGAGAGGTCTTA	0.507													25	53	---	---	---	---	PASS
TSHZ2	128553	broad.mit.edu	37	20	51872336	51872336	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872336C>T	uc002xwo.2	+	2	3295	c.2339C>T	c.(2338-2340)GCA>GTA	p.A780V		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	780					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			TCCTCGCAAGCACAATCTTGT	0.562													15	59	---	---	---	---	PASS
LIPI	149998	broad.mit.edu	37	21	15554165	15554165	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15554165C>A	uc002yjm.2	-	4	630	c.620G>T	c.(619-621)GGG>GTG	p.G207V	LIPI_uc010gkw.1_Missense_Mutation_p.G140V	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	186					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		GAACCTTGGCCCAGCAGGGTC	0.408													33	155	---	---	---	---	PASS
EWSR1	2130	broad.mit.edu	37	22	29695685	29695685	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29695685G>A	uc003aet.2	+	16	2103	c.1775G>A	c.(1774-1776)CGT>CAT	p.R592H	EWSR1_uc003aev.2_Missense_Mutation_p.R597H|EWSR1_uc003aew.2_Missense_Mutation_p.R536H|EWSR1_uc003aex.2_Missense_Mutation_p.R591H|EWSR1_uc003aey.2_Missense_Mutation_p.R387H|EWSR1_uc003aez.2_Missense_Mutation_p.R253H	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2	592	Arg/Gly/Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						AGAGGTGGCCGTGGTGGAGAC	0.657			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								22	66	---	---	---	---	PASS
SCUBE1	80274	broad.mit.edu	37	22	43654262	43654262	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43654262C>A	uc003bdt.1	-	6	778	c.690G>T	c.(688-690)CAG>CAT	p.Q230H	SCUBE1_uc003bdu.1_Missense_Mutation_p.Q230H	NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	230					adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				GGGCGTACTTCTGGTGGCAAC	0.612													6	17	---	---	---	---	PASS
RIBC2	26150	broad.mit.edu	37	22	45813560	45813560	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45813560G>A	uc011aqs.1	+	4	484	c.275G>A	c.(274-276)AGG>AAG	p.R92K		NM_015653	NP_056468	Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2	24											0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		AATCTCTGTAGGGCTATCAAT	0.453													13	55	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50885814	50885814	+	Silent	SNP	A	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50885814A>G	uc003blh.2	-	40	5715	c.5520T>C	c.(5518-5520)GCT>GCC	p.A1840A	SBF1_uc003ble.2_Silent_p.A304A|SBF1_uc003blf.2_Silent_p.A316A|SBF1_uc011arx.1_Silent_p.A1478A	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	1814	PH.				protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CAGGTGCCACAGCCTCCACCT	0.647													5	17	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32328302	32328302	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32328302G>C	uc004dda.1	-	42	6258	c.6014C>G	c.(6013-6015)ACT>AGT	p.T2005S	DMD_uc004dcw.2_Missense_Mutation_p.T661S|DMD_uc004dcx.2_Missense_Mutation_p.T664S|DMD_uc004dcz.2_Missense_Mutation_p.T1882S|DMD_uc004dcy.1_Missense_Mutation_p.T2001S|DMD_uc004ddb.1_Missense_Mutation_p.T1997S|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2005					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGAGACATGAGTGATTTCAGT	0.423													9	41	---	---	---	---	PASS
PHF16	9767	broad.mit.edu	37	X	46917619	46917619	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46917619A>T	uc004dgx.2	+	11	1663	c.1612A>T	c.(1612-1614)AGA>TGA	p.R538*	PHF16_uc004dgy.2_Nonsense_Mutation_p.R538*	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN	PHD finger protein 16	538					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0						CCCACCACCAAGAATTACCTT	0.423													120	69	---	---	---	---	PASS
TFE3	7030	broad.mit.edu	37	X	48887600	48887600	+	3'UTR	SNP	G	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48887600G>C	uc004dmb.3	-	10					TFE3_uc004dmc.3_3'UTR	NM_006521	NP_006512	P19532	TFE3_HUMAN	transcription factor E3						humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding		ASPSCR1/TFE3(161)|PRCC/TFE3(25)|SFPQ/TFE3(6)|NONO/TFE3(2)|CLTC/TFE3(2)	soft_tissue(120)|kidney(76)|central_nervous_system(1)	197						TGGGGGAAAAGGCGGGGCCTC	0.617			T	SFPQ|ASPSCR1|PRCC|NONO|CLTC	papillary renal|alveolar soft part sarcoma|renal								5	2	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53239756	53239756	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53239756C>T	uc004drz.2	-	12	2119	c.1586G>A	c.(1585-1587)GGT>GAT	p.G529D	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.G462D|KDM5C_uc004dsa.2_Missense_Mutation_p.G528D	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	529	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						CTTCGGCTCACCCCTGCACAA	0.532			N|F|S		clear cell renal carcinoma								95	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3765	3765	+	RNA	SNP	A	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3765A>G	uc004cos.3	+	2		c.2058A>G			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		CTACTATCAACATTACTAATA	0.453													16	8	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9554	9554	+	RNA	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9554G>A	uc011mfi.1	+	1		c.892G>A			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		GGAGGGCACTGGCCCCCAACA	0.488													30	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14973	14973	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14973G>A	uc004coy.2	+	1	213	c.138G>A	c.(136-138)TGG>TGA	p.W46*	uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		CGTAAATTATGGCTGAATCAT	0.483													6	38	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15519	15519	+	3'UTR	SNP	T	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15519T>C	uc004coy.2	+	1					uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		CAATTATACCCTAGCCAACCC	0.483											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	5	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	9221848	9221848	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9221848delG	uc009vmq.2	-											EF609116																		TCTGCTTTCAGAATCAAAGAC	0.473													4	2	---	---	---	---	
EPHB2	2048	broad.mit.edu	37	1	23109271	23109271	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23109271delA	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CACCAAAAAGAAAAAAAAAAA	0.458									Hereditary_Prostate_Cancer				5	3	---	---	---	---	
RHCE	6006	broad.mit.edu	37	1	25753904	25753904	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25753904delC	uc001bkj.2	-							NM_020485	NP_065231	P18577	RHCE_HUMAN	Rhesus blood group, CcEe antigens isoform 1							integral to plasma membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		tgtaaaatggCCACTGCTGAT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30031652	30031652	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30031652delT								PTPRU (378337 upstream) : None (None downstream)																							tgactgccgcttttcagacgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	44617374	44617374	+	IGR	DEL	A	-	-	rs803381	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44617374delA								KLF17 (16567 upstream) : DMAP1 (61751 downstream)																							CAGTGTATATATTTTTTTTTT	0.383													3	3	---	---	---	---	
CLCA1	1179	broad.mit.edu	37	1	86942477	86942478	+	Intron	INS	-	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86942477_86942478insT	uc001dlt.2	+						CLCA1_uc001dls.1_Intron	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor						calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TTTTTTTTAACTGTACCAACTA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116745752	116745752	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116745752delC								C1orf161 (67891 upstream) : ATP1A1 (169252 downstream)																							GCAGTGCTCTCCCCATCTCTT	0.418													4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145038687	145038687	+	Intron	DEL	G	-	-	rs67176560		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145038687delG	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		tcaactaaaagcacccaagtc	0.204			T	PDGFRB	MPD								3	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145041680	145041681	+	Intron	DEL	AA	-	-	rs10544872		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145041680_145041681delAA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_5'Flank|PDE4DIP_uc001eln.3_5'Flank|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_5'Flank|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						AAAAATACAGAAAGTTATATAG	0.272													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149227701	149227702	+	IGR	INS	-	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149227701_149227702insA								LOC645166 (274647 upstream) : LOC388692 (51774 downstream)																							gaaagctttttaaaaagaaagg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161362928	161362928	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161362928delC								C1orf192 (25264 upstream) : FCGR2A (112277 downstream)																							cactttgtagcccctcagcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	162526849	162526849	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162526849delT								UHMK1 (33005 upstream) : UAP1 (4447 downstream)																							GTCTTTTTCATTAAGGAGGCA	0.353													4	2	---	---	---	---	
NCF2	4688	broad.mit.edu	37	1	183559708	183559709	+	5'UTR	DEL	AG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183559708_183559709delAG	uc001gqj.3	-	1					NCF2_uc010pod.1_5'UTR|NCF2_uc010poe.1_5'UTR|NCF2_uc001gqk.3_Intron	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2						cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						ggaaagaagcagagagagagag	0.307													4	2	---	---	---	---	
ZC3H11A	9877	broad.mit.edu	37	1	203775437	203775437	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203775437delT	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_5'Flank	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ttctttttccttttttttttt	0.194													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221307067	221307068	+	IGR	INS	-	A	A	rs140242409	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221307067_221307068insA								HLX (248669 upstream) : LOC400804 (196202 downstream)																							TAAGATCTATTAAAAAAAAAAT	0.317													4	2	---	---	---	---	
CNIH3	149111	broad.mit.edu	37	1	224840078	224840078	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224840078delT	uc001hos.1	+							NM_152495	NP_689708	Q8TBE1	CNIH3_HUMAN	cornichon homolog 3						intracellular signal transduction|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic shaft|postsynaptic membrane					0	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		AGCTAACAGGTTTGATGAGTT	0.493											OREG0014282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ROCK2	9475	broad.mit.edu	37	2	11341904	11341905	+	Intron	INS	-	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11341904_11341905insC	uc002rbd.1	-							NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		AAAACTGATCTCAAAAAAAGCA	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41997231	41997231	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41997231delA								None (None upstream) : PKDCC (277930 downstream)																							atattttactaaaaattcttt	0.045													4	2	---	---	---	---	
ABCG5	64240	broad.mit.edu	37	2	44043050	44043052	+	Intron	DEL	AAA	-	-	rs78379142		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44043050_44043052delAAA	uc002rtn.2	-						ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Intron|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ACAGGAAAAGAAAAAAAAAAAAA	0.419													4	2	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	46218503	46218503	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46218503delT	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			aggacagagatttttttttgt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	61052035	61052035	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61052035delG								PAPOLG (25939 upstream) : REL (56717 downstream)																							AGAACCACCTGGGGGGACAGG	0.343													4	2	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	87204958	87204958	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87204958delT	uc010fgv.2	+						RMND5A_uc002srs.3_Intron|RGPD1_uc002ssb.2_Intron|RGPD1_uc002ssc.2_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						Gttatttttattttttttttt	0.318													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	88525141	88525142	+	IGR	INS	-	GAAAT	GAAAT			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88525141_88525142insGAAAT								THNSL2 (38996 upstream) : FOXI3 (222584 downstream)																							ttaaaacaagagaaatgtattc	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91694607	91694610	+	IGR	DEL	GTGT	-	-	rs111250694		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91694607_91694610delGTGT								None (None upstream) : LOC654342 (110582 downstream)																							gtgtgtgtacgtgtgtgtgtgtgt	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91792896	91792897	+	IGR	INS	-	G	G	rs146949792		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91792896_91792897insG								None (None upstream) : LOC654342 (12295 downstream)																							ACTTGAAAGCTttatgaactga	0.287													3	5	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100052594	100052595	+	Intron	INS	-	GTTT	GTTT	rs145209140	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100052594_100052595insGTTT	uc002tad.2	-						REV1_uc002tac.2_Intron	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						GTCTCTAATTAGTCAAAAAGTG	0.292								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102603749	102603750	+	IGR	DEL	GA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102603749_102603750delGA								MAP4K4 (92598 upstream) : IL1R2 (4556 downstream)																							TGGTGACGCTGAGGTTTTATCT	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113851015	113851015	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113851015delG								IL1F10 (17590 upstream) : IL1RN (5922 downstream)																							CACCATATCTGGGGACAGTGC	0.383													4	2	---	---	---	---	
MGAT5	4249	broad.mit.edu	37	2	135174046	135174046	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135174046delT	uc002ttv.1	+							NM_002410	NP_002401	Q09328	MGT5A_HUMAN	N-acetylglucosaminyltransferase V						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)		cattccttACttttttttttt	0.005													4	2	---	---	---	---	
GPR155	151556	broad.mit.edu	37	2	175310077	175310079	+	Intron	DEL	CTC	-	-	rs71407117		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175310077_175310079delCTC	uc002uit.2	-						GPR155_uc002uiu.2_Intron|GPR155_uc002uiv.2_Intron|GPR155_uc010fqs.2_Intron	NM_001033045	NP_001028217	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155 isoform 9						intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1						GTTTCAACCTCTCCTCCTGACAG	0.335													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177941254	177941254	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177941254delC								MIR1246 (475474 upstream) : HNRNPA3 (136168 downstream)																							TTTCAAGAAGCCCAGGGTAAG	0.458													4	2	---	---	---	---	
NBEAL1	65065	broad.mit.edu	37	2	203980489	203980489	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203980489delA	uc002uzt.3	+							NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3								binding			ovary(1)|skin(1)	2						AATACTATATAAAAAAAATTT	0.204													4	2	---	---	---	---	
SPAG16	79582	broad.mit.edu	37	2	214605998	214605998	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214605998delT	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		tacattattgttattatttcc	0.070													4	2	---	---	---	---	
BARD1	580	broad.mit.edu	37	2	215615072	215615072	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215615072delA	uc002veu.2	-						BARD1_uc010zjm.1_Intron	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1						cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TATTAAGTCTAAACTCGTATC	0.284									Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				4	2	---	---	---	---	
IQCA1	79781	broad.mit.edu	37	2	237316422	237316422	+	Intron	DEL	T	-	-	rs113217981		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237316422delT	uc002vvz.1	-						IQCA1_uc002vwb.2_Intron|IQCA1_uc002vwa.1_Intron|IQCA1_uc010zni.1_Intron	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1								ATP binding			ovary(1)	1						TCACTCCTCATTTTTTTTTTT	0.428													10	5	---	---	---	---	
SATB1	6304	broad.mit.edu	37	3	18478919	18478919	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18478919delT	uc003cbj.2	-							NM_001131010	NP_001124482	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1						cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						TTCTAAAAGATTTTTTTTAAA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	27618282	27618282	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27618282delT								SLC4A7 (92444 upstream) : EOMES (139606 downstream)																							CTCTCttttatttttttgaga	0.214													4	2	---	---	---	---	
EOMES	8320	broad.mit.edu	37	3	27760547	27760548	+	Intron	DEL	CT	-	-	rs60539964		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27760547_27760548delCT	uc003cdx.2	-						EOMES_uc003cdy.3_Intron|EOMES_uc010hfn.2_Intron|EOMES_uc011axc.1_Intron	NM_005442	NP_005433	O95936	EOMES_HUMAN	eomesodermin						CD8-positive, alpha-beta T cell differentiation involved in immune response|cell differentiation involved in embryonic placenta development|endoderm formation|mesoderm formation|mesodermal to mesenchymal transition involved in gastrulation|positive regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|breast(1)	4						TGCCCCCCCCCTTTTTTTTTGA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	36972527	36972528	+	IGR	DEL	AT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36972527_36972528delAT								TRANK1 (70116 upstream) : EPM2AIP1 (54830 downstream)																							acattcagcaatacctaacaaa	0.089													4	2	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47139504	47139505	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47139504_47139505delCT	uc003cqs.2	-	9	5135_5136	c.5082_5083delAG	c.(5080-5085)AGAGTCfs	p.R1694fs	SETD2_uc003cqv.2_Frame_Shift_Del_p.R1761fs	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1694_1695					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTGATGCTGACTCTGTTTTCTC	0.416			N|F|S|Mis		clear cell renal carcinoma								90	42	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	69011622	69011622	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69011622delT								FAM19A4 (29911 upstream) : C3orf64 (12747 downstream)																							TTTCTCTCCCTTTTTCGGAGT	0.398													4	2	---	---	---	---	
GAP43	2596	broad.mit.edu	37	3	115431937	115431938	+	Intron	INS	-	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115431937_115431938insT	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		TCCAGGCTCCAGATGGACATCT	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116545909	116545909	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116545909delT								LOC285194 (110024 upstream) : None (None downstream)																							agtgggtatctttttttttct	0.000													4	2	---	---	---	---	
EEFSEC	60678	broad.mit.edu	37	3	128104825	128104825	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128104825delC	uc003eki.2	+						EEFSEC_uc003ekj.2_Intron	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,							cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						CACAAATAAGCCCCCAAAGAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	132108054	132108054	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132108054delT								ACPP (20910 upstream) : DNAJC13 (28499 downstream)																							GTAAGAAAAATTTTTTTTTGT	0.269													5	3	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134869022	134869025	+	Intron	DEL	TAAA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134869022_134869025delTAAA	uc003eqt.2	+						EPHB1_uc003equ.2_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TTCCATTTTTTAAATACATGATGT	0.407													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143315186	143315187	+	Intron	DEL	AC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143315186_143315187delAC	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						acagagagatacacacacCTGG	0.307													4	2	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	169119863	169119863	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169119863delG	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						GCTTAAAAAAGGGGCTGTGAT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	169803605	169803605	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169803605delA								GPR160 (424 upstream) : PHC3 (1763 downstream)																							tagacacaataaaaaatgtct	0.080													4	2	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184653836	184653836	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184653836delT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc010hye.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GAAATTTTGATTTTTTTTTTT	0.343													5	3	---	---	---	---	
IGF2BP2	10644	broad.mit.edu	37	3	185394003	185394003	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185394003delA	uc003fpo.2	-						IGF2BP2_uc010hyi.2_Intron|IGF2BP2_uc010hyj.2_Intron|IGF2BP2_uc010hyk.2_Intron|IGF2BP2_uc010hyl.2_Intron|IGF2BP2_uc003fpp.2_Intron|IGF2BP2_uc003fpq.2_Intron	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			ccttgctcttaaaaaaaggta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186620987	186620987	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186620987delT								ADIPOQ (44737 upstream) : ST6GAL1 (27529 downstream)																							atctcctcactttttatctgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187057778	187057778	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187057778delA								MASP1 (48026 upstream) : RTP4 (28390 downstream)																							TGCCAGAGTCAAAGGATTCCA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	43796	43797	+	IGR	INS	-	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43796_43797insA								None (None upstream) : ZNF595 (9430 downstream)																							CTTCAATACTGAAAAAAAAAAT	0.366													7	4	---	---	---	---	
NOP14	8602	broad.mit.edu	37	4	2952613	2952616	+	Intron	DEL	GAGT	-	-	rs3832272		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2952613_2952616delGAGT	uc003ggj.1	-						C4orf10_uc003ggh.2_RNA|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						cagagagagagagtgagaaagaga	0.245													4	2	---	---	---	---	
NCAPG	64151	broad.mit.edu	37	4	17826411	17826415	+	Intron	DEL	TTGTT	-	-	rs3217048		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17826411_17826415delTTGTT	uc003gpp.2	+						NCAPG_uc011bxj.1_Intron	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		GTCAGATATATTGTTTTGTTTTGTT	0.293													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	18710015	18710015	+	IGR	DEL	T	-	-	rs74416709	byFrequency	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18710015delT								LCORL (686630 upstream) : None (None downstream)																							gccacatccctagcactctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26050686	26050687	+	IGR	INS	-	A	A	rs138206723	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26050686_26050687insA								C4orf52 (119186 upstream) : RBPJ (270645 downstream)																							CGAGATGAAGGAATGAAGCAAA	0.426													3	3	---	---	---	---	
NFXL1	152518	broad.mit.edu	37	4	47880243	47880246	+	Intron	DEL	AGAT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47880243_47880246delAGAT	uc010igh.2	-						NFXL1_uc003gxo.2_Intron|NFXL1_uc003gxp.2_Intron|NFXL1_uc003gxq.3_Intron|NFXL1_uc010igi.2_Intron	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CTATCTAAGAAGATACATAACCTA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49133800	49133800	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49133800delT								CWH43 (69707 upstream) : None (None downstream)																							attccattcgtttccattcca	0.000													4	2	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54661414	54661414	+	Intron	DEL	A	-	-	rs144145123		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54661414delA	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	AAAAAGCTACAAAAAAAAATT	0.294			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			5	3	---	---	---	---	
KIAA1211	57482	broad.mit.edu	37	4	57146813	57146813	+	Intron	DEL	T	-	-	rs78978021		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57146813delT	uc003hbk.2	+						KIAA1211_uc010iha.2_Intron	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					aatgaatGCATTGATTACTGC	0.224													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	75766417	75766417	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75766417delC								BTC (46535 upstream) : PARM1 (91881 downstream)																							TCCAAGCTTTCTGAGAATGTA	0.453													4	2	---	---	---	---	
ARHGAP24	83478	broad.mit.edu	37	4	86491532	86491532	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86491532delT	uc003hpk.2	+						ARHGAP24_uc003hpi.1_Intron|ARHGAP24_uc003hpj.2_Intron	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		tctttctttctttctttcttt	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	109133857	109133858	+	IGR	INS	-	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109133857_109133858insT								LEF1 (44279 upstream) : LOC285456 (325488 downstream)																							TTCTTTTACTATTTTTTTTTCT	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	155441029	155441032	+	IGR	DEL	TGTT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155441029_155441032delTGTT								DCHS2 (28099 upstream) : PLRG1 (16631 downstream)																							CCAAGCGTGCTGTTTGAATAAATA	0.422													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	157305313	157305313	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157305313delC								CTSO (430265 upstream) : PDGFC (377451 downstream)																							CATATACCGACCCACAAACCT	0.313													4	2	---	---	---	---	
CLCN3	1182	broad.mit.edu	37	4	170633519	170633520	+	Intron	INS	-	T	T	rs142199490	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170633519_170633520insT	uc003isi.2	+						CLCN3_uc003ish.2_Intron|CLCN3_uc011cjz.1_Intron|CLCN3_uc011cka.1_Intron|CLCN3_uc003isj.1_Intron	NM_001829	NP_001820	P51790	CLCN3_HUMAN	chloride channel 3 isoform b						endosomal lumen acidification	cell surface|early endosome membrane|Golgi membrane|integral to membrane|late endosome membrane|transport vesicle membrane	antiporter activity|ATP binding|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|voltage-gated chloride channel activity			breast(2)|ovary(1)	3		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TTTCATTCAGATTTTTTTTTTA	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	188284171	188284172	+	IGR	DEL	CA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188284171_188284172delCA								FAT1 (636321 upstream) : ZFP42 (632753 downstream)																							gacacccaggcacacacacaca	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	5678563	5678564	+	IGR	DEL	GT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5678563_5678564delGT								KIAA0947 (188226 upstream) : FLJ33360 (631990 downstream)																							ggtgtaagtggtgtgtgtgtgt	0.347													4	2	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13844041	13844042	+	Intron	INS	-	T	T	rs142837720	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13844041_13844042insT	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCTCTTGAGTGTAGTACATAAA	0.351									Kartagener_syndrome				4	2	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35184782	35184782	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35184782delA	uc003jjm.2	-							NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CCTGTTTCTTATCCTCTTCCC	0.458													4	2	---	---	---	---	
CCDC152	100129792	broad.mit.edu	37	5	42779822	42779822	+	Intron	DEL	T	-	-	rs33987951		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42779822delT	uc003jmx.3	+						CCDC152_uc011cpr.1_Intron	NM_001134848	NP_001128320	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152												0						GTTTTAAGAGTTTTTTTTTTT	0.264													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44081565	44081565	+	IGR	DEL	A	-	-	rs11362852		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44081565delA								NNT (375898 upstream) : FGF10 (223532 downstream)																							gttatctgggaaaaaaaaaat	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44533647	44533648	+	IGR	INS	-	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44533647_44533648insA								FGF10 (144863 upstream) : MRPS30 (275379 downstream)																							CATTCCTGCCCAAAAATACTTT	0.391													4	2	---	---	---	---	
GPX8	493869	broad.mit.edu	37	5	54460229	54460230	+	3'UTR	INS	-	T	T	rs77476120		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54460229_54460230insT	uc003jpq.2	+	3					CDC20B_uc003jpn.1_Intron|CDC20B_uc010ivu.1_Intron|CDC20B_uc003jpo.1_Intron|CDC20B_uc010ivv.1_Intron|CDC20B_uc003jpp.2_Intron|GPX8_uc003jpr.2_3'UTR|GPX8_uc003jps.2_RNA|GPX8_uc003jpt.2_3'UTR	NM_001008397	NP_001008398	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8						response to oxidative stress	integral to membrane	glutathione peroxidase activity				0					Glutathione(DB00143)	GCAATGAAGGATTTTTTTTTAA	0.213													4	2	---	---	---	---	
PIK3R1	5295	broad.mit.edu	37	5	67586995	67586995	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67586995delG	uc003jva.2	+						PIK3R1_uc003jvb.2_Intron|PIK3R1_uc003jvc.2_Intron|PIK3R1_uc003jvd.2_Intron|PIK3R1_uc003jve.2_5'UTR|PIK3R1_uc011crb.1_5'Flank	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TGCATCTTTTGTGCTGCTTTT	0.393			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			4	2	---	---	---	---	
POC5	134359	broad.mit.edu	37	5	74974018	74974018	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74974018delT	uc003keh.3	-						POC5_uc010izu.2_Intron|POC5_uc003keg.3_Intron	NM_001099271	NP_001092741	Q8NA72	POC5_HUMAN	proteome of centriole 5 isoform 1						cell cycle	centriole				lung(1)	1						AAAAACCaacttttttttttt	0.159													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	75140253	75140253	+	IGR	DEL	A	-	-	rs71600472		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75140253delA								POC5 (126940 upstream) : SV2C (239052 downstream)																							cagaaacaggaaaaaaaaaaa	0.025													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	114847649	114847649	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114847649delA								CCDC112 (215191 upstream) : FEM1C (8959 downstream)																							agaacatgagaaaaaaaaaga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	121914401	121914401	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121914401delG								SNCAIP (114607 upstream) : SNX2 (196349 downstream)																							atgatgtggtgggcactaact	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122977699	122977700	+	IGR	DEL	GA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122977699_122977700delGA								CSNK1G3 (25237 upstream) : ZNF608 (994910 downstream)																							tgaattgcttgaattctctatt	0.045													4	2	---	---	---	---	
CDC42SE2	56990	broad.mit.edu	37	5	130651112	130651112	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130651112delA	uc003kvh.2	+						CDC42SE2_uc003kvi.2_Intron|CDC42SE2_uc003kvj.2_Intron|CDC42SE2_uc003kvk.2_Intron|CDC42SE2_uc003kvl.2_5'Flank	NM_020240	NP_064625	Q9NRR3	C42S2_HUMAN	CDC42 small effector 2						phagocytosis|regulation of cell shape|regulation of signal transduction	cell projection|cytoplasm|cytoskeleton|phagocytic cup	protein binding|structural molecule activity				0		all_cancers(142;0.0525)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGAAATACGTAGcagagtttg	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	131888277	131888277	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131888277delT								IL5 (9063 upstream) : RAD50 (3434 downstream)																							GGcatgtccatttttttcctt	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135754936	135754937	+	IGR	INS	-	A	A	rs150290072		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135754936_135754937insA								TRPC7 (61863 upstream) : SPOCK1 (556051 downstream)																							ggtctgtctccaaaaaaaaaaa	0.198													6	4	---	---	---	---	
JAKMIP2	9832	broad.mit.edu	37	5	146993362	146993362	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146993362delA	uc003loq.1	-						JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Intron|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Intron	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein							Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTTAAAGTAAGGGGGCTAA	0.219													4	2	---	---	---	---	
HTR4	3360	broad.mit.edu	37	5	148016893	148016893	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148016893delC	uc003lpn.2	-						HTR4_uc010jgu.1_5'Flank|HTR4_uc003lpi.1_Intron|HTR4_uc003lpj.1_Intron|HTR4_uc003lpk.2_Intron|HTR4_uc011dby.1_5'Flank|HTR4_uc003lpl.2_Intron|HTR4_uc003lpm.2_Intron|HTR4_uc010jgv.2_Intron|HTR4_uc003lpo.1_Intron|SH3TC2_uc003lpp.1_Intron|HTR4_uc003lpq.1_Intron	NM_000870	NP_000861	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform b						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	TATTTATGTTCTTTCCAGAAA	0.333													4	2	---	---	---	---	
PCYOX1L	78991	broad.mit.edu	37	5	148744106	148744107	+	Intron	INS	-	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148744106_148744107insC	uc003lqk.2	+						PCYOX1L_uc003lql.2_Intron|PCYOX1L_uc010jgz.2_Intron|PCYOX1L_uc003lqm.2_Intron|PCYOX1L_uc003lqn.2_Intron	NM_024028	NP_076933	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like precursor						prenylcysteine catabolic process	extracellular region	oxidoreductase activity, acting on a sulfur group of donors, oxygen as acceptor			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gcagaacaaggccccctctgaa	0.020													5	3	---	---	---	---	
GLRA1	2741	broad.mit.edu	37	5	151202681	151202681	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151202681delG	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TTGGCTGGCTGGGGAGTTCTG	0.408													4	2	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155305405	155305405	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155305405delC	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			aaagcagcagcccagacagtg	0.000													4	2	---	---	---	---	
GABRA1	2554	broad.mit.edu	37	5	161277112	161277113	+	Intron	INS	-	GG	GG	rs61241552		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161277112_161277113insGG	uc010jiw.2	+						GABRA1_uc010jix.2_Intron|GABRA1_uc010jiy.2_Intron|GABRA1_uc003lyx.3_Intron|GABRA1_uc010jiz.2_Intron|GABRA1_uc010jja.2_5'Flank|GABRA1_uc010jjb.2_5'Flank	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	tgtgtgtgtgtggtttgtatgt	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172816631	172816631	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172816631delT								STC2 (60125 upstream) : LOC285593 (190015 downstream)																							gtcctcatcattttttttttg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175336278	175336278	+	IGR	DEL	T	-	-	rs67243038		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175336278delT								CPLX2 (25255 upstream) : THOC3 (50258 downstream)																							ggctcccccctcttgccagcc	0.000													5	3	---	---	---	---	
NEDD9	4739	broad.mit.edu	37	6	11324453	11324453	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11324453delC	uc010joz.2	-						NEDD9_uc003mzw.3_Intron	NM_001142393	NP_001135865	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			TCTTAGTTAACCAGTAATCTG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18581422	18581422	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18581422delT	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																		GCTTCATGACTTTTTACTTAG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	24056241	24056241	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24056241delT								None (None upstream) : NRSN1 (70173 downstream)																							CTGATCTCTCTTTTTTGCAGC	0.303													4	2	---	---	---	---	
ZFAND3	60685	broad.mit.edu	37	6	38058968	38058969	+	Intron	DEL	TG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38058968_38058969delTG	uc003onx.2	+							NM_021943	NP_068762	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1						CTTTTGGAGATGTGTGTGTGTA	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	44534706	44534706	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44534706delG								CDC5L (119927 upstream) : SUPT3H (242348 downstream)																							CTGTGGGAGAGGGAGGAgaag	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	44571809	44571809	+	IGR	DEL	T	-	-	rs146730105		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44571809delT								CDC5L (157030 upstream) : SUPT3H (205245 downstream)																							TGCTCTCCAGTTGACGAAGGA	0.493													2	4	---	---	---	---	
CD2AP	23607	broad.mit.edu	37	6	47549466	47549466	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47549466delC	uc003oyw.2	+							NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein						cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			AGAATGTTTTCATCACCACAG	0.139													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57327750	57327751	+	Intron	INS	-	A	A	rs144521501	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57327750_57327751insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TGAGAGCTGTTAAACAAATGTA	0.351													4	2	---	---	---	---	
ELOVL4	6785	broad.mit.edu	37	6	80631176	80631177	+	Intron	INS	-	A	A	rs35137040		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80631176_80631177insA	uc003pja.3	-						ELOVL4_uc011dyt.1_Intron	NM_022726	NP_073563	Q9GZR5	ELOV4_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups			ovary(1)|skin(1)	2		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	gactccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88782032	88782032	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88782032delG								SPACA1 (5483 upstream) : CNR1 (67555 downstream)																							ggttgttgctggtgaaaatct	0.000													4	2	---	---	---	---	
MED23	9439	broad.mit.edu	37	6	131915559	131915559	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131915559delT	uc003qcs.1	-						MED23_uc003qcq.2_Intron|MED23_uc003qcr.1_5'Flank|MED23_uc011eca.1_Intron	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		TCCAGATAACTGAAAAACAGC	0.358													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152615470	152615470	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152615470delA	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kiy.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATTTTGGTTTATATATATCAA	0.289										HNSCC(10;0.0054)			4	2	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162724646	162724646	+	Intron	DEL	A	-	-	rs67760132		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162724646delA	uc003qtx.3	-						PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		AGGAAGCTGTAAAAAAAAATT	0.244													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	400424	400424	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:400424delC								FAM20C (99713 upstream) : PDGFA (136475 downstream)																							CAAAACTGAACCCCCAGCGAT	0.587													4	2	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4276473	4276474	+	Intron	DEL	GA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4276473_4276474delGA	uc003smx.2	+						SDK1_uc010kso.2_Intron|SDK1_uc003smy.2_Intron|SDK1_uc003smz.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCAGCACCAGGAGAGAGAAGGA	0.450													4	2	---	---	---	---	
TMEM195	392636	broad.mit.edu	37	7	15430712	15430713	+	Intron	DEL	TC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15430712_15430713delTC	uc003stb.1	-							NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						TTTTTATTTTTCAATTAATTAT	0.252													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25329415	25329415	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25329415delT								NPVF (61310 upstream) : MIR148A (660124 downstream)																							ACACTGCCAATTTTTTTCTCA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	26095892	26095893	+	IGR	DEL	CA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26095892_26095893delCA								MIR148A (106286 upstream) : NFE2L3 (95954 downstream)																							AGCTCCTCCCCACACACACAgc	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27501284	27501284	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27501284delA								EVX1 (215092 upstream) : HIBADH (63779 downstream)																							tcatctgtacaaaaaaaaatt	0.214													3	3	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34076216	34076217	+	Intron	INS	-	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34076216_34076217insG	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						CACACAATCTAGGGGTGCAAAT	0.530													4	2	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34174874	34174875	+	Intron	DEL	GA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34174874_34174875delGA	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						TTTTGTTCTTGACAAGCCGGGA	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53842071	53842071	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53842071delC								POM121L12 (737454 upstream) : HPVC1 (426846 downstream)																							CATTGACCAGCCTTCCTTTTG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55714741	55714741	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55714741delT								LOC442308 (99 upstream) : FKBP9L (34027 downstream)																							TTGCTGCCTCTTTTTTTTTTT	0.353													3	4	---	---	---	---	
SPDYE7P	441251	broad.mit.edu	37	7	72339826	72339826	+	5'Flank	DEL	G	-	-	rs237936	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72339826delG	uc010lal.1	-							NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0						TCTTTTTTttgttgttgttgt	0.254													3	3	---	---	---	---	
EIF4H	7458	broad.mit.edu	37	7	73601779	73601779	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73601779delT	uc003uad.1	+						RFC2_uc011kfa.1_Intron|EIF4H_uc011kfg.1_Intron|EIF4H_uc010lbm.2_Intron|EIF4H_uc003uae.1_Intron|EIF4H_uc003uaf.1_Intron	NM_022170	NP_071496	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H						interspecies interaction between organisms|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0						TTTCTTTTCCTTTTTTTTTGT	0.289													5	4	---	---	---	---	
STAG3L1	54441	broad.mit.edu	37	7	74991540	74991541	+	Intron	DEL	TT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74991540_74991541delTT	uc003ucu.1	+						STAG3L1_uc010lcz.1_Intron|STAG3L1_uc003ucv.1_Intron|STAG3L1_uc011kfw.1_Intron|STAG3L1_uc011kfx.1_Intron	NM_018991	NP_061864	P0CL83	ST3L1_HUMAN	stromal antigen 3-like 1 isoform 1							nucleus	binding				0						GAGCATGttctttttttttttt	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96561134	96561135	+	IGR	INS	-	T	T	rs150522897	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96561134_96561135insT								SHFM1 (221931 upstream) : DLX6AS (36693 downstream)																							GCAACGCTGCCTCCAGCCTCAG	0.505													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	101977386	101977386	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101977386delA								SH2B2 (15209 upstream) : SPDYE6 (8807 downstream)																							gcctATGGACAAAAAAAAAAA	0.154													2	4	---	---	---	---	
KCND2	3751	broad.mit.edu	37	7	119958302	119958302	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119958302delG	uc003vjj.1	+							NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related						regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					GTGTTGGGTTGACTACAAATA	0.244													4	2	---	---	---	---	
MGAM	8972	broad.mit.edu	37	7	141730864	141730864	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141730864delC	uc003vwy.2	+							NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase						polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	cccctcacttccctgataccg	0.000													4	2	---	---	---	---	
AGAP3	116988	broad.mit.edu	37	7	150782232	150782233	+	5'Flank	DEL	TT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150782232_150782233delTT	uc003wjg.1	+						TMUB1_uc003wjb.2_5'Flank|TMUB1_uc003wjc.2_5'Flank|TMUB1_uc003wjd.2_5'Flank|AGAP3_uc003wje.1_5'Flank|AGAP3_uc003wjf.1_5'Flank|AGAP3_uc010lpy.1_5'Flank	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						TGGATGTTACTTTTAGAATTAT	0.401													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152127453	152127453	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152127453delA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AACAATATAGAAAAAAAAAAG	0.303			N		medulloblastoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155949110	155949111	+	IGR	INS	-	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155949110_155949111insC								SHH (344143 upstream) : C7orf4 (384074 downstream)																							CCTTCCAGGGGCAGCCATGCCG	0.545													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158045296	158045296	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158045296delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GGTAGGAAGGCCCCACCACCC	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1245698	1245699	+	IGR	INS	-	GA	GA	rs72193420		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1245698_1245699insGA								ERICH1 (564472 upstream) : DLGAP2 (203870 downstream)																							AGACACCACGCGAGACGGAGGA	0.520													4	2	---	---	---	---	
HMBOX1	79618	broad.mit.edu	37	8	28821076	28821076	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28821076delA	uc003xhd.3	+						HMBOX1_uc010lvd.2_Intron|HMBOX1_uc003xhc.3_Intron|HMBOX1_uc010lve.2_Intron|HMBOX1_uc003xhe.2_Intron|HMBOX1_uc011lay.1_5'Flank	NM_001135726	NP_001129198	Q6NT76	HMBX1_HUMAN	homeobox containing 1						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		TTAACCAGCTAATAAGTTGTC	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	28913942	28913942	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28913942delT								HMBOX1 (3702 upstream) : KIF13B (10854 downstream)																							CTGTTCTCCATTCCACTTATA	0.403													4	2	---	---	---	---	
KIF13B	23303	broad.mit.edu	37	8	28929891	28929891	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28929891delG	uc003xhh.3	-						KIF13B_uc011laz.1_Intron	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CACGAACCAAGCAGGCAGCTT	0.373													4	2	---	---	---	---	
PLAT	5327	broad.mit.edu	37	8	42045707	42045707	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42045707delA	uc003xos.2	-						PLAT_uc010lxf.1_Intron|PLAT_uc010lxg.1_Intron|PLAT_uc003xot.2_Intron|PLAT_uc011lcm.1_Intron|PLAT_uc011lcn.1_Intron	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1						blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	cctttggttgaaaaaaatcca	0.065													4	2	---	---	---	---	
RP1	6101	broad.mit.edu	37	8	55609089	55609089	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55609089delA	uc011ldy.1	+									P56715	RP1_HUMAN	SubName: Full=cDNA, FLJ79410, moderately similar to Oxygen-regulated protein 1;						axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGAGGAAAGGAAAAGGGCTCA	0.468													4	2	---	---	---	---	
XKR4	114786	broad.mit.edu	37	8	56030998	56030999	+	Intron	DEL	TC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56030998_56030999delTC	uc003xsf.2	+							NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			GTCAGTCACATCTCTCTCTCTC	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56591150	56591150	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56591150delC								XKR4 (152442 upstream) : TMEM68 (60170 downstream)																							AAAAACAGAGCAGGACAAGCT	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66057884	66057884	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66057884delA								CYP7B1 (346536 upstream) : ARMC1 (457188 downstream)																							TCTGAAAATTAAAAAAATAAA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84331365	84331365	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84331365delA								None (None upstream) : RALYL (764088 downstream)																							CTCTTGCTTGAAAAAATGTGT	0.383													4	2	---	---	---	---	
LRRC69	100130742	broad.mit.edu	37	8	92231447	92231447	+	3'UTR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92231447delA	uc010mal.1	+	8					SLC26A7_uc003yex.2_Intron|SLC26A7_uc003yey.2_Intron|LRRC69_uc003yev.1_3'UTR|LRRC69_uc003yew.1_3'UTR	NM_001129890	NP_001123362	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69												0						AAAAAAGTACAAAAAAAAATT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	94486378	94486378	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94486378delG								C8orf83 (456477 upstream) : FAM92A1 (226395 downstream)																							CACAAAGGAAGAAAATCAGGG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	97651335	97651335	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97651335delT								SDC2 (27298 upstream) : PGCP (6164 downstream)																							GATACGGCCCTTTTTTCAAAT	0.433													4	2	---	---	---	---	
GRHL2	79977	broad.mit.edu	37	8	102589410	102589410	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102589410delT	uc010mbu.2	+							NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3							cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			TGTAGGACTCTTTTTTTTTTC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126868272	126868276	+	IGR	DEL	AAGGC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126868272_126868276delAAGGC								TRIB1 (417630 upstream) : FAM84B (696411 downstream)																							gtggctgaagaaggcaaggcgacaa	0.039													4	4	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131283232	131283232	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131283232delA	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CCACTTGGCCAAACAAATCAC	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143723039	143723039	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143723039delA								ARC (27206 upstream) : JRK (15836 downstream)																							tgtcaaccttaaaaagatcag	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34918405	34918406	+	IGR	INS	-	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34918405_34918406insA								C9orf144 (79822 upstream) : KIAA1045 (39115 downstream)																							CCAAGGTCTTTAAAAAAAAAAA	0.361													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66465026	66465027	+	Intron	INS	-	G	G	rs145447612		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66465026_66465027insG	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																		CAGCAGGCTGAGGGATCCAAGG	0.381													4	2	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77386338	77386339	+	Intron	DEL	CA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77386338_77386339delCA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						cacacatgcgcacacacacaca	0.000													3	3	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79997528	79997529	+	Intron	DEL	TA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79997528_79997529delTA	uc004akr.2	+						VPS13A_uc004akp.3_3'UTR|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						ATATAATCCTTATATCCAATTA	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	84649500	84649500	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84649500delT								FLJ46321 (39330 upstream) : RASEF (947817 downstream)																							AATGCCAGCCTTTTTTTTGCC	0.299													4	2	---	---	---	---	
AUH	549	broad.mit.edu	37	9	94009552	94009552	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94009552delG	uc004arf.3	-						AUH_uc004arg.3_Intron	NM_001698	NP_001689	Q13825	AUHM_HUMAN	AU RNA binding protein/enoyl-Coenzyme A						branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding				0						GTGCTACTCTGCAAGAGGGTA	0.527													4	2	---	---	---	---	
GAPVD1	26130	broad.mit.edu	37	9	128097667	128097667	+	Intron	DEL	A	-	-	rs13288223	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128097667delA	uc010mwx.2	+						GAPVD1_uc011lzs.1_Intron|GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc010mwy.1_Intron	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						ttttttttttaaaaatggggc	0.000													4	2	---	---	---	---	
NCS1	23413	broad.mit.edu	37	9	132985664	132985664	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985664delT	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101	P62166	NCS1_HUMAN	frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0						gtccttagccttttttttttg	0.214													4	2	---	---	---	---	
PFKFB3	5209	broad.mit.edu	37	10	6236196	6236197	+	Intron	DEL	AA	-	-	rs3084084		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6236196_6236197delAA	uc010qaw.1	+						PFKFB3_uc001ijd.2_Intron|PFKFB3_uc009xii.2_Intron	NM_001145443	NP_001138915	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						CCTATTGGATAAAAGCTTTGGA	0.490													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6321510	6321510	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6321510delT								PFKFB3 (44005 upstream) : PRKCQ (147595 downstream)																							AGAAAGGCTCTTTTCCTGCTT	0.458													4	2	---	---	---	---	
ITIH2	3698	broad.mit.edu	37	10	7762682	7762682	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7762682delA	uc001ijs.2	+							NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						CAGATCCTGCAGGAGAGATCG	0.502													4	2	---	---	---	---	
ARMC4	55130	broad.mit.edu	37	10	28149387	28149387	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28149387delA	uc009xky.2	-						ARMC4_uc010qds.1_Intron|ARMC4_uc010qdt.1_Intron|ARMC4_uc001itz.2_Intron	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4								binding			ovary(4)|skin(2)	6						gtttaaaaagaaaaaaaaaGT	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	28301425	28301427	+	IGR	DEL	TTC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28301425_28301427delTTC								ARMC4 (13448 upstream) : MPP7 (38496 downstream)																							GCTTGAACAATTCTTCTCTGGGT	0.300													4	2	---	---	---	---	
LOC441666	441666	broad.mit.edu	37	10	42833236	42833237	+	RNA	DEL	TC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42833236_42833237delTC	uc010qey.1	-	3		c.738_739delGA				NR_024380				Homo sapiens noncoding mRNA sequence.												0						ACTTGTAGGGTCTCTCTTTAGT	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50801678	50801679	+	IGR	INS	-	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50801678_50801679insA								PGBD3 (54094 upstream) : CHAT (15462 downstream)																							ATGGCTCAGTGTGATGAGCTCC	0.579											OREG0020184	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	58649085	58649086	+	IGR	DEL	GA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58649085_58649086delGA								ZWINT (528051 upstream) : None (None downstream)																							agatcatcatgagagagagaca	0.000													4	2	---	---	---	---	
VCL	7414	broad.mit.edu	37	10	75870925	75870925	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75870925delG	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					ATAGAGAGCTGGTCTGATGTG	0.512													4	2	---	---	---	---	
LDB3	11155	broad.mit.edu	37	10	88433996	88433997	+	Intron	DEL	TT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88433996_88433997delTT	uc001kdv.2	+						LDB3_uc010qml.1_Intron|LDB3_uc010qmm.1_Intron|LDB3_uc001kdu.2_Intron|LDB3_uc009xsz.2_Intron|LDB3_uc001kdr.2_Intron|LDB3_uc009xsy.2_Intron|LDB3_uc001kds.2_Intron|LDB3_uc001kdt.2_Intron	NM_007078	NP_009009	O75112	LDB3_HUMAN	LIM domain binding 3 isoform 1							cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding			ovary(1)	1						TAATCCCCTGTTTAACGACAta	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	102611063	102611064	+	IGR	DEL	TC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102611063_102611064delTC								PAX2 (21366 upstream) : FAM178A (61262 downstream)																							attcagtgtgtctaaaaactaa	0.218													4	2	---	---	---	---	
AFAP1L2	84632	broad.mit.edu	37	10	116056505	116056505	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116056505delC	uc001lbn.2	-						AFAP1L2_uc001lbo.2_Intron|AFAP1L2_uc010qse.1_Intron|AFAP1L2_uc001lbp.2_Intron|AFAP1L2_uc001lbm.2_Intron|AFAP1L2_uc010qsd.1_Intron|AFAP1L2_uc001lbq.1_3'UTR	NM_001001936	NP_001001936	Q8N4X5	AF1L2_HUMAN	KIAA1914 protein isoform 1						inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		ACTGAAGCATCCCCAAGCTCA	0.522													4	2	---	---	---	---	
CUZD1	50624	broad.mit.edu	37	10	124596659	124596659	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124596659delT	uc001lgq.2	-						CUZD1_uc001lgp.2_Intron|CUZD1_uc009yad.2_Intron|CUZD1_uc009yaf.2_Intron|CUZD1_uc001lgr.2_Intron|CUZD1_uc010qty.1_Intron|CUZD1_uc009yae.2_Intron|CUZD1_uc001lgs.2_Intron|CUZD1_uc010qtz.1_Intron	NM_022034	NP_071317	Q86UP6	CUZD1_HUMAN	CUB and zona pellucida-like domains 1 precursor						cell cycle|cell division|cell proliferation|substrate-dependent cell migration, cell attachment to substrate|trypsinogen activation	integral to membrane|transport vesicle membrane|zymogen granule membrane				ovary(1)|skin(1)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		TGATTATGGATTTTTTTTTTC	0.368													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11281360	11281360	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11281360delC								ZBED5 (401740 upstream) : GALNTL4 (11061 downstream)																							atttattcttctctccatctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13241120	13241120	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13241120delG								RASSF10 (208473 upstream) : ARNTL (58205 downstream)																							GCTCAGGAGAGGGGGGAAAAA	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45104305	45104305	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45104305delT								LOC221122 (104729 upstream) : PRDM11 (11259 downstream)																							tctccttttcttcaaatttca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48355893	48355893	+	IGR	DEL	A	-	-	rs67880258		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48355893delA								OR4C3 (8413 upstream) : OR4C45 (11009 downstream)																							TTATGGAATTATAAATTACTG	0.348													3	4	---	---	---	---	
BBS1	582	broad.mit.edu	37	11	66286896	66286897	+	Intron	DEL	TT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66286896_66286897delTT	uc001oij.1	+						BBS1_uc001oii.1_Intron|BBS1_uc010rpf.1_Intron|BBS1_uc010rpg.1_Intron|BBS1_uc001oik.1_Intron|BBS1_uc001oil.1_Intron	NM_024649	NP_078925	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1						nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	BBSome|cilium membrane|cytoplasm	protein binding			ovary(1)	1						cataattgacttagacaatcct	0.030									Bardet-Biedl_syndrome				4	2	---	---	---	---	
BBS1	582	broad.mit.edu	37	11	66296759	66296759	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66296759delG	uc001oij.1	+						BBS1_uc001oii.1_Intron|BBS1_uc010rpg.1_Intron|BBS1_uc001oik.1_Intron|BBS1_uc001oil.1_Intron|ZDHHC24_uc001oim.1_Intron|ZDHHC24_uc009yrg.1_Intron|BBS1_uc010rph.1_Intron	NM_024649	NP_078925	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1						nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	BBSome|cilium membrane|cytoplasm	protein binding			ovary(1)	1						TTGATGGACAGGGAGGCAGTG	0.358									Bardet-Biedl_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	87838098	87838099	+	IGR	INS	-	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87838098_87838099insT								TMEM135 (803530 upstream) : RAB38 (8332 downstream)																							CATGCTGCTTCTGGGAGACTCC	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	88147927	88147927	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88147927delA								CTSC (76986 upstream) : GRM5 (89818 downstream)																							ATTACTGGAGAAAAAGCAGTG	0.493													4	2	---	---	---	---	
PANX1	24145	broad.mit.edu	37	11	93904146	93904146	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93904146delG	uc001per.2	+						PANX1_uc001peq.2_Intron	NM_015368	NP_056183	Q96RD7	PANX1_HUMAN	pannexin 1						positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTCTTACCTTGCTACTGTTTC	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	93932944	93932947	+	IGR	DEL	TGAT	-	-	rs137910271		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93932944_93932947delTGAT								PANX1 (17809 upstream) : FOLR4 (105856 downstream)																							GTTGATTAACTGATTGATTGATTC	0.407													5	3	---	---	---	---	
ATM	472	broad.mit.edu	37	11	108183806	108183806	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108183806delC	uc001pkb.1	+						ATM_uc009yxr.1_Intron|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Intron|ATM_uc001pkg.1_Intron|ATM_uc009yxt.1_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		ctcgccacatcccactctcaa	0.000			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			4	2	---	---	---	---	
BCO2	83875	broad.mit.edu	37	11	112065744	112065748	+	Intron	DEL	TATCT	-	-	rs148699863		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112065744_112065748delTATCT	uc001pnf.2	+						BCO2_uc001pne.1_Intron|BCO2_uc001png.2_Intron|BCO2_uc001pnh.2_Intron|BCO2_uc010rwt.1_Intron|BCO2_uc009yyn.2_Intron|BCO2_uc001pni.2_Intron	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN	beta-carotene dioxygenase 2 isoform a						carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						TTGGTCTATCTATCTTATCTTGATC	0.283													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123880158	123880159	+	IGR	DEL	AG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123880158_123880159delAG								OR10S1 (31760 upstream) : OR10G4 (6123 downstream)																							TTTGAGTAACagagagagagag	0.257													5	3	---	---	---	---	
FEZ1	9638	broad.mit.edu	37	11	125319658	125319658	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125319658delT	uc001qbx.2	-						FEZ1_uc001qbw.2_Intron	NM_005103	NP_005094	Q99689	FEZ1_HUMAN	zygin 1 isoform 1						axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		AACAGTGGGATTGCCACTTCA	0.338													4	2	---	---	---	---	
A2M	2	broad.mit.edu	37	12	9259920	9259921	+	Intron	INS	-	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9259920_9259921insC	uc001qvk.1	-						A2M_uc009zgk.1_Intron	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor						blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	CTATCGTTCTGAAACACTCACA	0.386													4	2	---	---	---	---	
CLEC9A	283420	broad.mit.edu	37	12	10197962	10197962	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10197962delT	uc001qxa.2	+							NM_207345	NP_997228	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A						positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding			ovary(1)	1						AATGAGAAACTTTTTTTTTTA	0.348													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	23655913	23655914	+	IGR	INS	-	T	T			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23655913_23655914insT								ETNK1 (812306 upstream) : SOX5 (29318 downstream)																							AAGCACACAGGTTTTTTTTTAA	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	26244508	26244508	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26244508delT								RASSF8 (11684 upstream) : BHLHE41 (28453 downstream)																							TCTTATTTAATTTTTTTTCAA	0.368													4	2	---	---	---	---	
RACGAP1	29127	broad.mit.edu	37	12	50383963	50383965	+	3'UTR	DEL	TAA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50383963_50383965delTAA	uc001rvt.2	-	19					RACGAP1_uc009zlm.1_3'UTR|RACGAP1_uc001rvs.2_3'UTR|RACGAP1_uc001rvu.2_3'UTR	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1						blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						CTAAAAGTAGTAATGAGTACAGG	0.404													57	25	---	---	---	---	
SMARCC2	6601	broad.mit.edu	37	12	56576106	56576106	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56576106delT	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TCCACAGTAAttttttttttt	0.154													4	2	---	---	---	---	
FAM19A2	338811	broad.mit.edu	37	12	62240813	62240813	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62240813delC	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		CACTTTCCTTCCCACACAAGT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	63565431	63565431	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63565431delT								AVPR1A (18841 upstream) : DPY19L2 (387262 downstream)																							GATATTATAGTTTTTTTGAAT	0.333													4	2	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	67064250	67064251	+	Intron	DEL	TC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67064250_67064251delTC	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GCTCATAACTTCATACAGGACT	0.480													4	2	---	---	---	---	
CPSF6	11052	broad.mit.edu	37	12	69655902	69655903	+	Intron	INS	-	A	A	rs146620973	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69655902_69655903insA	uc001sut.3	+						CPSF6_uc001suu.3_Intron|CPSF6_uc010stk.1_Intron	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,						mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			GCTACTAGTTTAATAGATGATG	0.337													6	4	---	---	---	---	
THAP2	83591	broad.mit.edu	37	12	72058585	72058585	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72058585delC	uc001swq.2	+						ZFC3H1_uc001swo.2_5'Flank|ZFC3H1_uc010sts.1_5'Flank|ZFC3H1_uc001swp.2_5'Flank	NM_031435	NP_113623	Q9H0W7	THAP2_HUMAN	THAP domain containing, apoptosis associated							nucleolus	DNA binding|metal ion binding			ovary(1)	1						TTGGTCATTACCCCTTAGTAA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76118853	76118854	+	IGR	DEL	GA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76118853_76118854delGA								KRR1 (213435 upstream) : PHLDA1 (300374 downstream)																							ggagggaggggagagagagaga	0.356													4	4	---	---	---	---	
NAP1L1	4673	broad.mit.edu	37	12	76450179	76450179	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76450179delA	uc001sxw.2	-						NAP1L1_uc001sxv.2_Intron|NAP1L1_uc001sxz.2_Intron|NAP1L1_uc001sxx.2_Intron|NAP1L1_uc001sxy.2_Intron|NAP1L1_uc010sty.1_Intron|NAP1L1_uc010stz.1_Intron|NAP1L1_uc010sua.1_Intron|NAP1L1_uc001syb.2_Intron|NAP1L1_uc001sya.2_Intron|NAP1L1_uc001syc.2_Intron	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1						DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				CCATTTTAGTAAAAAAAAAAT	0.348													6	3	---	---	---	---	
POLR3B	55703	broad.mit.edu	37	12	106903453	106903453	+	3'UTR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106903453delA	uc001tlp.2	+	28					POLR3B_uc001tlq.2_3'UTR	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						TAAAACAACCAAAAAAAAATG	0.433													8	4	---	---	---	---	
GPN3	51184	broad.mit.edu	37	12	110891219	110891219	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110891219delA	uc001tqr.2	-						GPN3_uc001tqs.2_Intron	NM_016301	NP_057385	Q9UHW5	GPN3_HUMAN	GPN-loop GTPase 3 isoform 1							protein complex	GTP binding				0						aataaaaaataaaaaaataaa	0.363													4	2	---	---	---	---	
ATXN2	6311	broad.mit.edu	37	12	111894232	111894232	+	Intron	DEL	A	-	-	rs10708872		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111894232delA	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsg.2_Intron|ATXN2_uc001tsl.1_Intron	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						CCATCTGGACAACTCCTTTCT	0.483													4	2	---	---	---	---	
C12orf51	283450	broad.mit.edu	37	12	112655141	112655142	+	Intron	DEL	AC	-	-	rs4767497		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112655141_112655142delAC	uc009zwc.2	-						C12orf51_uc001ttr.1_Intron	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						acacacacatacacacacacac	0.084													3	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	118246548	118246548	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118246548delT	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					gttgccatccttccaaTGAAA	0.065													4	2	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119485517	119485517	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119485517delG	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						ccaacgtgatggtagaagtgc	0.030													4	2	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119493605	119493605	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119493605delA	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						ctcacctgtgaaatgggagca	0.104													4	2	---	---	---	---	
MPHOSPH9	10198	broad.mit.edu	37	12	123646211	123646211	+	Intron	DEL	A	-	-	rs72277618		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123646211delA	uc001uel.2	-						MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_Intron|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9						M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		AACTTAAAGCAAAAAAAAAAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126707294	126707294	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126707294delA								TMEM132B (563705 upstream) : LOC100128554 (219733 downstream)																							tgaagaattgaaaaaaagtta	0.000													4	2	---	---	---	---	
ZDHHC20	253832	broad.mit.edu	37	13	21974342	21974343	+	Intron	DEL	AT	-	-	rs140771562		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21974342_21974343delAT	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		ACAAATAAACATGTGTATATGA	0.262													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	30444035	30444035	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30444035delT								UBL3 (19215 upstream) : KATNAL1 (332733 downstream)																							gacaaaaaaataaacaggtaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79161687	79161688	+	Intron	DEL	CA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79161687_79161688delCA	uc001vku.1	+											Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																		TATTGAATAGcacacacacaca	0.391													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101422498	101422498	+	IGR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101422498delT								TMTC4 (95395 upstream) : NALCN (283632 downstream)																							TTTCCACTACTTTTTTTTTTG	0.433													4	2	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	110985271	110985271	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110985271delC	uc001vqx.2	+							NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			AGCCCAAATTCCCATGGTAGC	0.498													4	2	---	---	---	---	
ARHGEF7	8874	broad.mit.edu	37	13	111875705	111875705	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111875705delT	uc001vrs.2	+						ARHGEF7_uc001vrr.2_Intron|ARHGEF7_uc001vrt.2_Intron|ARHGEF7_uc010tjn.1_Intron|ARHGEF7_uc001vru.1_Intron|ARHGEF7_uc001vrv.3_Intron|ARHGEF7_uc001vrw.3_Intron|ARHGEF7_uc001vrx.3_Intron|ARHGEF7_uc010tjo.1_Intron	NM_001113511	NP_001106983	Q14155	ARHG7_HUMAN	PAK-interacting exchange factor beta isoform c						apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GTTAGGATCATTTCTTTATTC	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	32389181	32389183	+	IGR	DEL	TGA	-	-	rs146581537		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32389181_32389183delTGA								NUBPL (58764 upstream) : C14orf128 (155443 downstream)																							GTGCACCTCCTGATGATCTGTTT	0.448													4	2	---	---	---	---	
FRMD6	122786	broad.mit.edu	37	14	52088152	52088153	+	Intron	DEL	AG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52088152_52088153delAG	uc001wzb.2	+							NM_001042481	NP_001035946	Q96NE9	FRMD6_HUMAN	FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					ATACTTCCTTAGCTCCACCATC	0.460													4	2	---	---	---	---	
C14orf43	91748	broad.mit.edu	37	14	74189784	74189784	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74189784delG	uc001xot.2	-						C14orf43_uc001xos.2_Intron|C14orf43_uc001xou.2_Intron|C14orf43_uc010tud.1_Intron|C14orf43_uc010arw.2_Intron	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)		aagctataaaggacaatgtcg	0.129													4	2	---	---	---	---	
TTLL5	23093	broad.mit.edu	37	14	76183986	76183987	+	Intron	INS	-	G	G			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76183986_76183987insG	uc001xrx.2	+						TTLL5_uc010ask.1_Intron|TTLL5_uc001xry.1_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		gtttttcaacttggatacgata	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	77593966	77593967	+	IGR	INS	-	GAGT	GAGT	rs140059246	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77593966_77593967insGAGT								KIAA1737 (10337 upstream) : ZDHHC22 (3647 downstream)																							CCTACAGGAGAGAGTAAGAGTG	0.485													4	2	---	---	---	---	
TTC8	123016	broad.mit.edu	37	14	89343511	89343511	+	Intron	DEL	A	-	-	rs34301947		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89343511delA	uc010ath.2	+						TTC8_uc001xxl.2_Intron|TTC8_uc010ati.2_Intron|TTC8_uc001xxm.2_Intron|TTC8_uc010atj.2_Intron|TTC8_uc001xxi.2_Intron|TTC8_uc001xxj.2_Intron|TTC8_uc001xxk.2_Intron	NM_198309	NP_938051	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8 isoform B						cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding				0						TGGGTTTGTTAAAAAAAAAAG	0.279									Bardet-Biedl_syndrome				7	4	---	---	---	---	
TECPR2	9895	broad.mit.edu	37	14	102915798	102915798	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102915798delT	uc001ylw.1	+						TECPR2_uc010awl.2_Intron|TECPR2_uc010txx.1_Intron	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2								protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						TCCTGCCACATTTTTTTGGTC	0.413													4	2	---	---	---	---	
KIAA0284	283638	broad.mit.edu	37	14	105356241	105356245	+	Intron	DEL	AAATG	-	-	rs61996002	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105356241_105356245delAAATG	uc010axb.2	+						INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Intron|KIAA0284_uc001yps.2_Intron|KIAA0284_uc001ypt.2_Intron	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1							cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		atggatggacaaatggatggatgga	0.210													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20864458	20864459	+	IGR	INS	-	T	T	rs140719414	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20864458_20864459insT								GOLGA8C (83432 upstream) : BCL8 (5597 downstream)																							CCTTTGGAAGATTTTTTTTTCA	0.262													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21148508	21148508	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21148508delG	uc001ytw.1	+											Homo sapiens hypothetical protein LOC348120, mRNA (cDNA clone IMAGE:4838061).																		gcatgtatcagggtagttcta	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26616021	26616022	+	IGR	DEL	TC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26616021_26616022delTC								ATP10A (505704 upstream) : GABRB3 (172673 downstream)																							aataaatttatctctctctctt	0.000													4	2	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66257515	66257515	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66257515delC	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						ACCTGTGCTTCAAGATCCTCC	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98889716	98889716	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98889716delC								ARRDC4 (372649 upstream) : FAM169B (90675 downstream)																							TGGTGATGTGCCCCTTTCTGA	0.473													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6197929	6197930	+	Intron	DEL	CC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6197929_6197930delCC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		tgccttcagtcccagctctcaa	0.104													4	2	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	9849713	9849713	+	3'UTR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9849713delA	uc002czo.3	-	13					GRIN2A_uc010uym.1_3'UTR	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TTTGGAAAAGAAAAAAAAAAA	0.388													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	14160955	14160956	+	IGR	DEL	TA	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14160955_14160956delTA								ERCC4 (114750 upstream) : MKL2 (4240 downstream)																							GATGGGAAAGTATGGCACATCT	0.480													4	2	---	---	---	---	
ARHGAP17	55114	broad.mit.edu	37	16	24982157	24982159	+	Intron	DEL	TAT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24982157_24982159delTAT	uc002dnb.2	-						ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dnf.2_5'Flank|ARHGAP17_uc002dng.1_Intron	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		tgttagctgctattattATTATT	0.148													4	2	---	---	---	---	
HS3ST4	9951	broad.mit.edu	37	16	26056045	26056046	+	Intron	INS	-	G	G	rs149494110	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26056045_26056046insG	uc002dof.2	+							NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		GGGGCCAGGCAGGGGCATCTGC	0.475													2	7	---	---	---	---	
NAE1	8883	broad.mit.edu	37	16	66858495	66858495	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66858495delA	uc002eqf.2	-						NAE1_uc002eqe.2_Intron|NAE1_uc002eqg.2_Intron|NAE1_uc010cdv.2_Intron|NAE1_uc010cdw.1_Intron	NM_003905	NP_003896	Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1 isoform a						apoptosis|cell cycle|DNA replication|mitotic cell cycle DNA replication checkpoint|protein neddylation|signal transduction	cytoplasm|insoluble fraction|plasma membrane	catalytic activity|protein heterodimerization activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	actccgtctcaaaaaaaaaaa	0.134													4	2	---	---	---	---	
CA7	766	broad.mit.edu	37	16	66886480	66886495	+	Intron	DEL	AAAAGAAAAGAAAAAA	-	-	rs72439001		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66886480_66886495delAAAAGAAAAGAAAAAA	uc002eqi.2	+						uc002eqh.2_Intron|CA7_uc002eqj.2_Intron	NM_005182	NP_005173	P43166	CAH7_HUMAN	carbonic anhydrase VII isoform 1						one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		aaaaagaaagaaaagaaaagaaaaaaaaaagaaaag	0.148													5	3	---	---	---	---	
SLC12A4	6560	broad.mit.edu	37	16	67991417	67991417	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67991417delT	uc002euz.2	-						SLC12A4_uc010ceu.2_Intron|SLC12A4_uc010vkh.1_Intron|SLC12A4_uc010vki.1_Intron|SLC12A4_uc010vkj.1_Intron|SLC12A4_uc002eva.2_Intron|SLC12A4_uc002evb.2_Intron|SLC12A4_uc010cew.1_Intron	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a						cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TACATTGCCCTTTTTTTTTCT	0.259													4	2	---	---	---	---	
SLC7A6	9057	broad.mit.edu	37	16	68335453	68335453	+	3'UTR	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68335453delT	uc002evt.1	+	12					SLC7A6_uc002evu.1_3'UTR|SLC7A6_uc002evv.1_RNA|SLC7A6_uc010cfc.1_RNA|SLC7A6OS_uc002evw.1_Intron	NM_001076785	NP_001070253	Q92536	YLAT2_HUMAN	solute carrier family 7 (cationic amino acid						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|antiporter activity			central_nervous_system(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.0948)		TATAGAATTCTTTTTTTTTTA	0.373													7	4	---	---	---	---	
CDYL2	124359	broad.mit.edu	37	16	80741952	80741952	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80741952delC	uc002ffs.2	-							NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2							nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						GATGCCCTTTCCCCCTTCATG	0.463													4	2	---	---	---	---	
AFG3L1	172	broad.mit.edu	37	16	90064556	90064556	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90064556delG	uc002fpx.1	+						AFG3L1_uc002fqb.1_Intron|AFG3L1_uc002fqd.1_5'Flank	NR_003228				Homo sapiens AFG3L1 isoform 1 mRNA, partial sequence.												0						ACCCTAAGCTGTGAGAGCTGA	0.483													4	2	---	---	---	---	
ALOXE3	59344	broad.mit.edu	37	17	8012271	8012272	+	Intron	INS	-	C	C			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8012271_8012272insC	uc010cnr.2	-						ALOXE3_uc002gka.2_Intron|ALOXE3_uc010vuo.1_Intron	NM_021628	NP_067641	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3 isoform 2						leukotriene biosynthetic process		iron ion binding|lipoxygenase activity			skin(3)|lung(1)|central_nervous_system(1)	5						TCCACTGGACACCCCCTCCTTC	0.599													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	8086211	8086211	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8086211delG								TMEM107 (6497 upstream) : C17orf59 (5441 downstream)																							ttcttttcttgcaatttatca	0.000													4	2	---	---	---	---	
PIK3R6	146850	broad.mit.edu	37	17	8752318	8752318	+	Intron	DEL	G	-	-	rs150307075	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8752318delG	uc002glq.1	-						PIK3R6_uc002glr.1_Intron|PIK3R6_uc002gls.1_Intron	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6						platelet activation	cytosol					0						TTGACTTTCCGGGTGACCAAT	0.443													4	2	---	---	---	---	
C17orf48	56985	broad.mit.edu	37	17	10609586	10609587	+	Intron	DEL	AT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10609586_10609587delAT	uc002gmt.2	+						C17orf48_uc002gmu.2_Intron|C17orf48_uc002gmv.2_Intron|C17orf48_uc010vvg.1_Intron	NM_020233	NP_064618	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol pyrophosphatase								ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding				0						ATGCAGTGTGATATATATATAT	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	15737482	15737482	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15737482delG								MEIS3P1 (44465 upstream) : ADORA2B (110749 downstream)																							CTGAACTGCTGGaggagaagg	0.542													4	2	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21306688	21306690	+	Intron	DEL	ACA	-	-	rs144651249	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21306688_21306690delACA	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	attggttttgacaacatcataca	0.039										Prostate(3;0.18)			4	2	---	---	---	---	
TTC25	83538	broad.mit.edu	37	17	40114190	40114190	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40114190delG	uc002hyj.3	+						TTC25_uc010cxt.2_Intron	NM_031421	NP_113609	Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm	protein binding			ovary(1)	1		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				taggtgctgtggggggaaagg	0.144													4	2	---	---	---	---	
TBX21	30009	broad.mit.edu	37	17	45814583	45814584	+	Intron	DEL	GT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45814583_45814584delGT	uc002ilv.1	+							NM_013351	NP_037483	Q9UL17	TBX21_HUMAN	T-box 21						lymphocyte migration|multicellular organismal development|positive regulation of transcription, DNA-dependent|response to virus	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0						CTGTGTGGCAGTGTGTGTGTGT	0.500													4	2	---	---	---	---	
PCTP	58488	broad.mit.edu	37	17	53846655	53846655	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53846655delT	uc002iul.3	+						PCTP_uc002ium.3_Intron|PCTP_uc010dcg.2_Intron|PCTP_uc010dch.2_Intron	NM_021213	NP_067036	Q9UKL6	PPCT_HUMAN	phosphatidylcholine transfer protein isoform 1							cytosol	phosphatidylcholine binding|phosphatidylcholine transmembrane transporter activity			lung(1)	1			BRCA - Breast invasive adenocarcinoma(1;0.00207)			ttcatcatggttttgggcaac	0.005													4	2	---	---	---	---	
TRIM25	7706	broad.mit.edu	37	17	54992740	54992740	+	5'Flank	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54992740delT	uc002iut.2	-						TRIM25_uc010dcj.2_5'Flank	NM_005082	NP_005073	Q14258	TRI25_HUMAN	tripartite motif-containing 25						innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|response to virus	cell junction|cytosol|nucleus	sequence-specific DNA binding transcription factor activity|ubiquitin-protein ligase activity|zinc ion binding			lung(1)|breast(1)|skin(1)	3	Breast(9;6.15e-08)					ttctcttttctttttttttct	0.234													4	2	---	---	---	---	
HEATR6	63897	broad.mit.edu	37	17	58132610	58132610	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58132610delA	uc002iyk.1	-						HEATR6_uc010ddk.1_Intron|HEATR6_uc010wos.1_Intron	NM_022070	NP_071353	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6								binding			ovary(1)|skin(1)	2	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			tcttttGCATAAAAAACTAGG	0.144													4	2	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59301777	59301777	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59301777delA	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			tggaaataagaaaggaaagtc	0.000													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64024186	64024187	+	Intron	DEL	TA	-	-	rs144001403		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64024186_64024187delTA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			aaataaaatttatttttaaaaC	0.163													3	4	---	---	---	---	
ABCA8	10351	broad.mit.edu	37	17	66890717	66890718	+	Intron	DEL	TT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66890717_66890718delTT	uc002jhp.2	-						ABCA8_uc002jhq.2_Intron|ABCA8_uc010wqq.1_Intron|ABCA8_uc010wqr.1_Intron|ABCA8_uc002jhr.2_Intron	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					GTGTTTATTGTTTAAGAACAAA	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79476214	79476214	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79476214delC								BAHCC1 (42856 upstream) : ACTG1 (785 downstream)																							AGCCTCCTCTCCCCCATCCCC	0.547													4	2	---	---	---	---	
KCTD1	284252	broad.mit.edu	37	18	24106099	24106099	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24106099delA	uc002kvw.2	-						KCTD1_uc010xbj.1_Intron|KCTD1_uc010xbk.1_Intron	NM_001136205	NP_001129677	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			TTCTGGGTTGAAAAAAAAAAT	0.428													4	2	---	---	---	---	
ASXL3	80816	broad.mit.edu	37	18	31187358	31187358	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31187358delT	uc010dmg.1	+						ASXL3_uc002kxq.2_Intron	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						GGATGGCCCCTTTTTGTTGCA	0.348													4	2	---	---	---	---	
PIK3C3	5289	broad.mit.edu	37	18	39609037	39609037	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39609037delA	uc002lap.2	+						PIK3C3_uc010xcl.1_Intron|PIK3C3_uc002laq.2_Intron	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3						cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						TTTATGTGGGAAAAAAATGCG	0.333										TSP Lung(28;0.18)			4	2	---	---	---	---	
CCDC102B	79839	broad.mit.edu	37	18	66590882	66590882	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66590882delA	uc002lkk.2	+						CCDC102B_uc002lki.2_Intron	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B											ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				GGTTCACACTAAAGAGTGAAG	0.249													4	2	---	---	---	---	
ATP8B3	148229	broad.mit.edu	37	19	1808455	1808457	+	Intron	DEL	ACA	-	-	rs61377208		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1808455_1808457delACA	uc002ltw.2	-						ATP8B3_uc002ltv.2_Intron|ATP8B3_uc002ltx.2_Intron|ATP8B3_uc002lty.1_5'Flank|ATP8B3_uc002ltz.1_Intron	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3						ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TATGGGACACACACCATTCATTA	0.379													4	2	---	---	---	---	
C19orf28	126321	broad.mit.edu	37	19	3557210	3557212	+	In_Frame_Del	DEL	CAG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3557210_3557212delCAG	uc002lxz.2	-	1	360_362	c.190_192delCTG	c.(190-192)CTGdel	p.L64del	C19orf28_uc002lxw.2_In_Frame_Del_p.L64del|C19orf28_uc002lxx.2_In_Frame_Del_p.L64del|C19orf28_uc002lxy.2_In_Frame_Del_p.L64del	NM_174983	NP_778148	Q6NUT3	CS028_HUMAN	hypothetical protein LOC126321 isoform c	64	Helical; (Potential).				transmembrane transport	integral to membrane				breast(1)|pancreas(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACCTGGCCCAGCAGCAGCAGC	0.729													4	2	---	---	---	---	
SMARCA4	6597	broad.mit.edu	37	19	11106036	11106037	+	Intron	DEL	GG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11106036_11106037delGG	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc002mqg.1_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron|SMARCA4_uc002mqe.2_Intron	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GTCGCTGGTTGGGCAGATATTG	0.579			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28464281	28464281	+	IGR	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28464281delG								LOC148189 (179433 upstream) : LOC148145 (991759 downstream)																							GAGAAGTGTTGGAAGAGTAAT	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	40942872	40942873	+	IGR	DEL	AG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40942872_40942873delAG								SERTAD1 (10940 upstream) : SERTAD3 (3876 downstream)																							ttgtatttttagtagagacggg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	44388960	44388961	+	IGR	INS	-	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44388960_44388961insA								ZNF404 (4672 upstream) : ZNF45 (27820 downstream)																							atgagcaggagaaaaaaaaatc	0.000													4	2	---	---	---	---	
HRC	3270	broad.mit.edu	37	19	49655112	49655112	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49655112delC	uc002pmv.2	-							NM_002152	NP_002143	P23327	SRCH_HUMAN	histidine rich calcium binding protein						muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			ovary(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TCGAGCCAGGCCCCGGCCCAC	0.662													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54835103	54835104	+	IGR	DEL	AT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54835103_54835104delAT								LILRA5 (10694 upstream) : LILRA4 (9589 downstream)																							ctgactccacattcggagagaa	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	3207097	3207097	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3207097delC								ITPA (2593 upstream) : SLC4A11 (967 downstream)																							GATTGGTTCTCGGGGCCCTGG	0.348													4	2	---	---	---	---	
ADRA1D	146	broad.mit.edu	37	20	4210072	4210073	+	Intron	INS	-	A	A	rs146294296	by1000genomes	TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4210072_4210073insA	uc002wkr.2	-							NM_000678	NP_000669	P25100	ADA1D_HUMAN	alpha-1D-adrenergic receptor						cell proliferation|cell-cell signaling|DNA metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|multicellular organismal development|positive regulation of cell proliferation	integral to plasma membrane	alpha1-adrenergic receptor activity				0					Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Methotrimeprazine(DB01403)|Norepinephrine(DB00368)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)	ggaaggaagatgggggcgagtg	0.000													7	6	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8571470	8571470	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8571470delT	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						cctactttaatttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10110137	10110137	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10110137delC	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																		gtcatgccatcccccccaaaa	0.000													4	2	---	---	---	---	
SLC24A3	57419	broad.mit.edu	37	20	19519780	19519782	+	Intron	DEL	TGT	-	-	rs151268175		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19519780_19519782delTGT	uc002wrl.2	+							NM_020689	NP_065740	Q9HC58	NCKX3_HUMAN	solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1						agttacattctgttgtttcttgg	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	21622350	21622351	+	IGR	DEL	AG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21622350_21622351delAG								NKX2-2 (127686 upstream) : PAX1 (63946 downstream)																							AGTCTTTATTAGAAAAGGTGGC	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25910266	25910267	+	IGR	INS	-	T	T	rs149342775		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25910266_25910267insT								FAM182B (61480 upstream) : LOC100134868 (80168 downstream)																							TGTGAGGACAGTTTTTTTTAAT	0.322													4	5	---	---	---	---	
CTNNBL1	56259	broad.mit.edu	37	20	36407392	36407392	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36407392delT	uc010zvw.1	+						CTNNBL1_uc002xhh.2_Intron|CTNNBL1_uc002xhi.2_Intron|CTNNBL1_uc002xhj.2_Intron	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				GTGTTTTGGCTTTTTTTTTTG	0.318													4	2	---	---	---	---	
DNTTIP1	116092	broad.mit.edu	37	20	44438017	44438018	+	Intron	DEL	AG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44438017_44438018delAG	uc002xpk.2	+							NM_052951	NP_443183	Q9H147	TDIF1_HUMAN	terminal deoxynucleotidyltransferase interacting							nucleus				ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.0122)				CCCTATCCCTAGGTCTCCCTTC	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49974518	49974519	+	IGR	INS	-	TGGA	TGGA	rs13038800		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49974518_49974519insTGGA								KCNG1 (334843 upstream) : NFATC2 (33247 downstream)																							ggatgaatgggtggatggatgg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52530785	52530787	+	IGR	DEL	CCT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52530785_52530787delCCT								SUMO1P1 (38537 upstream) : BCAS1 (29292 downstream)																							CCAGTGCCCACCTCCTCCTCCCA	0.256													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55149139	55149139	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55149139delC								C20orf107 (37565 upstream) : TFAP2C (55219 downstream)																							GTGCTCAATACAGGGAACGTG	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57995983	57995984	+	IGR	INS	-	AT	AT			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57995983_57995984insAT								EDN3 (94937 upstream) : PHACTR3 (156580 downstream)																							GACAATATGCAATGATGTCCAC	0.391													3	3	---	---	---	---	
SLCO4A1	28231	broad.mit.edu	37	20	61301258	61301258	+	Intron	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61301258delC	uc002ydb.1	+						SLCO4A1_uc002ydc.1_Intron|SLCO4A1_uc002yde.1_Intron	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family						sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)			GTTAAGGAGACATACACCTCG	0.318													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9828415	9828417	+	IGR	DEL	ATG	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9828415_9828417delATG								None (None upstream) : None (None downstream)																							ctctagaggcatgatgggttaaa	0.123													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11184776	11184779	+	IGR	DEL	AAAC	-	-	rs11184115		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11184776_11184779delAAAC								BAGE (85839 upstream) : None (None downstream)																							aaaaacaaaaaaacaaaaaactgg	0.000													4	2	---	---	---	---	
RNF160	26046	broad.mit.edu	37	21	30325898	30325898	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30325898delT	uc002ymr.2	-							NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294								ligase activity|zinc ion binding				0						AATACCACCCTTTTCCCAAAT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	31709205	31709205	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31709205delA								KRTAP26-1 (16598 upstream) : KRTAP27-1 (126 downstream)																							GAAAAACAAGAAAAAAAATCT	0.299													4	2	---	---	---	---	
TRAPPC10	7109	broad.mit.edu	37	21	45500154	45500155	+	Intron	DEL	TT	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45500154_45500155delTT	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc011afa.1_5'Flank	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						TTCACCTGACTTTTTTTTTTAT	0.228													4	2	---	---	---	---	
UFD1L	7353	broad.mit.edu	37	22	19462349	19462349	+	Intron	DEL	T	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19462349delT	uc002zpm.2	-						UFD1L_uc002zpo.2_Intron|UFD1L_uc011agy.1_Intron|UFD1L_uc002zpp.2_Intron|UFD1L_uc010grq.2_Intron|uc002zpq.1_5'Flank	NM_005659	NP_005650	Q92890	UFD1_HUMAN	ubiquitin fusion degradation 1-like isoform A						skeletal system development|ubiquitin-dependent protein catabolic process	cytosol|nucleus	protein binding|ubiquitin-specific protease activity				0	Colorectal(54;0.0993)					GGGAACCCCCTTCACAGAGGA	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27195884	27195884	+	IGR	DEL	C	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27195884delC								MIAT (80935 upstream) : MN1 (948382 downstream)																							GGACATGCAGCCGGATCTGCT	0.542													4	2	---	---	---	---	
MTMR3	8897	broad.mit.edu	37	22	30389871	30389871	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30389871delA	uc003agv.3	+						MTMR3_uc003agu.3_Intron|MTMR3_uc003agw.3_Intron	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c						phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			TTTGTGATGCaagggcatgtg	0.224													4	2	---	---	---	---	
TNRC6B	23112	broad.mit.edu	37	22	40480864	40480865	+	Intron	INS	-	A	A			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40480864_40480865insA	uc003aym.2	+							NM_001024843	NP_001020014	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 3						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						ATGTTAATTCTAAGTGCCTTGG	0.054													4	2	---	---	---	---	
TEF	7008	broad.mit.edu	37	22	41772208	41772208	+	Intron	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41772208delA	uc003azx.2	+							NM_001145398	NP_001138870	Q10587	TEF_HUMAN	thyrotrophic embryonic factor isoform 2						rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGTTCTGCTTATGCTCTACTG	0.209													4	2	---	---	---	---	
PARVB	29780	broad.mit.edu	37	22	44530145	44530145	+	Intron	DEL	G	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44530145delG	uc003ben.2	+						PARVB_uc003bem.2_Intron|PARVB_uc010gzn.2_Intron|PARVB_uc003beo.2_Intron	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b						cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)				TTCCTAAGGAGGATGTTTGTG	0.602													4	2	---	---	---	---	
MAP3K15	389840	broad.mit.edu	37	X	19431232	19431233	+	Intron	DEL	AC	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19431232_19431233delAC	uc004czk.1	-						MAP3K15_uc004czj.1_Intron	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase								ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					ATGTTTTTATacacacacacac	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	84791373	84791373	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84791373delA								POF1B (156625 upstream) : MIR1321 (299412 downstream)																							aatcttgaacaaaaaaaaaca	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	88671812	88671813	+	IGR	INS	-	TT	TT	rs10677362		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88671812_88671813insTT								CPXCR1 (662029 upstream) : TGIF2LX (505127 downstream)																							aaataGCAAACGAGAGCTTGAC	0.144													4	2	---	---	---	---	
SEPT6	23157	broad.mit.edu	37	X	118752507	118752507	+	3'UTR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118752507delA	uc004erv.2	-	10					SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_3'UTR	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						AAGAAACTCTAAAAAAAAAAT	0.418													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13524860	13524860	+	IGR	DEL	A	-	-			TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13524860delA								None (None upstream) : None (None downstream)																							TAATGGTGATAAAACTTTTCA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59014683	59014684	+	IGR	DEL	AT	-	-	rs10534960		TCGA-CZ-5464-01A-01D-1501-10	TCGA-CZ-5464-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59014683_59014684delAT								None (None upstream) : None (None downstream)																							acaaaacagaatgagagttccc	0.035													4	2	---	---	---	---	
