Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16975030	16975030	+	RNA	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16975030G>A	uc010och.1	+	7		c.1490G>A			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						CTCGGTTCACGTTTACCTCCG	0.607													3	23	---	---	---	---	PASS
MFSD2A	84879	broad.mit.edu	37	1	40435189	40435189	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40435189C>A	uc001cev.2	+	14	1762	c.1581C>A	c.(1579-1581)AGC>AGA	p.S527R	MFSD2A_uc001ceu.2_Missense_Mutation_p.S514R|MFSD2A_uc010ojc.1_Missense_Mutation_p.S358R|MFSD2A_uc009vvy.2_RNA|MFSD2A_uc001cex.2_Missense_Mutation_p.S178R	NM_001136493	NP_001129965	Q8NA29	MFS2A_HUMAN	major facilitator superfamily domain containing	527					transmembrane transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)|pancreas(1)	2						ACGAGGCCAGCAGCTCTGGCT	0.602													6	12	---	---	---	---	PASS
CDC20	991	broad.mit.edu	37	1	43825663	43825663	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43825663C>T	uc001cix.2	+	5	552	c.451C>T	c.(451-453)CTC>TTC	p.L151F	CDC20_uc001ciy.2_Missense_Mutation_p.L151F	NM_001255	NP_001246	Q12834	CDC20_HUMAN	cell division cycle 20	151					activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	cytosol|nucleoplasm|spindle	enzyme binding|protein C-terminus binding				0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACTGAAAGTACTCTACAGCCA	0.517													16	44	---	---	---	---	PASS
ITGB3BP	23421	broad.mit.edu	37	1	63920618	63920618	+	Silent	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63920618T>C	uc001dba.1	-	5	307	c.276A>G	c.(274-276)AAA>AAG	p.K92K	ITGB3BP_uc001dbb.1_Silent_p.K131K|ITGB3BP_uc001dbc.1_RNA|ITGB3BP_uc001dbd.1_RNA|ITGB3BP_uc009wak.1_Silent_p.K114K|ITGB3BP_uc001dbe.1_Silent_p.K5K	NM_014288	NP_055103	Q13352	CENPR_HUMAN	integrin beta 3 binding protein	92	Potential.				apoptosis|cell adhesion|CenH3-containing nucleosome assembly at centromere|induction of apoptosis by extracellular signals|mitotic prometaphase|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome, centromeric region|cytosol|membrane fraction|nucleoplasm	protein C-terminus binding|signal transducer activity				0						ATTTCTCAACTTTTGATAGCA	0.303													8	570	---	---	---	---	PASS
PRKACB	5567	broad.mit.edu	37	1	84679863	84679863	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84679863G>T	uc001djj.2	+	9	1057	c.793G>T	c.(793-795)GAT>TAT	p.D265Y	PRKACB_uc001djl.2_Missense_Mutation_p.D312Y|PRKACB_uc010ort.1_Missense_Mutation_p.D272Y|PRKACB_uc001djn.2_Missense_Mutation_p.D269Y|PRKACB_uc010oru.1_Missense_Mutation_p.D253Y|PRKACB_uc001djp.2_Missense_Mutation_p.D271Y|PRKACB_uc001djq.2_Missense_Mutation_p.D235Y|PRKACB_uc010orv.1_Missense_Mutation_p.D252Y	NM_002731	NP_002722	P22694	KAPCB_HUMAN	cAMP-dependent protein kinase catalytic subunit	265	Protein kinase.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding			lung(2)|ovary(1)	3				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		CTTCAGTTCAGATCTCAAGGA	0.388													63	285	---	---	---	---	PASS
SLC35A3	23443	broad.mit.edu	37	1	100472612	100472612	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100472612T>C	uc001dsp.1	+	4	562	c.365T>C	c.(364-366)CTT>CCT	p.L122P	SLC35A3_uc001dsq.1_Missense_Mutation_p.L122P|SLC35A3_uc009wdy.1_Missense_Mutation_p.L122P|SLC35A3_uc001dsr.1_Missense_Mutation_p.L164P|SLC35A3_uc001dss.1_Missense_Mutation_p.L41P	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A	122					UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		TTAAAAATTCTTACAACAGCA	0.279													75	325	---	---	---	---	PASS
DDX20	11218	broad.mit.edu	37	1	112305622	112305622	+	Silent	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112305622T>C	uc001ebs.2	+	10	1662	c.1305T>C	c.(1303-1305)CCT>CCC	p.P435P	DDX20_uc010owf.1_Silent_p.P197P|DDX20_uc001ebt.2_Silent_p.P43P	NM_007204	NP_009135	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	435	Helicase C-terminal.				assembly of spliceosomal tri-snRNP|ncRNA metabolic process	Cajal body|cytoskeleton|cytosol|spliceosomal complex	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding			lung(1)|kidney(1)	2		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCTTCTCCCTTTACCAGGTA	0.303													7	343	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152191542	152191542	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152191542C>T	uc001ezt.1	-	3	2639	c.2563G>A	c.(2563-2565)GGC>AGC	p.G855S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	855	9.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCATGTTGGCCGGAGCTTGAT	0.577													16	87	---	---	---	---	PASS
IVL	3713	broad.mit.edu	37	1	152882732	152882732	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152882732G>T	uc001fau.2	+	2	505	c.459G>T	c.(457-459)TTG>TTT	p.L153F		NM_005547	NP_005538	P07476	INVO_HUMAN	involucrin	153	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].|1.				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity			ovary(3)	3	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCAACTGTTGGAGCTCCCAG	0.259													5	71	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200587085	200587085	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200587085T>C	uc010ppk.1	-	2	1206	c.767A>G	c.(766-768)CAT>CGT	p.H256R	KIF14_uc010ppj.1_5'UTR	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	256	Required for PRC1-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						AATACTTCTATGATACAAGTT	0.373													97	395	---	---	---	---	PASS
KDM5B	10765	broad.mit.edu	37	1	202733213	202733213	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202733213G>A	uc001gyf.2	-	6	888	c.772C>T	c.(772-774)CGT>TGT	p.R258C	KDM5B_uc009xag.2_Missense_Mutation_p.R294C|KDM5B_uc001gyg.1_Missense_Mutation_p.R100C	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B	258					negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						CCCATTCGACGTCTCAGATTA	0.308													115	512	---	---	---	---	PASS
NUAK2	81788	broad.mit.edu	37	1	205290624	205290624	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205290624G>A	uc001hce.2	-	1	260	c.133C>T	c.(133-135)CAC>TAC	p.H45Y		NM_030952	NP_112214	Q9H093	NUAK2_HUMAN	NUAK family, SNF1-like kinase, 2	45					actin cytoskeleton organization|apoptosis|cellular response to glucose starvation|negative regulation of apoptosis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|stomach(1)|breast(1)	5	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TTGTGCTTGTGGTGGTGCCGC	0.667													3	18	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004727	248004727	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004727G>T	uc001idn.1	-	1	472	c.472C>A	c.(472-474)CTG>ATG	p.L158M		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGGGAAGGCAGAAAGCCTGTG	0.582													9	20	---	---	---	---	PASS
XPO1	7514	broad.mit.edu	37	2	61724064	61724064	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61724064C>T	uc002sbj.2	-	10	1566	c.838G>A	c.(838-840)GAA>AAA	p.E280K	XPO1_uc010fcl.2_Missense_Mutation_p.E276K|XPO1_uc010ypn.1_Missense_Mutation_p.E276K|XPO1_uc002sbk.2_5'UTR|XPO1_uc002sbh.2_5'Flank	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1	280	Necessary for HTLV-1 Rex-mediated mRNA export.				intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AATTGTTCTTCATATTGGCTT	0.363													5	246	---	---	---	---	PASS
MAT2A	4144	broad.mit.edu	37	2	85770896	85770896	+	3'UTR	SNP	A	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85770896A>C	uc002spr.2	+	9					MAT2A_uc010fgk.2_3'UTR	NM_005911	NP_005902	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha						methylation|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TAAATATTGAAAGTGTTAGCC	0.473													12	73	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109381095	109381095	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109381095C>T	uc002tem.3	+	20	4226	c.4100C>T	c.(4099-4101)TCA>TTA	p.S1367L		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1367	RanBP2-type 1.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						AAGAATGCTTCAACTGCTAAG	0.393													33	143	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109383602	109383602	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109383602G>A	uc002tem.3	+	20	6733	c.6607G>A	c.(6607-6609)GCG>ACG	p.A2203T		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2203					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						AGGTACAGGTGCGGCCGGTGC	0.403													9	53	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109383603	109383603	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109383603C>T	uc002tem.3	+	20	6734	c.6608C>T	c.(6607-6609)GCG>GTG	p.A2203V		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2203					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						GGTACAGGTGCGGCCGGTGCC	0.403													10	54	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109383605	109383605	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109383605G>A	uc002tem.3	+	20	6736	c.6610G>A	c.(6610-6612)GCC>ACC	p.A2204T		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2204					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						TACAGGTGCGGCCGGTGCCTC	0.398													8	55	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109398731	109398731	+	Silent	SNP	C	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109398731C>A	uc002tem.3	+	27	9034	c.8908C>A	c.(8908-8910)CGG>AGG	p.R2970R		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2970	RanBD1 4.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						GAATTATTACCGGATCCTAAT	0.378													6	338	---	---	---	---	PASS
IL1F9	56300	broad.mit.edu	37	2	113736205	113736205	+	5'UTR	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113736205A>G	uc002tio.1	+	2					IL1F9_uc010fkr.1_5'UTR	NM_019618	NP_062564	Q9NZH8	IL36G_HUMAN	interleukin 1 family, member 9						cell-cell signaling	extracellular space	cytokine activity|interleukin-1 receptor antagonist activity				0						AGGTGCTGAGACAACCACACT	0.517													5	122	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145156228	145156228	+	Silent	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145156228G>T	uc002tvu.2	-	8	3006	c.2526C>A	c.(2524-2526)ATC>ATA	p.I842I	ZEB2_uc002tvv.2_Silent_p.I836I|ZEB2_uc010zbm.1_Silent_p.I813I|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Silent_p.I871I	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	842						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		GATCTAAACTGATGCTACTAG	0.358													6	470	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155099374	155099374	+	Silent	SNP	G	A	A	rs147522830		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155099374G>A	uc002tyr.3	+	6	1209	c.642G>A	c.(640-642)ACG>ACA	p.T214T	GALNT13_uc002tyt.3_Silent_p.T214T|GALNT13_uc010foc.1_Silent_p.T33T|GALNT13_uc010fod.2_5'Flank	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	214	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						GTGAATGCACGTTAGGATGGC	0.473													5	139	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170007491	170007491	+	Silent	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170007491A>G	uc002ues.2	-	68	12720	c.12507T>C	c.(12505-12507)GCT>GCC	p.A4169A		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4169	Extracellular (Potential).|LDL-receptor class B 35.				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CATCAAGTTTAGCCACCTCAA	0.428													12	265	---	---	---	---	PASS
C2orf77	129881	broad.mit.edu	37	2	170518797	170518797	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170518797C>T	uc002ufe.2	-	5	906	c.812G>A	c.(811-813)CGG>CAG	p.R271Q		NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN	hypothetical protein LOC129881	271	Potential.										0						TACAAGAAACCGTCTCCTGCT	0.279													6	682	---	---	---	---	PASS
CAV3	859	broad.mit.edu	37	3	8787538	8787538	+	Silent	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8787538G>A	uc003bra.2	+	2	508	c.441G>A	c.(439-441)CTG>CTA	p.L147L	C3orf32_uc003bqz.2_5'Flank|CAV3_uc003brb.2_Silent_p.L147L	NM_001234	NP_001225	P56539	CAV3_HUMAN	caveolin 3	147	Cytoplasmic (Potential).				cell growth|elevation of cytosolic calcium ion concentration|muscle organ development|negative regulation of cardiac muscle hypertrophy|negative regulation of cell size|negative regulation of MAP kinase activity|negative regulation of sarcomere organization|positive regulation of microtubule polymerization|regulation of skeletal muscle contraction|regulation of ventricular cardiomyocyte membrane repolarization|T-tubule organization	caveola|dystrophin-associated glycoprotein complex|Golgi membrane|neuromuscular junction|T-tubule	protein C-terminus binding|protein complex binding|protein complex scaffold|sodium channel regulator activity			lung(1)|breast(1)	2						AGGTGGTGCTGCGGAAGGAGG	0.647													6	33	---	---	---	---	PASS
NGLY1	55768	broad.mit.edu	37	3	25761556	25761556	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25761556T>C	uc003cdl.2	-	11	1846	c.1738A>G	c.(1738-1740)ACA>GCA	p.T580A	NGLY1_uc010hfg.2_Missense_Mutation_p.T562A|NGLY1_uc003cdm.2_Intron|NGLY1_uc011awo.1_Missense_Mutation_p.T538A|NGLY1_uc003cdk.2_RNA	NM_018297	NP_060767	Q96IV0	NGLY1_HUMAN	N-glycanase 1 isoform 1	580	PAW.				glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding			breast(1)	1						CATTCTACTGTTCCAGTCTGA	0.373													6	265	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52643533	52643533	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52643533G>T	uc003des.2	-	16	2375	c.2363C>A	c.(2362-2364)TCA>TAA	p.S788*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.S788*|PBRM1_uc003der.2_Nonsense_Mutation_p.S756*|PBRM1_uc003det.2_Nonsense_Mutation_p.S803*|PBRM1_uc003deu.2_Nonsense_Mutation_p.S803*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.S788*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.S788*|PBRM1_uc003dey.2_Nonsense_Mutation_p.S788*|PBRM1_uc003dez.1_Nonsense_Mutation_p.S788*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.S701*|PBRM1_uc003dfa.1_Nonsense_Mutation_p.S134*|PBRM1_uc003dfc.2_Nonsense_Mutation_p.S155*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	788					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ACTCATGACTGACACAAAAAG	0.458			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								35	137	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113127970	113127970	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113127970C>T	uc003eae.1	-	7	919	c.873G>A	c.(871-873)TCG>TCA	p.S291S		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	291	WD 2.									central_nervous_system(1)	1						GGCCTGATCCCGATGTAGTAA	0.398													4	170	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180328082	180328082	+	Missense_Mutation	SNP	G	T	T	rs150698778		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180328082G>T	uc003fkk.2	+	12	2197	c.2065G>T	c.(2065-2067)GCT>TCT	p.A689S	TTC14_uc003fkl.2_3'UTR|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	689							RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CAAAAAATACGCTCACTCTGG	0.408													5	190	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195509939	195509939	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195509939G>T	uc011bto.1	-	3	8588	c.8128C>A	c.(8128-8130)CCT>ACT	p.P2710T	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGGGATGGTGACA	0.592													5	27	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55155210	55155210	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55155210C>G	uc003han.3	+	21	3140	c.2809C>G	c.(2809-2811)CCG>GCG	p.P937A	PDGFRA_uc003haa.2_Missense_Mutation_p.P697A	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	937	Protein kinase.|Cytoplasmic (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GAACAGTGAGCCGGAGAAGAG	0.537			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			70	307	---	---	---	---	PASS
CCDC158	339965	broad.mit.edu	37	4	77292666	77292666	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77292666T>G	uc003hkb.3	-	9	1206	c.1053A>C	c.(1051-1053)TTA>TTC	p.L351F		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	351	Potential.									skin(3)|ovary(2)|pancreas(1)	6						TGGCAAGGACTAACTGCTTTT	0.383													66	304	---	---	---	---	PASS
ENOPH1	58478	broad.mit.edu	37	4	83378172	83378172	+	Silent	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83378172T>C	uc003hmv.2	+	5	884	c.627T>C	c.(625-627)TTT>TTC	p.F209F	ENOPH1_uc003hmw.2_Silent_p.F121F|ENOPH1_uc003hmx.2_Silent_p.F63F	NM_021204	NP_067027	Q9UHY7	ENOPH_HUMAN	enolase-phosphatase 1	209					L-methionine salvage from methylthioadenosine	cytoplasm|nucleus	2,3-diketo-5-methylthiopentyl-1-phosphate enolase activity|2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase activity|acireductone synthase activity|magnesium ion binding|phosphoglycolate phosphatase activity				0						ACATTTTGTTTCTGACAGATG	0.383													7	264	---	---	---	---	PASS
LIN54	132660	broad.mit.edu	37	4	83858433	83858433	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83858433C>T	uc003hnx.3	-	9	1929	c.1551G>A	c.(1549-1551)TCG>TCA	p.S517S	LIN54_uc003hnz.3_Silent_p.S296S|LIN54_uc003hny.3_Silent_p.S116S|LIN54_uc010ijt.2_Silent_p.S428S|LIN54_uc010iju.2_Silent_p.S116S|LIN54_uc010ijv.2_Silent_p.S296S	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a	517					cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)				GCCGACTGGCCGACTCTGATG	0.303													8	213	---	---	---	---	PASS
SLC9A3	6550	broad.mit.edu	37	5	475720	475720	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:475720A>T	uc003jbe.2	-	15	2319	c.2207T>A	c.(2206-2208)TTC>TAC	p.F736Y	SLC9A3_uc011clx.1_Missense_Mutation_p.F727Y|LOC25845_uc003jbd.2_5'Flank|LOC25845_uc010itb.1_5'Flank|uc011cly.1_5'Flank	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	736	Cytoplasmic (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			ACTAGCCAGGAACTCGATCCC	0.637													7	34	---	---	---	---	PASS
RNF180	285671	broad.mit.edu	37	5	63513323	63513323	+	Intron	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63513323G>A	uc003jti.2	+						RNF180_uc003jth.3_3'UTR|RNF180_uc010iws.2_3'UTR	NM_001113561	NP_001107033	Q86T96	RN180_HUMAN	ring finger protein 180 isoform 1							integral to membrane|nuclear envelope	zinc ion binding				0		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		ttttctgtgcgtccttgaaag	0.000													21	85	---	---	---	---	PASS
THBS4	7060	broad.mit.edu	37	5	79368152	79368152	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79368152G>A	uc003kgh.2	+	15	2095	c.1772G>A	c.(1771-1773)CGG>CAG	p.R591Q	uc003kgi.3_Intron	NM_003248	NP_003239	P35443	TSP4_HUMAN	thrombospondin 4 precursor	591	TSP type-3 5.				endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity				0		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		CGTGACCAACGGGACAAGGAT	0.473													4	215	---	---	---	---	PASS
XRCC4	7518	broad.mit.edu	37	5	82499423	82499423	+	Missense_Mutation	SNP	C	T	T	rs140143447		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82499423C>T	uc003kib.2	+	5	663	c.535C>T	c.(535-537)CGG>TGG	p.R179W	XRCC4_uc003kia.1_Missense_Mutation_p.R179W|XRCC4_uc003kid.2_Missense_Mutation_p.R179W|XRCC4_uc003kic.2_Missense_Mutation_p.R179W|XRCC4_uc003kie.2_Missense_Mutation_p.R179W|XRCC4_uc003kif.1_Missense_Mutation_p.R179W|XRCC4_uc003kig.2_5'Flank	NM_022406	NP_071801	Q13426	XRCC4_HUMAN	X-ray repair cross complementing protein 4	179					DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding			skin(3)	3		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		TCTTTATAAGCGGTTTATTCT	0.318								NHEJ					5	476	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112178912	112178912	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112178912A>G	uc010jby.2	+	16	8001	c.7621A>G	c.(7621-7623)ATC>GTC	p.I2541V	APC_uc011cvt.1_Missense_Mutation_p.I2523V|APC_uc003kpz.3_Missense_Mutation_p.I2541V|APC_uc003kpy.3_Missense_Mutation_p.I2541V|APC_uc010jbz.2_Missense_Mutation_p.I2258V|APC_uc010jca.2_Missense_Mutation_p.I1841V	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	2541	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TAGACTTCCAATCAATAGGTC	0.443		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			19	90	---	---	---	---	PASS
RAD50	10111	broad.mit.edu	37	5	131894978	131894978	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131894978C>T	uc003kxi.2	+	2	519	c.132C>T	c.(130-132)ACC>ACT	p.T44T	RAD50_uc003kxg.1_5'UTR|RAD50_uc003kxh.2_5'UTR	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	44					DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTCTTTAGACCATCATTGAAT	0.294								Homologous_recombination					5	245	---	---	---	---	PASS
BRD8	10902	broad.mit.edu	37	5	137486669	137486669	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137486669A>G	uc003lcf.1	-	22	2940	c.2885T>C	c.(2884-2886)ATC>ACC	p.I962T	BRD8_uc003lcc.1_Intron	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	962					cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GTTGCTGCTGATGCACAAGGG	0.443													5	133	---	---	---	---	PASS
APBB3	10307	broad.mit.edu	37	5	139942267	139942267	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139942267C>T	uc003lgd.1	-	4	691	c.332G>A	c.(331-333)AGC>AAC	p.S111N	APBB3_uc003lgb.1_5'UTR|APBB3_uc003lgc.1_5'UTR|APBB3_uc003lge.1_Missense_Mutation_p.S111N|APBB3_uc003lgf.1_RNA|APBB3_uc010jfp.1_RNA|APBB3_uc011czi.1_Intron|APBB3_uc010jfq.1_5'Flank|SLC35A4_uc003lgg.1_5'Flank|SLC35A4_uc003lgh.1_5'Flank	NM_133172	NP_573418	O95704	APBB3_HUMAN	amyloid beta precursor protein-binding, family	111						actin cytoskeleton|cytoplasm				ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCTCCATGCTCTGGATGTA	0.532													13	103	---	---	---	---	PASS
PCDHB1	29930	broad.mit.edu	37	5	140432455	140432455	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140432455C>T	uc003lik.1	+	1	1477	c.1400C>T	c.(1399-1401)CCT>CTT	p.P467L		NM_013340	NP_037472	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1 precursor	467	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACAACAGTCCTGCGGTTTTT	0.413													44	79	---	---	---	---	PASS
SLC36A1	206358	broad.mit.edu	37	5	150846769	150846769	+	Silent	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150846769G>A	uc003luc.2	+	6	646	c.429G>A	c.(427-429)GTG>GTA	p.V143V	GM2A_uc011dcs.1_Intron|SLC36A1_uc003lub.1_Silent_p.V143V|SLC36A1_uc010jhw.1_Silent_p.V143V	NM_078483	NP_510968	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 member 1	143	Helical; Name=3; (Potential).				cellular nitrogen compound metabolic process|ion transport	endoplasmic reticulum|integral to membrane|lysosomal membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			skin(1)	1		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Glycine(DB00145)|L-Alanine(DB00160)	GACGTGTTGTGGACTTCTTCC	0.403													7	615	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169474616	169474616	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169474616C>T	uc003maf.2	+	40	4149	c.4069C>T	c.(4069-4071)CGG>TGG	p.R1357W	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.R849W	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1357	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCCTTCCTGCGGGTGAGTTT	0.542													21	74	---	---	---	---	PASS
DBN1	1627	broad.mit.edu	37	5	176894265	176894265	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176894265C>A	uc003mgy.2	-	6	718	c.546G>T	c.(544-546)GAG>GAT	p.E182D	DBN1_uc003mgx.2_Missense_Mutation_p.E184D|DBN1_uc010jkn.1_Missense_Mutation_p.E132D|DBN1_uc003mgz.1_Missense_Mutation_p.E119D	NM_004395	NP_004386	Q16643	DREB_HUMAN	drebrin 1 isoform a	182					actin filament organization|regulation of dendrite development|regulation of neuronal synaptic plasticity	actomyosin|cytoplasm|dendrite	actin binding|profilin binding			breast(3)|ovary(1)|lung(1)|skin(1)	6	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTTGGCCTGCTCCCAGAACT	0.612													16	141	---	---	---	---	PASS
SLC22A7	10864	broad.mit.edu	37	6	43272449	43272449	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43272449C>T	uc003out.2	+	11	1732	c.1633C>T	c.(1633-1635)CAG>TAG	p.Q545*		NM_153320	NP_696961	Q9Y694	S22A7_HUMAN	solute carrier family 22 member 7 isoform b	545						basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			GCCCATGAAGCAGGTCCAGAA	0.607													9	42	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90358035	90358035	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90358035G>C	uc003pnn.1	-	98	16336	c.16220C>G	c.(16219-16221)TCT>TGT	p.S5407C		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	5407	VWFA.				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CACAGCCAAAGATTCAAATGC	0.373													53	248	---	---	---	---	PASS
ZUFSP	221302	broad.mit.edu	37	6	116981933	116981933	+	Silent	SNP	A	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116981933A>C	uc003pxf.1	-	3	882	c.636T>G	c.(634-636)GTT>GTG	p.V212V	ZUFSP_uc010kef.1_Silent_p.V16V	NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	212	C2H2-type 3.					intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		AATGCAAGTCAACATGTTCCT	0.313													53	246	---	---	---	---	PASS
FABP7	2173	broad.mit.edu	37	6	123104810	123104810	+	Intron	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123104810G>T	uc003pzf.2	+						FABP7_uc003pze.1_3'UTR	NM_001446	NP_001437	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain						negative regulation of cell proliferation	cytoplasm	lipid binding|transporter activity				0				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|gamma-Homolinolenic acid(DB00154)|Icosapent(DB00159)	TTTAAAATTCGGTGACTGAAG	0.338													7	483	---	---	---	---	PASS
TNFAIP3	7128	broad.mit.edu	37	6	138201233	138201233	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138201233C>T	uc003qhr.2	+	8	1998	c.1932C>T	c.(1930-1932)GTC>GTT	p.V644V	TNFAIP3_uc003qhs.2_Silent_p.V644V	NM_006290	NP_006281	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	644	Interaction with NAF1 (By similarity).				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	p.0?(22)		haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CAGGGAAAGTCAGTCCCACAG	0.517			D|N|F		marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma								12	49	---	---	---	---	PASS
PLEKHG1	57480	broad.mit.edu	37	6	151151969	151151969	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151151969C>T	uc003qny.1	+	16	2034	c.1722C>T	c.(1720-1722)ACC>ACT	p.T574T	PLEKHG1_uc011eel.1_Silent_p.T614T|PLEKHG1_uc011eem.1_Silent_p.T633T|PLEKHG1_uc003qnz.2_Silent_p.T574T	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G	574					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TGAACTCTACCAGACTATGTG	0.517													4	79	---	---	---	---	PASS
SUN1	23353	broad.mit.edu	37	7	905604	905604	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:905604G>T	uc011jvp.1	+	17	1959	c.1880G>T	c.(1879-1881)AGT>ATT	p.S627I	GET4_uc003sjj.1_RNA|SUN1_uc003sjf.2_Missense_Mutation_p.S544I|SUN1_uc011jvq.1_Missense_Mutation_p.S524I|SUN1_uc003sjg.2_Missense_Mutation_p.S532I|SUN1_uc011jvr.1_Missense_Mutation_p.S425I|SUN1_uc003sji.2_Missense_Mutation_p.S465I|SUN1_uc003sjk.2_Missense_Mutation_p.S266I	NM_001130965	NP_001124437	O94901	SUN1_HUMAN	unc-84 homolog A isoform a	654	Perinuclear space.|SUN.				cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0						AGCATCTTGAGTACTCGCTGT	0.488													60	126	---	---	---	---	PASS
RABGEF1	27342	broad.mit.edu	37	7	66260561	66260561	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66260561A>T	uc011kee.1	+	5	783	c.619A>T	c.(619-621)ATG>TTG	p.M207L	RABGEF1_uc003tvf.2_Missense_Mutation_p.M27L|RABGEF1_uc003tvg.2_Missense_Mutation_p.M1L|RABGEF1_uc010lag.2_Missense_Mutation_p.M193L|RABGEF1_uc003tvh.2_Missense_Mutation_p.M193L|RABGEF1_uc003tvi.2_Missense_Mutation_p.M27L	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	371					endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						GGCCGAAAGGATGCAAACTCG	0.453													32	150	---	---	---	---	PASS
AHCYL2	23382	broad.mit.edu	37	7	129045730	129045730	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129045730G>A	uc011kov.1	+	9	1250	c.1196G>A	c.(1195-1197)GGC>GAC	p.G399D	AHCYL2_uc003vot.2_Missense_Mutation_p.G398D|AHCYL2_uc003vov.2_Missense_Mutation_p.G296D|AHCYL2_uc011kow.1_Missense_Mutation_p.G297D|AHCYL2_uc011kox.1_Missense_Mutation_p.G296D	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN	S-adenosylhomocysteine hydrolase-like 2 isoform	399					one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2						GTAGTCTGTGGCTATGGAGAG	0.318													94	641	---	---	---	---	PASS
COPG2	26958	broad.mit.edu	37	7	130292326	130292326	+	Intron	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130292326G>A	uc003vqh.1	-							NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)					acattgtaatgatatactgta	0.000													113	274	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151877031	151877031	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151877031T>C	uc003wla.2	-	37	7549	c.7330A>G	c.(7330-7332)AGG>GGG	p.R2444G	MLL3_uc003wkz.2_Missense_Mutation_p.R1505G|MLL3_uc003wky.2_5'Flank	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2444	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ACAGGAGACCTAATGTTCCCA	0.532			N		medulloblastoma								6	163	---	---	---	---	PASS
LPL	4023	broad.mit.edu	37	8	19811832	19811832	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19811832C>T	uc003wzk.3	+	5	1113	c.743C>T	c.(742-744)GCT>GTT	p.A248V		NM_000237	NP_000228	P06858	LIPL_HUMAN	lipoprotein lipase precursor	248					fatty acid biosynthetic process|lipoprotein metabolic process|phospholipid metabolic process|positive regulation of cholesterol storage|positive regulation of sequestering of triglyceride|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	anchored to membrane|chylomicron|plasma membrane|very-low-density lipoprotein particle	heparin binding|lipoprotein lipase activity|phospholipase activity|receptor binding|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	Clofibrate(DB00636)|Gemfibrozil(DB01241)|Orlistat(DB01083)	ATTGGAGAAGCTATCCGCGTG	0.443													9	163	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30695427	30695427	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30695427G>T	uc003xil.2	-	3	7224	c.7224C>A	c.(7222-7224)TGC>TGA	p.C2408*		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2408										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ACTTTGATGCGCAAGTGTCTT	0.368													5	381	---	---	---	---	PASS
MYBL1	4603	broad.mit.edu	37	8	67479018	67479018	+	Silent	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67479018G>T	uc003xwj.2	-	14	2258	c.1851C>A	c.(1849-1851)ACC>ACA	p.T617T	MYBL1_uc003xwl.2_Silent_p.T617T|MYBL1_uc003xwk.2_Silent_p.T616T	NM_001080416	NP_001073885	P10243	MYBA_HUMAN	v-myb myeloblastosis viral oncogene homolog	617					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)	3			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			TCCCAGAAGCGGTATTCTAGA	0.343													7	735	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71068766	71068766	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71068766T>C	uc003xyn.1	-	11	1996	c.1834A>G	c.(1834-1836)ACA>GCA	p.T612A		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	612					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GGGTCATTTGTTTCCTTTTGC	0.547			T	RUNXBP2	AML								6	209	---	---	---	---	PASS
TMEM70	54968	broad.mit.edu	37	8	74893789	74893789	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74893789A>G	uc003yab.2	+	3	803	c.716A>G	c.(715-717)GAC>GGC	p.D239G	TMEM70_uc003yac.2_3'UTR	NM_017866	NP_060336	Q9BUB7	TMM70_HUMAN	transmembrane protein 70 isoform a	239					mitochondrial proton-transporting ATP synthase complex assembly	integral to mitochondrial membrane|mitochondrial inner membrane				ovary(1)	1	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			ATGGGTTATGACAAAGAAGAA	0.333													6	187	---	---	---	---	PASS
PKIA	5569	broad.mit.edu	37	8	79514097	79514097	+	3'UTR	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79514097A>G	uc003yba.2	+	4					PKIA_uc003ybb.2_3'UTR|PKIA_uc010lzo.2_3'UTR	NM_006823	NP_006814	P61925	IPKA_HUMAN	cAMP-dependent protein kinase inhibitor alpha								cAMP-dependent protein kinase inhibitor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						AAATGTCTCAAATCTCCAGGA	0.443													6	325	---	---	---	---	PASS
CDH17	1015	broad.mit.edu	37	8	95164306	95164306	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95164306A>G	uc003ygh.2	-	13	1711	c.1586T>C	c.(1585-1587)ATT>ACT	p.I529T	CDH17_uc011lgo.1_Missense_Mutation_p.I315T|CDH17_uc011lgp.1_Missense_Mutation_p.I529T	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	529	Extracellular (Potential).|Cadherin 5.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TTTGAACACAATGTTGGAAAC	0.388													6	328	---	---	---	---	PASS
FANCC	2176	broad.mit.edu	37	9	98011487	98011487	+	Silent	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98011487T>C	uc004avh.2	-	2	349	c.87A>G	c.(85-87)GAA>GAG	p.E29E	FANCC_uc004avi.3_Silent_p.E29E|FANCC_uc010mrm.1_RNA|FANCC_uc011lul.1_RNA	NM_000136	NP_000127	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	29					protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)				CTTGCTGGGTTTCCAAAGTGG	0.433			D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	155	---	---	---	---	PASS
PARG	8505	broad.mit.edu	37	10	51077571	51077571	+	Silent	SNP	C	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51077571C>A	uc001jif.2	-	10	2280	c.2019G>T	c.(2017-2019)CCG>CCT	p.P673P	PARG_uc001jih.2_Silent_p.P673P|PARG_uc001jig.2_Silent_p.P259P|PARG_uc010qgv.1_Intron|PARG_uc009xoi.2_Intron|PARG_uc010qgw.1_Silent_p.P564P|PARG_uc009xoj.2_Silent_p.P224P|PARG_uc010qgx.1_Silent_p.P591P	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	673					carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		TAAGTTTCTCCGGTTTCCTTG	0.338													5	522	---	---	---	---	PASS
STOX1	219736	broad.mit.edu	37	10	70641800	70641800	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70641800A>G	uc001jos.2	+	2	484	c.397A>G	c.(397-399)ATG>GTG	p.M133V	STOX1_uc001jor.2_Missense_Mutation_p.M133V|STOX1_uc009xpy.2_Missense_Mutation_p.M133V|STOX1_uc001joq.2_Missense_Mutation_p.M23V	NM_001130161	NP_001123633	Q6ZVD7	STOX1_HUMAN	storkhead box 1 isoform a	133						cytoplasm|nucleolus	DNA binding			kidney(1)|skin(1)	2						TATATCTGATATGAATACAGC	0.363													6	524	---	---	---	---	PASS
DNTT	1791	broad.mit.edu	37	10	98098063	98098063	+	3'UTR	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98098063A>G	uc001kmf.2	+	11					DNTT_uc001kmg.2_3'UTR	NM_004088	NP_004079	P04053	TDT_HUMAN	terminal deoxynucleotidyltransferase isoform 1						DNA modification	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(1)	1		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		GCCATAGGAGAGTTTGGGGTT	0.308													5	128	---	---	---	---	PASS
BCCIP	56647	broad.mit.edu	37	10	127519136	127519136	+	Silent	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127519136G>T	uc001ljb.3	+	4	350	c.327G>T	c.(325-327)ACG>ACT	p.T109T	BCCIP_uc001ljd.3_Silent_p.T109T|BCCIP_uc010qui.1_Silent_p.T109T|BCCIP_uc001ljc.3_Silent_p.T109T|BCCIP_uc010quj.1_Intron	NM_078468	NP_510868	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A-interacting protein isoform	109	Interaction with BRCA2.				cell cycle|DNA repair|neuroendocrine cell differentiation|regulation of cyclin-dependent protein kinase activity	nuclear cyclin-dependent protein kinase holoenzyme complex	kinase regulator activity|protein binding			ovary(1)|breast(1)	2		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				aataGCAAACGGATGTTTCAG	0.284													6	675	---	---	---	---	PASS
DOCK1	1793	broad.mit.edu	37	10	129231596	129231596	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129231596G>A	uc001ljt.2	+	48	4965	c.4901G>A	c.(4900-4902)CGG>CAG	p.R1634Q	DOCK1_uc010qun.1_Missense_Mutation_p.R1655Q|DOCK1_uc009yaq.2_Missense_Mutation_p.R629Q	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1634					apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TCCATGGTGCGGTCCTTCACG	0.602													3	41	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33628343	33628343	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33628343A>G	uc001mup.3	+	13	4287	c.4163A>G	c.(4162-4164)GAG>GGG	p.E1388G		NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	1382						integral to membrane				ovary(2)	2						AGGAGCCAGGAGTCATCGGCA	0.597													3	9	---	---	---	---	PASS
AGBL2	79841	broad.mit.edu	37	11	47713657	47713657	+	Silent	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47713657T>C	uc001ngg.2	-	8	946	c.846A>G	c.(844-846)AGA>AGG	p.R282R	AGBL2_uc001ngf.2_5'Flank|AGBL2_uc010rhq.1_Silent_p.R244R|AGBL2_uc001ngh.1_Silent_p.R226R	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN	carboxypeptidase 2, cytosolic	282					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2						TTACTCACACTCTGACAGCTT	0.383													53	249	---	---	---	---	PASS
SLC22A9	114571	broad.mit.edu	37	11	63175623	63175623	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63175623T>A	uc001nww.2	+	8	1596	c.1328T>A	c.(1327-1329)TTA>TAA	p.L443*	SLC22A9_uc001nwx.2_Intron	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	443	Helical; (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						ACACTGGGCTTAGGAGCGTCT	0.483													25	122	---	---	---	---	PASS
SDHD	6392	broad.mit.edu	37	11	111965721	111965721	+	3'UTR	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111965721T>C	uc001pmz.2	+	4						NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D						respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	CTTTGAAGAATTGATGTATGC	0.418			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				5	10	---	---	---	---	PASS
TMEM25	84866	broad.mit.edu	37	11	118404209	118404209	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118404209G>T	uc010rye.1	+	5	922	c.748G>T	c.(748-750)GTG>TTG	p.V250L	TMEM25_uc010ryd.1_Missense_Mutation_p.V250L|TMEM25_uc001ptk.3_Missense_Mutation_p.V250L|TMEM25_uc001pth.2_Intron|TMEM25_uc009zad.2_Intron|TMEM25_uc001pti.2_Intron|TMEM25_uc010ryf.1_Missense_Mutation_p.V153L|TMEM25_uc001ptl.2_Missense_Mutation_p.V250L|TMEM25_uc001ptm.2_Intron|TMEM25_uc001ptn.2_Intron	NM_032780	NP_116169	Q86YD3	TMM25_HUMAN	transmembrane protein 25 isoform 1	250	Helical; (Potential).					extracellular region|integral to membrane|plasma membrane					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		GGGCACCCTCGTGGGGTTCAG	0.607													12	32	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122930276	122930276	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122930276C>G	uc001pyo.2	-	5	1103	c.1025G>C	c.(1024-1026)CGT>CCT	p.R342P	HSPA8_uc009zbc.2_Missense_Mutation_p.R106P|HSPA8_uc001pyp.2_Missense_Mutation_p.R342P|HSPA8_uc010rzu.1_Missense_Mutation_p.R265P|HSPA8_uc009zbd.1_Missense_Mutation_p.R342P	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	342	Interaction with BAG1.				cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CTTGGGGATACGAGTAGAACC	0.463													9	64	---	---	---	---	PASS
ZBTB44	29068	broad.mit.edu	37	11	130131008	130131008	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130131008A>T	uc001qga.2	-	2	1155	c.761T>A	c.(760-762)TTA>TAA	p.L254*	ZBTB44_uc001qgb.3_Nonsense_Mutation_p.L254*|ZBTB44_uc001qfx.2_RNA|ZBTB44_uc001qgc.1_Nonsense_Mutation_p.L254*|ZBTB44_uc001qfz.2_Nonsense_Mutation_p.L254*	NM_014155	NP_054874	Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	254					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		AGGTAATTCTAAAGTCCGGGT	0.433													23	68	---	---	---	---	PASS
CLSTN3	9746	broad.mit.edu	37	12	7295478	7295478	+	Silent	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7295478G>T	uc001qsr.2	+	11	1832	c.1554G>T	c.(1552-1554)TCG>TCT	p.S518S	CLSTN3_uc001qss.2_Silent_p.S530S	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	518	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						ACCCTTTGTCGATCCACCACT	0.428											OREG0021650	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	35	47	---	---	---	---	PASS
DNM1L	10059	broad.mit.edu	37	12	32886681	32886681	+	Silent	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32886681T>C	uc001rld.2	+	13	1640	c.1479T>C	c.(1477-1479)TAT>TAC	p.Y493Y	DNM1L_uc001rle.2_Silent_p.Y493Y|DNM1L_uc001rlf.2_Silent_p.Y493Y|DNM1L_uc010skh.1_Silent_p.Y559Y|DNM1L_uc001rlg.2_Silent_p.Y559Y|DNM1L_uc001rlh.2_Silent_p.Y546Y|DNM1L_uc010ski.1_Silent_p.Y290Y	NM_012062	NP_036192	O00429	DNM1L_HUMAN	dynamin 1-like isoform 1	493	Interaction with GSK3B.				cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AACTGGCTTATATCAACACAA	0.299													106	617	---	---	---	---	PASS
SLC4A8	9498	broad.mit.edu	37	12	51897852	51897852	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51897852C>A	uc001rys.1	+	23	3299	c.3121C>A	c.(3121-3123)CCC>ACC	p.P1041T	SLC4A8_uc001ryo.2_Missense_Mutation_p.P988T|SLC4A8_uc001ryt.1_RNA	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate	1041	Cytoplasmic (Potential).				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		AGACAAGTTTCCCTTAGAGAG	0.398													67	313	---	---	---	---	PASS
MFSD5	84975	broad.mit.edu	37	12	53647588	53647588	+	Silent	SNP	C	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53647588C>G	uc001sci.1	+	2	1160	c.969C>G	c.(967-969)GTC>GTG	p.V323V	MFSD5_uc001sch.1_Silent_p.V430V	NM_032889	NP_116278	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing	323	Helical; (Potential).				transport	integral to membrane				skin(2)|ovary(1)	3						TCATCGTCGTCTTCTCTCTCT	0.537													11	76	---	---	---	---	PASS
METTL7B	196410	broad.mit.edu	37	12	56076036	56076036	+	Silent	SNP	G	A	A	rs144071589		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56076036G>A	uc010spr.1	+	1	707	c.498G>A	c.(496-498)CCG>CCA	p.P166P		NM_152637	NP_689850	Q6UX53	MET7B_HUMAN	methyltransferase like 7B precursor	166							methyltransferase activity				0						TACTGAGACCGGTAAGCAGGG	0.622													9	12	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56096858	56096858	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56096858T>C	uc001shh.2	-	2	531	c.311A>G	c.(310-312)TAC>TGC	p.Y104C	ITGA7_uc001shg.2_Missense_Mutation_p.Y104C|ITGA7_uc010sps.1_Intron|ITGA7_uc009znx.2_5'Flank	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	104	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						GTCCACTCTGTAGCAGTCAGT	0.642													6	29	---	---	---	---	PASS
AVIL	10677	broad.mit.edu	37	12	58201174	58201174	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58201174C>G	uc001sqj.1	-	12	1460	c.1431G>C	c.(1429-1431)AGG>AGC	p.R477S	AVIL_uc009zqe.1_Missense_Mutation_p.R470S|AVIL_uc001sqk.1_Missense_Mutation_p.R55S|AVIL_uc001sql.3_Missense_Mutation_p.R454S	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin	477	Core (By similarity).				actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					CCGTTCCCATCCTGACTCGAA	0.557													19	109	---	---	---	---	PASS
TDG	6996	broad.mit.edu	37	12	104380948	104380948	+	3'UTR	SNP	A	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104380948A>C	uc001tkg.2	+	10					TDG_uc009zuk.2_3'UTR|TDG_uc010swi.1_3'UTR|TDG_uc010swj.1_3'UTR	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase						depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		TTGCTAACTGAAGTGTTTTAT	0.368								BER_DNA_glycosylases					9	38	---	---	---	---	PASS
DIS3	22894	broad.mit.edu	37	13	73347935	73347935	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73347935C>G	uc001vix.3	-	8	1500	c.1126G>C	c.(1126-1128)GCT>CCT	p.A376P	DIS3_uc001viy.3_Missense_Mutation_p.A346P|DIS3_uc001viz.2_RNA	NM_014953	NP_055768	Q9Y2L1	RRP44_HUMAN	DIS3 mitotic control isoform a	376					CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding			central_nervous_system(1)	1		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		CTCTTATCAGCAGGTGTAAAG	0.378										Multiple Myeloma(4;0.011)			70	266	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22891755	22891755	+	Intron	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22891755T>C	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Silent_p.L23L|uc001wdt.1_Intron|uc001wdu.2_Silent_p.L23L					SubName: Full=Alpha-chain C region; Flags: Fragment;																		AGCCATTGAGTTGGTGCCTGA	0.522													5	86	---	---	---	---	PASS
FBXO33	254170	broad.mit.edu	37	14	39871677	39871677	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39871677A>G	uc001wvk.2	-	2	976	c.638T>C	c.(637-639)GTT>GCT	p.V213A		NM_203301	NP_976046	Q7Z6M2	FBX33_HUMAN	F-box protein 33	213											0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		CTGTTGTAGAACACTTATGTC	0.299													7	463	---	---	---	---	PASS
SAMD4A	23034	broad.mit.edu	37	14	55203899	55203899	+	Silent	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55203899G>A	uc001xbb.2	+	3	871	c.870G>A	c.(868-870)CTG>CTA	p.L290L	SAMD4A_uc001xbc.2_Intron	NM_015589	NP_056404	Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4 isoform	291					positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0						ATGCCCCCCTGTCTCCACAAA	0.522													20	56	---	---	---	---	PASS
DDX24	57062	broad.mit.edu	37	14	94519372	94519372	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94519372C>T	uc001ycj.2	-	8	2379	c.2280G>A	c.(2278-2280)GAG>GAA	p.E760E	DDX24_uc010twq.1_Silent_p.E717E|DDX24_uc010twr.1_Silent_p.E510E	NM_020414	NP_065147	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24	760					RNA metabolic process	cytoplasm|nucleolus|nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|skin(1)	4		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		CCAGCTCAATCTCCAGGGCAG	0.478													21	71	---	---	---	---	PASS
MIR299	407023	broad.mit.edu	37	14	101490139	101490139	+	RNA	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101490139G>A	hsa-mir-299|MI0000744	+			c.9G>A			uc001yjx.1_RNA|uc010awb.1_5'Flank|MIR380_hsa-mir-380|MI0000788_5'Flank|MIR1197_hsa-mir-1197|MI0006656_5'Flank|uc001yjy.1_5'Flank|MIR323_hsa-mir-323|MI0000807_5'Flank|MIR758_hsa-mir-758|MI0003757_5'Flank|MIR329-1_hsa-mir-329-1|MI0001725_5'Flank																	0						TGAAGAAATGGTTTACCGTCC	0.517													3	19	---	---	---	---	PASS
MIR329-1	574408	broad.mit.edu	37	14	101493161	101493161	+	RNA	SNP	A	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101493161A>T	hsa-mir-329-1|MI0001725	+			c.40A>T			MIR329-2_hsa-mir-329-2|MI0001726_5'Flank|MIR494_hsa-mir-494|MI0003134_5'Flank|uc010txm.1_5'Flank																	0						TGTTTCTTTAATGAGGACGAA	0.468													8	587	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23811842	23811842	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23811842C>T	uc001ywh.3	+	1	1389	c.913C>T	c.(913-915)CGT>TGT	p.R305C	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Missense_Mutation_p.R305C	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	305						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		TGCTGTGCAGCGTGGTATGGA	0.522													19	87	---	---	---	---	PASS
CCNB2	9133	broad.mit.edu	37	15	59408907	59408907	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59408907A>T	uc002afz.2	+	6	764	c.616A>T	c.(616-618)AAG>TAG	p.K206*	CCNB2_uc010bge.2_Nonsense_Mutation_p.K125*	NM_004701	NP_004692	O95067	CCNB2_HUMAN	cyclin B2	206					cell cycle checkpoint|cell division|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	centrosome|cytosol|nucleus	protein kinase binding				0						AGTTTCCCGGAAGAAGCTTCA	0.403													42	175	---	---	---	---	PASS
ZNF609	23060	broad.mit.edu	37	15	64967175	64967175	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64967175C>G	uc002ann.2	+	4	2122	c.2122C>G	c.(2122-2124)CCC>GCC	p.P708A		NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	708						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						TCAGCCCAAGCCCACTGTTAT	0.517													6	24	---	---	---	---	PASS
NOMO2	283820	broad.mit.edu	37	16	18573208	18573208	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18573208G>C	uc002dfe.2	-	1	227	c.155C>G	c.(154-156)TCG>TGG	p.S52W	NOMO2_uc002dff.2_Missense_Mutation_p.S52W|NOMO2_uc010bvx.2_5'UTR	NM_001004060	NP_001004060	Q5JPE7	NOMO2_HUMAN	nodal modulator 2 isoform 1	52	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			skin(1)	1						CTCGATGAGCGAGTAGTTGAT	0.602													3	4	---	---	---	---	PASS
KIF1C	10749	broad.mit.edu	37	17	4924146	4924146	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4924146C>T	uc002gan.1	+	21	2309	c.1983C>T	c.(1981-1983)GCC>GCT	p.A661A		NM_006612	NP_006603	O43896	KIF1C_HUMAN	kinesin family member 1C	661	Potential.				microtubule-based movement|retrograde vesicle-mediated transport, Golgi to ER	endoplasmic reticulum|Golgi apparatus|microtubule	ATP binding|microtubule motor activity			breast(2)	2						AGGAAGAAGCCGATCTTCTGC	0.582													3	24	---	---	---	---	PASS
RPAIN	84268	broad.mit.edu	37	17	5335887	5335887	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5335887T>C	uc002gbq.2	+	7	1226	c.656T>C	c.(655-657)CTC>CCC	p.L219P	RPAIN_uc010vtb.1_3'UTR|RPAIN_uc002gbs.2_Missense_Mutation_p.L235P|RPAIN_uc002gbt.2_Missense_Mutation_p.L172P|RPAIN_uc002gbu.2_Missense_Mutation_p.L188P|RPAIN_uc002gbv.2_RNA|RPAIN_uc002gbr.2_RNA|RPAIN_uc002gbw.2_3'UTR	NM_001033002	NP_001028174	Q86UA6	RIP_HUMAN	RPA interacting protein isoform b	219					DNA recombination|DNA repair|DNA-dependent DNA replication|protein import into nucleus|response to UV	cytoplasm|cytoplasm|nucleolus|PML body|PML body	metal ion binding|protein complex binding				0						GCTGTGATCCTCTAGAGCCAG	0.363													8	459	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35932009	35932009	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35932009A>G	uc002hoa.2	-	9	1062	c.979T>C	c.(979-981)TCA>CCA	p.S327P	SYNRG_uc010wde.1_Missense_Mutation_p.S249P|SYNRG_uc010wdf.1_Missense_Mutation_p.S249P|SYNRG_uc002hoc.2_Missense_Mutation_p.S248P|SYNRG_uc002hoe.2_Missense_Mutation_p.S249P|SYNRG_uc002hod.2_Missense_Mutation_p.S249P|SYNRG_uc010wdg.1_Missense_Mutation_p.S249P|SYNRG_uc002hob.2_Missense_Mutation_p.S327P|SYNRG_uc002hof.2_Missense_Mutation_p.S39P|SYNRG_uc010cvd.1_Missense_Mutation_p.S127P|SYNRG_uc002hog.1_Missense_Mutation_p.S461P|SYNRG_uc010wdh.1_3'UTR	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	327	EH.				endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						AGCCCAGATGACATCAGAATG	0.403													8	538	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67124895	67124895	+	Silent	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67124895G>T	uc002jhw.1	-	8	1159	c.984C>A	c.(982-984)ACC>ACA	p.T328T		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	328	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					CAACCAAATTGGTGAGGACAG	0.388													40	177	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67124896	67124896	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67124896G>T	uc002jhw.1	-	8	1158	c.983C>A	c.(982-984)ACC>AAC	p.T328N		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	328	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					AACCAAATTGGTGAGGACAGC	0.393													40	173	---	---	---	---	PASS
ANKRD30B	374860	broad.mit.edu	37	18	14772197	14772197	+	Silent	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14772197A>G	uc010dlo.2	+	9	1479	c.1299A>G	c.(1297-1299)AAA>AAG	p.K433K	ANKRD30B_uc010xak.1_RNA	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	433										ovary(1)|skin(1)	2						AGTGTACAAAAGTTGAGGAAG	0.289													8	501	---	---	---	---	PASS
NEDD4L	23327	broad.mit.edu	37	18	56035074	56035074	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56035074C>T	uc002lgy.2	+	22	2434	c.2160C>T	c.(2158-2160)GCC>GCT	p.A720A	NEDD4L_uc002lgz.2_Silent_p.A656A|NEDD4L_uc002lgx.2_Silent_p.A700A|NEDD4L_uc010xee.1_Silent_p.A599A|NEDD4L_uc002lhc.2_Silent_p.A712A|NEDD4L_uc002lhd.2_Silent_p.A599A|NEDD4L_uc002lhb.2_Silent_p.A579A|NEDD4L_uc002lhe.2_Silent_p.A692A|NEDD4L_uc002lhf.2_Silent_p.A579A|NEDD4L_uc002lhg.2_Silent_p.A599A|NEDD4L_uc002lhh.2_Silent_p.A495A|NEDD4L_uc010dpn.2_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally	720	HECT.				cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						CTGGTCTGGCCGTATTTCATG	0.423													5	446	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65180323	65180323	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65180323G>C	uc002lke.1	-	2	2777	c.1553C>G	c.(1552-1554)TCA>TGA	p.S518*		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	508						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				ACACTGGCTTGAGGGTGATGG	0.483													19	94	---	---	---	---	PASS
MIER2	54531	broad.mit.edu	37	19	325695	325695	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:325695C>T	uc002lok.1	-	7	604	c.595G>A	c.(595-597)GTG>ATG	p.V199M		NM_017550	NP_060020	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family	199	ELM2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGGTCCCACCATGATCTCC	0.602													5	110	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9068910	9068910	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9068910G>A	uc002mkp.2	-	3	18740	c.18536C>T	c.(18535-18537)ACC>ATC	p.T6179I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6181	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCCTGCTGAGGTGGCTATGGT	0.473													5	73	---	---	---	---	PASS
ZNF426	79088	broad.mit.edu	37	19	9643586	9643586	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9643586T>G	uc002mlq.2	-	6	524	c.260A>C	c.(259-261)AAA>ACA	p.K87T	ZNF426_uc010dws.2_Missense_Mutation_p.K49T	NM_024106	NP_077011	Q9BUY5	ZN426_HUMAN	zinc finger protein 426	87	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TAGACTGGGTTTGATGATCTG	0.413													49	171	---	---	---	---	PASS
PALM3	342979	broad.mit.edu	37	19	14165245	14165245	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14165245C>T	uc010xnk.1	-	6	1194	c.1194G>A	c.(1192-1194)GCG>GCA	p.A398A		NM_001145028	NP_001138500	A6NDB9	PALM3_HUMAN	hypothetical protein LOC342979	398	Glu-rich.				negative regulation of cytokine-mediated signaling pathway|response to lipopolysaccharide|Toll signaling pathway	cytoplasm|plasma membrane	ATP binding|protein binding			pancreas(1)	1						TGGATTCTTCCGCTTTTCTCT	0.587													49	242	---	---	---	---	PASS
ZFP112	7771	broad.mit.edu	37	19	44840845	44840845	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44840845T>G	uc010ejj.2	-	4	282	c.169A>C	c.(169-171)ATA>CTA	p.I57L	ZFP112_uc002ozc.3_Missense_Mutation_p.I51L|ZFP112_uc010xwy.1_Missense_Mutation_p.I74L|ZFP112_uc010xwz.1_Missense_Mutation_p.I56L	NM_001083335	NP_001076804	Q9UJU3	ZF112_HUMAN	zinc finger protein 228 isoform 1	57	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5						AGCTGGGATATTAGGTCTGGC	0.368													46	249	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54754901	54754901	+	Intron	SNP	T	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54754901T>A	uc002qex.2	-						LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.A578A|LILRB5_uc002qey.2_Intron|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGTCCTCTTCTGCCTGTCTGT	0.587													9	82	---	---	---	---	PASS
SLC24A3	57419	broad.mit.edu	37	20	19665938	19665938	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19665938G>C	uc002wrl.2	+	12	1454	c.1257G>C	c.(1255-1257)GAG>GAC	p.E419D		NM_020689	NP_065740	Q9HC58	NCKX3_HUMAN	solute carrier family 24	419	Cytoplasmic (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1						aggacaatgagaatgatgagg	0.413													43	156	---	---	---	---	PASS
YWHAB	7529	broad.mit.edu	37	20	43533772	43533772	+	Silent	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43533772G>A	uc002xmt.2	+	5	870	c.588G>A	c.(586-588)ACG>ACA	p.T196T	YWHAB_uc002xmu.2_Silent_p.T196T	NM_003404	NP_003395	P31946	1433B_HUMAN	tyrosine 3-monooxygenase/tryptophan	196					activation of MAPKK activity|activation of pro-apoptotic gene products|axon guidance|cytoplasmic sequestering of protein|epidermal growth factor receptor signaling pathway|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|mRNA metabolic process|negative regulation of protein dephosphorylation|nerve growth factor receptor signaling pathway|Ras protein signal transduction	centrosome|cytosol|melanosome|perinuclear region of cytoplasm	histone deacetylase binding|phosphoserine binding|protein domain specific binding			kidney(2)|ovary(1)|breast(1)	4		Myeloproliferative disorder(115;0.0122)				TGGCAAAAACGGTGAGAAAGA	0.383													19	102	---	---	---	---	PASS
SPINLW1	57119	broad.mit.edu	37	20	44174195	44174195	+	Intron	SNP	T	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44174195T>G	uc002xou.2	-						SPINLW1_uc010zxc.1_Intron|SPINLW1_uc002xot.2_Intron|SPINLW1_uc002xov.1_Nonstop_Mutation_p.*102C	NM_020398	NP_065131	O95925	EPPI_HUMAN	serine peptidase inhibitor-like, with Kunitz and							extracellular region	serine-type endopeptidase inhibitor activity			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)				CCCTCAGCGATCAGGGCACAA	0.313													17	96	---	---	---	---	PASS
PRIC285	85441	broad.mit.edu	37	20	62192230	62192230	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62192230C>A	uc002yfm.2	-	16	8091	c.7199G>T	c.(7198-7200)CGG>CTG	p.R2400L	PRIC285_uc002yfl.1_Missense_Mutation_p.R1831L	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	2400					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			GTTTTGCAGCCGCTCATTCTT	0.612													4	34	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11047486	11047486	+	3'UTR	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11047486A>G	uc002yit.1	-	5						NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTTACTTTGCATTTCCAGCCG	0.338													19	751	---	---	---	---	PASS
FAM165B	54065	broad.mit.edu	37	21	35751738	35751738	+	5'UTR	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35751738C>T	uc002ytu.3	+	2					FAM165B_uc002ytv.2_RNA|FAM165B_uc002ytw.2_RNA	NM_058182	NP_478062	P58511	F165B_HUMAN	chromosome 21 open reading frame 51							integral to membrane					0						TCAGACCTTCCAGCTGCCTCT	0.448													5	289	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24456572	24456572	+	Silent	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24456572C>T	uc002zzi.1	+	12	1712	c.1585C>T	c.(1585-1587)CTG>TTG	p.L529L	CABIN1_uc002zzj.1_Silent_p.L479L|CABIN1_uc002zzl.1_Silent_p.L529L	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	529					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GCCCAACCCGCTGCTGAGGGA	0.612													6	10	---	---	---	---	PASS
APOBEC3B	9582	broad.mit.edu	37	22	39380188	39380188	+	Silent	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39380188G>A	uc003awo.1	+	2	180	c.126G>A	c.(124-126)AAG>AAA	p.K42K	APOBEC3A_uc011aoc.1_Intron|APOBEC3B_uc003awp.1_Silent_p.K42K|APOBEC3B_uc003awq.1_RNA|APOBEC3D_uc011aod.1_Intron|APOBEC3D_uc011aoe.1_Intron|APOBEC3D_uc011aof.1_Intron	NM_004900	NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	42					negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					TGAAAATAAAGAGGGGCCGCT	0.448													16	96	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70612782	70612782	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70612782C>T	uc004dzu.3	+	20	3037	c.2986C>T	c.(2986-2988)CGT>TGT	p.R996C	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.R1017C|TAF1_uc004dzv.3_Missense_Mutation_p.R170C	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	996					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				TGCAGACCTTCGTCGCCTTTC	0.433													5	148	---	---	---	---	PASS
SLC25A14	9016	broad.mit.edu	37	X	129483276	129483276	+	Silent	SNP	G	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129483276G>T	uc004evn.1	+	5	582	c.369G>T	c.(367-369)GGG>GGT	p.G123G	SLC25A14_uc011mut.1_Silent_p.G88G|SLC25A14_uc011muu.1_Silent_p.G123G|SLC25A14_uc010nrg.2_Silent_p.G120G|SLC25A14_uc004evo.1_5'UTR|SLC25A14_uc004evp.1_Silent_p.G123G|SLC25A14_uc004evq.1_Silent_p.G120G|SLC25A14_uc004evr.1_Silent_p.G120G	NM_003951	NP_003942	O95258	UCP5_HUMAN	solute carrier family 25, member 14 isoform	123	Solcar 1.|Helical; Name=2; (Potential).				aerobic respiration|mitochondrial transport	integral to plasma membrane|mitochondrial inner membrane	binding			ovary(1)	1						TTAAAATTGGGATTTACCAAA	0.348													57	112	---	---	---	---	PASS
CXorf66	347487	broad.mit.edu	37	X	139038639	139038639	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139038639A>G	uc004fbb.2	-	3	524	c.502T>C	c.(502-504)TCA>CCA	p.S168P		NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor	168	Ser-rich.|Cytoplasmic (Potential).					integral to membrane					0						TTTGAGCATGATGACTTGGAT	0.388													8	432	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9474	9474	+	RNA	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9474G>A	uc011mfi.1	+	1		c.812G>A			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		TTATTACCTCAGAAGTTTTTT	0.512													16	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15708	15708	+	3'UTR	SNP	G	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15708G>A	uc004coy.2	+	1					uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		TCGCCCACTAAGCCAATCACT	0.448											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	31	35	---	---	---	---	PASS
C1orf70	339453	broad.mit.edu	37	1	1475197	1475197	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1475197delC	uc009vkf.2	-							NM_001114748	NP_001108220	Q5SV17	CA070_HUMAN	hypothetical protein LOC339453							integral to membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.74e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.06e-22)|GBM - Glioblastoma multiforme(42;4.66e-06)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CCGGTCAGCGCCAAGGAGCGG	0.418													4	2	---	---	---	---	
KLHL21	9903	broad.mit.edu	37	1	6663851	6663851	+	5'Flank	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6663851delA	uc001aoa.2	-						KLHL21_uc001anz.1_5'Flank	NM_014851	NP_055666	Q9UJP4	KLH21_HUMAN	kelch-like 21						anaphase|cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|polar microtubule				central_nervous_system(1)	1	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		TGCGGTGGGGAATGGTGAAAG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9261519	9261519	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9261519delG								MIR34A (49683 upstream) : H6PD (33344 downstream)																							AAGCCAAGCTGGAGAAAGATC	0.537													4	2	---	---	---	---	
UBR4	23352	broad.mit.edu	37	1	19497713	19497713	+	Intron	DEL	A	-	-	rs11365192		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19497713delA	uc001bbi.2	-						UBR4_uc001bbm.1_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		aaaacaaaacaaaaaaaactg	0.114													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35155383	35155384	+	IGR	INS	-	CTGA	CTGA	rs140401512	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35155383_35155384insCTGA								MIR552 (20088 upstream) : GJB5 (65337 downstream)																							gctctctgtagctgactacgtt	0.000													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39895831	39895832	+	Intron	DEL	AA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39895831_39895832delAA	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATATAAACTAAAAATATGTGC	0.317													4	2	---	---	---	---	
SLC2A1	6513	broad.mit.edu	37	1	43407980	43407980	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43407980delG	uc001cik.2	-							NM_006516	NP_006507	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|energy reserve metabolic process|regulation of insulin secretion|water-soluble vitamin metabolic process	integral to membrane|melanosome|membrane fraction|midbody	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			central_nervous_system(2)|pancreas(2)|ovary(1)	5	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	ctcagtttccgggtctacaaa	0.169													4	2	---	---	---	---	
FAM159A	348378	broad.mit.edu	37	1	53132618	53132618	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53132618delG	uc001cug.1	+						FAM159A_uc001cuh.2_Intron	NM_001042693		Q6UWV7	F159A_HUMAN	hypothetical protein LOC348378							integral to membrane					0						GCAGCCACCTGAAGTAATCTC	0.507													4	2	---	---	---	---	
ZYG11B	79699	broad.mit.edu	37	1	53222488	53222488	+	Intron	DEL	T	-	-	rs150619003		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53222488delT	uc001cuj.2	+						ZYG11B_uc009vzg.2_Intron|ZYG11B_uc010onj.1_Intron	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B								protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						AACAtttttcttttttttttt	0.149													4	2	---	---	---	---	
PDE4B	5142	broad.mit.edu	37	1	66771107	66771107	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66771107delT	uc001dcn.2	+						PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Intron|PDE4B_uc001dcp.2_Intron	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN	phosphodiesterase 4B isoform 1						signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)	gaatttcagataaacaacagg	0.075													4	2	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	86000655	86000657	+	Intron	DEL	AAG	-	-	rs66688926		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86000655_86000657delAAG	uc001dlc.2	-							NM_001134445	NP_001127917	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	ACCAAAGAAAAAGAAGAAAAGGA	0.389													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	91325677	91325677	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91325677delA								BARHL2 (142883 upstream) : ZNF644 (55183 downstream)																							gtttacaaggaaaaaAAAAGG	0.050													4	2	---	---	---	---	
EVI5	7813	broad.mit.edu	37	1	92979682	92979683	+	Intron	DEL	TA	-	-	rs143557515		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92979682_92979683delTA	uc001dox.2	-						EVI5_uc010otf.1_Intron	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5						cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		ttctatgtgttatatataatgg	0.089													5	5	---	---	---	---	
HIAT1	64645	broad.mit.edu	37	1	100507933	100507933	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100507933delT	uc001dst.2	+							NM_033055	NP_149044	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1						transmembrane transport	integral to membrane|plasma membrane	transporter activity				0		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		GAGCACCAGATTTTTTTTTTC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110431144	110431145	+	IGR	INS	-	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110431144_110431145insG								EPS8L3 (124580 upstream) : CSF1 (22088 downstream)																							gggctgctgttgggggggtctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110990348	110990349	+	IGR	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110990348_110990349insT								HBXIP (39802 upstream) : PROK1 (3439 downstream)																							CCTCCGGcttccctcctttgtc	0.252													4	2	---	---	---	---	
RHOC	389	broad.mit.edu	37	1	113251342	113251346	+	5'Flank	DEL	AAGAT	-	-	rs71920420		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113251342_113251346delAAGAT	uc001ecp.1	-						RHOC_uc001ecq.1_5'Flank|RHOC_uc001ecr.1_5'Flank|RHOC_uc009wgk.1_5'Flank	NM_001042679	NP_001036144	P08134	RHOC_HUMAN	ras homolog gene family, member C precursor						axon guidance|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|signal transducer activity			ovary(1)	1	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGAAGTTCTCAAGATAAGGTGATGT	0.156													3	4	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144918474	144918477	+	Intron	DEL	GTTT	-	-	rs67298873		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144918474_144918477delGTTT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Intron|PDE4DIP_uc001eme.1_Intron|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTTCTGTACAGTTTGTCTTCATCT	0.186			T	PDGFRB	MPD								4	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145023449	145023449	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145023449delA	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ACAATGTCTTAAAAAAATCTG	0.428			T	PDGFRB	MPD								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148849428	148849430	+	IGR	DEL	TCG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148849428_148849430delTCG								NBPF16 (91117 upstream) : LOC645166 (78856 downstream)																							tcttttcatctcgtcatttcatt	0.000													4	3	---	---	---	---	
PLEKHO1	51177	broad.mit.edu	37	1	150128650	150128651	+	Intron	DEL	AC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150128650_150128651delAC	uc001ett.2	+						PLEKHO1_uc001etr.2_Intron|PLEKHO1_uc001ets.2_Intron|PLEKHO1_uc001etu.2_Intron	NM_016274	NP_057358	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O							cytoplasm|nucleus|plasma membrane				lung(1)	1	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCTGTCTTATACACACACATCC	0.391													4	2	---	---	---	---	
ETV3L	440695	broad.mit.edu	37	1	157071368	157071368	+	5'Flank	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157071368delA	uc001fqq.1	-							NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				ctTAAGACTTAAAAAAAAAAA	0.025													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157614247	157614248	+	IGR	DEL	TG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157614247_157614248delTG								FCRL4 (46377 upstream) : FCRL3 (32030 downstream)																							TGTTAGCATTTGTGTGTGGAGA	0.470													4	2	---	---	---	---	
RASAL2	9462	broad.mit.edu	37	1	178358340	178358340	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178358340delT	uc001glr.2	+						RASAL2_uc009wxb.2_Intron|RASAL2_uc001glq.2_Intron	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						AGGATGTGGCTTTTTTTTCCT	0.378													4	2	---	---	---	---	
CFHR1	3078	broad.mit.edu	37	1	196794449	196794450	+	Intron	INS	-	T	T	rs146000731	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196794449_196794450insT	uc001gtn.2	+						CFHR1_uc001gtm.2_Intron	NM_002113	NP_002104	Q03591	FHR1_HUMAN	complement factor H-related 1 precursor						complement activation	extracellular space					0						AGTTAGTGATGCTTTTCATTCC	0.282													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	217587858	217587858	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217587858delA								ESRRG (276761 upstream) : GPATCH2 (15976 downstream)																							CACTACTCTCAAAAACCCTGC	0.348													4	2	---	---	---	---	
GPATCH2	55105	broad.mit.edu	37	1	217722549	217722549	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217722549delT	uc001hlf.1	-							NM_018040	NP_060510	Q9NW75	GPTC2_HUMAN	G patch domain containing 2							intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		ATATTATGGGTTAGACATCAT	0.279													4	2	---	---	---	---	
RAB3GAP2	25782	broad.mit.edu	37	1	220364227	220364227	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220364227delT	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		GCatttttaattttttttttt	0.318													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	231571457	231571457	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231571457delA								EGLN1 (10667 upstream) : TSNAX-DISC1 (92942 downstream)																							attactaaccaagggccaatt	0.000													4	2	---	---	---	---	
LGALS8	3964	broad.mit.edu	37	1	236707832	236707832	+	Intron	DEL	T	-	-	rs72755785		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236707832delT	uc001hxz.1	+						LGALS8_uc001hxw.1_Intron|LGALS8_uc001hxy.1_Intron|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TTTTAAAGGGTTTTTTTTTTC	0.408													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	239318480	239318481	+	IGR	INS	-	GAA	GAA			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239318480_239318481insGAA								LOC339535 (669163 upstream) : CHRM3 (231384 downstream)																							GCAGGGTGGAGGAAGTTCAAAT	0.406													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245539725	245539726	+	Intron	DEL	AA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245539725_245539726delAA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ttgggagattaaaaaaaaaaat	0.183													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4372611	4372611	+	IGR	DEL	A	-	-	rs76979260		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4372611delA								ALLC (622353 upstream) : None (None downstream)																							CACGAAATGGAAAAAAAAAAT	0.279													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8618464	8618465	+	IGR	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8618464_8618465insT								LOC339788 (501487 upstream) : ID2 (200875 downstream)																							TAGGGCCCCCCTCATTCCACAC	0.589													4	2	---	---	---	---	
IAH1	285148	broad.mit.edu	37	2	9621703	9621703	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9621703delT	uc002qzr.2	+						IAH1_uc002qzs.2_Intron|IAH1_uc002qzt.2_Intron|IAH1_uc010yiz.1_Intron	NM_001039613	NP_001034702	Q2TAA2	IAH1_HUMAN	isoamyl acetate-hydrolyzing esterase 1 homolog						lipid catabolic process		hydrolase activity, acting on ester bonds				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTTCAGTCTGTTTTCAATCCA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	28685815	28685817	+	IGR	DEL	TTT	-	-	rs151187706		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28685815_28685817delTTT								FOSL2 (48301 upstream) : PLB1 (33165 downstream)																							taactgctgattttttttttttt	0.000													6	3	---	---	---	---	
CEBPZ	10153	broad.mit.edu	37	2	37442333	37442334	+	Intron	DEL	AG	-	-	rs3217142		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37442333_37442334delAG	uc002rpz.2	-							NM_005760	NP_005751	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein zeta						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding			pancreas(1)	1		all_hematologic(82;0.21)				CATAGCTGTCAGTGCCGTTACA	0.401													3	3	---	---	---	---	
CEBPZ	10153	broad.mit.edu	37	2	37442339	37442340	+	Intron	DEL	GT	-	-	rs3841525		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37442339_37442340delGT	uc002rpz.2	-							NM_005760	NP_005751	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein zeta						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding			pancreas(1)	1		all_hematologic(82;0.21)				TGTCAGTGCCGTTACAGTGAAA	0.386													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38517543	38517543	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38517543delC								C2orf58 (108552 upstream) : ATL2 (4488 downstream)																							CTCTGCCCTTCAGTAACTCCC	0.463													4	2	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39055865	39055865	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39055865delA	uc002rrf.2	-						DHX57_uc002rrd.3_Intron|DHX57_uc002rre.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				accctttctcaaaaaaaaaaa	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	54546622	54546622	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54546622delC								ACYP2 (14189 upstream) : C2orf73 (11449 downstream)																							TCTATACCCTCCCTCCAAACA	0.433													4	2	---	---	---	---	
VRK2	7444	broad.mit.edu	37	2	58134880	58134881	+	5'UTR	DEL	AG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58134880_58134881delAG	uc002rzo.2	+	1					VRK2_uc010fcb.2_5'UTR	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2							integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						tcatcctacaagatgcttctca	0.213													4	2	---	---	---	---	
FANCL	55120	broad.mit.edu	37	2	58422061	58422062	+	Intron	INS	-	A	A	rs147285132	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58422061_58422062insA	uc002rzw.3	-						FANCL_uc002rzx.3_Intron|FANCL_uc010fce.2_Intron|FANCL_uc010fcf.1_Intron	NM_018062	NP_060532	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L isoform						DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TATTATATCACAAAAAAAAAAG	0.312								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	3	---	---	---	---	
PAPOLG	64895	broad.mit.edu	37	2	60998411	60998411	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60998411delT	uc002sai.2	+						PAPOLG_uc002saj.2_Intron|PAPOLG_uc002sak.2_Intron	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AAGGCTTTGATTTTTTTTTCT	0.164													4	2	---	---	---	---	
ZNF638	27332	broad.mit.edu	37	2	71624785	71624785	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71624785delT	uc002shx.2	+						ZNF638_uc010yqw.1_Intron|ZNF638_uc002shy.2_Intron|ZNF638_uc002shz.2_Intron|ZNF638_uc002sia.2_Intron|ZNF638_uc002sib.1_Intron|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Intron	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638						RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						GATCTATTGATTTTTTATCTT	0.363													4	2	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71863029	71863030	+	Intron	DEL	AA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71863029_71863030delAA	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						aaaaagcaacaaagagggaata	0.000													4	2	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77371548	77371548	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77371548delA	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		GCATGGGGTCAAAAAAAAAAA	0.264													3	3	---	---	---	---	
FLJ40330	645784	broad.mit.edu	37	2	89072063	89072063	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89072063delT	uc002stf.2	+						FLJ40330_uc010fhf.2_Intron|FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						TTGACATCACTTTTTTTGGCT	0.363													4	2	---	---	---	---	
MRPS9	64965	broad.mit.edu	37	2	105665448	105665448	+	Intron	DEL	G	-	-	rs78916472		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105665448delG	uc002tcn.3	+							NM_182640	NP_872578	P82933	RT09_HUMAN	mitochondrial ribosomal protein S9 precursor						DNA damage response, detection of DNA damage|translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0						GCTTTGAGTAGGGGACACATT	0.348													8	5	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107042813	107042814	+	Intron	INS	-	AA	AA			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107042813_107042814insAA	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						AAGGAATAAAGAAGAAAGTAAC	0.356													6	3	---	---	---	---	
ANAPC1	64682	broad.mit.edu	37	2	112592574	112592574	+	Intron	DEL	A	-	-	rs150159007		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112592574delA	uc002thi.2	-							NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						AGAGTATGTTAAAAAAAAAAA	0.229													3	3	---	---	---	---	
MERTK	10461	broad.mit.edu	37	2	112778786	112778786	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112778786delA	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						caaaagtctcaaaaaaaaaaT	0.244													4	2	---	---	---	---	
IL1F9	56300	broad.mit.edu	37	2	113737918	113737918	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113737918delT	uc002tio.1	+						IL1F9_uc010fkr.1_Intron	NM_019618	NP_062564	Q9NZH8	IL36G_HUMAN	interleukin 1 family, member 9						cell-cell signaling	extracellular space	cytokine activity|interleukin-1 receptor antagonist activity				0						CTTGTTTTGCTTTTTTTTTTT	0.348													4	2	---	---	---	---	
EPB41L5	57669	broad.mit.edu	37	2	120872611	120872611	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120872611delT	uc002tmg.2	+						EPB41L5_uc010fll.2_Intron|EPB41L5_uc010flm.2_Intron	NM_020909	NP_065960	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1						ttagcaacaatttttatctta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	126520973	126520975	+	IGR	DEL	TCA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126520973_126520975delTCA								CNTNAP5 (848112 upstream) : GYPC (892709 downstream)																							AATGCTGCTGTCAAGAGACCACA	0.448													4	2	---	---	---	---	
AMMECR1L	83607	broad.mit.edu	37	2	128628170	128628170	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128628170delC	uc002tpl.2	-						AMMECR1L_uc002tpm.2_Intron	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN	AMME chromosomal region gene 1-like											central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		ACCAAGCAGACTAGGGAGAAT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134942895	134942896	+	IGR	DEL	TG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134942895_134942896delTG								NCKAP5 (616864 upstream) : MGAT5 (68934 downstream)																							TTACCCCTCTTGTTTTCCAAAT	0.441													4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	142089679	142089679	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142089679delT	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		taattgttgattttttttttt	0.090										TSP Lung(27;0.18)			4	2	---	---	---	---	
RBMS1	5937	broad.mit.edu	37	2	161347562	161347562	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161347562delT	uc002ubo.2	-						RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Intron|RBMS1_uc002ubp.2_Intron|RBMS1_uc010fox.2_Intron	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						AATCAAAGTCTTTTTTTTTTT	0.348													3	3	---	---	---	---	
SCN3A	6328	broad.mit.edu	37	2	165971747	165971747	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165971747delT	uc002ucx.2	-						SCN3A_uc002ucy.2_Intron|SCN3A_uc002ucz.2_Intron|SCN3A_uc002uda.1_Intron|SCN3A_uc002udb.1_Intron	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	tctttctttattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	173566360	173566360	+	IGR	DEL	T	-	-	rs11350083		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173566360delT								PDK1 (76537 upstream) : LOC91149 (21560 downstream)																							GTTTATCCTGttttttttttt	0.249													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174277623	174277624	+	IGR	DEL	AA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174277623_174277624delAA								CDCA7 (43905 upstream) : SP3 (495635 downstream)																							agtggggactaatatttagcag	0.000													4	2	---	---	---	---	
SCRN3	79634	broad.mit.edu	37	2	175287375	175287375	+	Intron	DEL	T	-	-	rs111886937		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175287375delT	uc002uiq.2	+						SCRN3_uc010zen.1_Intron|SCRN3_uc010zeo.1_Intron|SCRN3_uc002uis.2_Intron	NM_024583	NP_078859	Q0VDG4	SCRN3_HUMAN	secernin 3						proteolysis		dipeptidase activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.229)			TTTCTAGGGATTTTTTTACCT	0.244													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176209152	176209152	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176209152delT								ATP5G3 (162662 upstream) : KIAA1715 (581258 downstream)																							ctactcaccatttttttcttt	0.080													4	2	---	---	---	---	
MTX2	10651	broad.mit.edu	37	2	177162844	177162844	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177162844delT	uc002ukx.2	+						MTX2_uc002ukw.2_Intron	NM_006554	NP_006545	O75431	MTX2_HUMAN	metaxin 2						protein targeting to mitochondrion	mitochondrial outer membrane				ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00365)|Epithelial(96;0.0654)|all cancers(119;0.181)			taaacataaattttttttttt	0.259													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	184914760	184914760	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184914760delG								NUP35 (888353 upstream) : ZNF804A (548333 downstream)																							gcagcctgctgggggactgcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204432969	204432969	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204432969delT								RAPH1 (32911 upstream) : CD28 (138229 downstream)																							TGGCTGTTTATTTGGCATTTG	0.353													4	2	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	205438426	205438426	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205438426delA	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CTTGGGTACTAAGGCATTGAA	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	215730790	215730791	+	IGR	INS	-	A	A	rs138879674	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215730790_215730791insA								BARD1 (56362 upstream) : ABCA12 (65476 downstream)																							aaggggaagtcagttattaaaa	0.000													4	2	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218860168	218860168	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218860168delA	uc010fvk.1	-							NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		ctcagtggggaaaaaaaaaac	0.010													3	4	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225679248	225679248	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225679248delT	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		Atttgtttcctttttttttga	0.124													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	226239506	226239506	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226239506delG								DOCK10 (332176 upstream) : KIAA1486 (26096 downstream)																							TCATGAGTCAGGAGTCACAGT	0.468													4	2	---	---	---	---	
SP100	6672	broad.mit.edu	37	2	231363398	231363398	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231363398delA	uc002vqt.2	+						SP100_uc002vqs.2_Intron|SP100_uc002vqu.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TATGTCAGGGAAAAAAAGATG	0.403													4	2	---	---	---	---	
SAG	6295	broad.mit.edu	37	2	234249398	234249399	+	Intron	DEL	TG	-	-	rs35743911		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234249398_234249399delTG	uc002vuh.2	+						SAG_uc010zmq.1_Intron	NM_000541	NP_000532	P10523	ARRS_HUMAN	S-arrestin						rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway		protein phosphatase inhibitor activity			ovary(1)	1		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		GCAGCCAGCTtgtgtgtgtgtg	0.297													5	3	---	---	---	---	
TRPM8	79054	broad.mit.edu	37	2	234852617	234852617	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234852617delT	uc002vvh.2	+						TRPM8_uc010fyj.2_Intron	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,							integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GTGGGAGGTGTTTTTTTTTGT	0.194													4	2	---	---	---	---	
LOC152024	152024	broad.mit.edu	37	3	24138196	24138196	+	RNA	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24138196delT	uc003ccu.3	-	4		c.2552delA								Homo sapiens hypothetical protein LOC152024, mRNA (cDNA clone IMAGE:4829078).												0						TTTTTTCCTGTTTTTTTTGAA	0.333													4	2	---	---	---	---	
KIF9	64147	broad.mit.edu	37	3	47281088	47281088	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47281088delT	uc010hjp.2	-						KIF9_uc003cqx.2_Intron|KIF9_uc003cqy.2_Intron|KIF9_uc011bat.1_Intron|uc003cqw.1_Intron	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2						blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TGTTATTATAttttttttcca	0.154													4	3	---	---	---	---	
TBC1D23	55773	broad.mit.edu	37	3	100038274	100038275	+	Intron	INS	-	T	T	rs147748072	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100038274_100038275insT	uc003dtt.2	+						TBC1D23_uc003dts.2_Intron|TBC1D23_uc003dtu.2_Intron	NM_018309	NP_060779	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23							intracellular	Rab GTPase activator activity			ovary(1)|liver(1)	2						ccttatgattctttttttttct	0.045													5	3	---	---	---	---	
ZPLD1	131368	broad.mit.edu	37	3	102175390	102175405	+	Intron	DEL	TATCTATCTATCTATC	-	-	rs10557928		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102175390_102175405delTATCTATCTATCTATC	uc003dvs.1	+						ZPLD1_uc003dvt.1_Intron|ZPLD1_uc011bhg.1_Intron	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						ttatctattatatctatctatctatctatctatcta	0.208													8	6	---	---	---	---	
FLJ25363	401082	broad.mit.edu	37	3	109195296	109195296	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109195296delT	uc003dxr.1	+							NM_001145553	NP_001139025			hypothetical protein LOC401082												0						aggcctgagattttttttttg	0.000													4	3	---	---	---	---	
DRD3	1814	broad.mit.edu	37	3	113890423	113890424	+	Intron	DEL	CT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113890423_113890424delCT	uc003ebd.2	-						DRD3_uc010hqn.1_Intron|DRD3_uc003ebb.1_Intron|DRD3_uc003ebc.1_Intron	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a						activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)	AGAGCTTTAACTCTCTCATTAC	0.495													4	2	---	---	---	---	
ZBTB20	26137	broad.mit.edu	37	3	114420600	114420600	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114420600delA	uc003ebk.2	-						ZBTB20_uc003ebl.2_Intron|ZBTB20_uc003ebm.2_Intron|ZBTB20_uc003ebn.2_Intron|ZBTB20_uc003ebp.2_Intron	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CATCTAACTGAAAAAAAAAAG	0.264													4	2	---	---	---	---	
LSAMP	4045	broad.mit.edu	37	3	115897877	115897878	+	Intron	INS	-	A	A	rs74285330		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115897877_115897878insA	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TTTTACTACCTAAAAAAAAAAA	0.371													4	2	---	---	---	---	
TFDP2	7029	broad.mit.edu	37	3	141672056	141672056	+	Intron	DEL	A	-	-	rs140575104		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141672056delA	uc003eun.3	-						TFDP2_uc003euk.3_Intron|TFDP2_uc010hur.2_Intron|TFDP2_uc003eul.3_Intron|TFDP2_uc011bnf.1_Intron|TFDP2_uc011bng.1_Intron|TFDP2_uc003eum.3_Intron	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization						cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						TAAGAGCAGGAAAAAAAAAAT	0.373													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	144989365	144989365	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144989365delA								None (None upstream) : PLOD2 (797863 downstream)																							AGTCATATACAAAAAAAAGGC	0.303													4	2	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160950902	160950902	+	Intron	DEL	T	-	-	rs148221887		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160950902delT	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_5'Flank	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			GACAATGTACTTTTTTTTTTT	0.269													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166580080	166580080	+	IGR	DEL	A	-	-	rs112109917		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166580080delA								None (None upstream) : ZBBX (378001 downstream)																							CAGAGGCAGGAAAAAAAAAAT	0.294													5	3	---	---	---	---	
ATP11B	23200	broad.mit.edu	37	3	182537824	182537824	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182537824delA	uc003flb.2	+						ATP11B_uc003fla.2_Intron	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B						aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			CCTGTGAAAGAAAAAAAAATA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185609744	185609745	+	IGR	DEL	TG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185609744_185609745delTG								IGF2BP2 (66917 upstream) : TRA2B (22615 downstream)																							AAATCGATTTTGTGTGTGTGTT	0.351													4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185879677	185879678	+	Intron	DEL	TG	-	-	rs72184387		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185879677_185879678delTG	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	tttctgtgtctgtgtgtgtgtg	0.000													4	2	---	---	---	---	
TPRG1	285386	broad.mit.edu	37	3	188987542	188987542	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188987542delC	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		cctcattttacagtggtctta	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193724785	193724785	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193724785delT								LOC100128023 (12758 upstream) : HES1 (129149 downstream)																							CAACTTGACGTTTTTTTTTTC	0.388													2	4	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3314644	3314644	+	5'Flank	DEL	A	-	-	rs71652768		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3314644delA	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_5'Flank	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AGTTTTCTCCAAAAAAAAAAA	0.269													4	3	---	---	---	---	
STK32B	55351	broad.mit.edu	37	4	5474433	5474433	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5474433delA	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						AAAATCATATAAAAGCTACCC	0.313													4	2	---	---	---	---	
GPR78	27201	broad.mit.edu	37	4	8588212	8588212	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8588212delG	uc003glk.2	+						CPZ_uc003gll.2_Intron	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78						activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						CTGTTCATGTGGGTGAGGTGG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	23516565	23516565	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23516565delA								GBA3 (695374 upstream) : PPARGC1A (277080 downstream)																							TCAAATGTTTATTTACTTTCC	0.393													4	2	---	---	---	---	
CCDC149	91050	broad.mit.edu	37	4	24918322	24918322	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24918322delT	uc011bxr.1	-						CCDC149_uc003gre.2_Intron	NM_173463	NP_775734	B4DZG3	B4DZG3_HUMAN	coiled-coil domain containing 149 isoform 1												0		Breast(46;0.173)				TTCATGGCCATTTTTTTTCCC	0.368													4	2	---	---	---	---	
PCDH7	5099	broad.mit.edu	37	4	30726508	30726508	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30726508delT	uc003gsk.1	+						PCDH7_uc011bxw.1_Intron|PCDH7_uc011bxx.1_Intron	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						TCATACTACATTTTTTTGTTT	0.328													4	2	---	---	---	---	
SCFD2	152579	broad.mit.edu	37	4	54179260	54179261	+	Intron	INS	-	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54179260_54179261insA	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AGATGGATGTGAAAAAAAACAA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	65488587	65488587	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65488587delT								TECRL (213409 upstream) : EPHA5 (696695 downstream)																							gcttttgtggtttttttttgt	0.000													3	3	---	---	---	---	
UGT2A1	10941	broad.mit.edu	37	4	70462252	70462252	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70462252delT	uc003hem.3	-						UGT2A1_uc011caq.1_Intron|UGT2A1_uc010ihu.2_Intron|UGT2A1_uc010iht.2_Intron|UGT2A1_uc010ihs.2_Intron	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,						detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						AGTTTCTATAtttttttttgg	0.144													11	6	---	---	---	---	
GC	2638	broad.mit.edu	37	4	72637487	72637487	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72637487delA	uc003hge.2	-						GC_uc003hgd.2_5'Flank|GC_uc010iie.2_Intron|GC_uc010iif.2_Intron	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor						hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	TGACACGTTCAAAAGGTTAAG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	88817714	88817715	+	IGR	INS	-	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88817714_88817715insA								MEPE (49772 upstream) : SPP1 (79087 downstream)																							CAGTGAATCACAGAGAGGTCAC	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	106898605	106898606	+	IGR	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106898605_106898606insT								NPNT (5778 upstream) : TBCK (68627 downstream)																							CTTTTAATGTGTTGCTTTGACC	0.406													4	2	---	---	---	---	
LEF1	51176	broad.mit.edu	37	4	109003030	109003030	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109003030delC	uc003hyt.1	-						LEF1_uc011cfj.1_Intron|LEF1_uc011cfk.1_Intron|LEF1_uc003hyu.1_Intron|LEF1_uc003hyv.1_Intron|LEF1_uc010imb.1_Intron|LEF1_uc003hyw.1_5'Flank	NM_016269	NP_057353	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1 isoform 1						canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		AAAGAAATCTCCCACCCTCAA	0.428													4	2	---	---	---	---	
ENPEP	2028	broad.mit.edu	37	4	111431767	111431767	+	Intron	DEL	A	-	-	rs72130658		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111431767delA	uc003iab.3	+							NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase						cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	TCAAGGCAGGAAAAAAAAAAA	0.403													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	112950716	112950716	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112950716delG								None (None upstream) : C4orf32 (115837 downstream)																							CAGTATTGATGGGAAGCTCAT	0.373													4	2	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114300948	114300948	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114300948delA	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron|ANK2_uc010imr.2_Intron|ANK2_uc010ims.2_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AAGGATGTCCAAAAAAAAGCT	0.338													4	2	---	---	---	---	
PRDM5	11107	broad.mit.edu	37	4	121828994	121828994	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121828994delG	uc003idn.2	-						PRDM5_uc003ido.2_Intron|PRDM5_uc010ine.2_Intron|PRDM5_uc010inf.2_Intron|PRDM5_uc003idp.1_Intron	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5						histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						TATTTCATATGTTTCAATCCT	0.393													4	2	---	---	---	---	
HSPA4L	22824	broad.mit.edu	37	4	128714895	128714895	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128714895delT	uc003ifm.2	+						HSPA4L_uc010iny.1_Intron|HSPA4L_uc011cgr.1_Intron	NM_014278	NP_055093	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like						protein folding|response to unfolded protein	cytoplasm|nucleus	ATP binding|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						ggattTAGCCTTTTTAACTGT	0.179													4	2	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183522021	183522022	+	Intron	INS	-	AT	AT	rs141344153	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183522021_183522022insAT	uc003ivd.1	+							NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		TGTGTATATACATATATATATA	0.297													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189499378	189499379	+	IGR	DEL	CA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189499378_189499379delCA								TRIML1 (430729 upstream) : None (None downstream)																							TCCTGAGGTTCACTGATGTTGT	0.401													4	2	---	---	---	---	
ANKH	56172	broad.mit.edu	37	5	14744673	14744674	+	Intron	INS	-	GT	GT	rs145913450	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14744673_14744674insGT	uc003jfm.3	-						ANKH_uc003jfl.3_Intron	NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						TGGAGGTGGACGTGTGTGTGTT	0.569													3	4	---	---	---	---	
GOLPH3	64083	broad.mit.edu	37	5	32135385	32135386	+	Intron	DEL	AC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32135385_32135386delAC	uc003jhp.1	-							NM_022130	NP_071413	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3						cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding			ovary(1)	1						ggggtttgttaccaccacagct	0.119													6	4	---	---	---	---	
AGXT2	64902	broad.mit.edu	37	5	35040980	35040981	+	Intron	INS	-	A	A	rs149569953	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35040980_35040981insA	uc003jjf.2	-						AGXT2_uc011com.1_Intron|AGXT2_uc011con.1_Intron	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	alanine-glyoxylate aminotransferase 2 precursor						glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)	ATATAGTCTGGAAAAAAAATCT	0.371													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	41888075	41888075	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41888075delT								OXCT1 (17284 upstream) : C5orf51 (16395 downstream)																							ctttcttacctttttttccct	0.000													4	2	---	---	---	---	
NDUFS4	4724	broad.mit.edu	37	5	52870674	52870674	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52870674delA	uc003jpe.2	+							NM_002495	NP_002486	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4						brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1		Lung NSC(810;8.27e-05)|Breast(144;0.0848)			NADH(DB00157)	gtccatccagaaaattgtggc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	65849713	65849713	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65849713delA								SFRS12 (373001 upstream) : MAST4 (42463 downstream)																							tgcaGGTAGGAAAAAAAAAAG	0.174													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	67845487	67845487	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67845487delG								PIK3R1 (247840 upstream) : SLC30A5 (544331 downstream)																							GAATTCTGGAGAGTCGTTCTC	0.532													4	2	---	---	---	---	
IQGAP2	10788	broad.mit.edu	37	5	75821289	75821289	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75821289delT	uc003kek.2	+							NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TTCCAGTGAATTTTTTTTTTT	0.299													4	2	---	---	---	---	
EDIL3	10085	broad.mit.edu	37	5	83433475	83433475	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83433475delT	uc003kio.1	-						EDIL3_uc003kip.1_Intron	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		ATCCTTAGAATTAAATCAAAC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92641074	92641074	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92641074delA								None (None upstream) : FLJ42709 (103991 downstream)																							TATGAAATGGAAAAAAAAAAT	0.244													6	3	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94888950	94888950	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94888950delA	uc003klb.2	-						ARSK_uc003kld.2_5'Flank|ARSK_uc010jbg.2_5'Flank|ARSK_uc011cum.1_5'Flank|TTC37_uc010jbf.1_Intron|ARSK_uc003klc.2_5'Flank	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						GGGGAGAAAGAAGAAAAAGAT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102139868	102139868	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102139868delC								SLCO6A1 (305148 upstream) : PAM (61659 downstream)																							CTTAAAGTATCAGGAGGTCTC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	120952552	120952552	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120952552delA								PRR16 (929590 upstream) : FTMT (235098 downstream)																							GGATACTGACAAAAAAAAAAG	0.299													6	3	---	---	---	---	
SLC12A2	6558	broad.mit.edu	37	5	127506975	127506976	+	Intron	DEL	TG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127506975_127506976delTG	uc003kus.2	+						SLC12A2_uc010jdf.2_Intron|SLC12A2_uc010jdg.2_Intron	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12						potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCAAGGTTTTTGTGTGTGTGTC	0.297													4	2	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127669817	127669817	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127669817delT	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTAGTAGTagtagagaaaggg	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	131479395	131479395	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131479395delA								CSF2 (67537 upstream) : P4HA2 (48911 downstream)																							aatggagagtaaacaaaagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133024505	133024506	+	IGR	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133024505_133024506insT								FSTL4 (76282 upstream) : C5orf15 (266693 downstream)																							GCTGCTGACTGTCCCGGACTTT	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133130436	133130436	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133130436delC								FSTL4 (182213 upstream) : C5orf15 (160763 downstream)																							CTGCAAGACTCCCAACCCAGC	0.547													4	2	---	---	---	---	
PKD2L2	27039	broad.mit.edu	37	5	137225971	137225971	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137225971delA	uc003lby.2	+						PKD2L2_uc010jep.1_Intron|PKD2L2_uc003lbw.1_Intron|PKD2L2_uc003lbx.2_Intron	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2							integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			actccgtctcaaaaaaaaaaT	0.144													4	3	---	---	---	---	
ARAP3	64411	broad.mit.edu	37	5	141038714	141038714	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141038714delC	uc003llm.2	-						ARAP3_uc003lll.2_Intron|ARAP3_uc011dbe.1_Intron|ARAP3_uc003lln.2_Intron	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7						acttgatgttcccacagaaaa	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	146943184	146943184	+	Intron	DEL	A	-	-	rs35610252		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146943184delA	uc003lop.1	+											Homo sapiens cDNA FLJ14672 fis, clone NT2RP2003687.																		TCTGGCTTCCAAAGATGAGCA	0.348													4	4	---	---	---	---	
ATP10B	23120	broad.mit.edu	37	5	160200849	160200849	+	Intron	DEL	C	-	-	rs80047524		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160200849delC	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACCCTGACCTCCTAGCTCCTT	0.428													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161640303	161640303	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161640303delT								GABRG2 (57759 upstream) : None (None downstream)																							TCACTTGATGTTCAGTCTTGA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165692471	165692471	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165692471delA								None (None upstream) : None (None downstream)																							ggaaatgaagaaaagggaaca	0.000													4	2	---	---	---	---	
DOCK2	1794	broad.mit.edu	37	5	169069949	169069950	+	Intron	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169069949_169069950insT	uc003maf.2	+						DOCK2_uc011der.1_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTTGGATTTGTTTTTTTTTTC	0.441													3	3	---	---	---	---	
C5orf25	375484	broad.mit.edu	37	5	175716419	175716419	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175716419delA	uc003mdt.3	+						C5orf25_uc003mds.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Intron|uc003mdu.1_5'UTR	NM_198567	NP_940969	Q8NDZ2	CE025_HUMAN	hypothetical protein LOC375484												0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		CTTGGACCAGAAAAAAAAAAA	0.383													4	3	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178678989	178678990	+	Intron	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178678989_178678990insT	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGTCTCACTGATTTTTTTttct	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6138431	6138431	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6138431delC								NRN1 (130798 upstream) : F13A1 (5881 downstream)																							cgtggcttctccagcatggga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8629903	8629903	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8629903delC	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																		CTCCATCCCTCCCCACCCTCT	0.453													4	2	---	---	---	---	
NEDD9	4739	broad.mit.edu	37	6	11237958	11237958	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11237958delC	uc010joz.2	-						NEDD9_uc003mzw.3_Intron	NM_001142393	NP_001135865	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			gatggcaaagcccccaaagcc	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	20330599	20330599	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20330599delA								MBOAT1 (117929 upstream) : E2F3 (71538 downstream)																							GTGTTACAAGAAAAAAAAAAG	0.219													3	3	---	---	---	---	
CMAH	8418	broad.mit.edu	37	6	25089937	25089937	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25089937delA	uc003nes.3	-						CMAH_uc003ner.3_Intron					SubName: Full=CMP-N-acetylneuraminic acid hydroxylase;												0						caaggaagggaaaggcatggg	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28937270	28937270	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28937270delC								TRIM27 (45502 upstream) : ZNF311 (25324 downstream)																							CTCATGGAGTCCAGGTCGATC	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29194357	29194357	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29194357delT								OR2J2 (52007 upstream) : OR14J1 (80110 downstream)																							tAATACTTTCTTTTTTTTTTC	0.224													2	4	---	---	---	---	
C6orf134	79969	broad.mit.edu	37	6	30602033	30602033	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30602033delT	uc003nqu.2	+						C6orf134_uc003nqr.3_Intron|C6orf134_uc003rdc.2_Intron|C6orf134_uc003nqs.3_Intron|C6orf134_uc003rdd.2_Intron|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Intron|C6orf134_uc003nqv.2_Intron	NM_024909	NP_079185	Q5SQI0	ATAT_HUMAN	hypothetical protein LOC79969 isoform 2								tubulin N-acetyltransferase activity				0						GTTAGGGTCAttttttttttc	0.119													5	4	---	---	---	---	
BTBD9	114781	broad.mit.edu	37	6	38237374	38237374	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38237374delT	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a						cell adhesion						0						GGGCAGTTGCTTTTTTTTTTT	0.473													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	47742113	47742113	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47742113delT								GPR115 (52356 upstream) : OPN5 (7685 downstream)																							TTCCTCACAGTTTTTTTTTGT	0.318													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	50963111	50963111	+	IGR	DEL	T	-	-	rs34740689		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50963111delT								TFAP2B (147786 upstream) : PKHD1 (517034 downstream)																							AATGCTTTCATTTTTTCCCAG	0.413													3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57477146	57477147	+	Intron	INS	-	TTCTAT	TTCTAT	rs10690452		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57477146_57477147insTTCTAT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		acaaaaatcaattctatttctt	0.099													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57492883	57492883	+	Intron	DEL	T	-	-	rs63666464		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57492883delT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AAAGATTGAGTTTTTTTAGGA	0.348													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	72260661	72260661	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72260661delA								C6orf155 (130213 upstream) : RIMS1 (335989 downstream)																							GCCCCAGCTCAAATTCTGTAC	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	102691368	102691368	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102691368delC								GRIK2 (173411 upstream) : None (None downstream)																							TTGTCCTTCTCCATTCTCTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	119043439	119043439	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119043439delG								C6orf204 (12201 upstream) : ASF1A (171802 downstream)																							ACAGCTTCATGGGACATAATG	0.517													4	2	---	---	---	---	
MAP7	9053	broad.mit.edu	37	6	136730191	136730191	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136730191delA	uc003qgz.2	-						MAP7_uc011edf.1_Intron|MAP7_uc011edg.1_Intron|MAP7_uc010kgu.2_Intron|MAP7_uc011edh.1_Intron|MAP7_uc010kgv.2_Intron|MAP7_uc010kgs.2_Intron|MAP7_uc011edi.1_Intron|MAP7_uc010kgq.1_Intron|MAP7_uc003qha.1_Intron|MAP7_uc010kgr.2_Intron|MAP7_uc010kgt.2_Intron	NM_003980	NP_003971	Q14244	MAP7_HUMAN	microtubule-associated protein 7						establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GTTTAAATGGAAAAAAAAAAT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	139063302	139063305	+	Intron	DEL	ATGA	-	-	rs146105914		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139063302_139063305delATGA	uc003qid.1	-											Homo sapiens cDNA FLJ35273 fis, clone PROST2006020.																		GTAGGGACAGatgaatgaatgaat	0.466													4	4	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157405583	157405584	+	Intron	DEL	AC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157405583_157405584delAC	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron|ARID1B_uc003qqq.1_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GTACAACTTTACTCATTTTTTA	0.376													9	4	---	---	---	---	
FAM120B	84498	broad.mit.edu	37	6	170705407	170705407	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170705407delG	uc003qxp.2	+						FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B						cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		GGTCTGTCTCGGGTGGAGTCT	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1695881	1695881	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1695881delA								TFAMP1 (39554 upstream) : ELFN1 (52917 downstream)																							CCAAAGGCTTAAAAAATTCTG	0.358													4	2	---	---	---	---	
OCM	654231	broad.mit.edu	37	7	5922472	5922473	+	Intron	DEL	TT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5922472_5922473delTT	uc003spe.3	+							NM_001097622	NP_001091091	P0CE72	ONCO_HUMAN	oncomodulin								calcium ion binding				0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0978)|OV - Ovarian serous cystadenocarcinoma(56;2.11e-14)		GCAAAGAttctttttttttttt	0.233													7	4	---	---	---	---	
ISPD	729920	broad.mit.edu	37	7	16144848	16144848	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16144848delT	uc010ktx.2	-						ISPD_uc010kty.2_Intron	NM_001101426	NP_001094896	A4D126	ISPD_HUMAN	notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1						gaagaatatctttttttaaac	0.005										Multiple Myeloma(15;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	33842712	33842712	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33842712delT								BBS9 (197032 upstream) : BMPER (102400 downstream)																							CAGAAGAAACTTTTTTTTTTC	0.443													4	2	---	---	---	---	
HUS1	3364	broad.mit.edu	37	7	48016644	48016645	+	Intron	INS	-	A	A	rs148267866	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48016644_48016645insA	uc003tod.1	-						HUS1_uc003toe.1_Intron|HUS1_uc011kce.1_Intron	NM_004507	NP_004498	O60921	HUS1_HUMAN	HUS1 checkpoint protein						DNA damage checkpoint|DNA replication	Golgi apparatus|nucleolus|nucleoplasm	protein binding			ovary(2)|lung(2)|kidney(1)	5		Breast(660;0.00139)				GAAGTGTGGTGATAAGACAAAA	0.391								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	50911405	50911405	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50911405delC								GRB10 (50246 upstream) : COBL (172505 downstream)																							AATCGCTTGACCCTGGAAGTC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52684910	52684910	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52684910delT								None (None upstream) : POM121L12 (418439 downstream)																							TTGTCTTTCATTTTTCCTAGC	0.378													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57498589	57498589	+	IGR	DEL	T	-	-	rs75462970		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57498589delT								ZNF479 (291018 upstream) : ZNF716 (11294 downstream)																							CCCTGCCTCCTTTTTTTTTTC	0.343													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61759467	61759467	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61759467delA								None (None upstream) : LOC643955 (992205 downstream)																							TGTGATGAGcaaagtagacat	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68628668	68628668	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68628668delA								None (None upstream) : AUTS2 (435237 downstream)																							gtaaagcagtaaaaaaaaatg	0.000													4	2	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71250095	71250095	+	3'UTR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71250095delG	uc003twa.3	-	6					CALN1_uc003twb.3_3'UTR|CALN1_uc003twc.3_3'UTR	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GGTGCCACATGGGGGGTTACC	0.532													4	2	---	---	---	---	
WBSCR22	114049	broad.mit.edu	37	7	73111776	73111776	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73111776delA	uc003tyt.2	+						WBSCR22_uc003tyu.2_Intron|WBSCR22_uc003tyv.2_Intron|WBSCR22_uc003tyw.1_Intron	NM_017528	NP_059998	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22							nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				GGGTGTCCAGAGCGGGGAATT	0.582													5	3	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89908833	89908833	+	Intron	DEL	G	-	-	rs71526681		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89908833delG	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_5'Flank	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						AATTTTTGGTGTTTTTTTTTT	0.219											OREG0003793	type=REGULATORY REGION|Gene=AK024715|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	91294195	91294195	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91294195delT								FZD1 (396064 upstream) : MTERF (137265 downstream)																							CTCAACAGGCTTTTTTTTCTA	0.403													4	2	---	---	---	---	
ASB4	51666	broad.mit.edu	37	7	95165535	95165535	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95165535delT	uc011kij.1	+							NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4						intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			TGGGTTCTGGtttttttttta	0.229													4	2	---	---	---	---	
MDFIC	29969	broad.mit.edu	37	7	114587658	114587658	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114587658delG	uc003vhf.2	+							NM_199072	NP_951038	Q9P1T7	MDFIC_HUMAN	MyoD family inhibitor domain containing protein						activation of JUN kinase activity|interspecies interaction between organisms|negative regulation of protein import into nucleus|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|regulation of Wnt receptor signaling pathway|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleolus|nucleolus|nucleus	cyclin binding|Tat protein binding			ovary(1)	1						TCTGGCTTCTGCCCAGAAGCT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	120503300	120503301	+	IGR	DEL	CT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120503300_120503301delCT								TSPAN12 (5123 upstream) : ING3 (87516 downstream)																							gagcaagaccctctctctctct	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	121357753	121357754	+	IGR	DEL	CA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121357753_121357754delCA								FAM3C (321331 upstream) : PTPRZ1 (155405 downstream)																							atagcatcttcaccaagagtaa	0.010													4	2	---	---	---	---	
TMEM229A	730130	broad.mit.edu	37	7	123672748	123672748	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123672748delG	uc011kob.1	-	1	776	c.310delC	c.(310-312)CTGfs	p.L104fs	uc011koc.1_Intron	NM_001136002	NP_001129474	B2RXF0	T229A_HUMAN	transmembrane protein 229A	104						host cell nucleus|integral to membrane	sequence-specific DNA binding transcription factor activity				0						ACCTTCTCCAGGGCGAAATGG	0.677													37	17	---	---	---	---	
METTL2B	55798	broad.mit.edu	37	7	128140707	128140710	+	Intron	DEL	GTTA	-	-	rs5887382		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128140707_128140710delGTTA	uc003vnf.2	+						METTL2B_uc003vng.2_Intron|METTL2B_uc011kop.1_Intron	NM_018396	NP_060866	Q6P1Q9	MTL2B_HUMAN	methyltransferase like 2B								methyltransferase activity			skin(1)	1						aGTTTGTGCTGTTAGTTTAATAGG	0.216													6	5	---	---	---	---	
AGK	55750	broad.mit.edu	37	7	141284707	141284707	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141284707delG	uc003vwi.2	+						AGK_uc011krg.1_Intron|AGK_uc003vwh.2_Intron	NM_018238	NP_060708	Q53H12	AGK_HUMAN	acylglycerol kinase precursor						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway	mitochondrial membrane	acylglycerol kinase activity|ATP binding|diacylglycerol kinase activity|NAD+ kinase activity			ovary(1)|breast(1)	2	Melanoma(164;0.0171)					ATTTCTTCCTGACCGTTTATG	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142737368	142737368	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142737368delA								OR9A2 (13149 upstream) : OR6V1 (12070 downstream)																							CTTCTACAGGAGGCAGTCAGC	0.164													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151984728	151984728	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151984728delA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		caggaatttgaaaatatagtc	0.000			N		medulloblastoma								4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151986595	151986595	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151986595delT	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaataaatgcttttttcatgg	0.000			N		medulloblastoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152728816	152728817	+	IGR	DEL	GA	-	-	rs138347467		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152728816_152728817delGA								ACTR3B (176353 upstream) : DPP6 (855602 downstream)																							ACTATGGGGGGAGATGGATCTT	0.406													4	2	---	---	---	---	
ZNF596	169270	broad.mit.edu	37	8	191211	191212	+	Intron	INS	-	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:191211_191212insA	uc003wot.2	+						ZNF596_uc003wou.2_Intron|ZNF596_uc003wov.2_Intron|ZNF596_uc003wow.2_Intron	NM_173539	NP_775810	Q8TC21	ZN596_HUMAN	zinc finger protein 596						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)		CCTTGTTGGGGAAATAAATTCA	0.426													4	2	---	---	---	---	
MTUS1	57509	broad.mit.edu	37	8	17510400	17510400	+	Intron	DEL	T	-	-	rs75731166		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17510400delT	uc003wxv.2	-						MTUS1_uc003wxt.2_Intron|MTUS1_uc011kyg.1_Intron|MTUS1_uc010lsy.2_Intron|MTUS1_uc003wxw.2_Intron|MTUS1_uc003wxs.2_Intron	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1							Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		aatacagtgattttTTTTTTA	0.159													6	3	---	---	---	---	
PCM1	5108	broad.mit.edu	37	8	17826953	17826953	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17826953delT	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_5'Flank|PCM1_uc011kyj.1_5'Flank|PCM1_uc003wyk.3_5'Flank	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		AAATATTAGCTTTTTTTTTTA	0.279			T	RET|JAK2	papillary thyroid|CML|MPD								6	3	---	---	---	---	
C8orf80	389643	broad.mit.edu	37	8	27910607	27910607	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27910607delA	uc003xgm.3	-							NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN	speckled-like pattern in the germinal center							nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)		acacccagcCAAAAAAAAAAG	0.129													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49778650	49778651	+	IGR	DEL	CA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49778650_49778651delCA								EFCAB1 (130780 upstream) : SNAI2 (51588 downstream)																							AGGAGGACTCCACACACACTGA	0.396													4	2	---	---	---	---	
RB1CC1	9821	broad.mit.edu	37	8	53536113	53536113	+	3'UTR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53536113delA	uc003xre.3	-	24					RB1CC1_uc003xrf.3_3'UTR	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1						autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTGTCTGGGTAAAAAAAAAAA	0.333													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64154803	64154804	+	IGR	DEL	TG	-	-	rs5891893		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64154803_64154804delTG								YTHDF3 (29458 upstream) : None (None downstream)																							ccaggagtgctgtgtgtgtgtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	78847711	78847711	+	IGR	DEL	G	-	-	rs28658457	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78847711delG								PEX2 (935187 upstream) : PKIA (580625 downstream)																							TAgtttttttgtttgtttgtt	0.274													6	3	---	---	---	---	
HEY1	23462	broad.mit.edu	37	8	80676259	80676259	+	3'UTR	DEL	T	-	-	rs11336222		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80676259delT	uc003ybm.2	-	5					HEY1_uc010lzq.2_3'UTR|HEY1_uc003ybl.2_3'UTR	NM_012258	NP_036390	Q9Y5J3	HEY1_HUMAN	hairy/enhancer-of-split related with YRPW motif						angiogenesis|negative regulation of Notch signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|transcription, DNA-dependent	nucleus	DNA binding|protein binding			lung(3)	3	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			TTGTTCTTTCTTTTTTATTTA	0.373													5	3	---	---	---	---	
ZNF704	619279	broad.mit.edu	37	8	81587709	81587709	+	Intron	DEL	T	-	-	rs111402539		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81587709delT	uc003yby.1	-							NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704							intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			ttttgttttgttttttttttt	0.000													4	4	---	---	---	---	
WWP1	11059	broad.mit.edu	37	8	87378488	87378489	+	Intron	DEL	TC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87378488_87378489delTC	uc003ydt.2	+							NM_007013	NP_008944	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase						central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			lung(1)|liver(1)	2						GGAATGGAGATCAGCAAGATAC	0.515													4	2	---	---	---	---	
SLC26A7	115111	broad.mit.edu	37	8	92324602	92324602	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92324602delC	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|SLC26A7_uc003yez.2_Intron|SLC26A7_uc003yfa.2_Intron	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			acttggttatccattatagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	92452570	92452570	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92452570delT								SLC26A7 (42190 upstream) : RUNX1T1 (518582 downstream)																							ggaaatcatcttctgggggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103903269	103903271	+	IGR	DEL	AAT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103903269_103903271delAAT								AZIN1 (26872 upstream) : ATP6V1C1 (129977 downstream)																							aattgtatcaaatatactttctg	0.054													4	2	---	---	---	---	
BAALC	79870	broad.mit.edu	37	8	104230490	104230490	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104230490delA	uc003yld.2	+						BAALC_uc003yle.2_Intron|uc003ylf.2_Intron|BAALC_uc003ylg.2_Intron|BAALC_uc010mcc.2_Intron	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			AGATTGTGGCAAAAATGATCT	0.433													4	2	---	---	---	---	
LRP12	29967	broad.mit.edu	37	8	105511766	105511771	+	Intron	DEL	ATGTCT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105511766_105511771delATGTCT	uc003yma.2	-						LRP12_uc003ymb.2_Intron	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12						endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AAAATCAGAAATGTCTATTAAAAAGT	0.257													140	73	---	---	---	---	
ANXA13	312	broad.mit.edu	37	8	124740148	124740148	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124740148delT	uc003yqu.2	-						ANXA13_uc003yqt.2_Intron	NM_004306	NP_004297	P27216	ANX13_HUMAN	annexin A13 isoform a						cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			CATTCTTTAATTTTTTTGCAA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	129309871	129309872	+	IGR	DEL	TT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129309871_129309872delTT								MIR1208 (147437 upstream) : None (None downstream)																							tatgctgagctttcaagctcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134354065	134354066	+	IGR	INS	-	T	T	rs113817502		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134354065_134354066insT								NDRG1 (44518 upstream) : ST3GAL1 (113025 downstream)																							GGGTTTTTTTGTTTTTTTTTag	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140209846	140209847	+	IGR	DEL	CT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140209846_140209847delCT								COL22A1 (283610 upstream) : KCNK9 (403235 downstream)																							tctgagactCCTCATCTACAGC	0.297													4	3	---	---	---	---	
KCNK9	51305	broad.mit.edu	37	8	140651764	140651765	+	Intron	DEL	TG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140651764_140651765delTG	uc003yvf.1	-						KCNK9_uc003yvg.1_Intron	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9							integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			AAGGAACTGATGAAGGACAAGG	0.594													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141389507	141389508	+	Intron	DEL	GT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141389507_141389508delGT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						tcttgtgaaggtgtgtgtgtgg	0.050													4	2	---	---	---	---	
EIF2C2	27161	broad.mit.edu	37	8	141553276	141553276	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141553276delA	uc003yvn.2	-						EIF2C2_uc010men.2_Intron|EIF2C2_uc010meo.2_Intron	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1						mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)			tagaaacaacaaaaaaaaacc	0.174													6	3	---	---	---	---	
TSNARE1	203062	broad.mit.edu	37	8	143404569	143404569	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143404569delA	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					aggtaatcccaaaaaattata	0.100													4	2	---	---	---	---	
CYHR1	50626	broad.mit.edu	37	8	145689287	145689287	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145689287delC	uc003zcv.2	-						CYHR1_uc003zcw.2_3'UTR|CYHR1_uc003zcx.2_3'UTR|CYHR1_uc003zcy.2_3'UTR|KIFC2_uc003zcz.2_5'Flank	NM_138496	NP_612505	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1 isoform 1							perinuclear region of cytoplasm	zinc ion binding				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			AGAATCAGGACCCCCAAACGT	0.512											OREG0019056	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	146282427	146282428	+	IGR	INS	-	T	T	rs74202367		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146282427_146282428insT								C8orf33 (1012 upstream) : None (None downstream)																							CTTTTCCCCCCAATCAGACTCC	0.351													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	6053547	6053547	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6053547delG								RANBP6 (37907 upstream) : IL33 (162260 downstream)																							GACTGGAGGAGGGAGGAACTG	0.363													4	2	---	---	---	---	
RECK	8434	broad.mit.edu	37	9	36040810	36040810	+	Intron	DEL	T	-	-	rs67810399		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36040810delT	uc003zyv.2	+						RECK_uc010mld.2_Intron|RECK_uc003zyu.3_Intron|RECK_uc003zyw.2_Intron	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			tactcataggtttttttttta	0.030													4	2	---	---	---	---	
FRMPD1	22844	broad.mit.edu	37	9	37736856	37736857	+	Intron	DEL	GT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37736856_37736857delGT	uc004aag.1	+						FRMPD1_uc004aah.1_Intron|FRMPD1_uc011lqm.1_Intron|FRMPD1_uc011lqn.1_Intron	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		gtgcgtgagagtgtgtgtgtgt	0.366													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66491022	66491022	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66491022delA								FAM74A4 (996636 upstream) : LOC442421 (5448 downstream)																							agaaagacacaaactaccaaa	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87020004	87020004	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87020004delC								SLC28A3 (36591 upstream) : NTRK2 (263462 downstream)																							tcttatttgacccccagaata	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	89397057	89397057	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89397057delA								ZCCHC6 (427679 upstream) : GAS1 (162222 downstream)																							GCTGACCTGGAAAAAAAAGAC	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	107978502	107978502	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107978502delC								ABCA1 (288066 upstream) : SLC44A1 (28427 downstream)																							tactctcatgcctctgcctct	0.090													4	2	---	---	---	---	
FSD1L	83856	broad.mit.edu	37	9	108275403	108275403	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108275403delT	uc011lvv.1	+						FSD1L_uc011lvw.1_Intron|FSD1L_uc004bcq.2_Intron	NM_001145313	NP_001138785	Q9BXM9	FSD1L_HUMAN	fibronectin type III and SPRY domain containing												0						TTTTTATTACTTTTTTTTAGT	0.264													4	2	---	---	---	---	
PALM2	114299	broad.mit.edu	37	9	112441018	112441018	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112441018delT	uc004beg.2	+						PALM2_uc004bef.2_Intron	NM_001037293	NP_001032370	Q8IXS6	PALM2_HUMAN	paralemmin 2 isoform b						regulation of cell shape	plasma membrane				ovary(2)	2						TGTTGTTTTCTTTTCTTTTTT	0.393													4	2	---	---	---	---	
C9orf43	257169	broad.mit.edu	37	9	116186801	116186802	+	Intron	DEL	TT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116186801_116186802delTT	uc004bho.3	+						C9orf43_uc004bhp.2_Intron	NM_152786	NP_689999	Q8TAL5	CI043_HUMAN	hypothetical protein LOC257169												0						TATttctttctttttttttttt	0.223													4	2	---	---	---	---	
RALGPS1	9649	broad.mit.edu	37	9	129957597	129957598	+	Intron	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129957597_129957598insT	uc004bqo.1	+						RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1						CCCTCCCCTGCCCTGTTCTGGG	0.639													4	2	---	---	---	---	
BAT2L1	84726	broad.mit.edu	37	9	134349675	134349675	+	Intron	DEL	T	-	-	rs75614597		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134349675delT	uc004can.3	+						BAT2L1_uc010mzj.1_Intron|BAT2L1_uc004cao.3_Intron	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like								protein binding				0						gatgcttatgtttttttttgg	0.264													4	2	---	---	---	---	
SLC2A6	11182	broad.mit.edu	37	9	136342146	136342146	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136342146delC	uc004cee.2	-						SLC2A6_uc004cef.2_Intron|SLC2A6_uc004ceg.2_Intron|SLC2A6_uc011mdj.1_Intron	NM_017585	NP_060055	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	D-glucose transmembrane transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		GGTGGGAAGGCCTGGCCTTAC	0.637													4	2	---	---	---	---	
ABCA2	20	broad.mit.edu	37	9	139908125	139908128	+	Intron	DEL	CCCG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139908125_139908128delCCCG	uc011mem.1	-						ABCA2_uc011mel.1_Intron|ABCA2_uc004ckl.1_Intron|ABCA2_uc004ckm.1_Intron|ABCA2_uc004ckn.1_Intron	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2						cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGGTCTGGGACCCGAGGAGACAGG	0.686													4	2	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	626672	626672	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:626672delT	uc001ifp.2	-							NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TTCCACATAATTTTTTTTTCC	0.299													3	3	---	---	---	---	
MSRB2	22921	broad.mit.edu	37	10	23399432	23399432	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23399432delT	uc001iro.2	+							NM_012228	NP_036360	Q9Y3D2	MSRB2_HUMAN	methionine sulfoxide reductase B2 precursor						protein repair	mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0					L-Methionine(DB00134)	CTGTCTTGACTTTTTTTTCTA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	24853786	24853786	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24853786delA								KIAA1217 (17015 upstream) : ARHGAP21 (18752 downstream)																							atttatccctaagtatttaat	0.000													4	2	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29776326	29776327	+	Intron	DEL	AA	-	-	rs72152755		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29776326_29776327delAA	uc001iut.1	-						LOC387647_uc001iuq.1_RNA|SVIL_uc010qdw.1_Intron|SVIL_uc001iuu.1_Intron|SVIL_uc009xlc.2_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TTTCACTTCTAAAGAGTCTTGT	0.545													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	47010149	47010149	+	IGR	DEL	T	-	-	rs67707077		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47010149delT								GPRIN2 (4506 upstream) : ANXA8 (1604 downstream)																							ACACCTCACATTTtttttaac	0.164													2	4	---	---	---	---	
CHAT	1103	broad.mit.edu	37	10	50829197	50829197	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50829197delA	uc001jhz.2	+						CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_Intron|CHAT_uc001jhy.1_Intron|CHAT_uc001jia.2_Intron|CHAT_uc010qgs.1_Intron	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2						neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	GTGCAGGGAGAAAGGGTTTCC	0.567													4	2	---	---	---	---	
PPP3CB	5532	broad.mit.edu	37	10	75198411	75198411	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75198411delA	uc001jue.2	-						PPP3CB_uc001juf.2_Intron|PPP3CB_uc001jug.2_Intron|PPP3CB_uc010qkj.1_Intron	NM_021132	NP_066955	P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta											skin(1)	1	Prostate(51;0.0119)					AAAGCCTTCCAAAAAATAAAA	0.353													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78907500	78907501	+	Intron	DEL	CC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78907500_78907501delCC	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	TGACACATGGCCCCAACTTTTC	0.505													4	2	---	---	---	---	
TSPAN14	81619	broad.mit.edu	37	10	82279270	82279271	+	3'UTR	INS	-	TTTT	TTTT	rs5786459		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82279270_82279271insTTTT	uc001kcj.3	+	9					TSPAN14_uc009xss.2_3'UTR|TSPAN14_uc001kci.3_3'UTR	NM_030927	NP_112189	Q8NG11	TSN14_HUMAN	tetraspanin 14 isoform 1							integral to membrane				ovary(1)|central_nervous_system(1)	2			Colorectal(32;0.229)			GTTGATGATGATTTTTTTTTTT	0.401													3	3	---	---	---	---	
FAS	355	broad.mit.edu	37	10	90769119	90769119	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90769119delG	uc001kfr.2	+						FAS_uc010qna.1_Intron|FAS_uc001kfs.2_Intron|FAS_uc001kft.2_Intron|FAS_uc010qnb.1_Intron|FAS_uc010qnc.1_Intron|FAS_uc001kfw.2_Intron|FAS_uc010qnd.1_Intron|FAS_uc010qne.1_Intron|FAS_uc009xtp.2_Intron	NM_000043	NP_000034	P25445	TNR6_HUMAN	tumor necrosis factor receptor superfamily,						activation of caspase activity|activation of pro-apoptotic gene products|anti-apoptosis|cellular response to mechanical stimulus|positive regulation of necrotic cell death	cytosol|extracellular region|integral to membrane|soluble fraction	identical protein binding|kinase binding			upper_aerodigestive_tract(1)|breast(1)	2		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)		ctctgcctgaggagatggagg	0.000									Autoimmune_Lymphoproliferative_syndrome_type_I				4	2	---	---	---	---	
LIPA	3988	broad.mit.edu	37	10	90978930	90978930	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90978930delA	uc001kga.3	-						LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|LIPA_uc010qnf.1_Intron|LIPA_uc009xtq.2_Intron|LIPA_uc009xtr.1_Intron	NM_000235	NP_000226	P38571	LICH_HUMAN	lipase A precursor						lipid catabolic process	lysosome	lipase activity|sterol esterase activity				0		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		TCCTTTAAAGAAAAAAAAAAG	0.114													4	3	---	---	---	---	
CUTC	51076	broad.mit.edu	37	10	101511018	101511018	+	Intron	DEL	A	-	-	rs76735386		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101511018delA	uc001kqd.3	+						CUTC_uc001kqe.3_Intron	NM_015960	NP_057044	Q9NTM9	CUTC_HUMAN	cutC copper transporter homolog						copper ion homeostasis|copper ion transport|protein tetramerization	cytoplasm|nucleus	copper ion binding			breast(1)	1		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		tttaatactcaactttctcca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	108281899	108281900	+	IGR	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108281899_108281900insT								None (None upstream) : SORCS1 (51522 downstream)																							TGAGATGTGAGTTTTGGCACCA	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	110810035	110810035	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110810035delC								None (None upstream) : XPNPEP1 (814489 downstream)																							GAATTTCCCacaatagagtga	0.239													4	2	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121003081	121003082	+	Intron	INS	-	C	C	rs78135226		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121003081_121003082insC	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		agtttttctttttttttttttt	0.000													4	2	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121003082	121003083	+	Intron	INS	-	TTC	TTC	rs28488908		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121003082_121003083insTTC	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		gtttttcttttttttttttttt	0.000													4	2	---	---	---	---	
HTRA1	5654	broad.mit.edu	37	10	124246605	124246605	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124246605delT	uc001lgj.2	+							NM_002775	NP_002766	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1 precursor						proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				caagccccagttactcatttt	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	127160036	127160036	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127160036delA								CTBP2 (310412 upstream) : LOC100169752 (102904 downstream)																							AAACACAACTAAAAATTATTC	0.373													4	2	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127582434	127582434	+	Intron	DEL	T	-	-	rs5788733		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127582434delT	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATTTGCTACATTTTTTATCAA	0.289													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130687954	130687954	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130687954delA								MKI67 (763486 upstream) : MGMT (577500 downstream)																							atgattctttaaaaaaaattt	0.000													4	3	---	---	---	---	
PSMA1	5682	broad.mit.edu	37	11	14530475	14530475	+	Intron	DEL	A	-	-	rs113557116		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14530475delA	uc001mlk.2	-						PSMA1_uc001mll.2_Intron|PSMA1_uc010rcp.1_Intron|PSMA1_uc001mlj.2_Intron	NM_002786	NP_002777	P25786	PSA1_HUMAN	proteasome alpha 1 subunit isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|polysome|proteasome core complex, alpha-subunit complex	protein binding|RNA binding|threonine-type endopeptidase activity			upper_aerodigestive_tract(1)|skin(1)	2						gccaacacctaactcatctcc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	24041457	24041458	+	IGR	INS	-	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24041457_24041458insA								None (None upstream) : LUZP2 (477098 downstream)																							ATTTTTGTCTTAAAAAAAAAGC	0.307													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34861172	34861172	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34861172delA								EHF (178091 upstream) : APIP (35542 downstream)																							GAGAACAACCAAAACTAATTT	0.214													4	2	---	---	---	---	
MS4A8B	83661	broad.mit.edu	37	11	60474782	60474783	+	Intron	INS	-	GA	GA	rs11230453		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60474782_60474783insGA	uc001npv.2	+						MS4A8B_uc009yne.1_Intron	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity				0						GTATGgagagcgagagagagag	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	62699736	62699736	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62699736delC								CHRM1 (10724 upstream) : SLC22A6 (44334 downstream)																							GAGAGCCTGGCCCTAGCCATT	0.418													4	2	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72325803	72325803	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72325803delG	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	aaggactggaggggaggggcc	0.159													4	2	---	---	---	---	
NEU3	10825	broad.mit.edu	37	11	74696621	74696622	+	5'Flank	DEL	CT	-	-	rs147130919		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74696621_74696622delCT	uc001ovv.2	+							NM_006656	NP_006647	A8K327	A8K327_HUMAN	sialidase 3											ovary(2)	2						caaacaacccctgtgttcaggt	0.000													4	3	---	---	---	---	
PICALM	8301	broad.mit.edu	37	11	85670386	85670387	+	Intron	DEL	AA	-	-	rs68172244		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85670386_85670387delAA	uc001pbm.2	-						PICALM_uc001pbl.2_Intron|PICALM_uc001pbn.2_Intron|PICALM_uc010rtl.1_Intron|PICALM_uc001pbk.2_Intron|PICALM_uc010rtk.1_Intron	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly						clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				atcaaagctcaatggctgggca	0.045			T	MLLT10|MLL	TALL|AML|								4	5	---	---	---	---	
GRM5	2915	broad.mit.edu	37	11	88361522	88361522	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88361522delT	uc001pcq.2	-						GRM5_uc009yvm.2_Intron	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	AGAATCTTGCTTAATGGATGT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89436060	89436061	+	IGR	INS	-	TG	TG	rs139543107	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89436060_89436061insTG								FOLH1B (4175 upstream) : TRIM77 (7406 downstream)																							caataggggactgtgtgtgtgt	0.124													4	3	---	---	---	---	
FAT3	120114	broad.mit.edu	37	11	92311941	92311941	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92311941delT	uc001pdj.3	+							NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				cagatgagtgttttagggaca	0.149										TCGA Ovarian(4;0.039)			4	2	---	---	---	---	
MTMR2	8898	broad.mit.edu	37	11	95584195	95584196	+	Intron	INS	-	A	A	rs146712846	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95584195_95584196insA	uc001pfu.2	-						MTMR2_uc001pfv.2_Intron|MTMR2_uc001pfs.2_Intron|MTMR2_uc001pft.2_Intron|MTMR2_uc010ruj.1_Intron	NM_016156	NP_057240	Q13614	MTMR2_HUMAN	myotubularin-related protein 2 isoform 1							nucleus	inositol or phosphatidylinositol phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GAGGTGGAAGGAAACAGTAAGA	0.218													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	96218664	96218664	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96218664delT								JRKL (91937 upstream) : None (None downstream)																							TGATATGTCCTTTTGTGCTAT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	104062035	104062035	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104062035delA								PDGFD (27008 upstream) : CASP12 (694407 downstream)																							CGCTGAAACCAAAAAAATGTG	0.408													4	2	---	---	---	---	
CASP1	834	broad.mit.edu	37	11	104938142	104938142	+	Intron	DEL	T	-	-	rs5794377		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104938142delT	uc010rve.1	-						CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|uc001piq.1_Intron	NM_033292	NP_150634	P29466	CASP1_HUMAN	caspase 1 isoform alpha precursor						cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)	GATACAGGAATTTTTTTTTTT	0.343													7	4	---	---	---	---	
ELMOD1	55531	broad.mit.edu	37	11	107506111	107506111	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107506111delT	uc010rvs.1	+						ELMOD1_uc001pjm.2_Intron|ELMOD1_uc010rvt.1_Intron	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1						phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		AAATCCCTTATTTTTAAGTCA	0.194													4	2	---	---	---	---	
BCO2	83875	broad.mit.edu	37	11	112065744	112065748	+	Intron	DEL	TATCT	-	-	rs148699863		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112065744_112065748delTATCT	uc001pnf.2	+						BCO2_uc001pne.1_Intron|BCO2_uc001png.2_Intron|BCO2_uc001pnh.2_Intron|BCO2_uc010rwt.1_Intron|BCO2_uc009yyn.2_Intron|BCO2_uc001pni.2_Intron	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN	beta-carotene dioxygenase 2 isoform a						carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						TTGGTCTATCTATCTTATCTTGATC	0.283													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113394290	113394291	+	IGR	INS	-	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113394290_113394291insA								DRD2 (47877 upstream) : TMPRSS5 (163978 downstream)																							cctctcaaattaaaaaaaaaaa	0.054													9	5	---	---	---	---	
TMPRSS13	84000	broad.mit.edu	37	11	117787449	117787451	+	Intron	DEL	TAA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117787449_117787451delTAA	uc001prs.1	-						TMPRSS13_uc009yzr.1_Intron|TMPRSS13_uc001prt.1_Intron|TMPRSS13_uc001pru.1_Intron	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TGTGTTTTTTTAATAGCTAGTAT	0.369													4	2	---	---	---	---	
USP2	9099	broad.mit.edu	37	11	119231138	119231138	+	Intron	DEL	T	-	-	rs11339666		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119231138delT	uc001pwm.3	-						USP2_uc001pwl.3_Intron|USP2_uc001pwn.3_Intron	NM_004205	NP_004196	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2 isoform a						cell cycle|muscle organ development|negative regulation of transcription from RNA polymerase II promoter|positive regulation of mitotic cell cycle|protein deubiquitination|protein stabilization|ubiquitin-dependent protein catabolic process	nucleus|perinuclear region of cytoplasm	cyclin binding|cysteine-type endopeptidase activity|metal ion binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity			ovary(2)|urinary_tract(1)|skin(1)	4		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		ttttcttttcttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127093744	127093746	+	IGR	DEL	ATC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127093744_127093746delATC								KIRREL3 (220389 upstream) : None (None downstream)																							catcgtcgtgatcatcatcatca	0.172													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131641010	131641010	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131641010delA	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						TAAAACTTATAAAAAAAAAGT	0.373													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	132180313	132180313	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132180313delC	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron|NTM_uc001qgr.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						TTTTTAATGTCACCATGTAGA	0.378													4	2	---	---	---	---	
GALNT8	26290	broad.mit.edu	37	12	4830281	4830282	+	Intron	DEL	TG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4830281_4830282delTG	uc001qne.1	+							NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4						GAGGTGAGCATGTGTGTGTGTA	0.446													4	2	---	---	---	---	
PHC1	1911	broad.mit.edu	37	12	9087516	9087516	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9087516delT	uc001qvd.2	+						PHC1_uc001qve.2_Intron	NM_004426	NP_004417	P78364	PHC1_HUMAN	polyhomeotic 1-like						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						CCAGTTACTATTTTTTTTTTC	0.368													5	6	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32298125	32298126	+	Intron	INS	-	G	G	rs138027506	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32298125_32298126insG	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GGAAGAAAGAATAAAAAAGCCA	0.371													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	37926938	37926938	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37926938delG								None (None upstream) : ALG10B (783619 downstream)																							gtctgtgtgtgggggtaagtg	0.289													4	2	---	---	---	---	
IRAK4	51135	broad.mit.edu	37	12	44167526	44167527	+	Intron	INS	-	A	A	rs145962440	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44167526_44167527insA	uc001rnu.3	+						IRAK4_uc001rnt.3_Intron|IRAK4_uc001rnx.3_Intron|IRAK4_uc001rny.3_Intron|IRAK4_uc010sky.1_Intron|IRAK4_uc001rnv.3_Intron|IRAK4_uc001rnw.3_Intron	NM_001114182	NP_001107654	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4						innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0	all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		AGTGAAATTTCGTGTTATTTCA	0.208													12	6	---	---	---	---	
IRAK4	51135	broad.mit.edu	37	12	44167530	44167531	+	Intron	INS	-	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44167530_44167531insA	uc001rnu.3	+						IRAK4_uc001rnt.3_Intron|IRAK4_uc001rnx.3_Intron|IRAK4_uc001rny.3_Intron|IRAK4_uc010sky.1_Intron|IRAK4_uc001rnv.3_Intron|IRAK4_uc001rnw.3_Intron	NM_001114182	NP_001107654	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4						innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0	all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		AAATTTCGTGTTATTTCATTTT	0.193													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	44840361	44840361	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44840361delT								TMEM117 (56821 upstream) : NELL2 (61697 downstream)																							TCCTGGTAGCTTTCAAAATGT	0.373													4	2	---	---	---	---	
ADCY6	112	broad.mit.edu	37	12	49162165	49162166	+	3'UTR	DEL	CA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49162165_49162166delCA	uc001rsh.3	-	21					ADCY6_uc001rsj.3_3'UTR|ADCY6_uc001rsi.3_3'UTR	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						GAAAGAAAGTCACTTGCATAAT	0.540													4	2	---	---	---	---	
TUBA1C	84790	broad.mit.edu	37	12	49663991	49663991	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49663991delT	uc001rtt.1	+						TUBA1C_uc001rts.2_Intron|TUBA1C_uc010smh.1_Intron	NM_032704	NP_116093	Q9BQE3	TBA1C_HUMAN	tubulin alpha 6						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0						GAGACACCCCTTTTGAGGTCA	0.383													4	2	---	---	---	---	
SP7	121340	broad.mit.edu	37	12	53721906	53721906	+	3'UTR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53721906delG	uc001sct.2	-	2					SP7_uc001scu.2_3'UTR|SP7_uc001scv.2_3'UTR	NM_152860	NP_690599	Q8TDD2	SP7_HUMAN	osterix						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGGCAGCCCTGGGGTGGGAGA	0.607											OREG0021867	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54179886	54179886	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54179886delA								CALCOCO1 (58579 upstream) : HOXC13 (152690 downstream)																							CTGAATCAGGAAGGCCTGAGA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55587847	55587849	+	IGR	DEL	ACC	-	-	rs72038686		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55587847_55587849delACC								OR9K2 (63288 upstream) : OR10A7 (26960 downstream)																							CAGAGAAACAACCAAGATATGAG	0.453													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	57331501	57331501	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57331501delC								SDR9C7 (3456 upstream) : RDH16 (13717 downstream)																							CCTTGGAGAGCCCCAGTTGAG	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	60709739	60709739	+	IGR	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60709739delC								SLC16A7 (534332 upstream) : None (None downstream)																							tctggtacttccttggcttgt	0.005													4	2	---	---	---	---	
TMBIM4	51643	broad.mit.edu	37	12	66539381	66539381	+	Intron	DEL	T	-	-	rs75009871		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66539381delT	uc001stc.2	-						LLPH_uc010ssx.1_Intron|TMBIM4_uc001std.2_Intron|TMBIM4_uc009zqr.2_Intron|TMBIM4_uc001ste.2_Intron|TMBIM4_uc001stf.2_Intron|TMBIM4_uc009zqs.2_Intron	NM_016056	NP_057140	Q9HC24	TMBI4_HUMAN	transmembrane BAX inhibitor motif containing 4							integral to membrane	protein binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(28;0.0745)		GGAAAGCTTATTTTTTTTTTT	0.343													2	4	---	---	---	---	
MDM1	56890	broad.mit.edu	37	12	68721137	68721137	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68721137delA	uc001stz.2	-						MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_Intron|MDM1_uc001sua.3_Intron|MDM1_uc010std.1_3'UTR	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1							nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		CCTCGTTTCTAATTACTTTCC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	73210775	73210775	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73210775delT								TRHDE (151354 upstream) : None (None downstream)																							tcaaccacactgacctctttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	87661101	87661102	+	IGR	DEL	CA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87661101_87661102delCA								MGAT4C (428420 upstream) : C12orf50 (712714 downstream)																							cattgctgttcagctcctaccc	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	88275312	88275313	+	IGR	INS	-	T	T	rs71082411		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88275312_88275313insT								None (None upstream) : C12orf50 (98503 downstream)																							caatatctctcttttttTTTTC	0.144													4	2	---	---	---	---	
PAH	5053	broad.mit.edu	37	12	103295684	103295684	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103295684delA	uc001tjq.1	-						PAH_uc010swc.1_Intron	NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase						catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	ggaaaagcagaaaaaaaaatc	0.035													4	2	---	---	---	---	
PAH	5053	broad.mit.edu	37	12	103300817	103300818	+	Intron	INS	-	T	T			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103300817_103300818insT	uc001tjq.1	-						PAH_uc010swc.1_Intron	NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase						catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	TTATCTTCTAATTTTTTTCTTA	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105850887	105850888	+	IGR	DEL	AG	-	-	rs74851963		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105850887_105850888delAG								C12orf75 (85592 upstream) : NUAK1 (606237 downstream)																							ACTGGTAGTCAGAGTCTCAGTA	0.426													5	5	---	---	---	---	
NUAK1	9891	broad.mit.edu	37	12	106489309	106489309	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106489309delC	uc001tlj.1	-							NM_014840	NP_055655	O60285	NUAK1_HUMAN	AMPK-related protein kinase 5								ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2						gcaggctcttcctctgctaaa	0.294													4	2	---	---	---	---	
PWP1	11137	broad.mit.edu	37	12	108082782	108082782	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108082782delA	uc001tmo.1	+						PWP1_uc001tmn.1_Intron|PWP1_uc009zuu.1_Intron	NM_007062	NP_008993	Q13610	PWP1_HUMAN	periodic tryptophan protein 1						transcription, DNA-dependent	nucleus					0						TCTAGGATCTAAAAAAAAAAG	0.328													11	5	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110251222	110251223	+	Intron	INS	-	A	A	rs142309012	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110251222_110251223insA	uc001tpj.1	-						TRPV4_uc001tpg.1_Intron|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Intron|TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						atctcaaaaagaaaaaaaaagc	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129275472	129275473	+	IGR	INS	-	TT	TT			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129275472_129275473insTT								TMEM132C (83009 upstream) : SLC15A4 (2266 downstream)																							GCTTAATGTGCTTTTTTTTCCA	0.406													4	2	---	---	---	---	
C13orf31	144811	broad.mit.edu	37	13	44457716	44457717	+	Intron	INS	-	A	A	rs147245430	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44457716_44457717insA	uc010acg.2	+						C13orf31_uc001uzf.3_Intron	NM_001128303	NP_001121775	Q8IV20	CM031_HUMAN	hypothetical protein LOC144811												0		Lung NSC(96;0.000163)|all_hematologic(4;0.0127)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Breast(139;0.0364)|Lung SC(185;0.0367)|Acute lymphoblastic leukemia(4;0.138)		GBM - Glioblastoma multiforme(144;0.000573)|BRCA - Breast invasive adenocarcinoma(63;0.121)		GAGATTATAATCTAAAATCTTA	0.213													7	8	---	---	---	---	
THSD1P1	374500	broad.mit.edu	37	13	52793908	52793916	+	Intron	DEL	CTCAGTTGG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52793908_52793916delCTCAGTTGG	uc001vgm.1	-						uc001vgn.2_RNA					Homo sapiens cDNA FLJ14630 fis, clone NT2RP2000459.												0						CTTTTTGTGTCTCAGTTGGCTCCTTCTAC	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	66778706	66778706	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66778706delG								None (None upstream) : PCDH9 (98261 downstream)																							cccttgaacaggggtgccact	0.095													2	4	---	---	---	---	
MYCBP2	23077	broad.mit.edu	37	13	77632725	77632725	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77632725delT	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron|MYCBP2_uc001vke.2_Intron	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTTAACAAAGTTTTTTTTTTT	0.289													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	89459862	89459862	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89459862delA								None (None upstream) : None (None downstream)																							tcttgcttacaaaaacttaca	0.000													4	2	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96622821	96622821	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96622821delA	uc001vmt.2	-							NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						CAAAAATGAGAAAAAAAATAT	0.274													4	2	---	---	---	---	
POTEG	404785	broad.mit.edu	37	14	19563219	19563220	+	Intron	INS	-	C	C			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19563219_19563220insC	uc001vuz.1	+						POTEG_uc001vva.1_Intron|POTEG_uc010ahc.1_Intron|uc001vvb.2_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											ovary(1)	1						GTTTTTTTTTTGTCCCTTCCTT	0.366													4	2	---	---	---	---	
SCFD1	23256	broad.mit.edu	37	14	31192049	31192049	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31192049delA	uc001wqm.1	+						SCFD1_uc001wqn.1_Intron|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_Intron|SCFD1_uc010amf.1_Intron|SCFD1_uc010tpi.1_Intron	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a						post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		ACCTCTTCCCAAAAAAAAAAA	0.294													4	2	---	---	---	---	
ERO1L	30001	broad.mit.edu	37	14	53127700	53127701	+	Intron	DEL	AA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53127700_53127701delAA	uc001wzv.2	-						ERO1L_uc001wzw.2_Intron|ERO1L_uc010aof.2_Intron	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN	ERO1-like precursor						chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor				0	Breast(41;0.226)					TTCAACCAGTAAAAGAGAGAGG	0.470													4	2	---	---	---	---	
SPTLC2	9517	broad.mit.edu	37	14	78021964	78021964	+	Intron	DEL	T	-	-	rs151267420	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78021964delT	uc001xub.2	-							NM_004863	NP_004854	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base							integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			upper_aerodigestive_tract(1)|ovary(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	TTACTGCttcttttttttttc	0.134													6	5	---	---	---	---	
ALKBH1	8846	broad.mit.edu	37	14	78149924	78149924	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78149924delT	uc001xuc.1	-						ALKBH1_uc001xud.1_Intron	NM_006020	NP_006011	Q13686	ALKB1_HUMAN	alkylated DNA repair protein alkB homolog						DNA dealkylation involved in DNA repair|DNA demethylation|oxidative demethylation|RNA repair	mitochondrion	DNA-(apurinic or apyrimidinic site) lyase activity|ferrous iron binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(1)|skin(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		ATCATCCTCCtttttttttga	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	87637207	87637207	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87637207delA								None (None upstream) : GALC (666957 downstream)																							ttttaagcagaaaaaaaaaat	0.000													4	2	---	---	---	---	
ZC3H14	79882	broad.mit.edu	37	14	89055340	89055340	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89055340delT	uc001xww.2	+						ZC3H14_uc010twd.1_Intron|ZC3H14_uc010twe.1_Intron|ZC3H14_uc001xwx.2_Intron|ZC3H14_uc010twf.1_Intron|ZC3H14_uc001xwy.2_Intron|ZC3H14_uc010twg.1_Intron|ZC3H14_uc001xxa.2_Intron	NM_024824	NP_079100	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14 isoform 1							cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3						attaaagggattttttttttc	0.129													4	2	---	---	---	---	
TC2N	123036	broad.mit.edu	37	14	92268994	92268994	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92268994delT	uc001xzu.3	-						TC2N_uc001xzt.3_Intron|TC2N_uc010auc.2_Intron|TC2N_uc001xzv.3_Intron	NM_001128595	NP_001122067	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear							nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)		ATTTCTGGCATTTTTCTTTGC	0.353													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106811854	106811855	+	Intron	DEL	CA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106811854_106811855delCA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TCATGGTGGGCACAAAACATAA	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20433365	20433365	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20433365delT								None (None upstream) : GOLGA6L6 (303729 downstream)																							TAACATCTTGTTTTAGGTTAA	0.313													4	2	---	---	---	---	
LOC646214	646214	broad.mit.edu	37	15	21935217	21935221	+	RNA	DEL	AAAAC	-	-	rs3084906		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21935217_21935221delAAAAC	uc010tzj.1	-	1		c.5519_5523delGTTTT				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						TACCTATTTGAAAACAAAACAAAAG	0.302													3	3	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28473276	28473276	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28473276delA	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		aaaaAGCTTTAaaaaaaaaaa	0.179													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	29053661	29053661	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29053661delA								WHAMML2 (29376 upstream) : APBA2 (77507 downstream)																							TGTCATCTTTAAAAAAATGCA	0.313													4	2	---	---	---	---	
DNAJC17	55192	broad.mit.edu	37	15	41099112	41099112	+	Intron	DEL	G	-	-	rs34110073		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41099112delG	uc001zms.1	-						DNAJC17_uc010bbz.1_Intron|DNAJC17_uc010bca.1_Intron|DNAJC17_uc010bcb.1_Intron|ZFYVE19_uc001zmt.1_5'Flank|ZFYVE19_uc001zmu.1_5'Flank|ZFYVE19_uc001zmv.1_5'Flank|ZFYVE19_uc001zmw.1_5'Flank|ZFYVE19_uc001zmx.1_5'Flank|ZFYVE19_uc010bcc.1_5'Flank	NM_018163	NP_060633	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17						protein folding		heat shock protein binding|nucleotide binding|RNA binding|unfolded protein binding				0		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		ACATTGGCAAGGGGGCATGAA	0.448													1	5	---	---	---	---	
GALK2	2585	broad.mit.edu	37	15	49599868	49599869	+	Intron	DEL	TC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49599868_49599869delTC	uc001zxj.1	+						GALK2_uc001zxi.1_Intron|GALK2_uc010ufb.1_Intron|GALK2_uc001zxk.2_Intron|GALK2_uc010ufc.1_Intron	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1						galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		AAGGTTTTGATCAGCGGAGTAA	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	53034259	53034261	+	IGR	DEL	CCT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53034259_53034261delCCT								KIAA1370 (63306 upstream) : ONECUT1 (15092 downstream)																							ctttgtagcccctcctttgaatc	0.000													4	2	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53906143	53906144	+	Intron	INS	-	TTAT	TTAT	rs138717914	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53906143_53906144insTTAT	uc002acj.2	-							NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		CACCTAAAATCTTATTTATTTA	0.307													7	6	---	---	---	---	
TRIP4	9325	broad.mit.edu	37	15	64687939	64687939	+	Intron	DEL	T	-	-	rs34572425		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64687939delT	uc002anm.2	+							NM_016213	NP_057297	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ligand-dependent nuclear receptor binding|transcription coactivator activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3						ACATCTTTGCttttttttttt	0.144													10	6	---	---	---	---	
PTPLAD1	51495	broad.mit.edu	37	15	65856307	65856307	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65856307delA	uc002apc.2	+						PTPLAD1_uc002apb.1_Intron|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain						activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0						actccatctcaaaaaaaaaaa	0.194													4	2	---	---	---	---	
ISL2	64843	broad.mit.edu	37	15	76629571	76629572	+	Intron	INS	-	T	T	rs35979759		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76629571_76629572insT	uc002bbw.1	+							NM_145805	NP_665804	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AGGGATGTGGGTTTTTTTTTTT	0.391													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	77207176	77207176	+	IGR	DEL	A	-	-	rs28645353		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77207176delA								SCAPER (9432 upstream) : RCN2 (16786 downstream)																							cagaggggggaaaaaaaactt	0.000													4	2	---	---	---	---	
DNAJA4	55466	broad.mit.edu	37	15	78563236	78563236	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78563236delA	uc002bdj.1	+						DNAJA4_uc002bdi.2_Intron|DNAJA4_uc002bdk.2_Intron|DNAJA4_uc002bdl.2_Intron	NM_001130182	NP_001123654	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4						protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding			skin(1)	1						tccccatctcaaaaaaaataa	0.000													4	3	---	---	---	---	
GOLGA6L10	647042	broad.mit.edu	37	15	82932287	82932288	+	Intron	DEL	AC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82932287_82932288delAC	uc010unt.1	-						uc002bhl.2_Intron|uc002bhm.2_Intron			A6NI86	GG6LA_HUMAN	Homo sapiens cDNA FLJ40113 fis, clone TESTI2008621.												0						taaattagaaacacaaataaat	0.124													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	89900407	89900407	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89900407delT								POLG (22381 upstream) : LOC254559 (4403 downstream)																							TCTCTTGCCCTTTATCTCTTG	0.507											OREG0023454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
SLCO3A1	28232	broad.mit.edu	37	15	92543633	92543634	+	Intron	DEL	TA	-	-	rs8029029		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92543633_92543634delTA	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			ccttTTTTTTTAAAAAAAAAAA	0.010													4	2	---	---	---	---	
C16orf11	146325	broad.mit.edu	37	16	614379	614379	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:614379delG	uc002chk.2	+						NHLRC4_uc002chl.2_5'Flank|PIGQ_uc010bqw.2_5'Flank	NM_145270	NP_660313	P0CG20	CP011_HUMAN	hypothetical protein LOC146325											central_nervous_system(1)	1						CGGAGCAGGTGGGCGTCTTGG	0.701													4	2	---	---	---	---	
ADCY9	115	broad.mit.edu	37	16	4136162	4136163	+	Intron	INS	-	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4136162_4136163insA	uc002cvx.2	-							NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						AGGACAAGGAGAAAAAAAATCA	0.564													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8405407	8405408	+	IGR	INS	-	GT	GT	rs144913506	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8405407_8405408insGT								A2BP1 (642067 upstream) : TMEM114 (214095 downstream)																							TTGTAAGGGGCgtgtgtgtgtg	0.441													3	3	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	9867833	9867834	+	Intron	DEL	TG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9867833_9867834delTG	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GAGGCAGTGTTGTGTGTGTGTG	0.436													4	2	---	---	---	---	
MYH11	4629	broad.mit.edu	37	16	15910273	15910273	+	Intron	DEL	A	-	-	rs113736776		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15910273delA	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron|MYH11_uc002deb.3_Intron	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						aagattggggaaaaaaaaggc	0.000			T	CBFB	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32539797	32539798	+	IGR	INS	-	A	A	rs138179239		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32539797_32539798insA								HERC2P4 (375923 upstream) : TP53TG3B (145043 downstream)																							caagatcctacaaaaatgcgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33972885	33972886	+	IGR	INS	-	T	T	rs144092915		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33972885_33972886insT								MIR1826 (7293 upstream) : UBE2MP1 (430916 downstream)																							ttctgagaaacttttttgtgat	0.000													7	6	---	---	---	---	
CTRB2	440387	broad.mit.edu	37	16	75238602	75238602	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75238602delG	uc002fdr.2	-							NM_001025200	NP_001020371	Q6GPI1	CTRB2_HUMAN	chymotrypsin B2 precursor						digestion|proteolysis	extracellular space	serine-type endopeptidase activity				0						AGAGCAGAGAGGGGTGGAAAG	0.697													4	2	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77337528	77337529	+	Intron	DEL	AT	-	-	rs141446001		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77337528_77337529delAT	uc002ffc.3	-						ADAMTS18_uc010chc.1_Intron|ADAMTS18_uc002ffe.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						GGTCAAGACAATAAAAAAAAAA	0.243													4	2	---	---	---	---	
C16orf46	123775	broad.mit.edu	37	16	81094614	81094614	+	3'UTR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81094614delA	uc002fgc.3	-	4					C16orf46_uc010chf.2_Intron|C16orf46_uc010vno.1_3'UTR	NM_152337	NP_689550	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46 isoform 2												0						GTTGTACTACAAAAAAAAAAT	0.408													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	84574505	84574505	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84574505delA								KIAA1609 (36217 upstream) : COTL1 (24701 downstream)																							actccatctcaaaaaaaaaga	0.000													4	2	---	---	---	---	
C16orf3	750	broad.mit.edu	37	16	90096053	90096055	+	5'UTR	DEL	CTT	-	-	rs79220619		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90096053_90096055delCTT	uc002fqk.1	-	1					GAS8_uc010vps.1_Intron|GAS8_uc002fqh.2_Intron|GAS8_uc010vpt.1_Intron|GAS8_uc010vpu.1_Intron|GAS8_uc010vpv.1_Intron|GAS8_uc010cjc.1_Intron|GAS8_uc002fqi.1_Intron|GAS8_uc010vpw.1_Intron|GAS8_uc002fqj.1_Intron	NM_001214	NP_001205	O95177	CP003_HUMAN	hypothetical protein LOC750												0		all_cancers(9;9.01e-08)|Hepatocellular(780;0.000325)|Lung NSC(15;0.0104)|all_lung(18;0.0239)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		CCTGCTGCTCCTTCTTGTTTGCT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	4273509	4273509	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4273509delT								UBE2G1 (3540 upstream) : SPNS3 (63710 downstream)																							tgtgtaccacttttttttttc	0.000													4	2	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11819719	11819720	+	Intron	INS	-	CT	CT			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11819719_11819720insCT	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron|DNAH9_uc010vvh.1_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGCACCTGTGCCTCTCTCTCTC	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20656957	20656957	+	IGR	DEL	T	-	-	rs113405636		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20656957delT								LGALS9B (286109 upstream) : CCDC144NL (109753 downstream)																							CAGTAACCAATTTTTTTTTTT	0.289													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25308525	25308525	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25308525delA								None (None upstream) : WSB1 (312581 downstream)																							atacagttataaaaagaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25319426	25319426	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25319426delT								None (None upstream) : WSB1 (301680 downstream)																							TTGTGCTGAGTTTGGGGGAAG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25375129	25375130	+	IGR	INS	-	A	A			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25375129_25375130insA								None (None upstream) : WSB1 (245976 downstream)																							TCTTGCCTAAGAAAAAAAACAA	0.376													4	3	---	---	---	---	
KSR1	8844	broad.mit.edu	37	17	25948111	25948111	+	Intron	DEL	C	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25948111delC	uc010crg.2	+						KSR1_uc002gzo.1_5'Flank|KSR1_uc002gzm.2_Intron|KSR1_uc002gzn.2_Intron	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras						Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CTCCCACTTTCCCATCACCTG	0.542													4	2	---	---	---	---	
CRLF3	51379	broad.mit.edu	37	17	29120865	29120865	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29120865delT	uc002hfr.3	-						CRLF3_uc010wbr.1_Intron	NM_015986	NP_057070	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3						negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				ATCTCCCttcttttttttttg	0.229													6	3	---	---	---	---	
NF1	4763	broad.mit.edu	37	17	29533686	29533700	+	Intron	DEL	TTTTGAACAAAAATA	-	-	rs3216935		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29533686_29533700delTTTTGAACAAAAATA	uc002hgg.2	+						NF1_uc002hge.1_Intron|NF1_uc002hgf.1_Intron|NF1_uc002hgh.2_Intron|NF1_uc010csn.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCCTTAAAACTTTTGAACAAAAATATTTTGATTAG	0.321			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			5	4	---	---	---	---	
LIG3	3980	broad.mit.edu	37	17	33313352	33313352	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33313352delT	uc002hik.1	+						LIG3_uc002hii.2_Intron|LIG3_uc002hij.2_Intron|LIG3_uc010cth.1_Intron	NM_013975	NP_039269	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent isoform alpha						base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding			skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9		Ovarian(249;0.17)			Bleomycin(DB00290)	gttttgggggtttttttgaga	0.139								Other_BER_factors					4	2	---	---	---	---	
MAPT	4137	broad.mit.edu	37	17	43998561	43998561	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43998561delA	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				GTTTGGGTGTAAATTCGGGGT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44486655	44486655	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44486655delT								ARL17A (47492 upstream) : LRRC37A2 (103421 downstream)																							TACAGTCttcttttttttttt	0.134													5	3	---	---	---	---	
SMURF2	64750	broad.mit.edu	37	17	62547477	62547477	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62547477delA	uc002jep.1	-						SMURF2_uc002jeq.1_Intron|SMURF2_uc002jer.1_Intron	NM_022739	NP_073576	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2						BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity			skin(3)|lung(1)	4	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			cctgtctcagaaaaaaaaaaa	0.169													4	2	---	---	---	---	
PITPNC1	26207	broad.mit.edu	37	17	65627963	65627963	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65627963delT	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			TGGGAAGAGATTTTTTTTTTT	0.403													4	2	---	---	---	---	
BPTF	2186	broad.mit.edu	37	17	65882603	65882603	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65882603delT	uc002jgf.2	+						BPTF_uc002jge.2_Intron|BPTF_uc010wqm.1_Intron	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTATTTTTCATTTTTTTTTTA	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68898927	68898928	+	IGR	INS	-	T	T	rs145124053	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68898927_68898928insT								KCNJ2 (722746 upstream) : None (None downstream)																							GGGGTTGAATATTAACCTGCAG	0.371													3	4	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76100303	76100303	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76100303delA	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CCCAGGATGCAAATGACACTG	0.423													4	2	---	---	---	---	
ARHGAP28	79822	broad.mit.edu	37	18	6876540	6876540	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6876540delA	uc010wzi.1	+						ARHGAP28_uc002knc.2_Intron|ARHGAP28_uc002knd.2_Intron|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Intron			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				TTTAGTTTGTAAAAGTTGAAA	0.383													4	2	---	---	---	---	
SEH1L	81929	broad.mit.edu	37	18	12977100	12977100	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12977100delT	uc002krr.2	+						SEH1L_uc002krq.2_Intron	NM_031216	NP_112493	Q96EE3	SEH1_HUMAN	sec13-like protein isoform 2						attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|carbohydrate metabolic process|cell division|glucose transport|mitotic metaphase plate congression|mitotic prometaphase|mRNA transport|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex					0						ATGAGATTGCTTAGGGTGATT	0.303													4	2	---	---	---	---	
ESCO1	114799	broad.mit.edu	37	18	19110662	19110662	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19110662delA	uc002kth.1	-						ESCO1_uc002kti.1_Intron	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1						cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						gcaacaatgtaaaaacattta	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	25271397	25271397	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25271397delT								C18orf16 (500747 upstream) : CDH2 (259533 downstream)																							GTCGTCAGAAttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	44847817	44847817	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44847817delT	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																		TTTACCACCCTTGCAGTAATG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	51678441	51678441	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51678441delA								DCC (620659 upstream) : MBD2 (2134 downstream)																							acagacatgcaaaaaaaaatt	0.000													4	2	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59935998	59935999	+	Intron	INS	-	TAACC	TAACC	rs148383213	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59935998_59935999insTAACC	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				ATACTTACTTGTAACCTAGTAA	0.218													10	5	---	---	---	---	
PHLPP1	23239	broad.mit.edu	37	18	60646826	60646826	+	3'UTR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60646826delT	uc002lis.2	+	18						NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein						apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						CTTTGGGTTATTTTTTTAAGT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65042307	65042307	+	IGR	DEL	T	-	-	rs75002100		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65042307delT								CDH19 (771091 upstream) : DSEL (131512 downstream)																							gtcttcttcattttttttttt	0.184													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65346771	65346771	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65346771delA								DSEL (162804 upstream) : TMX3 (994156 downstream)																							cttctatcagaaaaaaaaaac	0.025													4	2	---	---	---	---	
EMR1	2015	broad.mit.edu	37	19	6939491	6939491	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6939491delT	uc002mfw.2	+						EMR1_uc010dvc.2_Intron|EMR1_uc010dvb.2_Intron|EMR1_uc010xji.1_Intron|EMR1_uc010xjj.1_Intron	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					GGTTCTATGCTTAGTGGTGTT	0.249													4	2	---	---	---	---	
ZNF414	84330	broad.mit.edu	37	19	8576428	8576428	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8576428delA	uc002mkf.2	-						ZNF414_uc002mke.3_Intron|ZNF414_uc010dwf.2_Intron	NM_032370	NP_115746	Q96IQ9	ZN414_HUMAN	zinc finger protein 414 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACCTGCGGTAAAGGGGCGGG	0.692													4	2	---	---	---	---	
COL5A3	50509	broad.mit.edu	37	19	10078220	10078221	+	Intron	DEL	CA	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10078220_10078221delCA	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			ctcacacactcacacacacaca	0.139													6	3	---	---	---	---	
ILF3	3609	broad.mit.edu	37	19	10795850	10795850	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10795850delG	uc002mpn.2	+						ILF3_uc002mpm.2_3'UTR|ILF3_uc002mpl.2_3'UTR|ILF3_uc002mpk.2_3'UTR|ILF3_uc010xli.1_3'UTR|ILF3_uc002mpo.2_Intron|ILF3_uc002mpp.2_3'UTR|ILF3_uc002mpq.2_5'Flank	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a						M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			CAGGCTTTAAGGGGTAGATGA	0.378													6	3	---	---	---	---	
AKAP8L	26993	broad.mit.edu	37	19	15521067	15521067	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15521067delA	uc002naw.1	-						AKAP8L_uc002nax.1_Intron|AKAP8L_uc010xoh.1_Intron|AKAP8L_uc002nay.1_Intron	NM_014371	NP_055186	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like							cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding			ovary(1)	1						TTTGGACTTTAATTGGCCACT	0.279													4	2	---	---	---	---	
USHBP1	83878	broad.mit.edu	37	19	17369974	17369974	+	Intron	DEL	A	-	-	rs80351288		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17369974delA	uc002nfs.1	-						USHBP1_uc002nfr.1_5'Flank|USHBP1_uc002nft.1_Intron|USHBP1_uc010xpk.1_Intron|USHBP1_uc010eam.1_Intron	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1								PDZ domain binding			ovary(1)	1						attctgtctcaaaaaaaaaaa	0.249													4	3	---	---	---	---	
GATAD2A	54815	broad.mit.edu	37	19	19603751	19603751	+	Intron	DEL	T	-	-	rs34444399		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19603751delT	uc010xqt.1	+						GATAD2A_uc010xqu.1_Intron|GATAD2A_uc010xqv.1_Intron|GATAD2A_uc010xqw.1_Intron	NM_017660	NP_060130	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A						DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TAAAGCTCACttttttttttt	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	33023598	33023598	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33023598delG								DPY19L3 (48362 upstream) : PDCD5 (48506 downstream)																							ctatctctctgtttctttctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36477037	36477037	+	IGR	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36477037delG								LRFN3 (40942 upstream) : SDHAF1 (9064 downstream)																							ACCCAACTTTGGGGCTGCCAG	0.562													4	2	---	---	---	---	
ZNF382	84911	broad.mit.edu	37	19	37118584	37118585	+	3'UTR	DEL	AC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37118584_37118585delAC	uc002oek.2	+	5					ZNF382_uc010efa.2_3'UTR|ZNF382_uc010efb.2_3'UTR|ZNF382_uc002oel.2_3'UTR	NM_032825	NP_116214	Q96SR6	ZN382_HUMAN	zinc finger protein 382						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AGCCTGTAAAacacacacacac	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55023716	55023717	+	IGR	DEL	CT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55023716_55023717delCT								LAIR2 (1821 upstream) : KIR3DX1 (20192 downstream)																							ATTCTCCCTGCTCTCTCTGTGT	0.441													5	4	---	---	---	---	
ZNF776	284309	broad.mit.edu	37	19	58215748	58215749	+	Intron	DEL	AC	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58215748_58215749delAC	uc002qpx.2	+						ZNF154_uc002qpy.2_Intron|ZNF154_uc010euf.2_Intron	NM_173632	NP_775903	Q68DI1	ZN776_HUMAN	zinc finger protein 776						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		CACAGGAAAAACACACACACAC	0.401													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	1786927	1786927	+	IGR	DEL	T	-	-	rs112121500		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1786927delT								SIRPG (148502 upstream) : SIRPA (87886 downstream)																							caaatagggattttttttttt	0.080													4	2	---	---	---	---	
HSPA12B	116835	broad.mit.edu	37	20	3732151	3732151	+	Intron	DEL	C	-	-	rs149679568	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3732151delC	uc002wjd.2	+						HSPA12B_uc010zqi.1_Intron|HSPA12B_uc002wje.2_Intron|HSPA12B_uc010zqj.1_Intron	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B								ATP binding				0						CCCGTCCTGTCCCGCAGAGGC	0.721													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29617220	29617220	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29617220delG	uc010ztk.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron					RecName: Full=Protein FRG1B;												0						ttttagtacaggggtattcaa	0.000													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29652066	29652067	+	Intron	INS	-	A	A	rs141428334		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29652066_29652067insA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						atgcaactgataaatattttgt	0.000													5	3	---	---	---	---	
NFS1	9054	broad.mit.edu	37	20	34269624	34269624	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34269624delA	uc002xdw.1	-						NFS1_uc002xdt.1_Intron|NFS1_uc002xdu.1_Intron|NFS1_uc002xdv.1_Intron|NFS1_uc010zvk.1_Intron|NFS1_uc010zvl.1_Intron	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor						cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	tgtctcaatgaaaaaaaaaaT	0.025													7	4	---	---	---	---	
C20orf132	140699	broad.mit.edu	37	20	35743362	35743362	+	Intron	DEL	T	-	-	rs35991541		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35743362delT	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)				TGTTCAGTTGTTTTTTTTTTT	0.239													4	3	---	---	---	---	
SRC	6714	broad.mit.edu	37	20	36023319	36023320	+	Intron	DEL	GT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36023319_36023320delGT	uc002xgx.2	+						SRC_uc002xgy.2_Intron	NM_005417	NP_005408	P12931	SRC_HUMAN	proto-oncogene tyrosine-protein kinase SRC						axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	acatctgggcgtgtgtgtgtgt	0.347													4	2	---	---	---	---	
WFDC3	140686	broad.mit.edu	37	20	44417845	44417845	+	Intron	DEL	A	-	-	rs11478994		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44417845delA	uc002xpf.1	-						DNTTIP1_uc002xpk.2_5'Flank|WFDC3_uc002xpj.1_Intron|WFDC3_uc002xph.1_Intron|WFDC3_uc010ghh.1_Intron	NM_080614	NP_542181	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				cctgtctcttaaaaaaaaaaa	0.124													4	2	---	---	---	---	
PLTP	5360	broad.mit.edu	37	20	44530859	44530859	+	Intron	DEL	G	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44530859delG	uc002xqn.1	-						PLTP_uc002xql.1_Intron|PLTP_uc002xqm.1_Intron|PLTP_uc002xqo.1_Intron|PLTP_uc002xqp.1_Intron|PLTP_uc002xqq.1_Intron|PLTP_uc010zxj.1_Intron|PLTP_uc010ghj.1_Intron	NM_006227	NP_006218	P55058	PLTP_HUMAN	phospholipid transfer protein isoform a						cellular lipid metabolic process|lipid transport	extracellular region	lipid binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				GTGGACAGGTGTGATTGTCCT	0.532													4	2	---	---	---	---	
EYA2	2139	broad.mit.edu	37	20	45684493	45684493	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45684493delT	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235	O00167	EYA2_HUMAN	eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)				GCAACTCACCTTTTTTTTCAC	0.423													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52155244	52155245	+	IGR	DEL	GT	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52155244_52155245delGT								TSHZ2 (51279 upstream) : ZNF217 (28367 downstream)																							ATGTGTGCTCGTGTGTGTGTGT	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10708898	10708899	+	IGR	DEL	AT	-	-	rs142655236		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10708898_10708899delAT								None (None upstream) : TPTE (197844 downstream)																							caaaaaccacatgattatctca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10710970	10710972	+	IGR	DEL	TAT	-	-	rs144798371	by1000genomes	TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10710970_10710972delTAT								None (None upstream) : TPTE (195771 downstream)																							ctacttttaatatgaagatattt	0.000													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10719506	10719506	+	IGR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10719506delA								None (None upstream) : TPTE (187237 downstream)																							cctagtttttatgtgaagata	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11097184	11097185	+	Intron	DEL	TG	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11097184_11097185delTG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGTGCATAACTGTTCTCAACCT	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37518894	37518894	+	Intron	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37518894delT	uc002yvc.1	-						uc002yvd.1_Intron|uc002yvf.1_Intron					Homo sapiens mRNA expressed in placenta, clone IMAGE:139776.																		atttctgttcttttttttttt	0.174													4	2	---	---	---	---	
COMT	1312	broad.mit.edu	37	22	19930330	19930331	+	Intron	INS	-	G	G			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19930330_19930331insG	uc002zqu.2	+						TXNRD2_uc011ahc.1_5'Flank|TXNRD2_uc002zql.1_5'Flank|TXNRD2_uc002zqm.1_5'Flank|TXNRD2_uc002zqn.1_5'Flank|TXNRD2_uc002zqo.1_5'Flank|TXNRD2_uc002zqp.1_5'Flank|TXNRD2_uc002zqr.1_5'Flank|TXNRD2_uc010grv.1_5'Flank|COMT_uc002zqt.2_Intron|COMT_uc002zqv.2_Intron|COMT_uc002zqw.2_Intron	NM_000754	NP_000745	P21964	COMT_HUMAN	catechol-O-methyltransferase isoform MB-COMT						neurotransmitter biosynthetic process|neurotransmitter catabolic process|xenobiotic metabolic process	cytosol|integral to membrane|intracellular membrane-bounded organelle|microsome|plasma membrane|soluble fraction	catechol O-methyltransferase activity|magnesium ion binding|protein binding			ovary(1)	1	Colorectal(54;0.0993)				Carbidopa(DB00190)|Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Folic Acid(DB00158)|L-Valine(DB00161)|Levodopa(DB01235)|Methyldopa(DB00968)|Modafinil(DB00745)|Morphine(DB00295)|S-Adenosylmethionine(DB00118)|Tolcapone(DB00323)	gggagtgggaaggggtggggac	0.000													4	2	---	---	---	---	
FAM9A	171482	broad.mit.edu	37	X	8760352	8760352	+	Intron	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8760352delA	uc004csg.2	-							NM_174951	NP_777611	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A							nucleolus					0		Hepatocellular(5;0.219)				TAGGAAGGGGAGGGTTTTAGG	0.308													4	2	---	---	---	---	
CLCN4	1183	broad.mit.edu	37	X	10202053	10202053	+	3'UTR	DEL	A	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10202053delA	uc004csy.3	+	13					CLCN4_uc011mid.1_3'UTR	NM_001830	NP_001821	P51793	CLCN4_HUMAN	chloride channel 4							early endosome membrane|integral to membrane|late endosome membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						GTCCTTATTTATTGGTTCTTG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	75555026	75555026	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75555026delT								CXorf26 (156993 upstream) : MAGEE1 (93091 downstream)																							ttgctttCCCTTTTTTTTTTC	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	8001709	8001709	+	IGR	DEL	T	-	-			TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:8001709delT								TTTY12 (322988 upstream) : TTTY18 (549702 downstream)																							ACTGAAAAGATTTTTTTTTAA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58993347	58993347	+	IGR	DEL	G	-	-	rs75995370		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58993347delG								None (None upstream) : None (None downstream)																							ctctgcctatgggggcattgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59020533	59020533	+	IGR	DEL	A	-	-	rs146025559		TCGA-CZ-5466-01A-01D-1501-10	TCGA-CZ-5466-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59020533delA								None (None upstream) : None (None downstream)																							ttgctgctataatcagttacc	0.020													4	6	---	---	---	---	
