Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CLCNKA	1187	broad.mit.edu	37	1	16360190	16360190	+	3'UTR	SNP	A	C	C	rs28418375	by1000genomes	TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16360190A>C	uc001axu.2	+	20					CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_3'UTR|CLCNKA_uc010obw.1_3'UTR|CLCNKB_uc001axw.3_Intron	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	ACCCCAGCTGACCTGGTACTG	0.552													3	27	---	---	---	---	PASS
ATG4C	84938	broad.mit.edu	37	1	63300488	63300488	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63300488T>G	uc001dat.2	+	9	1216	c.1054T>G	c.(1054-1056)TTT>GTT	p.F352V	ATG4C_uc001dau.2_Missense_Mutation_p.F352V	NM_178221	NP_835739	Q96DT6	ATG4C_HUMAN	APG4 autophagy 4 homolog C isoform 8	352					autophagic vacuole assembly|protein targeting to membrane|proteolysis	cytosol|extracellular region	cysteine-type endopeptidase activity			ovary(1)	1						CTGCCAATCTTTTGTAGATGT	0.328													20	66	---	---	---	---	PASS
CDC14A	8556	broad.mit.edu	37	1	100933604	100933604	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100933604T>A	uc001dtg.3	+	10	1419	c.931T>A	c.(931-933)TGC>AGC	p.C311S	CDC14A_uc009web.2_RNA|CDC14A_uc010oui.1_Missense_Mutation_p.C253S|CDC14A_uc001dte.3_Missense_Mutation_p.C311S|CDC14A_uc001dtf.2_Missense_Mutation_p.C311S|CDC14A_uc009wed.1_Missense_Mutation_p.C18S|CDC14A_uc009wee.2_Missense_Mutation_p.C311S	NM_003672	NP_003663	Q9UNH5	CC14A_HUMAN	CDC14 homolog A isoform 1	311	B.				cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			large_intestine(1)	1		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		GATTAGAATATGCCGGCCAGG	0.418													8	238	---	---	---	---	PASS
KIAA0907	22889	broad.mit.edu	37	1	155887399	155887399	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155887399T>G	uc001fmi.1	-	11	1355	c.1331A>C	c.(1330-1332)CAG>CCG	p.Q444P	KIAA0907_uc001fmj.1_Missense_Mutation_p.Q444P|KIAA0907_uc009wrk.1_Missense_Mutation_p.Q301P|KIAA0907_uc009wrl.1_RNA	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	hypothetical protein LOC22889	444	Pro-rich.										0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			gggctggggctggggGCCAGC	0.443													5	9	---	---	---	---	PASS
APOBEC4	403314	broad.mit.edu	37	1	183617219	183617219	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183617219G>A	uc001gqn.2	-	2	970	c.698C>T	c.(697-699)ACA>ATA	p.T233I	RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron	NM_203454	NP_982279	Q8WW27	ABEC4_HUMAN	apolipoprotein B	233					mRNA processing		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0						TTTTACGCCTGTTATGGCATT	0.433													6	163	---	---	---	---	PASS
B3GALNT2	148789	broad.mit.edu	37	1	235611771	235611771	+	3'UTR	SNP	A	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235611771A>T	uc001hxc.2	-	12					TBCE_uc001hwz.1_Intron|TBCE_uc001hxa.1_Intron|TBCE_uc010pxr.1_Intron|TBCE_uc001hxb.1_Intron	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			TTGCCCAGCAAAATACAAAGT	0.403													18	57	---	---	---	---	PASS
OR2G2	81470	broad.mit.edu	37	1	247752195	247752195	+	Silent	SNP	T	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247752195T>C	uc010pyy.1	+	1	534	c.534T>C	c.(532-534)GAT>GAC	p.D178D		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	178	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GCCAAGTGGATCATTTCATCT	0.542													24	116	---	---	---	---	PASS
FBLN7	129804	broad.mit.edu	37	2	112944841	112944841	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112944841G>A	uc002tho.1	+	8	1349	c.1078G>A	c.(1078-1080)GCC>ACC	p.A360T	FBLN7_uc002thn.2_Intron|FBLN7_uc010fki.1_Missense_Mutation_p.A314T|FBLN7_uc010fkj.1_Missense_Mutation_p.A226T	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN	fibulin 7 isoform 1	360					cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2						CATGGCCACAGCCTCTGCCCC	0.642													22	82	---	---	---	---	PASS
CD80	941	broad.mit.edu	37	3	119256037	119256037	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119256037C>A	uc003ecq.2	-	4	1042	c.647G>T	c.(646-648)TGT>TTT	p.C216F	CD80_uc010hqt.1_Missense_Mutation_p.C216F|CD80_uc010hqu.1_Intron	NM_005191	NP_005182	P33681	CD80_HUMAN	CD80 antigen precursor	216	Extracellular (Potential).|Ig-like C2-type.				interspecies interaction between organisms|intracellular signal transduction|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of signal transduction|positive regulation of T-helper 1 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation	intracellular	coreceptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2					Abatacept(DB01281)	CTTGATGAGACACATGAAGCT	0.388													7	243	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141163046	141163046	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141163046C>T	uc003etw.2	+	8	2798	c.1816C>T	c.(1816-1818)CAG>TAG	p.Q606*	ZBTB38_uc010hun.2_Nonsense_Mutation_p.Q603*|ZBTB38_uc010huo.2_Nonsense_Mutation_p.Q606*|ZBTB38_uc003ety.2_Nonsense_Mutation_p.Q606*|ZBTB38_uc010hup.2_Nonsense_Mutation_p.Q607*	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	606					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						CTATGTTGTTCAGAATCCACA	0.433													31	100	---	---	---	---	PASS
ACOX3	8310	broad.mit.edu	37	4	8416611	8416611	+	Silent	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8416611G>A	uc010idk.2	-	4	568	c.423C>T	c.(421-423)CTC>CTT	p.L141L	ACOX3_uc003glc.3_Silent_p.L141L|ACOX3_uc003gld.3_Silent_p.L141L|ACOX3_uc003gle.1_Silent_p.L46L	NM_003501	NP_003492	O15254	ACOX3_HUMAN	acyl-Coenzyme A oxidase 3 isoform a	141					bile acid metabolic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|pristanoyl-CoA oxidase activity			central_nervous_system(1)	1						GAATATATGTGAGATGTCTTT	0.403													26	88	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160260314	160260314	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160260314G>A	uc003iqg.3	+	13	2169	c.1859G>A	c.(1858-1860)CGC>CAC	p.R620H		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	620	Ras-associating.				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CAGCAAAGCCGCTACATCATG	0.423													70	143	---	---	---	---	PASS
AGXT2	64902	broad.mit.edu	37	5	35026017	35026017	+	Intron	SNP	T	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35026017T>C	uc003jjf.2	-						AGXT2_uc003jje.1_Translation_Start_Site|AGXT2_uc011com.1_Intron	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	alanine-glyoxylate aminotransferase 2 precursor						glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)	TTTCAAAGTATATAAAAAAGT	0.378													3	17	---	---	---	---	PASS
RICTOR	253260	broad.mit.edu	37	5	38950756	38950756	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38950756T>C	uc003jlp.2	-	31	3218	c.3194A>G	c.(3193-3195)AAT>AGT	p.N1065S	RICTOR_uc003jlo.2_Missense_Mutation_p.N1065S|RICTOR_uc010ivf.2_Missense_Mutation_p.N780S	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	1065					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					TGTATCTTCATTGATATCAAG	0.358													28	101	---	---	---	---	PASS
PCDHB1	29930	broad.mit.edu	37	5	140431290	140431290	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140431290C>A	uc003lik.1	+	1	312	c.235C>A	c.(235-237)CGC>AGC	p.R79S		NM_013340	NP_037472	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1 precursor	79	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGGCTCCACCGCAAGACGGG	0.567													20	69	---	---	---	---	PASS
PRSS16	10279	broad.mit.edu	37	6	27222582	27222582	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27222582G>A	uc003nja.2	+	10	1273	c.1261G>A	c.(1261-1263)GCT>ACT	p.A421T	PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_Missense_Mutation_p.A164T|PRSS16_uc003njd.2_Intron	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	421					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity	p.A421T(1)		ovary(2)|central_nervous_system(2)|skin(1)	5						AGTAGCCCAGGCTGTGGCTCA	0.547													39	121	---	---	---	---	PASS
PFDN6	10471	broad.mit.edu	37	6	33257668	33257668	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33257668A>G	uc003odt.1	+	2	150	c.35A>G	c.(34-36)GAA>GGA	p.E12G	WDR46_uc003ods.2_5'Flank|WDR46_uc011dra.1_5'Flank|WDR46_uc010juo.1_5'Flank|PFDN6_uc010jup.1_Missense_Mutation_p.E12G	NM_014260	NP_055075	O15212	PFD6_HUMAN	HLA class II region expressed gene KE2	12					'de novo' posttranslational protein folding|chaperone-mediated protein complex assembly	prefoldin complex	chaperone binding|unfolded protein binding				0						CTACAGGGAGAAGTGGAGAAA	0.532													11	54	---	---	---	---	PASS
SYNCRIP	10492	broad.mit.edu	37	6	86324793	86324793	+	Missense_Mutation	SNP	C	G	G	rs146447694		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86324793C>G	uc003pla.2	-	11	2094	c.1553G>C	c.(1552-1554)CGC>CCC	p.R518P	SYNCRIP_uc003pku.2_Missense_Mutation_p.R518P|SYNCRIP_uc003pkw.2_Missense_Mutation_p.R483P|SYNCRIP_uc003pky.2_Missense_Mutation_p.R420P|SYNCRIP_uc003pkv.2_Missense_Mutation_p.R518P|SYNCRIP_uc003pkx.2_Missense_Mutation_p.R366P|SYNCRIP_uc003pkz.2_Missense_Mutation_p.R483P	NM_006372	NP_006363	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA	518	Interaction with SMN.|Interaction with APOBEC1.|8 X 3 AA repeats of R-G-G.				CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		GGCTCTACCGCGGGGAGGAGC	0.577													4	125	---	---	---	---	PASS
RFPL4B	442247	broad.mit.edu	37	6	112671198	112671198	+	Silent	SNP	T	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112671198T>C	uc003pvx.1	+	3	600	c.288T>C	c.(286-288)GAT>GAC	p.D96D		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	96	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		TTCGGGAGGATGTGACCCTGG	0.517													9	27	---	---	---	---	PASS
MYB	4602	broad.mit.edu	37	6	135539120	135539120	+	3'UTR	SNP	A	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135539120A>G	uc003qfc.2	+	15					MYB_uc003qfh.2_3'UTR|MYB_uc003qfi.2_3'UTR|MYB_uc010kgi.2_3'UTR|MYB_uc003qfq.2_3'UTR|MYB_uc010kgj.2_3'UTR|MYB_uc003qfo.2_3'UTR|MYB_uc003qfu.2_3'UTR|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_RNA|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_3'UTR|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_3'UTR|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog						blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		GTCATGTGAGACATTTCCAGA	0.428			T	NFIB	adenoid cystic carcinoma								17	70	---	---	---	---	PASS
C6orf118	168090	broad.mit.edu	37	6	165715646	165715646	+	Silent	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165715646G>A	uc003qum.3	-	2	201	c.165C>T	c.(163-165)GAC>GAT	p.D55D	C6orf118_uc011egi.1_RNA	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN	hypothetical protein LOC168090	55											0		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		AGAGGTAGACGTCCTCCCGGT	0.557													5	125	---	---	---	---	PASS
FAM120B	84498	broad.mit.edu	37	6	170627903	170627903	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170627903G>A	uc003qxp.2	+	2	1533	c.1425G>A	c.(1423-1425)ATG>ATA	p.M475I	FAM120B_uc003qxo.1_Missense_Mutation_p.M475I|FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	475					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		AAGTTCCCATGTATACAGGCC	0.468													8	205	---	---	---	---	PASS
NCAPG2	54892	broad.mit.edu	37	7	158483355	158483355	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158483355A>T	uc003wnv.1	-	5	587	c.442T>A	c.(442-444)TGT>AGT	p.C148S	NCAPG2_uc010lqu.1_5'Flank|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Missense_Mutation_p.C148S|NCAPG2_uc011kwe.1_Missense_Mutation_p.C148S	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	148					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CAGGTAACACACAAATCCTGA	0.408													7	108	---	---	---	---	PASS
TRIM55	84675	broad.mit.edu	37	8	67064733	67064733	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67064733A>C	uc003xvv.2	+	8	1333	c.1107A>C	c.(1105-1107)GAA>GAC	p.E369D	TRIM55_uc003xvu.2_Missense_Mutation_p.E369D|TRIM55_uc003xvw.2_Missense_Mutation_p.E369D|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1	369						cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TTCCAGGAGAAGATGAAAACC	0.343													16	55	---	---	---	---	PASS
ZBTB10	65986	broad.mit.edu	37	8	81411971	81411971	+	Silent	SNP	T	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81411971T>C	uc003ybx.3	+	2	1813	c.1215T>C	c.(1213-1215)AAT>AAC	p.N405N	ZBTB10_uc003ybv.3_Silent_p.N113N|ZBTB10_uc003ybw.3_Silent_p.N405N|ZBTB10_uc010lzt.2_Silent_p.N405N	NM_001105539	NP_001099009	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10 isoform	405	BTB.				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			lung(1)	1	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			ACCAAAACAATACTACCCACT	0.388													31	86	---	---	---	---	PASS
C8orf47	203111	broad.mit.edu	37	8	99101460	99101460	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99101460C>G	uc003yih.1	+	2	363	c.215C>G	c.(214-216)ACA>AGA	p.T72R		NM_173549	NP_775820	Q6P6B1	CH047_HUMAN	hypothetical protein LOC203111	72											0	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			GCAGAGCCTACAGCTAATGGT	0.517													4	87	---	---	---	---	PASS
TSNARE1	203062	broad.mit.edu	37	8	143310906	143310906	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143310906G>A	uc003ywk.2	-	13	1599	c.1481C>T	c.(1480-1482)TCA>TTA	p.S494L	TSNARE1_uc011lju.1_Missense_Mutation_p.S493L|TSNARE1_uc003ywj.2_Missense_Mutation_p.S495L	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	494	Helical; (Potential).				vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GACTCCAGCTGATAGGAAGCA	0.527													13	44	---	---	---	---	PASS
PBX3	5090	broad.mit.edu	37	9	128724472	128724472	+	Silent	SNP	C	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128724472C>T	uc004bqb.2	+	7	1217	c.1101C>T	c.(1099-1101)GTC>GTT	p.V367V	PBX3_uc004bqc.2_Silent_p.V186V|PBX3_uc004bqd.2_Intron|PBX3_uc011lzw.1_Silent_p.V292V|PBX3_uc011lzx.1_Intron|PBX3_uc004bqe.2_Silent_p.V275V	NM_006195	NP_006186	P40426	PBX3_HUMAN	pre-B-cell leukemia homeobox 3 isoform 1	367					anterior compartment pattern formation|posterior compartment specification		sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						GGTCCCAAGTCGGAGCCAATG	0.507													14	33	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136674238	136674238	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136674238T>A	uc004ces.2	-	7	636	c.590A>T	c.(589-591)GAC>GTC	p.D197V	VAV2_uc004cer.2_Missense_Mutation_p.D192V	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	197					angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GTTCCTCTTGTCATCTTCAGT	0.617													13	41	---	---	---	---	PASS
THNSL1	79896	broad.mit.edu	37	10	25312229	25312229	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25312229A>G	uc001isi.3	+	3	406	c.77A>G	c.(76-78)GAT>GGT	p.D26G	ENKUR_uc001ish.1_Intron	NM_024838	NP_079114	Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1	26					threonine biosynthetic process		ATP binding|pyridoxal phosphate binding|shikimate kinase activity|threonine synthase activity			pancreas(1)	1					L-Threonine(DB00156)|Pyridoxal Phosphate(DB00114)	GTTAAAACGGATAAACATGCA	0.368													26	68	---	---	---	---	PASS
CYP2C8	1558	broad.mit.edu	37	10	96805619	96805619	+	Silent	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96805619G>A	uc001kkb.2	-	6	1004	c.909C>T	c.(907-909)AGC>AGT	p.S303S	CYP2C8_uc001kkc.2_RNA|CYP2C8_uc010qoa.1_Silent_p.S233S|CYP2C8_uc010qob.1_Silent_p.S217S|CYP2C8_uc010qoc.1_Silent_p.S201S|CYP2C8_uc010qod.1_Silent_p.S217S	NM_000770	NP_000761	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C,	303					exogenous drug catabolic process|organic acid metabolic process|oxidative demethylation|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|electron carrier activity|heme binding|oxygen binding				0		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Aminophenazone(DB01424)|Amiodarone(DB01118)|Amodiaquine(DB00613)|Benzphetamine(DB00865)|Carbamazepine(DB00564)|Cerivastatin(DB00439)|Diclofenac(DB00586)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lovastatin(DB00227)|Midazolam(DB00683)|Montelukast(DB00471)|Nicardipine(DB00622)|Paclitaxel(DB01229)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rifampin(DB01045)|Rosiglitazone(DB00412)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Tolbutamide(DB01124)|Torasemide(DB00214)|Tretinoin(DB00755)|Trimethoprim(DB00440)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zopiclone(DB01198)	TCAGAGTGGTGCTTGTTGTCT	0.433													22	93	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104129688	104129688	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104129688G>T	uc001kux.1	+	26	3523	c.3283G>T	c.(3283-3285)GGC>TGC	p.G1095C	GBF1_uc001kuy.1_Missense_Mutation_p.G1095C|GBF1_uc001kuz.1_Missense_Mutation_p.G1096C	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1095					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TAGTGTTCGGGGCCCATCCAC	0.517													18	49	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1025856	1025856	+	Silent	SNP	G	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1025856G>T	uc001lsw.2	-	22	2799	c.2748C>A	c.(2746-2748)ATC>ATA	p.I916I		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	916	VWFD 3.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTTCCCACAGATGACGTTCT	0.647													3	19	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22015946	22015946	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22015946C>A	uc001rfi.1	-	18	2300	c.2280G>T	c.(2278-2280)TGG>TGT	p.W760C	ABCC9_uc001rfh.2_Missense_Mutation_p.W760C|ABCC9_uc001rfj.1_Missense_Mutation_p.W724C	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	760	Cytoplasmic (Potential).|ABC transporter 1.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CATTTAATAGCCAAGGCTTTT	0.338													12	64	---	---	---	---	PASS
KRT78	196374	broad.mit.edu	37	12	53242514	53242514	+	Silent	SNP	C	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53242514C>T	uc001sbc.1	-	1	265	c.201G>A	c.(199-201)GGG>GGA	p.G67G		NM_173352	NP_775487	Q8N1N4	K2C78_HUMAN	keratin 5b	67	Head.|Gly-rich.					keratin filament	protein binding|structural molecule activity			ovary(2)	2						CACTCCACTCCCCAAACCGCA	0.627													11	19	---	---	---	---	PASS
SPRYD4	283377	broad.mit.edu	37	12	56863103	56863103	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56863103G>A	uc001sli.3	+	2	441	c.366G>A	c.(364-366)TGG>TGA	p.W122*	SPRYD4_uc010sqo.1_Nonsense_Mutation_p.W110*	NM_207344	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	122	B30.2/SPRY.					nucleus					0						ATCGTTCCTGGGTGTTCACCT	0.567													45	189	---	---	---	---	PASS
MAP3K9	4293	broad.mit.edu	37	14	71267589	71267589	+	Silent	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71267589G>A	uc001xmm.2	-	2	615	c.615C>T	c.(613-615)GCC>GCT	p.A205A	MAP3K9_uc001xml.2_Silent_p.A205A	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase	205	Protein kinase.				activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CCCCTCTTAGGGCAATGATGT	0.532													32	66	---	---	---	---	PASS
C15orf21	283651	broad.mit.edu	37	15	45848224	45848224	+	RNA	SNP	G	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45848224G>T	uc010beg.1	+	6		c.1219G>T			C15orf21_uc010beh.1_RNA|C15orf21_uc010bei.1_RNA|C15orf21_uc010bej.1_RNA|C15orf21_uc001zvm.1_RNA|C15orf21_uc001zvn.1_RNA					Homo sapiens cDNA FLJ39426 fis, clone PROST2000505.												0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;3.03e-17)|GBM - Glioblastoma multiforme(94;7.36e-07)		TGCAGATTTTGTTTAGCTTTT	0.318			T	ETV1	prostate								8	19	---	---	---	---	PASS
CELF6	60677	broad.mit.edu	37	15	72597100	72597100	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72597100A>C	uc002auh.2	-	3	691	c.381T>G	c.(379-381)AGT>AGG	p.S127R	uc002aug.2_Intron|CELF6_uc002auk.3_RNA|CELF6_uc010biv.1_RNA|CELF6_uc010biw.2_5'UTR|CELF6_uc010ukl.1_Missense_Mutation_p.S12R|CELF6_uc010ukm.1_Missense_Mutation_p.S127R|CELF6_uc002aui.2_Intron|CELF6_uc002auj.2_5'UTR	NM_052840	NP_443072	Q96J87	CELF6_HUMAN	bruno-like 6, RNA binding protein	127	RRM 1.				mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3						CTCGGCCCTCACTGGCAGCTG	0.577													5	38	---	---	---	---	PASS
UNC45A	55898	broad.mit.edu	37	15	91478784	91478784	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91478784T>A	uc002bqg.2	+	2	402	c.62T>A	c.(61-63)GTG>GAG	p.V21E	UNC45A_uc002bqd.2_Missense_Mutation_p.V6E|UNC45A_uc010uqo.1_Missense_Mutation_p.V6E|UNC45A_uc010uqp.1_RNA|UNC45A_uc010uqq.1_Missense_Mutation_p.V21E	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform	21	TPR 1.				cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCCAGCTCAGTGGAGCAGCTG	0.672													19	76	---	---	---	---	PASS
MYLK3	91807	broad.mit.edu	37	16	46781877	46781877	+	Missense_Mutation	SNP	C	T	T	rs143624767		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46781877C>T	uc002eei.3	-	1	345	c.229G>A	c.(229-231)GGG>AGG	p.G77R	MYLK3_uc010vge.1_Intron	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	77					cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CCATCAGCCCCGCCCGGGCCC	0.687													8	24	---	---	---	---	PASS
ZNF23	7571	broad.mit.edu	37	16	71487199	71487199	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71487199A>T	uc002faf.2	-	5	903	c.89T>A	c.(88-90)CTG>CAG	p.L30Q	ZNF23_uc002fad.2_5'UTR|ZNF23_uc002fae.2_5'UTR|ZNF23_uc010vmf.1_Intron|ZNF23_uc002fag.2_5'UTR|ZNF23_uc002fah.2_Missense_Mutation_p.L30Q|ZNF23_uc002fai.2_Missense_Mutation_p.L68Q	NM_145911	NP_666016	P17027	ZNF23_HUMAN	zinc finger protein 23	30	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		TGAGCCCCCCAGCTCACTTCC	0.507													4	17	---	---	---	---	PASS
TRPV1	7442	broad.mit.edu	37	17	3486632	3486632	+	Silent	SNP	C	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3486632C>T	uc010vrr.1	-	8	2003	c.1476G>A	c.(1474-1476)GGG>GGA	p.G492G	TRPV1_uc010vro.1_Silent_p.G503G|TRPV1_uc010vrp.1_Silent_p.G432G|TRPV1_uc010vrq.1_Silent_p.G490G|TRPV1_uc010vrs.1_Silent_p.G492G|TRPV1_uc010vrt.1_Silent_p.G492G|TRPV1_uc010vru.1_Silent_p.G492G	NM_080706	NP_542437	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel,	492	Helical; (Potential).				cell surface receptor linked signaling pathway|chemosensory behavior|thermoception	cell junction|dendritic spine membrane|integral to plasma membrane|postsynaptic membrane	ATP binding|calcium channel activity|calmodulin binding			ovary(1)	1				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	GAACGCTTACCCCTCGGAAAA	0.433													4	16	---	---	---	---	PASS
C17orf65	339201	broad.mit.edu	37	17	42255127	42255127	+	5'UTR	SNP	C	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42255127C>G	uc002ifn.2	-	4					ASB16_uc002ifl.1_Intron|ASB16_uc002ifm.1_Intron	NM_178542	NP_848637	Q495Z4	CQ065_HUMAN	hypothetical protein LOC339201												0		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GGAGGAGGGACGAGCCACAGG	0.622													10	23	---	---	---	---	PASS
XYLT2	64132	broad.mit.edu	37	17	48432223	48432223	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48432223C>A	uc002iqo.2	+	4	922	c.813C>A	c.(811-813)GAC>GAA	p.D271E	XYLT2_uc010dbo.2_RNA	NM_022167	NP_071450	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	271	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			pancreas(1)	1	Breast(11;7.18e-19)					AGCGTTCCGACTACCTGCACC	0.627													13	55	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67023934	67023934	+	Silent	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67023934G>A	uc002jhu.2	-	13	1781	c.1638C>T	c.(1636-1638)CAC>CAT	p.H546H	ABCA9_uc010dez.2_Silent_p.H546H	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	546	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					TTGAAAGTGTGTGATTATAGA	0.373													20	89	---	---	---	---	PASS
SRP68	6730	broad.mit.edu	37	17	74041394	74041394	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74041394G>T	uc002jqk.1	-	12	1408	c.1373C>A	c.(1372-1374)ACT>AAT	p.T458N	SRP68_uc010wsu.1_Missense_Mutation_p.T357N|SRP68_uc002jql.1_Missense_Mutation_p.T420N|SRP68_uc002jqj.1_Missense_Mutation_p.T119N	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	458					response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						GAACACCAGAGTCTTGAGGCC	0.488													11	92	---	---	---	---	PASS
CEP76	79959	broad.mit.edu	37	18	12674675	12674675	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12674675C>G	uc002kri.2	-	11	1857	c.1701G>C	c.(1699-1701)GAG>GAC	p.E567D	PSMG2_uc002krg.2_Intron|CEP76_uc002krh.3_Missense_Mutation_p.E389D|CEP76_uc010wzz.1_Missense_Mutation_p.E492D	NM_024899	NP_079175	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	567					G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0						TTGTTGTACGCTCAAATTCAT	0.413													5	74	---	---	---	---	PASS
CCBE1	147372	broad.mit.edu	37	18	57103282	57103282	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57103282C>T	uc002lib.2	-	11	1149	c.1079G>A	c.(1078-1080)CGG>CAG	p.R360Q	CCBE1_uc010dpq.2_Missense_Mutation_p.R89Q|CCBE1_uc002lia.2_Missense_Mutation_p.R213Q	NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	360					lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				AGAGTGAGTCCGGTGCCCGAA	0.532													41	165	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10073521	10073521	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10073521A>T	uc002mmq.1	-	65	4911	c.4825T>A	c.(4825-4827)TAT>AAT	p.Y1609N		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1609	Fibrillar collagen NC1.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			AATGTGCTATACCAGCCTCCA	0.552													3	16	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40433371	40433371	+	Silent	SNP	G	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40433371G>T	uc002omp.3	-	2	906	c.898C>A	c.(898-900)CGG>AGG	p.R300R		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	300	IgGFc-binding.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CAGGATGGCCGGACCTCAAAC	0.562													3	54	---	---	---	---	PASS
EIF6	3692	broad.mit.edu	37	20	33872048	33872048	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33872048G>C	uc002xbv.1	-	2	340	c.124C>G	c.(124-126)CTC>GTC	p.L42V	EIF6_uc002xbx.1_Missense_Mutation_p.L42V|EIF6_uc002xbz.1_Missense_Mutation_p.S81R|EIF6_uc002xby.1_RNA	NM_181468	NP_852133	P56537	IF6_HUMAN	eukaryotic translation initiation factor 6	42					mature ribosome assembly	cytoplasm|nucleolus	protein binding|ribosome binding|translation initiation factor activity			pancreas(1)	1			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GTATCGGAGAGCTCGCCCTCG	0.677													19	92	---	---	---	---	PASS
NCOA3	8202	broad.mit.edu	37	20	46252829	46252829	+	Splice_Site	SNP	T	C	C			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46252829T>C	uc002xtk.2	+	4	461	c.256_splice	c.e4+2	p.G86_splice	NCOA3_uc010ght.1_Splice_Site_p.G86_splice|NCOA3_uc002xtl.2_Splice_Site_p.G86_splice|NCOA3_uc002xtm.2_Splice_Site_p.G86_splice|NCOA3_uc002xtn.2_Splice_Site_p.G86_splice|NCOA3_uc010zyc.1_5'Flank	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						AAGAGCAAGGTAATAAAAACA	0.214													11	42	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22661478	22661478	+	RNA	SNP	T	G	G			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22661478T>G	uc011aim.1	+	28		c.1702T>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						CAGATGCGTCTGAAGAAACAT	0.488													4	66	---	---	---	---	PASS
BMP15	9210	broad.mit.edu	37	X	50658996	50658996	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50658996G>T	uc011mnw.1	+	2	568	c.568G>T	c.(568-570)GTT>TTT	p.V190F		NM_005448	NP_005439	O95972	BMP15_HUMAN	bone morphogenetic protein 15 precursor	190					female gamete generation|granulosa cell development|ovarian follicle development	extracellular space	cytokine activity|growth factor activity			ovary(2)	2	Ovarian(276;0.236)					CACACAACTTGTTCAGCAAAG	0.463													3	49	---	---	---	---	PASS
HTR2C	3358	broad.mit.edu	37	X	114082636	114082636	+	Silent	SNP	G	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114082636G>A	uc004epu.1	+	5	1148	c.420G>A	c.(418-420)GCG>GCA	p.A140A	HTR2C_uc010nqc.1_Silent_p.A140A|HTR2C_uc004epv.1_Silent_p.A140A	NM_000868	NP_000859	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C	140	Helical; Name=3; (By similarity).				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity			ovary(3)	3					Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)	TTTCAACAGCGTCCATCATGC	0.433													4	105	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22161615	22161618	+	Intron	DEL	ACTC	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22161615_22161618delACTC	uc001bfj.2	-						HSPG2_uc009vqd.2_Intron	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	ttatgcatttactcactcacGTGT	0.093													4	2	---	---	---	---	
SEPN1	57190	broad.mit.edu	37	1	26139056	26139063	+	Intron	DEL	ACACACAC	-	-	rs66781270		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26139056_26139063delACACACAC	uc010oer.1	+						SEPN1_uc010oes.1_Intron	NM_020451	NP_065184	Q9NZV5	SELN_HUMAN	selenoprotein N, 1 isoform 1 precursor							endoplasmic reticulum membrane|extracellular region	protein binding			ovary(2)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		ctacacacaaacacacacacacacacac	0.183													3	4	---	---	---	---	
COL16A1	1307	broad.mit.edu	37	1	32124585	32124585	+	Intron	DEL	T	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32124585delT	uc001btk.1	-						COL16A1_uc001bti.1_Intron|COL16A1_uc001btj.1_Intron	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor						cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GATGAGTCAGTGGGATAGAAA	0.547													4	2	---	---	---	---	
PIGK	10026	broad.mit.edu	37	1	77595400	77595403	+	Intron	DEL	AAAT	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77595400_77595403delAAAT	uc001dhk.2	-						PIGK_uc010orj.1_Intron|PIGK_uc009wbx.2_Intron	NM_005482	NP_005473	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|protein thiol-disulfide exchange|proteolysis	GPI-anchor transamidase complex	cysteine-type endopeptidase activity|GPI-anchor transamidase activity|protein binding			ovary(2)|pancreas(1)	3						taaaaaataaaaataaataaataa	0.127													7	4	---	---	---	---	
CELSR2	1952	broad.mit.edu	37	1	109816863	109816864	+	3'UTR	INS	-	C	C	rs145508961	by1000genomes	TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109816863_109816864insC	uc001dxa.3	+	34						NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2						dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TAGTGCCAACTCCCCCCCCACC	0.550													4	3	---	---	---	---	
FCRL1	115350	broad.mit.edu	37	1	157774037	157774037	+	Intron	DEL	C	-	-	rs71658497		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774037delC	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CATGTCTCCACCCCCCCCCCA	0.527													5	4	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185992420	185992421	+	Intron	INS	-	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185992420_185992421insT	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAAACCTAGGGTTTTTTTTTTT	0.267													6	3	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61552412	61552412	+	Intron	DEL	A	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61552412delA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			aaattaaactaaaaaaaaaaa	0.114													6	3	---	---	---	---	
MFSD1	64747	broad.mit.edu	37	3	158542255	158542255	+	Intron	DEL	A	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158542255delA	uc003fcl.1	+						MFSD1_uc003fcm.1_Intron|MFSD1_uc003fcn.1_Intron|MFSD1_uc011bow.1_Intron|MFSD1_uc011box.1_Intron	NM_022736	NP_073573	Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane					0			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			tttacagtttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187141216	187141216	+	IGR	DEL	A	-	-	rs80024997		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187141216delA								RTP4 (51849 upstream) : SST (245480 downstream)																							cctgaaaaggaaaaaaaaagg	0.000													4	2	---	---	---	---	
LETM1	3954	broad.mit.edu	37	4	1834800	1834801	+	Intron	INS	-	T	T	rs111298028		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1834800_1834801insT	uc003gdv.2	-							NM_012318	NP_036450	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane						cristae formation	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			central_nervous_system(1)	1			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			ACTACttcttcttttttttttt	0.302													9	4	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83741997	83741998	+	Intron	DEL	AC	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83741997_83741998delAC	uc003hnf.2	-						SEC31A_uc003hnd.2_Intron|SEC31A_uc003hne.2_Intron|SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				acccacacaaacacacacacac	0.371													8	4	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19747498	19747499	+	Intron	INS	-	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747498_19747499insT	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTTTTCTGCAGTTTTTTTTTTT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153940150	153940150	+	IGR	DEL	T	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153940150delT								HAND1 (82326 upstream) : MIR1303 (125186 downstream)																							ttggtttttgttttttttttt	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32441391	32441392	+	IGR	INS	-	T	T	rs28986194		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32441391_32441392insT								HLA-DRA (28570 upstream) : HLA-DRB1 (43771 downstream)																							AAATTATGGGGAGGAGGTTACT	0.505													5	3	---	---	---	---	
SFRS3	6428	broad.mit.edu	37	6	36568787	36568788	+	Intron	INS	-	TC	TC			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36568787_36568788insTC	uc003omj.2	+						SFRS3_uc003omk.2_Intron	NM_003017	NP_003008	P84103	SRSF3_HUMAN	splicing factor, arginine/serine-rich 3						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						tctttttttttttttttttttt	0.342			T	BCL6	follicular lymphoma								5	6	---	---	---	---	
C6orf118	168090	broad.mit.edu	37	6	165703634	165703634	+	Intron	DEL	A	-	-	rs5881641		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165703634delA	uc003qum.3	-						C6orf118_uc011egi.1_Intron	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN	hypothetical protein LOC168090												0		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		TATTATTAACAATATTATGTA	0.239													3	3	---	---	---	---	
OCM	654231	broad.mit.edu	37	7	5920406	5920406	+	5'Flank	DEL	T	-	-	rs10235465		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5920406delT	uc003spe.3	+							NM_001097622	NP_001091091	P0CE72	ONCO_HUMAN	oncomodulin								calcium ion binding				0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0978)|OV - Ovarian serous cystadenocarcinoma(56;2.11e-14)		aaaaaaaaaaTAATCTAGACA	0.229													10	6	---	---	---	---	
GLI3	2737	broad.mit.edu	37	7	42263043	42263043	+	Intron	DEL	A	-	-	rs35625471		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42263043delA	uc011kbh.1	-							NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3						negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GTTTTCTGGCAAAAAAAAAAG	0.373									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				4	3	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111474750	111474750	+	Intron	DEL	A	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111474750delA	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCCCTAAGTTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
WDR91	29062	broad.mit.edu	37	7	134880706	134880706	+	Intron	DEL	A	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134880706delA	uc003vsp.2	-						WDR91_uc010lmq.2_Intron|WDR91_uc010lmr.2_Intron	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91											breast(2)|ovary(1)|skin(1)	4						ctcaataaggaaaaaaaaaaa	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41284152	41284153	+	IGR	DEL	GT	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41284152_41284153delGT								SFRP1 (117172 upstream) : GOLGA7 (63928 downstream)																							acatatatacgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
UBTD1	80019	broad.mit.edu	37	10	99329675	99329676	+	Intron	INS	-	A	A	rs79148719		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99329675_99329676insA	uc001knv.1	+						ANKRD2_uc001knw.2_5'Flank|ANKRD2_uc009xvu.2_5'Flank	NM_024954	NP_079230	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1												0		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		tgtctcaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112355980	112355981	+	Intron	INS	-	A	A	rs66980765		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112355980_112355981insA	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		gaccctgtctcaaaaaaaaaaa	0.119													4	2	---	---	---	---	
PPFIBP2	8495	broad.mit.edu	37	11	7661256	7661257	+	Intron	DEL	CC	-	-	rs66917736		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7661256_7661257delCC	uc001mfj.3	+						PPFIBP2_uc010rbb.1_Intron|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Intron|PPFIBP2_uc010rbd.1_Intron|PPFIBP2_uc010rbe.1_Intron|PPFIBP2_uc001mfl.3_Intron|PPFIBP2_uc009yfj.1_Intron	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2						cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGTCCCACCTCCCCAGAGGCTC	0.535													5	3	---	---	---	---	
NRIP3	56675	broad.mit.edu	37	11	9005798	9005799	+	Intron	INS	-	T	T			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9005798_9005799insT	uc001mhg.2	-						NRIP3_uc010rbu.1_Intron	NM_020645	NP_065696	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3						proteolysis		aspartic-type endopeptidase activity				0				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		AGCATGTGttatttttttttta	0.178													11	6	---	---	---	---	
ELP4	26610	broad.mit.edu	37	11	31648802	31648802	+	Intron	DEL	G	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31648802delG	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					CAAATTCTCTGGGGGGGGGGG	0.373													6	3	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31562355	31562356	+	Intron	INS	-	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31562355_31562356insA	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						ACAGTAGTATCAAAGAAAAAAA	0.267													6	3	---	---	---	---	
PEBP1	5037	broad.mit.edu	37	12	118577117	118577118	+	Intron	DEL	AA	-	-	rs35893505		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118577117_118577118delAA	uc001twu.1	+						PEBP1_uc010szc.1_Intron	NM_002567	NP_002558	P30086	PEBP1_HUMAN	prostatic binding protein								ATP binding|phosphatidylethanolamine binding|serine-type endopeptidase inhibitor activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					actctgtctcaaaaaaaaaaaa	0.213								Direct_reversal_of_damage					3	4	---	---	---	---	
GOLGA3	2802	broad.mit.edu	37	12	133374765	133374766	+	Intron	INS	-	G	G	rs5801992		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133374765_133374766insG	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGATGAGGGGTGGGGGGGGGGT	0.569													8	4	---	---	---	---	
HHIPL1	84439	broad.mit.edu	37	14	100123118	100123118	+	Intron	DEL	G	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100123118delG	uc010avs.2	+						HHIPL1_uc001ygl.1_Intron	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a						carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				tctgcaaaaagaaaagaaaag	0.000													4	3	---	---	---	---	
C1QTNF8	390664	broad.mit.edu	37	16	1143457	1143458	+	Intron	DEL	CG	-	-	rs71682367		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1143457_1143458delCG	uc010uuw.1	-							NM_207419	NP_997302	P60827	C1QT8_HUMAN	C1q and tumor necrosis factor related protein 8							collagen				skin(1)	1		Hepatocellular(780;0.00369)				cacacacacacGCGCGCGCGCG	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33942128	33942129	+	IGR	INS	-	T	T	rs76660512	by1000genomes	TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33942128_33942129insT								None (None upstream) : MIR1826 (23379 downstream)																							TGGAAAAAATACCACTTGTTAC	0.267													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83378805	83378805	+	Intron	DEL	A	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83378805delA	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CAAGCTACGGAAATCTCTTTC	0.468													7	4	---	---	---	---	
PIGS	94005	broad.mit.edu	37	17	26897744	26897747	+	Intron	DEL	TTCA	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26897744_26897747delTTCA	uc002hbo.2	-						PIGS_uc002hbn.2_Intron|PIGS_uc010wap.1_Intron	NM_033198	NP_149975	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			breast(2)|urinary_tract(1)|kidney(1)	4	Lung NSC(42;0.00431)					AAACACACTGTTCATTCAGAGGTC	0.436													7	4	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67211051	67211051	+	Intron	DEL	T	-	-	rs77351592		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67211051delT	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfb.1_5'Flank|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					aataaaacaattttttttaaa	0.209													11	5	---	---	---	---	
ZNF519	162655	broad.mit.edu	37	18	14124176	14124177	+	Intron	INS	-	A	A			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14124176_14124177insA	uc002kst.1	-						ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ctgtctcaattaaaaaaaaaaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20442507	20442507	+	IGR	DEL	T	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20442507delT								LOC284441 (72004 upstream) : ZNF826 (8571 downstream)																							GCAGCTCGtgttttttttttg	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53833023	53833024	+	IGR	INS	-	T	T	rs112929393		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53833023_53833024insT								BIRC8 (38148 upstream) : ZNF845 (3978 downstream)																							TCAGAAAAttcttttttttttt	0.203													5	3	---	---	---	---	
TMC4	147798	broad.mit.edu	37	19	54667041	54667042	+	Intron	INS	-	TTTT	TTTT	rs12052119		TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54667041_54667042insTTTT	uc010erf.2	-						TMC4_uc002qdn.2_Intron|TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					ttctttctttcttttttttttt	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49467094	49467096	+	IGR	DEL	TCC	-	-			TCGA-CZ-5989-01A-11D-1669-08	TCGA-CZ-5989-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49467094_49467096delTCC								FAM19A5 (319352 upstream) : C22orf34 (341080 downstream)																							cttccttccttccttcttccttc	0.074													4	2	---	---	---	---	
