Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIF1B	23095	broad.mit.edu	37	1	10425659	10425659	+	Missense_Mutation	SNP	G	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10425659G>C	uc001aqx.3	+	43	4907	c.4705G>C	c.(4705-4707)GGA>CGA	p.G1569R	KIF1B_uc001aqw.3_Missense_Mutation_p.G1523R|KIF1B_uc001aqy.2_Missense_Mutation_p.G1543R|KIF1B_uc001aqz.2_Missense_Mutation_p.G1569R|KIF1B_uc001ara.2_Missense_Mutation_p.G1529R|KIF1B_uc001arb.2_Missense_Mutation_p.G1555R	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1569					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTATGATTCAGGAGACATCGA	0.527													20	38	---	---	---	---	PASS
PRAMEF11	440560	broad.mit.edu	37	1	12885289	12885289	+	Silent	SNP	G	T	T	rs148273194	by1000genomes	TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12885289G>T	uc001auk.2	-	4	1018	c.822C>A	c.(820-822)CTC>CTA	p.L274L		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	274	LRR 3.										0						GGCACTGGGAGAGATGCTTCA	0.458													5	213	---	---	---	---	PASS
PDPN	10630	broad.mit.edu	37	1	13933693	13933693	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13933693C>G	uc001avd.2	+	2	370	c.321C>G	c.(319-321)GAC>GAG	p.D107E	PDPN_uc001avc.2_Missense_Mutation_p.D107E|PDPN_uc009vob.2_5'UTR|PDPN_uc009voc.2_5'UTR|PDPN_uc001ave.2_5'UTR|PDPN_uc001avf.2_5'UTR	NM_006474	NP_006465	Q86YL7	PDPN_HUMAN	lung type-I cell membrane-associated	31	Extracellular (Potential).				cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		CAGAAGATGACACTGAGACTA	0.517													5	89	---	---	---	---	PASS
TAS1R2	80834	broad.mit.edu	37	1	19166510	19166510	+	Silent	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19166510G>A	uc001bba.1	-	6	2104	c.2103C>T	c.(2101-2103)GGC>GGT	p.G701G		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	701	Helical; Name=4; (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGGGACTGAGGCCCGTGGCCA	0.557													5	134	---	---	---	---	PASS
OR10J1	26476	broad.mit.edu	37	1	159410089	159410089	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159410089G>T	uc010piv.1	+	1	541	c.541G>T	c.(541-543)GCT>TCT	p.A181S	uc001fts.3_Intron	NM_012351	NP_036483	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J,	181	Extracellular (Potential).				sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0429)					ACCCTTCTGTGCTAGAAAGGT	0.488													16	163	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186277944	186277944	+	Silent	SNP	C	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186277944C>G	uc001gru.3	+	7	3144	c.3093C>G	c.(3091-3093)CCC>CCG	p.P1031P	PRG4_uc001grt.3_Silent_p.P990P|PRG4_uc009wyl.2_Silent_p.P938P|PRG4_uc009wym.2_Silent_p.P897P|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	1031					cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CCAAAAAACCCACTTCTACCA	0.418													28	103	---	---	---	---	PASS
TMCC2	9911	broad.mit.edu	37	1	205238192	205238192	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205238192G>A	uc001hbz.1	+	4	1306	c.862G>A	c.(862-864)GCC>ACC	p.A288T	TMCC2_uc010prf.1_Missense_Mutation_p.A210T|TMCC2_uc001hca.2_Missense_Mutation_p.A63T|TMCC2_uc001hcb.1_Missense_Mutation_p.A48T|TMCC2_uc001hcc.1_5'UTR|TMCC2_uc001hcd.2_Missense_Mutation_p.A55T	NM_014858	NP_055673	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	288						integral to membrane	protein binding			pancreas(1)	1	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GACCAAGGCCGCCATTGACCA	0.642													18	37	---	---	---	---	PASS
IL10	3586	broad.mit.edu	37	1	206945852	206945852	+	5'Flank	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206945852C>A	uc001hen.1	-						IL10_uc009xbx.2_RNA	NM_000572	NP_000563	P22301	IL10_HUMAN	interleukin 10 precursor						anti-apoptosis|B cell differentiation|B cell proliferation|cytoplasmic sequestering of NF-kappaB|inflammatory response|leukocyte chemotaxis|negative regulation of B cell proliferation|negative regulation of cytokine secretion involved in immune response|negative regulation of interferon-alpha biosynthetic process|negative regulation of interleukin-6 production|negative regulation of membrane protein ectodomain proteolysis|negative regulation of MHC class II biosynthetic process|negative regulation of T cell proliferation|positive regulation of B cell apoptosis|positive regulation of cytokine secretion|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|receptor biosynthetic process|regulation of isotype switching|response to glucocorticoid stimulus|type 2 immune response	extracellular space	cytokine activity|growth factor activity|interleukin-10 receptor binding				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			ACCTTCACCTCTCTGTCCCCC	0.473													3	19	---	---	---	---	PASS
C1orf124	83932	broad.mit.edu	37	1	231487063	231487063	+	Missense_Mutation	SNP	T	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231487063T>G	uc001hur.2	+	4	912	c.464T>G	c.(463-465)TTT>TGT	p.F155C	C1orf124_uc001hus.2_Missense_Mutation_p.F155C|C1orf124_uc001hut.2_Missense_Mutation_p.F112C	NM_032018	NP_114407	Q9H040	CA124_HUMAN	hypothetical protein LOC83932 isoform a	155					DNA repair	nuclear speck	DNA binding|metal ion binding				0	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				TACCATACTTTTCACGATGAG	0.423													20	57	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248344209	248344209	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248344209G>T	uc010pzf.1	+	1	922	c.922G>T	c.(922-924)GGC>TGC	p.G308C		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTTAGGAAAGGGCAAGTCTGA	0.403													9	291	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56419911	56419911	+	Silent	SNP	C	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56419911C>T	uc002rzn.2	+	2	1078	c.576C>T	c.(574-576)AGC>AGT	p.S192S		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	192										breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCCAGGCCAGCCTGTGCCAAC	0.632													12	35	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109099526	109099526	+	Silent	SNP	C	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109099526C>T	uc002tec.2	+	12	3508	c.3354C>T	c.(3352-3354)GCC>GCT	p.A1118A	GCC2_uc002ted.2_Silent_p.A1017A	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1118	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						AGGAACATGCCACTACTGTAA	0.313													8	23	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168105254	168105254	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168105254C>A	uc002udx.2	+	8	7370	c.7352C>A	c.(7351-7353)TCA>TAA	p.S2451*	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Nonsense_Mutation_p.S2276*|XIRP2_uc010fpq.2_Nonsense_Mutation_p.S2229*|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2276					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ACCTCCCTGTCAGATATGGAA	0.413													8	90	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182396472	182396472	+	Missense_Mutation	SNP	A	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182396472A>G	uc002unu.2	+	25	3516	c.2753A>G	c.(2752-2754)CAA>CGA	p.Q918R	ITGA4_uc002unv.2_Missense_Mutation_p.Q163R	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	918	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	GTTCATATCCAACTGGAAGGC	0.343													22	81	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211469946	211469946	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211469946G>A	uc002vee.3	+	17	2089	c.1957G>A	c.(1957-1959)GTT>ATT	p.V653I	CPS1_uc010fur.2_Missense_Mutation_p.V659I|CPS1_uc010fus.2_Missense_Mutation_p.V202I	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	653	ATP-grasp 1.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CATGGAAAATGTTGATGCCAT	0.398													4	129	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191492	10191492	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191492G>T	uc003bvc.2	+	3	698	c.485G>T	c.(484-486)TGC>TTC	p.C162F	VHL_uc003bvd.2_Missense_Mutation_p.C121F	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	162	Interaction with Elongin BC complex.		C -> R (in VHLD; type I).|C -> F (in VHLD; type I; No effect on interaction with HIF1A nor on HIF1A degradation).|C -> Y (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.C162Y(3)|p.C162R(3)|p.C162F(2)|p.C162W(2)|p.C162*(1)|p.C162fs*12(1)|p.C162fs*9(1)|p.L158fs*6(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AAAGAGCGATGCCTCCAGGTT	0.507		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				6	15	---	---	---	---	PASS
NDUFAF3	25915	broad.mit.edu	37	3	49059963	49059963	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49059963C>A	uc003cvq.2	+	2	766	c.262C>A	c.(262-264)CAG>AAG	p.Q88K	DALRD3_uc003cvm.1_5'Flank|DALRD3_uc010hko.1_5'Flank|uc011bcb.1_5'Flank|MIR425_hsa-mir-425|MI0001448_5'Flank|NDUFAF3_uc003cvn.2_Missense_Mutation_p.Q31K|uc003cvo.1_5'Flank|MIR191_hsa-mir-191|MI0000465_5'Flank|NDUFAF3_uc003cvp.2_Missense_Mutation_p.Q31K|NDUFAF3_uc003cvr.2_Missense_Mutation_p.Q31K|NDUFAF3_uc003cvs.2_Missense_Mutation_p.Q31K	NM_199069	NP_951032	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	88					mitochondrial respiratory chain complex I assembly	mitochondrial inner membrane|nucleus	protein binding				0						CTCGGTGGTGCAGTGGAACGT	0.612													11	20	---	---	---	---	PASS
TP63	8626	broad.mit.edu	37	3	189586470	189586470	+	Missense_Mutation	SNP	C	T	T	rs147148566		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189586470C>T	uc003fry.2	+	8	1183	c.1094C>T	c.(1093-1095)TCG>TTG	p.S365L	TP63_uc003frx.2_Missense_Mutation_p.S365L|TP63_uc003frz.2_Missense_Mutation_p.S365L|TP63_uc010hzc.1_Missense_Mutation_p.S365L|TP63_uc003fsa.2_Missense_Mutation_p.S271L|TP63_uc003fsb.2_Missense_Mutation_p.S271L|TP63_uc003fsc.2_Missense_Mutation_p.S271L|TP63_uc003fsd.2_Missense_Mutation_p.S271L|TP63_uc010hzd.1_Missense_Mutation_p.S186L|TP63_uc003fse.1_Missense_Mutation_p.S246L	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	365	Interaction with HIPK2.				anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	p.S365L(1)		skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CAGCAAGTTTCGGACAGTACA	0.537									Hay-Wells_syndrome	HNSCC(45;0.13)			20	70	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8583134	8583134	+	Missense_Mutation	SNP	T	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8583134T>A	uc003glk.2	+	1	844	c.425T>A	c.(424-426)CTT>CAT	p.L142H	CPZ_uc003gll.2_RNA	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	142	Helical; Name=4; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						GGCGCTGCACTTGGCTGCTCG	0.711													4	13	---	---	---	---	PASS
TAPT1	202018	broad.mit.edu	37	4	16165153	16165153	+	Silent	SNP	G	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16165153G>T	uc010ied.1	-	14	1563	c.1482C>A	c.(1480-1482)TCC>TCA	p.S494S	TAPT1_uc011bxd.1_RNA|TAPT1_uc011bxe.1_Silent_p.S383S	NM_153365	NP_699196	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation	494						integral to membrane	growth hormone-releasing hormone receptor activity				0						TTTCTTCTGTGGAAAGGCCTG	0.333													8	25	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187627796	187627796	+	Silent	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187627796G>A	uc003izf.2	-	2	3374	c.3186C>T	c.(3184-3186)GAC>GAT	p.D1062D	FAT1_uc010iso.1_Silent_p.D1062D	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1062	Extracellular (Potential).|Cadherin 9.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						CTCTTCTGGCGTCCTCATCAT	0.468										HNSCC(5;0.00058)			4	162	---	---	---	---	PASS
PCDHA3	56145	broad.mit.edu	37	5	140182298	140182298	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140182298A>T	uc003lhf.2	+	1	1516	c.1516A>T	c.(1516-1518)AGC>TGC	p.S506C	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.S506C	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	506	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCTGTCGAGCTACGTGTC	0.682													6	191	---	---	---	---	PASS
PCDHB15	56121	broad.mit.edu	37	5	140627353	140627353	+	Missense_Mutation	SNP	T	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140627353T>A	uc003lje.2	+	1	2207	c.2207T>A	c.(2206-2208)CTG>CAG	p.L736Q		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	736	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCAGGGCATCTGGTGGACGTG	0.612													7	322	---	---	---	---	PASS
PCDHGA5	56110	broad.mit.edu	37	5	140745223	140745223	+	Silent	SNP	A	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140745223A>G	uc003lju.1	+	1	1326	c.1326A>G	c.(1324-1326)GTA>GTG	p.V442V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Silent_p.V442V	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	442	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTGAAAGTAGCAGACGTTA	0.478													81	112	---	---	---	---	PASS
ALDH5A1	7915	broad.mit.edu	37	6	24528317	24528317	+	Silent	SNP	T	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24528317T>C	uc003neg.2	+	8	1294	c.1266T>C	c.(1264-1266)CCT>CCC	p.P422P	ALDH5A1_uc003nef.2_Silent_p.P435P	NM_001080	NP_001071	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5A1 isoform 2 precursor	422					acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)	TCTTTGAGCCTACCCTGCTGT	0.502													15	36	---	---	---	---	PASS
PMS2L11	441263	broad.mit.edu	37	7	76669152	76669152	+	Intron	SNP	A	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76669152A>C	uc011kgn.1	+						LOC100132832_uc003ufy.2_RNA					Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						AATATAATAAATGAATAGATT	0.284													3	14	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127251610	127251610	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127251610C>G	uc010lld.1	-	8	1074	c.868G>C	c.(868-870)GCC>CCC	p.A290P	PAX4_uc003vmf.2_Missense_Mutation_p.A288P|PAX4_uc003vmg.1_Missense_Mutation_p.A290P	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	298	Transcription repression.				cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTGAGACAGGCTTTAGGTGGG	0.597													3	156	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138602172	138602172	+	Missense_Mutation	SNP	T	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138602172T>C	uc011kql.1	-	2	2249	c.2200A>G	c.(2200-2202)ACG>GCG	p.T734A	KIAA1549_uc003vuk.3_Missense_Mutation_p.T684A|KIAA1549_uc011kqj.1_Missense_Mutation_p.T734A	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	734	Ser-rich.					integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						AGTGAAACCGTAGACGCTTCA	0.463			O	BRAF	pilocytic astrocytoma								3	55	---	---	---	---	PASS
CNTLN	54875	broad.mit.edu	37	9	17416024	17416024	+	Nonsense_Mutation	SNP	T	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17416024T>A	uc003zmz.2	+	18	2974	c.2948T>A	c.(2947-2949)TTA>TAA	p.L983*	CNTLN_uc003zmy.2_Nonsense_Mutation_p.L984*|CNTLN_uc010mio.2_Nonsense_Mutation_p.L663*	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1	984	Potential.					centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		ATTATTTTATTACGAGAACGG	0.274													21	61	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140671279	140671279	+	Silent	SNP	C	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140671279C>T	uc011mfc.1	+	12	2038	c.2001C>T	c.(1999-2001)GCC>GCT	p.A667A	EHMT1_uc004coa.2_Silent_p.A667A|EHMT1_uc004cob.1_Silent_p.A636A	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	667					DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AGGGCAGGGCCGACACCACAA	0.592													7	33	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	409240	409240	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:409240A>T	uc001ifp.2	-	21	2579	c.2489T>A	c.(2488-2490)TTC>TAC	p.F830Y	DIP2C_uc009xhi.1_Missense_Mutation_p.F216Y|DIP2C_uc010pzz.1_Missense_Mutation_p.F151Y	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	830						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GGTCACCGAGAACACGGCTAT	0.627													9	43	---	---	---	---	PASS
ST8SIA6	338596	broad.mit.edu	37	10	17362931	17362931	+	Silent	SNP	T	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17362931T>C	uc001ipd.2	-	8	1143	c.1143A>G	c.(1141-1143)CAA>CAG	p.Q381Q	ST8SIA6_uc010qce.1_RNA	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide	381	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						TCATGTGAAGTTGGAGGATCT	0.368													4	287	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26789847	26789847	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26789847A>T	uc001iss.2	+	5	581	c.260A>T	c.(259-261)AAA>ATA	p.K87I	APBB1IP_uc001isr.2_Missense_Mutation_p.K87I|APBB1IP_uc009xks.1_Missense_Mutation_p.K87I	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	87					blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						CAGGCACAGAAAGAGTCCTTG	0.458													23	77	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33619643	33619643	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33619643C>A	uc001iwx.3	-	2	764	c.241G>T	c.(241-243)GAC>TAC	p.D81Y	NRP1_uc001iwv.3_Missense_Mutation_p.D81Y|NRP1_uc009xlz.2_Missense_Mutation_p.D81Y|NRP1_uc001iww.3_5'UTR|NRP1_uc001iwy.3_Missense_Mutation_p.D81Y|NRP1_uc001iwz.2_Missense_Mutation_p.D81Y|NRP1_uc001ixa.2_Missense_Mutation_p.D81Y|NRP1_uc001ixb.1_Missense_Mutation_p.D81Y|NRP1_uc001ixc.1_Missense_Mutation_p.D81Y	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	81	CUB 1.|Extracellular (Potential).				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	TACTTGCAGTCTCTGTCCTCC	0.478													11	26	---	---	---	---	PASS
EML3	256364	broad.mit.edu	37	11	62373575	62373575	+	Missense_Mutation	SNP	A	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62373575A>C	uc001ntu.1	-	13	1924	c.1616T>G	c.(1615-1617)GTA>GGA	p.V539G	EML3_uc001ntr.1_Missense_Mutation_p.V511G|EML3_uc001nts.1_Missense_Mutation_p.V511G|EML3_uc001ntt.1_Missense_Mutation_p.V423G|EML3_uc010rly.1_Missense_Mutation_p.V539G|EML3_uc009yny.1_Missense_Mutation_p.V322G	NM_153265	NP_694997	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like	539	WD 5.					cytoplasm|microtubule	protein binding			ovary(1)	1						CCCCCACTGTACCAGCCGGCG	0.647													13	81	---	---	---	---	PASS
KIAA1377	57562	broad.mit.edu	37	11	101868446	101868446	+	3'UTR	SNP	A	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101868446A>C	uc001pgm.2	+	11					KIAA1377_uc001pgn.2_3'UTR|KIAA1377_uc010run.1_3'UTR	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562								protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TTTTGTGAAAACCAGCCATAG	0.423													9	39	---	---	---	---	PASS
SC5DL	6309	broad.mit.edu	37	11	121175086	121175086	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121175086A>T	uc001pxu.2	+	3	375	c.227A>T	c.(226-228)GAG>GTG	p.E76V	SC5DL_uc001pxs.1_3'UTR|SC5DL_uc001pxt.2_Missense_Mutation_p.E76V|SC5DL_uc001pxv.2_Missense_Mutation_p.E76V	NM_006918	NP_008849	O75845	SC5D_HUMAN	sterol-C5-desaturase	76					fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	C-5 sterol desaturase activity|iron ion binding|lathosterol oxidase activity			ovary(1)	1		Breast(109;0.00328)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	OV - Ovarian serous cystadenocarcinoma(1;0.0334)	BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		GTCCGTCGAGAGATTAAGTTT	0.353													29	51	---	---	---	---	PASS
KLRG1	10219	broad.mit.edu	37	12	9144837	9144837	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9144837G>A	uc001qvh.2	+	2	129	c.118G>A	c.(118-120)GCA>ACA	p.A40T	KLRG1_uc001qvg.2_Missense_Mutation_p.A40T	NM_005810	NP_005801	Q96E93	KLRG1_HUMAN	killer cell lectin-like receptor subfamily G,	40	Helical; Signal-anchor for type II membrane protein; (Potential).				cell surface receptor linked signaling pathway|cellular defense response|inflammatory response|regulation of immune response	integral to membrane	receptor activity|sugar binding			central_nervous_system(1)	1						TTGCCTTGTGGCAATAGCTTT	0.448													40	219	---	---	---	---	PASS
LOC642846	642846	broad.mit.edu	37	12	9453702	9453702	+	RNA	SNP	C	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9453702C>T	uc010sgp.1	+	10		c.1341C>T			LOC642846_uc001qvp.2_RNA	NR_024374				Homo sapiens cDNA FLJ60280 complete cds, highly similar to Probable ATP-dependent RNA helicase DDX11 (EC 3.6.1.-).												0						GGTGGTGCTGCCCTATCAGAT	0.662													3	7	---	---	---	---	PASS
C12orf41	54934	broad.mit.edu	37	12	49073492	49073492	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49073492C>A	uc001rrx.2	-	3	451	c.376G>T	c.(376-378)GAG>TAG	p.E126*	C12orf41_uc001rrw.2_5'UTR|C12orf41_uc001rrz.2_Nonsense_Mutation_p.E309*|C12orf41_uc001rry.2_RNA	NM_017822	NP_060292	Q9H9L4	CL041_HUMAN	hypothetical protein LOC54934	126										ovary(2)	2						GACCCCAGCTCTGTCTTAGCA	0.507													3	20	---	---	---	---	PASS
TSFM	10102	broad.mit.edu	37	12	58190297	58190297	+	Silent	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58190297G>A	uc001sqi.2	+	6	958	c.909G>A	c.(907-909)CAG>CAA	p.Q303Q	TSFM_uc010sse.1_Silent_p.Q263Q|TSFM_uc001sqh.2_Silent_p.Q324Q|TSFM_uc010ssf.1_3'UTR	NM_005726	NP_005717	P43897	EFTS_HUMAN	Ts translation elongation factor, mitochondrial	303					regulation of transcription elongation, DNA-dependent	mitochondrion|nucleus	translation elongation factor activity				0	all_cancers(7;6.31e-80)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TGCAGCCTCAGGGGGTGTCGG	0.537													9	21	---	---	---	---	PASS
RCBTB2	1102	broad.mit.edu	37	13	49086880	49086880	+	Silent	SNP	T	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49086880T>C	uc001vch.2	-	7	872	c.501A>G	c.(499-501)CTA>CTG	p.L167L	RCBTB2_uc010tgg.1_Silent_p.L172L|RCBTB2_uc001vci.2_Silent_p.L143L|RCBTB2_uc010tgh.1_Intron|RCBTB2_uc001vcj.2_Silent_p.L171L|RCBTB2_uc010acv.1_RNA|RCBTB2_uc010tgi.1_Silent_p.L143L	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	167	RCC1 2.						Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		CATCAGATGTTAGCACCAAAG	0.368													23	84	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109817265	109817265	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109817265G>A	uc001vqt.1	+	33	5241	c.5115G>A	c.(5113-5115)ATG>ATA	p.M1705I	MYO16_uc010agk.1_Missense_Mutation_p.M1727I	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1705					cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AAACTAACATGAACATAAGTA	0.284													15	16	---	---	---	---	PASS
OR4Q3	441669	broad.mit.edu	37	14	20216003	20216003	+	Silent	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20216003C>A	uc010tkt.1	+	1	417	c.417C>A	c.(415-417)CCC>CCA	p.P139P		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCATGAACCCCCAGCTATGCC	0.498													5	89	---	---	---	---	PASS
LRP10	26020	broad.mit.edu	37	14	23344975	23344975	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23344975C>G	uc001whd.2	+	5	1371	c.818C>G	c.(817-819)GCT>GGT	p.A273G	LRP10_uc001whe.2_Missense_Mutation_p.A149G	NM_014045	NP_054764	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein	273	CUB 2.|Extracellular (Potential).				endocytosis	coated pit|integral to membrane				central_nervous_system(1)	1	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		AATGGCAAGGCTGTCACTGTG	0.582													24	59	---	---	---	---	PASS
MLH3	27030	broad.mit.edu	37	14	75515759	75515759	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75515759C>G	uc001xrd.1	-	2	816	c.600G>C	c.(598-600)CAG>CAC	p.Q200H	MLH3_uc001xre.1_Missense_Mutation_p.Q200H|MLH3_uc010tuy.1_RNA	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	200					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TTTTAGGGAGCTGAAGAACCA	0.373								MMR					11	54	---	---	---	---	PASS
PPP4R4	57718	broad.mit.edu	37	14	94741786	94741786	+	Missense_Mutation	SNP	C	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94741786C>T	uc001ycs.1	+	24	2679	c.2525C>T	c.(2524-2526)TCC>TTC	p.S842F		NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	842						cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						CCGAGTACTTCCCGTGGGACA	0.448													67	172	---	---	---	---	PASS
HERC2P2	400322	broad.mit.edu	37	15	23335621	23335621	+	Silent	SNP	C	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23335621C>T	uc001yvr.2	-	3	260	c.60G>A	c.(58-60)GAG>GAA	p.E20E	HERC2P2_uc010ayf.1_Intron					RecName: Full=Putative HERC2-like protein 3;												0						ATGTCACTTTCTCATTATTTC	0.363													5	36	---	---	---	---	PASS
MAPKBP1	23005	broad.mit.edu	37	15	42109168	42109168	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42109168G>A	uc001zok.3	+	15	1950	c.1664G>A	c.(1663-1665)CGG>CAG	p.R555Q	MAPKBP1_uc001zoj.3_Missense_Mutation_p.R549Q|MAPKBP1_uc010bcj.2_Missense_Mutation_p.R56Q|MAPKBP1_uc010bci.2_Missense_Mutation_p.R549Q|MAPKBP1_uc010udb.1_Missense_Mutation_p.R388Q|MAPKBP1_uc010bck.2_5'UTR|MAPKBP1_uc010bcl.2_Missense_Mutation_p.R56Q	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein	555	WD 8.									central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GATGCCGGGCGGGAGTACAGC	0.582													6	163	---	---	---	---	PASS
KIAA1199	57214	broad.mit.edu	37	15	81172060	81172060	+	Missense_Mutation	SNP	A	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81172060A>G	uc002bfw.1	+	4	505	c.245A>G	c.(244-246)AAG>AGG	p.K82R	KIAA1199_uc010unn.1_Missense_Mutation_p.K82R	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN	KIAA1199 precursor	82	G8.									upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						TCTTCAGGCAAGCTGGTCATT	0.527													14	45	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3658538	3658538	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3658538A>T	uc002cvp.2	-	2	1055	c.428T>A	c.(427-429)GTG>GAG	p.V143E	BTBD12_uc002cvq.1_Missense_Mutation_p.V143E	NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	143	Interaction with C20orf94, ERCC4 and MSH2.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						AGAGGCAAGCACACCCCCCTC	0.552								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				14	53	---	---	---	---	PASS
SEPT12	124404	broad.mit.edu	37	16	4833399	4833399	+	Intron	SNP	T	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4833399T>A	uc002cxq.2	-						SEPT12_uc002cxr.2_Intron|SEPT12_uc010bty.2_RNA	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2						cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						AGATGAGTCTTTGGATGGAAA	0.458													13	31	---	---	---	---	PASS
HSF4	3299	broad.mit.edu	37	16	67199696	67199696	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67199696C>A	uc002erl.1	+	5	1272	c.307C>A	c.(307-309)CAC>AAC	p.H103N	HSF4_uc002erm.1_Missense_Mutation_p.H103N|HSF4_uc002ern.1_RNA|HSF4_uc010cec.1_RNA	NM_001040667	NP_001035757	Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4 isoform b	103	By similarity.				response to stress	nucleus	sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		CGAGTTCCAGCACCCGAGCTT	0.706													3	15	---	---	---	---	PASS
CIRH1A	84916	broad.mit.edu	37	16	69199341	69199341	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69199341C>G	uc002ews.3	+	15	1841	c.1745C>G	c.(1744-1746)CCT>CGT	p.P582R	CIRH1A_uc002ewr.2_Missense_Mutation_p.P582R|CIRH1A_uc002ewt.3_Missense_Mutation_p.P499R|CIRH1A_uc010cfi.2_Missense_Mutation_p.P384R	NM_032830	NP_116219	Q969X6	CIR1A_HUMAN	cirhin	582						nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)		AGGGATACTCCTATCACACAC	0.468													15	71	---	---	---	---	PASS
CHST5	23563	broad.mit.edu	37	16	75563733	75563733	+	Silent	SNP	G	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75563733G>T	uc002fei.2	-	3	1945	c.550C>A	c.(550-552)CGG>AGG	p.R184R	CHST5_uc002fej.1_Silent_p.R190R	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	184	Lumenal (Potential).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						CAGGCCTCCCGGGCCAGGCTG	0.667													4	191	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10355565	10355565	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10355565G>A	uc002gmn.2	-	27	3542	c.3431C>T	c.(3430-3432)TCC>TTC	p.S1144F	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1144	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						CAGCTCCCGGGAGAGGTCAGA	0.592													6	121	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26961748	26961748	+	Missense_Mutation	SNP	G	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26961748G>C	uc002hbu.2	-	16	2956	c.2857C>G	c.(2857-2859)CTC>GTC	p.L953V		NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	953						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					TTGCCATAGAGACGACGGGAA	0.537													42	111	---	---	---	---	PASS
RHOT1	55288	broad.mit.edu	37	17	30536513	30536513	+	Intron	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30536513C>A	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron|RHOT1_uc002hgv.2_3'UTR	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TTGATATTTTCTTAGAGAATG	0.333													8	22	---	---	---	---	PASS
LIG3	3980	broad.mit.edu	37	17	33316728	33316728	+	Intron	SNP	A	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33316728A>G	uc002hik.1	+						LIG3_uc002hii.2_3'UTR|LIG3_uc002hij.2_Intron|LIG3_uc010cth.1_Intron	NM_013975	NP_039269	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent isoform alpha						base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding			skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9		Ovarian(249;0.17)			Bleomycin(DB00290)	GGAGAGCTCAAGGCcatggct	0.284								Other_BER_factors					3	26	---	---	---	---	PASS
KRT39	390792	broad.mit.edu	37	17	39122754	39122754	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39122754G>A	uc002hvo.1	-	1	391	c.355C>T	c.(355-357)CGA>TGA	p.R119*	KRT39_uc010wfm.1_Translation_Start_Site	NM_213656	NP_998821	Q6A163	K1C39_HUMAN	type I hair keratin KA35	119	Coil 1A.|Rod.					intermediate filament	structural molecule activity				0		Breast(137;0.00043)|Ovarian(249;0.15)				GCATTCTCTCGTTCTAGCATT	0.443													9	173	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18535179	18535179	+	Silent	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18535179G>A	uc002kte.2	-	30	4481	c.3540C>T	c.(3538-3540)ACC>ACT	p.T1180T		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1180	PH.|Auto-inhibitory.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					CATCTCCTTGGGTTACAGGTC	0.259													3	13	---	---	---	---	PASS
SYT4	6860	broad.mit.edu	37	18	40857247	40857247	+	5'UTR	SNP	T	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40857247T>A	uc002law.2	-	1					SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_5'UTR|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV							cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5						TCGGAGCCATTTTTTACTGCG	0.498													16	44	---	---	---	---	PASS
ZNF440	126070	broad.mit.edu	37	19	11941219	11941219	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11941219C>G	uc002msp.1	+	2	281	c.125C>G	c.(124-126)TCT>TGT	p.S42C		NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	42	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AACCTGACCTCTTTAGGTAAG	0.443													4	147	---	---	---	---	PASS
FCHO1	23149	broad.mit.edu	37	19	17865951	17865951	+	5'UTR	SNP	G	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17865951G>C	uc010ebb.2	+	3					FCHO1_uc002nhg.3_5'UTR|FCHO1_uc002nhh.2_5'UTR|FCHO1_uc010xpw.1_Intron	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN	FCH domain only 1 isoform b											breast(1)	1						GGGCCTGCAGGGGTCTCCACA	0.567													32	156	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36046491	36046491	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36046491C>G	uc002oal.1	-	14	2037	c.2008G>C	c.(2008-2010)GAT>CAT	p.D670H	ATP4A_uc010eee.1_5'UTR	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	670	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	GCACGGGCATCCCTGGGGAGG	0.637													24	65	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41078059	41078059	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41078059C>A	uc002ony.2	+	34	7540	c.7454C>A	c.(7453-7455)GCT>GAT	p.A2485D	SPTBN4_uc002onz.2_Missense_Mutation_p.A2485D|SPTBN4_uc010egx.2_Missense_Mutation_p.A1228D	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	2485	PH.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGCGAGGTGGCTAGTGACTAC	0.607													7	172	---	---	---	---	PASS
BCKDHA	593	broad.mit.edu	37	19	41930592	41930592	+	3'UTR	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41930592C>A	uc002oqq.2	+	9					CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_3'UTR|BCKDHA_uc002oqr.2_3'UTR|BCKDHA_uc010xvz.1_3'UTR	NM_000709	NP_000700	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0						GGGGACCTGACAGCACACCAC	0.602													3	38	---	---	---	---	PASS
ZNF702P	79986	broad.mit.edu	37	19	53472545	53472545	+	RNA	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53472545G>A	uc002qan.3	-	4		c.1956C>T				NR_003578				Synthetic construct DNA, clone: pF1KB9679, Homo sapiens ZNF702 gene for zinc finger protein 702, without stop codon, in Flexi system.												0						ACTTCATTATGCATTCTCCAA	0.363													8	12	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3677349	3677349	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3677349G>A	uc002wja.2	-	10	2567	c.2567C>T	c.(2566-2568)GCC>GTC	p.A856V	SIGLEC1_uc002wiz.3_Missense_Mutation_p.A856V	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	856	Ig-like C2-type 8.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CAGGGAGTTGGCCTCAGCTTT	0.607													5	101	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29624093	29624093	+	Splice_Site	SNP	G	T	T	rs75468660		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29624093G>T	uc010ztl.1	+	1	58	c.26_splice	c.e1+1	p.R9_splice	FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						CTGATTCCAGGTGAGCTTATG	0.289													3	21	---	---	---	---	PASS
C20orf106	200232	broad.mit.edu	37	20	55100886	55100886	+	Silent	SNP	C	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55100886C>T	uc002xxx.2	+	2	356	c.276C>T	c.(274-276)GGC>GGT	p.G92G	GCNT7_uc010zzg.1_5'UTR|C20orf107_uc010zzh.1_Intron	NM_001012971	NP_001012989	Q5JX71	CT106_HUMAN	hypothetical protein LOC200232 precursor	92	Cytoplasmic (Potential).					integral to membrane					0			Colorectal(105;0.202)			GCCTTCGAGGCGGCCAACTTC	0.398													7	188	---	---	---	---	PASS
psiTPTE22	387590	broad.mit.edu	37	22	17119476	17119476	+	RNA	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17119476G>A	uc002zls.1	+	2		c.313G>A			psiTPTE22_uc002zlr.2_RNA|psiTPTE22_uc002zlt.2_RNA					Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0						TAGACTATTTGGAGTTTTCCT	0.303													6	43	---	---	---	---	PASS
TUBA8	51807	broad.mit.edu	37	22	18609612	18609612	+	Silent	SNP	C	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18609612C>A	uc002znv.1	+	4	940	c.867C>A	c.(865-867)GCC>GCA	p.A289A	TUBA8_uc002znr.2_Silent_p.A223A|TUBA8_uc002znw.1_Silent_p.A313A|TUBA8_uc002znx.1_Silent_p.A136A	NM_018943	NP_061816	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	289					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0						TCTCTGTGGCCGAGATAACCA	0.602													27	81	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21115600	21115600	+	Missense_Mutation	SNP	T	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21115600T>C	uc002zsz.3	-	23	2840	c.2609A>G	c.(2608-2610)GAC>GGC	p.D870G		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	870					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ACCAGATTTGTCTTTCTGAAT	0.363													17	42	---	---	---	---	PASS
RANGAP1	5905	broad.mit.edu	37	22	41652800	41652800	+	Missense_Mutation	SNP	A	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41652800A>C	uc003azs.2	-	7	2273	c.803T>G	c.(802-804)GTG>GGG	p.V268G	RANGAP1_uc003azt.2_Missense_Mutation_p.V268G|RANGAP1_uc003azu.2_Missense_Mutation_p.V268G|RANGAP1_uc011aoz.1_Missense_Mutation_p.V213G	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	268					mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						AAAATTAATCACCTCCACCTG	0.637													6	5	---	---	---	---	PASS
TUBGCP6	85378	broad.mit.edu	37	22	50656996	50656996	+	Silent	SNP	G	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50656996G>A	uc003bkb.1	-	22	5387	c.4875C>T	c.(4873-4875)AGC>AGT	p.S1625S	TUBGCP6_uc003bka.1_Silent_p.S712S|TUBGCP6_uc010har.1_Silent_p.S1617S|TUBGCP6_uc010has.1_RNA	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1625					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGAAGACGCCGCTGTACTTGC	0.642													3	48	---	---	---	---	PASS
ERCC6L	54821	broad.mit.edu	37	X	71425445	71425445	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71425445G>T	uc004eaq.1	-	2	3269	c.3172C>A	c.(3172-3174)CAA>AAA	p.Q1058K	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Missense_Mutation_p.Q935K	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	1058					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)					GCATCAAATTGTTTCACAGAT	0.358													5	148	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73063859	73063859	+	RNA	SNP	G	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73063859G>T	uc004ebm.1	-	1		c.8730C>A				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						AGAAGTGATAGGGTTGTGGAC	0.413													4	71	---	---	---	---	PASS
XPNPEP2	7512	broad.mit.edu	37	X	128895243	128895243	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128895243G>T	uc004eut.1	+	17	1838	c.1594G>T	c.(1594-1596)GTG>TTG	p.V532L		NM_003399	NP_003390	O43895	XPP2_HUMAN	X-prolyl aminopeptidase 2, membrane-bound	532					cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0						CTTCCTGTGTGTGCATGAGTG	0.483													15	50	---	---	---	---	PASS
FAM58A	92002	broad.mit.edu	37	X	152860113	152860113	+	Silent	SNP	G	C	C			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152860113G>C	uc010nug.2	-	2	238	c.135C>G	c.(133-135)CCC>CCG	p.P45P				Q8N1B3	FA58A_HUMAN	RecName: Full=Cyclin-related protein FAM58B;	107					regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCAATTCCAGGGGCTCACCGC	0.552													17	65	---	---	---	---	PASS
WDR78	79819	broad.mit.edu	37	1	67358743	67358743	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67358743delA	uc001dcx.2	-						WDR78_uc001dcy.2_Intron|WDR78_uc001dcz.2_Intron|WDR78_uc009wax.2_5'Flank	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						agaaagagagagagagaaaga	0.080													4	2	---	---	---	---	
C1orf110	339512	broad.mit.edu	37	1	162825574	162825579	+	Intron	DEL	GAGTTG	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162825574_162825579delGAGTTG	uc001gck.2	-						C1orf110_uc009wuw.1_Splice_Site|C1orf110_uc009wux.1_Intron	NM_178550	NP_848645	Q86UF4	CA110_HUMAN	hypothetical protein LOC339512												0						GAAGtgttatgagttggattgtgtcc	0.170													5	5	---	---	---	---	
RC3H1	149041	broad.mit.edu	37	1	173930702	173930702	+	Intron	DEL	A	-	-	rs71715802		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173930702delA	uc001gju.3	-						RC3H1_uc010pms.1_Intron|RC3H1_uc001gjv.2_Intron|RC3H1_uc010pmt.1_Intron	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin						cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TATATAGTTTAAAAAAAAAAA	0.259													8	4	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185958904	185958904	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185958904delA	uc001grq.1	+						HMCN1_uc001grr.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CCAGATTTCTAtttttttttt	0.328													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189960370	189960370	+	IGR	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189960370delA								None (None upstream) : FAM5C (106427 downstream)																							CTTCCAACAGAAAATGTGGTA	0.433													8	5	---	---	---	---	
PLB1	151056	broad.mit.edu	37	2	28773038	28773038	+	Intron	DEL	T	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28773038delT	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_Intron	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					TTCCACGTGGttttttttttt	0.219													6	3	---	---	---	---	
ATR	545	broad.mit.edu	37	3	142217728	142217728	+	Intron	DEL	T	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142217728delT	uc003eux.3	-							NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein						cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						GCTTCATTCCttttttttttt	0.199								Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
NCAPG	64151	broad.mit.edu	37	4	17819025	17819026	+	Frame_Shift_Ins	INS	-	AA	AA			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17819025_17819026insAA	uc003gpp.2	+	6	1093_1094	c.917_918insAA	c.(916-918)TCAfs	p.S306fs	NCAPG_uc011bxj.1_5'UTR	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G	306	HEAT 5.				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		GCCTTGTTTTCAATAACTCCTC	0.391													114	57	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123159136	123159137	+	Intron	INS	-	A	A	rs11455945		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123159136_123159137insA	uc003ieh.2	+						KIAA1109_uc003iei.1_Intron|KIAA1109_uc010ins.1_Intron|KIAA1109_uc003iek.2_5'Flank	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						gactccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
LRBA	987	broad.mit.edu	37	4	151642666	151642666	+	Intron	DEL	T	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151642666delT	uc010ipj.2	-						LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					AAGAACTGGGTTTTTTTTTTT	0.284													6	3	---	---	---	---	
GALNT10	55568	broad.mit.edu	37	5	153677361	153677362	+	Intron	INS	-	TCCCC	TCCCC	rs146520730	by1000genomes	TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153677361_153677362insTCCCC	uc003lvh.2	+						GALNT10_uc003lvg.1_Intron|GALNT10_uc010jic.2_Intron|GALNT10_uc010jid.2_5'Flank	NM_198321	NP_938080	Q86SR1	GLT10_HUMAN	GalNAc transferase 10 isoform a							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			CTCTTTGTACTGAGCAAAAACT	0.233													8	4	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32521545	32521546	+	Intron	INS	-	AAGG	AAGG	rs70993877		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32521545_32521546insAAGG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TTGGGGAAAGACTTTATCCAGG	0.436													3	3	---	---	---	---	
SESN1	27244	broad.mit.edu	37	6	109314150	109314150	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109314150delA	uc003pst.3	-						SESN1_uc003psu.2_Intron	NM_014454	NP_055269	Q9Y6P5	SESN1_HUMAN	sestrin 1						cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		GATGCTAGTTAAAATTGATTT	0.338													22	13	---	---	---	---	
KPNA5	3841	broad.mit.edu	37	6	117002275	117002277	+	5'Flank	DEL	CCG	-	-	rs67797853	by1000genomes	TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117002275_117002277delCCG	uc003pxh.2	+						uc003pxg.1_5'Flank	NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		CACTCCTCCTccgccgccgccgc	0.567													3	3	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	136878752	136878752	+	3'UTR	DEL	T	-	-	rs71747329		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136878752delT	uc003qhc.2	-	30					MAP3K5_uc011edj.1_3'UTR	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GTTTTGTCTGTTTTTTTTTTT	0.343													4	2	---	---	---	---	
TNPO3	23534	broad.mit.edu	37	7	128645359	128645359	+	Intron	DEL	T	-	-	rs142831893		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128645359delT	uc003vol.1	-						TNPO3_uc003vom.1_Intron|TNPO3_uc010lly.1_Intron|TNPO3_uc010llz.1_Intron	NM_012470	NP_036602	Q9Y5L0	TNPO3_HUMAN	transportin 3						splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity			ovary(2)|skin(2)|lung(1)	5						AGTGTCACTGttttttttttt	0.204													5	5	---	---	---	---	
ACTR3B	57180	broad.mit.edu	37	7	152513741	152513741	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152513741delA	uc003wle.1	+						ACTR3B_uc003wlf.1_Intron|ACTR3B_uc003wlg.1_Intron|ACTR3B_uc011kvp.1_Intron	NM_020445	NP_065178	Q9P1U1	ARP3B_HUMAN	actin-related protein 3-beta isoform 1						regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		GGATGGAAATAAAAAAAAAAA	0.313													9	4	---	---	---	---	
RP1L1	94137	broad.mit.edu	37	8	10479846	10479846	+	Intron	DEL	A	-	-	rs150586051		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10479846delA	uc003wtc.2	-							NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1						intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		aaacaaagccaaaaaaaaaaa	0.174													4	2	---	---	---	---	
OXR1	55074	broad.mit.edu	37	8	107751967	107751970	+	Intron	DEL	TTAA	-	-	rs34123736		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107751967_107751970delTTAA	uc011lht.1	+						OXR1_uc003ymf.2_Intron|OXR1_uc011lhu.1_Intron|OXR1_uc010mcg.2_Intron|OXR1_uc010mch.2_Intron|OXR1_uc003ymk.2_Intron|OXR1_uc003yml.2_Intron	NM_018002	NP_060472	Q8N573	OXR1_HUMAN	oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GCAACTAGTGTTAATTAAGATGTT	0.235													3	4	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131179561	131179561	+	Intron	DEL	A	-	-	rs111521624		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131179561delA	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						aagaaaaaagaaaaaaaaaaa	0.174													4	2	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97131604	97131604	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97131604delA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TTACCTAACCAAAAAAAAAAA	0.264													4	3	---	---	---	---	
CTNND1	1500	broad.mit.edu	37	11	57563858	57563859	+	Intron	INS	-	A	A			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57563858_57563859insA	uc001nmc.3	+						CTNND1_uc001nlf.1_Intron|CTNND1_uc001nlh.1_Intron|CTNND1_uc001nlu.3_Intron|CTNND1_uc001nlt.3_Intron|CTNND1_uc001nls.3_Intron|CTNND1_uc001nlw.3_Intron|CTNND1_uc001nmf.3_Intron|CTNND1_uc001nmd.3_Intron|CTNND1_uc001nlk.3_Intron|CTNND1_uc001nme.3_Intron|CTNND1_uc001nll.3_Intron|CTNND1_uc001nmg.3_Intron|CTNND1_uc001nlj.3_Intron|CTNND1_uc001nlr.3_Intron|CTNND1_uc001nlp.3_Intron|CTNND1_uc001nlx.3_Intron|CTNND1_uc001nlz.3_Intron|CTNND1_uc009ymn.2_Intron|CTNND1_uc001nlm.3_Intron|CTNND1_uc001nly.3_Intron|CTNND1_uc001nmb.3_Intron|CTNND1_uc001nma.3_Intron|CTNND1_uc001nmi.3_Intron|CTNND1_uc001nmh.3_Intron|CTNND1_uc001nlq.3_Intron|CTNND1_uc001nln.3_Intron|CTNND1_uc001nli.3_Intron|CTNND1_uc001nlo.3_Intron|CTNND1_uc001nlv.3_Intron	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC						adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				gactccatctcaaaaaaaaaaa	0.144													6	3	---	---	---	---	
C1S	716	broad.mit.edu	37	12	7169412	7169412	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7169412delA	uc001qsj.2	+						C1S_uc001qsk.2_Intron|C1S_uc001qsl.2_Intron|C1S_uc009zfr.2_Intron|C1S_uc009zfs.2_Intron	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent						complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	tgtctctattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CSDA	8531	broad.mit.edu	37	12	10870901	10870901	+	Intron	DEL	C	-	-	rs11309033		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10870901delC	uc001qyt.2	-						CSDA_uc001qyu.2_Intron	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a						negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					CCACAGGCCACCCACCTTCCT	0.418													3	4	---	---	---	---	
PDE3A	5139	broad.mit.edu	37	12	20523334	20523335	+	Intron	INS	-	T	T	rs147390584	by1000genomes	TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20523334_20523335insT	uc001reh.1	+							NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	ttttttttttgttttttttgtt	0.347													4	3	---	---	---	---	
ING1	3621	broad.mit.edu	37	13	111367630	111367630	+	5'UTR	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111367630delA	uc001vri.2	+	1					CARS2_uc010tjm.1_5'Flank|uc001vre.2_5'Flank|ING1_uc001vrf.2_Intron|ING1_uc001vrg.2_Intron|ING1_uc001vrh.2_Intron	NM_005537	NP_005528	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1 isoform D						cell cycle|negative regulation of cell growth|negative regulation of cell proliferation	nucleus	zinc ion binding			ovary(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGGTGGGGGCAAAAAAAAAAA	0.517													4	2	---	---	---	---	
C14orf93	60686	broad.mit.edu	37	14	23457344	23457344	+	Intron	DEL	T	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23457344delT	uc001wib.1	-						C14orf93_uc001wic.1_Intron|C14orf93_uc001wid.1_Intron|C14orf93_uc001wig.2_Intron|C14orf93_uc001wih.2_Intron|C14orf93_uc001wie.2_Intron|C14orf93_uc001wia.3_Intron|C14orf93_uc001wif.2_Intron	NM_021944	NP_068763	Q9H972	CN093_HUMAN	hypothetical protein LOC60686 precursor							extracellular region				ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		AGATGAGGGCttttttttttt	0.269													7	4	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	63908449	63908450	+	Intron	INS	-	TCTA	TCTA	rs144336374	by1000genomes	TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63908449_63908450insTCTA	uc002amp.2	-							NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CAGGAGCCTGCTCTATTAGAAG	0.485													3	3	---	---	---	---	
ATF7IP2	80063	broad.mit.edu	37	16	10532293	10532293	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10532293delA	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						ttttttttttagagatgaggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14608988	14608988	+	IGR	DEL	T	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14608988delT								HS3ST3B1 (359496 upstream) : PMP22 (524109 downstream)																							TGCTTTGGGGTTTTTTTTTTT	0.353													4	2	---	---	---	---	
KRT37	8688	broad.mit.edu	37	17	39578961	39578961	+	Intron	DEL	C	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39578961delC	uc002hwp.1	-						uc002hwo.1_Intron	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37							intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)				GCTCTGAGAGCCCCAGGGCCG	0.657													4	2	---	---	---	---	
FTSJ3	117246	broad.mit.edu	37	17	61900955	61900955	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61900955delA	uc002jbz.2	-						FTSJ3_uc002jca.2_Intron	NM_017647	NP_060117	Q8IY81	RRMJ3_HUMAN	FtsJ homolog 3						RNA methylation|rRNA processing	nucleolus	methyltransferase activity|nucleic acid binding			ovary(1)	1						actccgtctcaaaaaaaaaaa	0.169													4	5	---	---	---	---	
HELZ	9931	broad.mit.edu	37	17	65146237	65146237	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65146237delA	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TTATTTATTTATTttctttct	0.149													3	3	---	---	---	---	
TMEM146	257062	broad.mit.edu	37	19	5778219	5778219	+	Intron	DEL	A	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5778219delA	uc002mda.2	+							NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor							integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						actccgactcaaaaaaaaaaa	0.234													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9794789	9794791	+	IGR	DEL	TTT	-	-	rs111810059		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9794789_9794791delTTT								ZNF562 (9013 upstream) : ZNF846 (68025 downstream)																							Atttttcatcttttttttttttt	0.212													3	3	---	---	---	---	
PIR	8544	broad.mit.edu	37	X	15478038	15478038	+	Intron	DEL	A	-	-	rs146737236		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15478038delA	uc004cwu.2	-						PIR_uc004cwv.2_Intron	NM_003662	NP_003653	O00625	PIR_HUMAN	pirin						transcription from RNA polymerase II promoter	cytoplasm|nucleus	metal ion binding|protein binding|quercetin 2,3-dioxygenase activity|transcription cofactor activity			ovary(1)	1	Hepatocellular(33;0.183)					ccttttcattAAAAAAAAAAa	0.000													4	4	---	---	---	---	
DLG3	1741	broad.mit.edu	37	X	69718534	69718537	+	Intron	DEL	TCAT	-	-	rs146166056		TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69718534_69718537delTCAT	uc004dyi.1	+						DLG3_uc004dyj.1_Intron|DLG3_uc011mpn.1_Intron	NM_021120	NP_066943	Q92796	DLG3_HUMAN	synapse-associated protein 102 isoform a						axon guidance|negative regulation of cell proliferation|synaptic transmission	plasma membrane	guanylate kinase activity			large_intestine(1)|pancreas(1)	2	Renal(35;0.156)					AAGGCTTGACTCATGGCACATCCA	0.583													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	136030245	136030245	+	Intron	DEL	T	-	-			TCGA-EU-5904-01A-11D-1669-08	TCGA-EU-5904-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136030245delT	uc004fai.1	+											Homo sapiens cDNA FLJ31132 fis, clone IMR322000953.																		GAGAACCTGCTTTTTTTTTTT	0.438													4	2	---	---	---	---	
