Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11177096	11177096	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11177096C>T	uc001asd.2	-	50	7102	c.6981G>A	c.(6979-6981)ATG>ATA	p.M2327I	MTOR_uc001asc.2_Missense_Mutation_p.M532I	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	2327	PI3K/PI4K.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						CAACCATTGACATGACCGCTA	0.383													63	281	---	---	---	---	PASS
USP48	84196	broad.mit.edu	37	1	22032266	22032266	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22032266C>G	uc001bfb.2	-	19	2576	c.2338G>C	c.(2338-2340)GGC>CGC	p.G780R	USP48_uc001bfa.2_Missense_Mutation_p.G318R|USP48_uc010odq.1_Missense_Mutation_p.G792R|USP48_uc009vqc.2_Missense_Mutation_p.G714R|USP48_uc001bfc.2_Missense_Mutation_p.G780R|USP48_uc001bfd.1_5'Flank	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a	780	DUSP 3.				ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		AACATGAGGCCCCCGTGGGGA	0.403													8	79	---	---	---	---	PASS
CELA3A	10136	broad.mit.edu	37	1	22329509	22329509	+	Silent	SNP	C	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22329509C>A	uc001bfl.2	+	2	76	c.57C>A	c.(55-57)GGC>GGA	p.G19G	CELA3B_uc009vqf.2_Intron	NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein	19					cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						CAGGCTATGGCCCACCTTCCT	0.488													6	103	---	---	---	---	PASS
AK2	204	broad.mit.edu	37	1	33476303	33476303	+	3'UTR	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33476303G>C	uc001bwo.1	-	7					uc001bwn.2_Intron|AK2_uc010ohq.1_3'UTR|AK2_uc009vud.1_3'UTR	NM_013411	NP_037543	P54819	KAD2_HUMAN	adenylate kinase 2 isoform b						nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				GTATTCCTCTGAGCCCCTCAC	0.488													6	53	---	---	---	---	PASS
ORC1L	4998	broad.mit.edu	37	1	52867122	52867122	+	Silent	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52867122A>G	uc001ctt.2	-	3	354	c.135T>C	c.(133-135)ATT>ATC	p.I45I	ORC1L_uc010oni.1_Silent_p.I45I|ORC1L_uc001ctu.2_Silent_p.I45I|ORC1L_uc009vzd.2_Intron	NM_004153	NP_004144	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	45	BAH.				cell cycle checkpoint|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nuclear origin of replication recognition complex|nucleolus|nucleoplasm|plasma membrane	ATP binding|DNA binding|nucleoside-triphosphatase activity|protein binding				0						TCTGGATGTGAATCTCGGTGG	0.408													6	264	---	---	---	---	PASS
CLCA2	9635	broad.mit.edu	37	1	86920891	86920891	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86920891C>T	uc001dlr.3	+	14	2675	c.2513C>T	c.(2512-2514)ACG>ATG	p.T838M		NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor	838	Extracellular (Potential).				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		GAGATATTTACGTTCTCACCC	0.388													10	142	---	---	---	---	PASS
GBP5	115362	broad.mit.edu	37	1	89726279	89726279	+	3'UTR	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89726279T>C	uc001dnc.2	-	12					GBP5_uc001dnd.2_3'UTR	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN	guanylate-binding protein 5							plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)		TTTGaaaaaataattataaag	0.289													12	41	---	---	---	---	PASS
ECM1	1893	broad.mit.edu	37	1	150482321	150482321	+	Intron	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150482321G>C	uc001eus.2	+						ECM1_uc010pce.1_Intron|ECM1_uc010pcf.1_Intron|ECM1_uc001eut.2_Intron|ECM1_uc001euu.2_Missense_Mutation_p.E78D|ECM1_uc001euv.2_Missense_Mutation_p.E76D|ECM1_uc009wlu.2_5'UTR	NM_004425	NP_004416	Q16610	ECM1_HUMAN	extracellular matrix protein 1 isoform 1						angiogenesis|biomineral tissue development|negative regulation of bone mineralization|negative regulation of peptidase activity|ossification|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade	proteinaceous extracellular matrix	laminin binding|protease binding|protein C-terminus binding|signal transducer activity			ovary(2)|central_nervous_system(1)	3	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GTGGAAAGGAGGGAAGAGGCC	0.582													13	47	---	---	---	---	PASS
THEM5	284486	broad.mit.edu	37	1	151820746	151820746	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151820746C>G	uc009wnd.2	-	4	619	c.487G>C	c.(487-489)GCA>CCA	p.A163P		NM_182578	NP_872384	Q8N1Q8	THEM5_HUMAN	thioesterase superfamily member 5	163							hydrolase activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ATCATGGCTGCCAGGGACCCG	0.587													5	33	---	---	---	---	PASS
PLEKHA6	22874	broad.mit.edu	37	1	204236640	204236640	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204236640C>A	uc001hau.2	-	5	560	c.243G>T	c.(241-243)TGG>TGT	p.W81C		NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3	81	PH.									ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CCAGGACGAACCAGCGCTTGT	0.587													11	64	---	---	---	---	PASS
FAM110C	642273	broad.mit.edu	37	2	46063	46063	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46063T>A	uc010yim.1	-	1	323	c.323A>T	c.(322-324)GAA>GTA	p.E108V		NM_001077710	NP_001071178	Q1W6H9	F110C_HUMAN	hypothetical protein LOC642273	108						microtubule|microtubule organizing center|spindle pole					0	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00221)		all cancers(51;0.000815)|Epithelial(75;0.00379)|OV - Ovarian serous cystadenocarcinoma(76;0.0127)|GBM - Glioblastoma multiforme(21;0.232)		TCGCACGAATTCGCATTTCTG	0.537													4	8	---	---	---	---	PASS
CLIP4	79745	broad.mit.edu	37	2	29383247	29383247	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29383247G>A	uc002rmv.2	+	12	1687	c.1448G>A	c.(1447-1449)GGG>GAG	p.G483E	CLIP4_uc002rmu.2_Missense_Mutation_p.G483E|CLIP4_uc010ezm.1_Missense_Mutation_p.G483E|CLIP4_uc002rmw.2_RNA	NM_024692	NP_078968	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family,	483										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					CGTTGCGAGGGGGAACTCCGC	0.498													5	189	---	---	---	---	PASS
TMEM163	81615	broad.mit.edu	37	2	135308182	135308182	+	Nonsense_Mutation	SNP	G	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135308182G>T	uc002ttx.2	-	4	483	c.417C>A	c.(415-417)TAC>TAA	p.Y139*	TMEM163_uc002tty.2_RNA	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163	139						integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		CCGCGTTGCTGTAACGCCACA	0.522													6	95	---	---	---	---	PASS
ITGB6	3694	broad.mit.edu	37	2	161052806	161052806	+	Silent	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161052806A>G	uc002ubh.2	-	3	283	c.267T>C	c.(265-267)CCT>CCC	p.P89P	ITGB6_uc010fow.1_RNA|ITGB6_uc010fou.2_Silent_p.P89P|ITGB6_uc010zcq.1_Silent_p.P47P|ITGB6_uc010fov.1_Silent_p.P89P	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor	89	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						CTACACTGAGAGGCTTATTTT	0.403													6	328	---	---	---	---	PASS
BZW1	9689	broad.mit.edu	37	2	201683585	201683585	+	Silent	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201683585A>G	uc010zhg.1	+	9	1075	c.1023A>G	c.(1021-1023)AAA>AAG	p.K341K	BZW1_uc002uwc.2_Intron	NM_014670	NP_055485	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1	309	W2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	protein binding				0						GGAACAAAAAAGAGGAGCTTG	0.408													5	116	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210565063	210565063	+	Splice_Site	SNP	G	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210565063G>T	uc002vde.1	+	10	4832	c.4584_splice	c.e10+1	p.S1528_splice	MAP2_uc002vdd.1_Splice_Site_p.S172_splice|MAP2_uc002vdf.1_Splice_Site_p.S172_splice|MAP2_uc002vdg.1_Splice_Site_p.S172_splice|MAP2_uc002vdh.1_Splice_Site_p.S172_splice|MAP2_uc002vdi.1_Splice_Site_p.S1524_splice	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1						central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	CAAAGTCTCTGTGAGTAAAAT	0.348													9	233	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225661855	225661855	+	Silent	SNP	T	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225661855T>A	uc010fwz.1	-	43	4892	c.4653A>T	c.(4651-4653)TCA>TCT	p.S1551S	DOCK10_uc002vob.2_Silent_p.S1545S|DOCK10_uc002voa.2_Silent_p.S207S|DOCK10_uc002voc.2_Silent_p.S405S	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1551							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GAAAGAACGCTGAAGGAAACT	0.443													9	120	---	---	---	---	PASS
PER2	8864	broad.mit.edu	37	2	239181739	239181739	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239181739A>T	uc002vyc.2	-	5	779	c.542T>A	c.(541-543)GTT>GAT	p.V181D	PER2_uc010znv.1_Missense_Mutation_p.V181D|PER2_uc010znw.1_Missense_Mutation_p.V181D|PER2_uc010fyx.1_Missense_Mutation_p.V181D	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2	181	PAS 1.				circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CTCAGAGGTAACGCTCTCCAT	0.542													13	56	---	---	---	---	PASS
ITIH4	3700	broad.mit.edu	37	3	52858939	52858939	+	Silent	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52858939G>A	uc003dfz.2	-	7	831	c.795C>T	c.(793-795)CCC>CCT	p.P265P	ITIH4_uc011bel.1_5'UTR|ITIH4_uc003dfy.2_Silent_p.P129P|ITIH4_uc011bem.1_Silent_p.P265P|ITIH4_uc011ben.1_Silent_p.P265P	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	265					acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TTAGGCCCTCGGGGGCAAAGT	0.557													17	58	---	---	---	---	PASS
LRTM1	57408	broad.mit.edu	37	3	54952623	54952623	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54952623G>C	uc003dhl.2	-	3	1035	c.901C>G	c.(901-903)CTC>GTC	p.L301V	CACNA2D3_uc003dhf.2_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	NM_020678	NP_065729	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	301	Helical; (Potential).					integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		AACATCATGAGACACACAATC	0.557													5	75	---	---	---	---	PASS
CRYBG3	131544	broad.mit.edu	37	3	97617802	97617802	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97617802G>A	uc003drx.2	+	10	1997	c.1933G>A	c.(1933-1935)GAA>AAA	p.E645K		NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0						TACAAATCAGGAAATTTCTGA	0.343													8	200	---	---	---	---	PASS
BOC	91653	broad.mit.edu	37	3	112993348	112993348	+	Nonsense_Mutation	SNP	C	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112993348C>G	uc003dzx.2	+	9	1982	c.1361C>G	c.(1360-1362)TCA>TGA	p.S454*	BOC_uc003dzy.2_Nonsense_Mutation_p.S454*|BOC_uc003dzz.2_Nonsense_Mutation_p.S454*|BOC_uc003eab.2_Nonsense_Mutation_p.S155*	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	454	Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			CCCCCAACGTCAGTGGGGCCT	0.667													4	14	---	---	---	---	PASS
TF	7018	broad.mit.edu	37	3	133486879	133486879	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133486879T>C	uc003epu.1	+	18	3221	c.1493T>C	c.(1492-1494)TTT>TCT	p.F498S	TF_uc011blt.1_Missense_Mutation_p.F371S|TF_uc003epw.1_Intron|TF_uc003epv.1_Missense_Mutation_p.F498S	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	498	Transferrin-like 2.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	ACAGATGAATTTTTCAGTGAA	0.453													6	165	---	---	---	---	PASS
TRPC1	7220	broad.mit.edu	37	3	142509917	142509917	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142509917G>C	uc003evc.2	+	8	1490	c.1354G>C	c.(1354-1356)GAA>CAA	p.E452Q	TRPC1_uc003evb.2_Missense_Mutation_p.E418Q|TRPC1_uc011bni.1_Missense_Mutation_p.E19Q	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	452	Cytoplasmic (Potential).				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						AGACTTTTTAGAAGAATCTCG	0.353													21	525	---	---	---	---	PASS
EIF2A	83939	broad.mit.edu	37	3	150264607	150264607	+	Silent	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150264607G>C	uc003eya.2	+	1	34	c.18G>C	c.(16-18)CCG>CCC	p.P6P	SERP1_uc003exy.2_5'Flank|SERP1_uc003exz.2_RNA|EIF2A_uc003eyb.2_5'UTR|EIF2A_uc003eyc.2_5'UTR|EIF2A_uc011bnv.1_Silent_p.P6P|EIF2A_uc011bnw.1_Silent_p.P6P	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A	6					regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CGTCCACGCCGCTCTTGACAG	0.562													12	97	---	---	---	---	PASS
C3orf70	285382	broad.mit.edu	37	3	184801259	184801259	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184801259T>C	uc003fpd.2	-	2	480	c.289A>G	c.(289-291)ATC>GTC	p.I97V		NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382	97											0						GAGACTGAGATCTGAATGGTG	0.498													20	76	---	---	---	---	PASS
TEC	7006	broad.mit.edu	37	4	48165756	48165756	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48165756C>T	uc003gxz.2	-	8	791	c.700G>A	c.(700-702)GTA>ATA	p.V234I		NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase	234	SH3.				intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						TTTCCCGTTACGTAATTACTT	0.279													9	213	---	---	---	---	PASS
COPS4	51138	broad.mit.edu	37	4	83978547	83978547	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83978547T>C	uc003hoa.2	+	6	840	c.701T>C	c.(700-702)ATC>ACC	p.I234T	COPS4_uc003hob.2_Missense_Mutation_p.I234T|COPS4_uc010ijw.2_Missense_Mutation_p.I234T|COPS4_uc010ijx.2_Missense_Mutation_p.I234T	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	234	PCI.				cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				CACTGTACGATCTTAGCATCA	0.358													5	114	---	---	---	---	PASS
QRFPR	84109	broad.mit.edu	37	4	122250674	122250674	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122250674T>C	uc010inj.1	-	6	1470	c.1091A>G	c.(1090-1092)AAT>AGT	p.N364S	QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_3'UTR	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	364	Cytoplasmic (Potential).					plasma membrane	neuropeptide Y receptor activity				0						AATTCCTGAATTTCCATGCCT	0.368													61	294	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89949314	89949314	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89949314T>C	uc003kju.2	+	20	4019	c.3923T>C	c.(3922-3924)TTC>TCC	p.F1308S	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1308	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTTGGAATTTTCCCCACCACC	0.483													13	245	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140712672	140712672	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712672G>C	uc003lji.1	+	1	2421	c.2421G>C	c.(2419-2421)CAG>CAC	p.Q807H	PCDHGA1_uc011dan.1_Missense_Mutation_p.Q807H	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	807	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATTTTCTCAGGTAAACTTTT	0.388													11	83	---	---	---	---	PASS
TUBB	203068	broad.mit.edu	37	6	30688176	30688176	+	5'UTR	SNP	T	C	C	rs11546740		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30688176T>C	uc003nrl.2	+	1					MDC1_uc003nrg.3_5'Flank|TUBB_uc003nrk.1_5'UTR|TUBB_uc011dmq.1_5'Flank	NM_178014	NP_821133	P07437	TBB5_HUMAN	tubulin, beta						cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding			ovary(1)	1					Colchicine(DB01394)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	TGCTCCAGCCTCTGGGGCGCA	0.567													5	21	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38919159	38919159	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38919159A>G	uc003ooe.1	+	80	12263	c.11663A>G	c.(11662-11664)AAG>AGG	p.K3888R	DNAH8_uc003oog.1_Missense_Mutation_p.K337R|uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TTGGAGGAGAAGTACACAGAA	0.418													5	152	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56506875	56506875	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56506875C>T	uc003pdf.2	-	16	1826	c.1798G>A	c.(1798-1800)GTG>ATG	p.V600M	DST_uc003pcz.3_Missense_Mutation_p.V422M|DST_uc011dxj.1_Missense_Mutation_p.V451M|DST_uc011dxk.1_Missense_Mutation_p.V462M|DST_uc011dxl.1_Missense_Mutation_p.V451M|DST_uc003pcy.3_Missense_Mutation_p.V96M|DST_uc003pdb.2_Missense_Mutation_p.V96M|DST_uc003pdc.3_Missense_Mutation_p.V96M|DST_uc003pdd.3_Missense_Mutation_p.V96M|DST_uc003pde.2_Missense_Mutation_p.V538M	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	422					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGAAACTGCACTCCTGATTCT	0.308													35	167	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142575085	142575085	+	Intron	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142575085G>C	uc003wbx.1	-						TRPV6_uc003wbw.1_5'Flank|TRPV6_uc010lou.1_5'UTR	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,						regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					TCCTGCAGGGGGTCCCTCCCA	0.602													6	25	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113392679	113392679	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113392679G>A	uc003ynu.2	-	38	6197	c.6038C>T	c.(6037-6039)ACA>ATA	p.T2013I	CSMD3_uc003yns.2_Missense_Mutation_p.T1215I|CSMD3_uc003ynt.2_Missense_Mutation_p.T1973I|CSMD3_uc011lhx.1_Missense_Mutation_p.T1909I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2013	Extracellular (Potential).|CUB 11.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATGGGGTATTGTTGTTCCTGA	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			25	108	---	---	---	---	PASS
FAM83H	286077	broad.mit.edu	37	8	144810219	144810219	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144810219C>T	uc003yzk.2	-	5	1481	c.1412G>A	c.(1411-1413)GGC>GAC	p.G471D	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	471					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CTCGAACAGGCCTTGCGGGCG	0.716													4	6	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84531514	84531514	+	3'UTR	SNP	C	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84531514C>A	uc011lst.1	+	4						NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						CCATTTGGAGCAAAAATATGT	0.468													9	72	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12077198	12077198	+	Silent	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12077198T>C	uc001ila.2	-	1	699	c.225A>G	c.(223-225)AAA>AAG	p.K75K	UPF2_uc001ilb.2_Silent_p.K75K|UPF2_uc001ilc.2_Silent_p.K75K|UPF2_uc009xiz.1_Silent_p.K75K	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	75	Potential.|Glu/Lys-rich.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				TTTCTTCGTCTTTTTTCTTGC	0.318													9	618	---	---	---	---	PASS
TLL2	7093	broad.mit.edu	37	10	98133425	98133425	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98133425T>G	uc001kml.1	-	19	2816	c.2590A>C	c.(2590-2592)AGC>CGC	p.S864R		NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	864	CUB 4.				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		AACATACTGCTGCCGGAAGCC	0.587													7	55	---	---	---	---	PASS
ABCC2	1244	broad.mit.edu	37	10	101552068	101552068	+	Silent	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101552068A>G	uc001kqf.2	+	3	424	c.285A>G	c.(283-285)ACA>ACG	p.T95T		NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),	95	Helical; Name=3; (By similarity).					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	GACAAGCCACAGTCCCTGCTG	0.468													23	94	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105948060	105948060	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105948060T>C	uc001kxw.2	-	13	1771	c.1655A>G	c.(1654-1656)GAG>GGG	p.E552G	C10orf79_uc009xxq.2_5'Flank|C10orf79_uc001kxx.3_Missense_Mutation_p.E553G	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	552											0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		TGTGAACATCTCCAACCTGCT	0.433													6	148	---	---	---	---	PASS
TRIM21	6737	broad.mit.edu	37	11	4411235	4411235	+	Silent	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4411235G>A	uc001lyy.1	-	2	518	c.405C>T	c.(403-405)TAC>TAT	p.Y135Y		NM_003141	NP_003132	P19474	RO52_HUMAN	tripartite motif protein 21	135	Potential.				cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein deubiquitination|positive regulation of cell cycle|protein autoubiquitination|protein destabilization|protein monoubiquitination|protein polyubiquitination|protein trimerization	cytoplasmic mRNA processing body|nucleus	DNA binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		GCCTCACCTGGTACTCCTGTG	0.562													18	51	---	---	---	---	PASS
OR51B4	79339	broad.mit.edu	37	11	5322438	5322438	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5322438C>G	uc010qza.1	-	1	739	c.739G>C	c.(739-741)GTA>CTA	p.V247L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033179	NP_149419	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B,	247	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGTGAAATACTAGGACACAG	0.428													15	68	---	---	---	---	PASS
SAA4	6291	broad.mit.edu	37	11	18257405	18257405	+	Silent	SNP	C	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18257405C>G	uc001mny.2	-	2	165	c.69G>C	c.(67-69)TCG>TCC	p.S23S		NM_006512	NP_006503	P35542	SAA4_HUMAN	serum amyloid A4, constitutive precursor	23					acute-phase response	high-density lipoprotein particle					0						CCTTGAAAAACGAACGCCAGC	0.507													6	123	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64111336	64111336	+	Silent	SNP	C	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64111336C>A	uc001nzy.2	+	13	1449	c.1405C>A	c.(1405-1407)CGG>AGG	p.R469R	CCDC88B_uc009ypo.1_Silent_p.R466R|CCDC88B_uc001nzz.1_Silent_p.R118R	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88	469	Potential.				microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						GAGGGAGAACCGGGAGCTTCG	0.687													10	38	---	---	---	---	PASS
OR2AT4	341152	broad.mit.edu	37	11	74800063	74800063	+	Silent	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74800063G>C	uc010rro.1	-	1	696	c.696C>G	c.(694-696)CGC>CGG	p.R232R		NM_001005285	NP_001005285	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GGGAACTGATGCGAAGCACTG	0.577													4	52	---	---	---	---	PASS
UBE4A	9354	broad.mit.edu	37	11	118244313	118244313	+	Silent	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118244313G>A	uc001psw.2	+	8	1158	c.1029G>A	c.(1027-1029)CCG>CCA	p.P343P	UBE4A_uc001psv.2_Silent_p.P350P	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A	343					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TAAAGACTCCGGGTGTTGTAG	0.453													7	311	---	---	---	---	PASS
TXNRD1	7296	broad.mit.edu	37	12	104725379	104725379	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104725379A>G	uc010swk.1	+	14	1632	c.1610A>G	c.(1609-1611)GAG>GGG	p.E537G	TXNRD1_uc010swl.1_Missense_Mutation_p.E387G|TXNRD1_uc010swm.1_Missense_Mutation_p.E439G|TXNRD1_uc010swn.1_Missense_Mutation_p.E387G|TXNRD1_uc010swo.1_Missense_Mutation_p.E387G|TXNRD1_uc010swp.1_Missense_Mutation_p.E349G|TXNRD1_uc010swq.1_Missense_Mutation_p.E437G|TXNRD1_uc001tku.2_RNA|TXNRD1_uc009zun.2_Missense_Mutation_p.E453G	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3	537					cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						GGCCTTTCTGAGGAGAAAGCT	0.333													6	261	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122825412	122825412	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122825412C>T	uc001ucg.1	-	10	2445	c.2339G>A	c.(2338-2340)CGG>CAG	p.R780Q	CLIP1_uc001uch.1_Missense_Mutation_p.R769Q|CLIP1_uc001uci.1_Missense_Mutation_p.R734Q|CLIP1_uc001ucj.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	780	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		ACTGGCTTTCCGAAGTGCATC	0.393													5	305	---	---	---	---	PASS
DHRS12	79758	broad.mit.edu	37	13	52351216	52351216	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52351216T>C	uc001vfq.2	-	6	538	c.490A>G	c.(490-492)AAA>GAA	p.K164E	DHRS12_uc001vfr.1_Missense_Mutation_p.K115E|DHRS12_uc001vfs.1_Missense_Mutation_p.K115E			A0PJE2	DHR12_HUMAN	RecName: Full=Dehydrogenase/reductase SDR family member 12;          EC=1.1.-.-;	164							binding|oxidoreductase activity				0		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		TCGTGTTCTTTCTCCAGCACA	0.562													5	110	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109562498	109562498	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109562498G>T	uc001vqt.1	+	16	1985	c.1859G>T	c.(1858-1860)CGG>CTG	p.R620L	MYO16_uc010agk.1_Missense_Mutation_p.R642L|MYO16_uc001vqu.1_Missense_Mutation_p.R420L|MYO16_uc010tjh.1_Missense_Mutation_p.R132L	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	620	Myosin head-like 1.				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGTGCACACCGGTGAGTGACT	0.343													4	132	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71462632	71462632	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71462632C>G	uc001xmo.2	+	8	3065	c.2619C>G	c.(2617-2619)CAC>CAG	p.H873Q	PCNX_uc001xmn.3_Intron|PCNX_uc010are.1_Intron	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	873						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GCAGTTTGCACGATGAACTTG	0.433													11	116	---	---	---	---	PASS
CHRFAM7A	89832	broad.mit.edu	37	15	30665422	30665422	+	Intron	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30665422T>C	uc001zdt.1	-						DKFZP434L187_uc001zds.2_RNA|CHRFAM7A_uc001zdu.1_Intron|CHRFAM7A_uc010azn.2_Intron|CHRFAM7A_uc001zdv.2_RNA	NM_139320	NP_647536	Q494W8	CRFM7_HUMAN	CHRNA7-FAM7A fusion isoform 1							integral to membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity			skin(1)	1		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		AGCAGTTCCTTCAGCCGGTTC	0.458													8	68	---	---	---	---	PASS
NUSAP1	51203	broad.mit.edu	37	15	41668015	41668015	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41668015A>G	uc001zns.3	+	9	1342	c.1112A>G	c.(1111-1113)GAA>GGA	p.E371G	NUSAP1_uc001znq.3_Intron|NUSAP1_uc001znr.3_Missense_Mutation_p.E370G|NUSAP1_uc010bce.2_Intron|NUSAP1_uc001znt.3_Missense_Mutation_p.E356G|NUSAP1_uc001znv.3_Missense_Mutation_p.E369G|NUSAP1_uc001znu.3_Missense_Mutation_p.E370G|NUSAP1_uc010ucw.1_Intron|NUSAP1_uc001znw.3_Missense_Mutation_p.E175G	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	371	Interaction with microtubules (By similarity).				cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CTCAACTATGAACCACACAAA	0.418													8	325	---	---	---	---	PASS
KIAA0430	9665	broad.mit.edu	37	16	15728972	15728972	+	Intron	SNP	C	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15728972C>A	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron|KIAA0430_uc010uzx.1_3'UTR	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1							peroxisome	nucleotide binding|RNA binding				0						AATTCATTTCCAGAAGTGACT	0.368													3	17	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16235190	16235190	+	3'UTR	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16235190C>T	uc010bvi.2	+	31					ABCC1_uc010bvj.2_3'UTR|ABCC1_uc010bvk.2_3'UTR|ABCC1_uc010bvl.2_3'UTR|ABCC1_uc010bvm.2_3'UTR|ABCC1_uc002del.3_3'UTR	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	ATGCCAGCGCCCAGGGAGGAG	0.527													5	27	---	---	---	---	PASS
PAFAH1B1	5048	broad.mit.edu	37	17	2570313	2570313	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2570313G>A	uc002fuw.3	+	5	788	c.220G>A	c.(220-222)GAA>AAA	p.E74K	PAFAH1B1_uc010ckb.1_RNA	NM_000430	NP_000421	P43034	LIS1_HUMAN	platelet-activating factor acetylhydrolase,	74	Interaction with NDEL1 (By similarity).|Potential.				acrosome assembly|actin cytoskeleton organization|adult locomotory behavior|brain morphogenesis|corpus callosum morphogenesis|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|hippocampus development|layer formation in cerebral cortex|learning or memory|lipid catabolic process|microtubule organizing center organization|mitotic prometaphase|neuroblast proliferation|neuromuscular process controlling balance|neuron migration|platelet activating factor metabolic process|regulation of Rho GTPase activity|retrograde axon cargo transport|synaptic transmission|vesicle transport along microtubule	astral microtubule|cell cortex|centrosome|cytosol|kinetochore|motile primary cilium|nuclear membrane|perinuclear region of cytoplasm	dynactin binding|heparin binding|microtubule binding|phospholipase binding|phosphoprotein binding|protein homodimerization activity			skin(1)	1						AAAGCTAAATGAAGCAAAAGA	0.368													19	82	---	---	---	---	PASS
MED24	9862	broad.mit.edu	37	17	38182523	38182523	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38182523A>C	uc002htt.2	-	19	2184	c.1871T>G	c.(1870-1872)CTT>CGT	p.L624R	MED24_uc010wer.1_5'Flank|MED24_uc010wes.1_Missense_Mutation_p.L484R|MED24_uc010wet.1_Intron|MED24_uc002hts.2_Missense_Mutation_p.L649R|MED24_uc002htu.2_Missense_Mutation_p.L611R|MED24_uc010cwn.2_Missense_Mutation_p.L611R|MED24_uc010weu.1_Missense_Mutation_p.L534R|MED24_uc010wev.1_Missense_Mutation_p.L574R|MED24_uc010wew.1_Missense_Mutation_p.L565R|SNORD124_uc010wey.1_5'Flank	NM_014815	NP_055630	O75448	MED24_HUMAN	mediator complex subunit 24 isoform 1	624					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1	Colorectal(19;0.000442)					GTGGGCCACAAGCCAAGCCAC	0.562													14	61	---	---	---	---	PASS
STAT5B	6777	broad.mit.edu	37	17	40371847	40371847	+	Silent	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40371847C>T	uc002hzh.2	-	6	733	c.564G>A	c.(562-564)CCG>CCA	p.P188P	STAT5B_uc002hzi.3_Silent_p.P188P	NM_012448	NP_036580	P51692	STA5B_HUMAN	signal transducer and activator of transcription	188					2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity			ovary(3)|lung(2)|skin(1)	6		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	GCTGGGCCAGCGGGCCAAACT	0.642													11	36	---	---	---	---	PASS
ST6GALNAC1	55808	broad.mit.edu	37	17	74622132	74622132	+	Silent	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74622132C>T	uc002jsh.2	-	7	1635	c.1461G>A	c.(1459-1461)AGG>AGA	p.R487R	ST6GALNAC1_uc002jsi.2_Silent_p.R355R|ST6GALNAC1_uc002jsj.2_RNA	NM_018414	NP_060884	Q9NSC7	SIA7A_HUMAN	sialyltransferase 7A	487	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity				0						GCAACAGGTACCTGTCCATGT	0.557													33	123	---	---	---	---	PASS
SF3A2	8175	broad.mit.edu	37	19	2245452	2245452	+	Silent	SNP	C	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2245452C>A	uc002lvg.2	+	5	375	c.253C>A	c.(253-255)CGA>AGA	p.R85R		NM_007165	NP_009096	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2	85					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex	nucleic acid binding|zinc ion binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGGCCCGGCGAGCAGCCAA	0.667													6	21	---	---	---	---	PASS
CHAF1A	10036	broad.mit.edu	37	19	4433326	4433326	+	Silent	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4433326C>T	uc002mal.2	+	13	2563	c.2463C>T	c.(2461-2463)CAC>CAT	p.H821H		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	821	Binds to p60.				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTACGTGCACCCGCAGGTGC	0.612								Chromatin_Structure					7	24	---	---	---	---	PASS
GRIK5	2901	broad.mit.edu	37	19	42507514	42507514	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42507514C>A	uc002osj.1	-	18	2519	c.2484G>T	c.(2482-2484)TGG>TGT	p.W828C	GRIK5_uc002osi.1_Missense_Mutation_p.W400C	NM_002088	NP_002079	Q16478	GRIK5_HUMAN	glutamate receptor KA2 precursor	828	Cytoplasmic (Potential).					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity				0		Prostate(69;0.059)			L-Glutamic Acid(DB00142)	TCCGTGTGGACCATATGAATT	0.587													16	83	---	---	---	---	PASS
ZSCAN22	342945	broad.mit.edu	37	19	58846167	58846167	+	5'UTR	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58846167C>T	uc002qsc.2	+	2					ZSCAN22_uc010yhz.1_5'UTR	NM_181846	NP_862829	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CACTGCTGCCCGATGGCCATC	0.607													3	27	---	---	---	---	PASS
SIRPA	140885	broad.mit.edu	37	20	1902301	1902301	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1902301G>A	uc002wfq.2	+	4	1057	c.697G>A	c.(697-699)GTC>ATC	p.V233I	SIRPA_uc010zps.1_Missense_Mutation_p.V213I|SIRPA_uc002wfr.2_Missense_Mutation_p.V233I|SIRPA_uc002wfs.2_Missense_Mutation_p.V233I|SIRPA_uc002wft.2_Missense_Mutation_p.V233I	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	233	Ig-like C1-type 1.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GGTGGCCCACGTCACCTTGCA	0.617													9	87	---	---	---	---	PASS
COX4I2	84701	broad.mit.edu	37	20	30231285	30231285	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30231285T>C	uc002wwj.1	+	4	401	c.326T>C	c.(325-327)GTC>GCC	p.V109A	COX4I2_uc002wwi.2_Missense_Mutation_p.V109A	NM_032609	NP_115998	Q96KJ9	COX42_HUMAN	cytochrome c oxidase subunit IV isoform 2	109					cellular respiration		cytochrome-c oxidase activity			ovary(1)	1	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.01e-05)|all cancers(5;9.46e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00121)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			ATGGGTTGTGTCTTCTTCTTC	0.562													6	203	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11098827	11098827	+	5'UTR	SNP	C	T	T	rs79274499	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11098827C>T	uc002yit.1	-	1					BAGE_uc002yix.2_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccatccagagcgagacgagcc	0.000													6	16	---	---	---	---	PASS
ABCG1	9619	broad.mit.edu	37	21	43708059	43708059	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43708059G>A	uc002zaq.2	+	9	1140	c.1034G>A	c.(1033-1035)CGG>CAG	p.R345Q	ABCG1_uc002zan.2_Missense_Mutation_p.R347Q|ABCG1_uc002zam.2_Missense_Mutation_p.R323Q|ABCG1_uc002zao.2_Missense_Mutation_p.R342Q|ABCG1_uc002zap.2_Missense_Mutation_p.R345Q|ABCG1_uc002zar.2_Missense_Mutation_p.R356Q|ABCG1_uc011aev.1_Missense_Mutation_p.R356Q|ABCG1_uc010gpb.1_5'UTR	NM_004915	NP_004906	P45844	ABCG1_HUMAN	ATP-binding cassette sub-family G member 1	345	Cytoplasmic (Potential).				amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)	AGAGCGGTTCGGGAGGGCATG	0.602													4	95	---	---	---	---	PASS
CARD10	29775	broad.mit.edu	37	22	37893039	37893039	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37893039A>G	uc003asx.1	-	12	1937	c.1934T>C	c.(1933-1935)ATG>ACG	p.M645T	CARD10_uc003ast.1_RNA|CARD10_uc003asv.1_5'Flank|CARD10_uc011ank.1_5'Flank|CARD10_uc003asw.1_Missense_Mutation_p.M359T|CARD10_uc003asy.1_Missense_Mutation_p.M645T	NM_014550	NP_055365	Q9BWT7	CAR10_HUMAN	caspase recruitment domain protein 10	645					activation of NF-kappaB-inducing kinase activity|protein complex assembly|regulation of apoptosis	CBM complex	receptor signaling complex scaffold activity			upper_aerodigestive_tract(1)|lung(1)|breast(1)|ovary(1)|prostate(1)|kidney(1)	6	Melanoma(58;0.0574)					TCTTGGTTCCATCCTGGCGGA	0.607													16	46	---	---	---	---	PASS
PLA2G6	8398	broad.mit.edu	37	22	38516843	38516843	+	Silent	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38516843G>A	uc003auy.1	-	12	1801	c.1665C>T	c.(1663-1665)TAC>TAT	p.Y555Y	PLA2G6_uc003auz.1_Silent_p.Y501Y|PLA2G6_uc003ava.1_Silent_p.Y555Y|PLA2G6_uc003avb.2_Silent_p.Y501Y|PLA2G6_uc010gxk.1_RNA	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a	555					cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	GCCCCGACTCGTAGGGCCTGG	0.617													3	18	---	---	---	---	PASS
MAGED1	9500	broad.mit.edu	37	X	51638670	51638670	+	Silent	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51638670G>A	uc004dpm.2	+	3	662	c.567G>A	c.(565-567)AAG>AAA	p.K189K	MAGED1_uc004dpn.2_Silent_p.K245K|MAGED1_uc004dpo.2_Silent_p.K189K	NM_001005332	NP_001005332	Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1 isoform b	189					apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding			ovary(3)	3	Ovarian(276;0.236)					ATACCACTAAGGCCCCAACAG	0.517										Multiple Myeloma(10;0.10)			26	106	---	---	---	---	PASS
KLF8	11279	broad.mit.edu	37	X	56295819	56295819	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56295819G>C	uc004dur.2	+	4	1601	c.655G>C	c.(655-657)GAC>CAC	p.D219H	KLF8_uc010nkg.2_3'UTR|KLF8_uc011mop.1_Missense_Mutation_p.D219H|KLF8_uc010nkh.2_RNA	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1	219					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AGTGAAAGTTGACCCCACCTC	0.463													27	118	---	---	---	---	PASS
DACH2	117154	broad.mit.edu	37	X	86069820	86069820	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86069820G>T	uc004eew.2	+	10	1837	c.1667G>T	c.(1666-1668)GGC>GTC	p.G556V	DACH2_uc004eex.2_Missense_Mutation_p.G543V|DACH2_uc010nmq.2_Missense_Mutation_p.G422V|DACH2_uc011mra.1_Missense_Mutation_p.G389V|DACH2_uc010nmr.2_Missense_Mutation_p.G337V|DACH2_uc004eey.2_Missense_Mutation_p.G249V|DACH2_uc004eez.2_Missense_Mutation_p.G239V	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	556					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						AGTGACAGTGGCCTGAGGATG	0.363													14	168	---	---	---	---	PASS
OR13H1	347468	broad.mit.edu	37	X	130678248	130678248	+	Silent	SNP	T	C	C			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130678248T>C	uc011muw.1	+	1	201	c.201T>C	c.(199-201)TCT>TCC	p.S67S	IGSF1_uc004ewf.2_Intron	NM_001004486	NP_001004486	Q8NG92	O13H1_HUMAN	olfactory receptor, family 13, subfamily H,	67	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Acute lymphoblastic leukemia(192;0.000636)					GTAACCTGTCTTTCTTAGACC	0.438													6	221	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135429669	135429669	+	Silent	SNP	C	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135429669C>T	uc004ezu.1	+	6	4095	c.3804C>T	c.(3802-3804)ACC>ACT	p.T1268T	GPR112_uc010nsb.1_Silent_p.T1063T|GPR112_uc010nsc.1_Silent_p.T1035T	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1268	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TGGGAAAAACCCCTAGAACTA	0.448													5	146	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140994984	140994984	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994984C>A	uc004fbt.2	+	4	2080	c.1794C>A	c.(1792-1794)AGC>AGA	p.S598R	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	598							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTCAGAGCCCTCCTCAGG	0.582										HNSCC(15;0.026)			5	86	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3003	3003	+	5'Flank	SNP	A	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3003A>G	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		TGTTGGATCAGGACATCCCGA	0.448													45	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13415	13415	+	RNA	SNP	G	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13415G>A	uc004cox.3	+	1		c.1079G>A			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		TCGAAAAATAGGAGGACTACT	0.448													37	55	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10350921	10350921	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10350921delA	uc001aqx.3	+						KIF1B_uc001aqv.3_Intron|KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		actccgtctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
C1orf144	26099	broad.mit.edu	37	1	16694886	16694886	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16694886delC	uc001aym.3	+						C1orf144_uc010ocb.1_Intron|C1orf144_uc001ayi.3_Intron|C1orf144_uc001ayk.3_Intron	NM_001114600	NP_001108072	Q7Z422	CA144_HUMAN	putative MAPK activating protein PM20,PM21												0		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.12e-05)|Kidney(64;0.00018)|KIRC - Kidney renal clear cell carcinoma(64;0.00267)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		GGGAAATTGACCCTGGCAGCA	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25029798	25029799	+	IGR	INS	-	AC	AC			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25029798_25029799insAC								SRRM1 (30027 upstream) : CLIC4 (41961 downstream)																							CCAATACCTAGACACACACACA	0.480													3	3	---	---	---	---	
SFRS4	6429	broad.mit.edu	37	1	29501130	29501130	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29501130delA	uc001bro.2	-						SFRS4_uc010ofy.1_Intron|SFRS4_uc009vtp.2_Intron	NM_005626	NP_005617	Q08170	SRSF4_HUMAN	splicing factor, arginine/serine-rich 4						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding				0		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)		ccaagtttggaaaaaaaAAAG	0.124													2	4	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34053028	34053028	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34053028delA	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTGGGAGAGgagcgttttctg	0.204													7	7	---	---	---	---	
TFAP2E	339488	broad.mit.edu	37	1	36043735	36043738	+	Intron	DEL	TGAA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36043735_36043738delTGAA	uc010ohy.1	+						PSMB2_uc001bzd.1_Intron	NM_178548	NP_848643	Q6VUC0	AP2E_HUMAN	transcription factor AP-2 epsilon (activating							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				gggtgtttgttgaatgaatgagtG	0.441													4	2	---	---	---	---	
STK40	83931	broad.mit.edu	37	1	36808001	36808001	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36808001delG	uc001cak.1	-						STK40_uc001cal.1_Intron|STK40_uc001cam.1_Intron|STK40_uc009vva.1_Intron|STK40_uc001can.1_3'UTR	NM_032017	NP_114406	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40							cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)				TGAGCTCCCTGGGATGGTCTA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	73630712	73630712	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73630712delG								NEGR1 (882307 upstream) : LRRIQ3 (860992 downstream)																							tgtacgcagagaacaaggcca	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	93431571	93431571	+	IGR	DEL	T	-	-	rs11306727		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93431571delT								FAM69A (4492 upstream) : MTF2 (113221 downstream)																							gagttcagaataggtgatgtg	0.000													4	3	---	---	---	---	
LRRC39	127495	broad.mit.edu	37	1	100625161	100625162	+	Intron	DEL	CC	-	-	rs7521791		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100625161_100625162delCC	uc001dsw.1	-						LRRC39_uc001dsx.1_Intron|LRRC39_uc001dsy.1_Intron|LRRC39_uc001dsz.1_Intron	NM_144620	NP_653221	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39											ovary(2)|skin(1)	3		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		tttttcttttcctttttttttt	0.272													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	104825636	104825637	+	IGR	DEL	AC	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104825636_104825637delAC								AMY1A (618464 upstream) : None (None downstream)																							ccctcctggtactgcctgctgc	0.000													4	2	---	---	---	---	
SORT1	6272	broad.mit.edu	37	1	109888137	109888137	+	Intron	DEL	A	-	-	rs112644374		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109888137delA	uc001dxm.1	-						SORT1_uc010ovi.1_Intron	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		actttgtttcaaaaaaaaaaa	0.174													6	3	---	---	---	---	
OVGP1	5016	broad.mit.edu	37	1	111970551	111970552	+	5'Flank	INS	-	CC	CC			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111970551_111970552insCC	uc001eba.2	-						OVGP1_uc001eaz.2_5'Flank|OVGP1_uc010owb.1_5'Flank|OVGP1_uc010owc.1_5'Flank	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor						chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		TCCCTCTCCAACAAAGCAACAG	0.436													7	14	---	---	---	---	
CGN	57530	broad.mit.edu	37	1	151506887	151506887	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151506887delC	uc009wmw.2	+						CGN_uc010pde.1_5'UTR	NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin							myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			cagtgggtttcccctttagag	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152716738	152716738	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152716738delT								C1orf68 (23834 upstream) : KPRP (13768 downstream)																							CACTGATTTCTTTTTTTTTCT	0.418													6	3	---	---	---	---	
UBAP2L	9898	broad.mit.edu	37	1	154215938	154215938	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154215938delT	uc001fep.3	+						UBAP2L_uc009wot.2_Intron|UBAP2L_uc010pek.1_Intron|UBAP2L_uc010pel.1_Intron|UBAP2L_uc010pen.1_Intron	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a						binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GAGAGACttcttttttttttt	0.179													9	4	---	---	---	---	
FLAD1	80308	broad.mit.edu	37	1	154964919	154964919	+	Intron	DEL	A	-	-	rs79704914		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154964919delA	uc001fgf.1	+						FLAD1_uc001fge.1_Intron|FLAD1_uc001fgg.1_Intron|FLAD1_uc001fgh.1_Intron|LENEP_uc001fgi.2_5'Flank	NM_025207	NP_079483	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase isoform						FAD biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|FMN adenylyltransferase activity			ovary(2)|skin(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			actccgtctcaaaaaaaaaaT	0.229													4	2	---	---	---	---	
CRP	1401	broad.mit.edu	37	1	159682250	159682251	+	3'UTR	DEL	GC	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159682250_159682251delGC	uc001ftw.2	-	2					CRP_uc001ftx.1_3'UTR|CRP_uc001fty.1_RNA	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor						acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)	tctccatgtggcaaacaagatg	0.000													4	2	---	---	---	---	
HSD17B7	51478	broad.mit.edu	37	1	162762821	162762822	+	Intron	INS	-	TT	TT	rs59454424		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162762821_162762822insTT	uc001gci.2	+						HSD17B7_uc009wuv.2_Intron	NM_016371	NP_057455	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7						cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	3-keto sterol reductase activity|estradiol 17-beta-dehydrogenase activity			ovary(1)	1	all_hematologic(112;0.115)				NADH(DB00157)	CGttttctttcttttttttttt	0.203													4	2	---	---	---	---	
MFSD4	148808	broad.mit.edu	37	1	205537258	205537258	+	5'Flank	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205537258delG	uc001hcv.3	+						MFSD4_uc010prk.1_5'Flank|MFSD4_uc010prl.1_5'Flank	NM_181644	NP_857595	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				skin(2)|central_nervous_system(1)	3	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CCAGTCTAGAGAATAATCAAC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	208173628	208173628	+	IGR	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208173628delA								CD34 (88945 upstream) : PLXNA2 (21962 downstream)																							AGTGCTGCTTAAAGGCTCAGG	0.483													4	2	---	---	---	---	
EPRS	2058	broad.mit.edu	37	1	220153149	220153149	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220153149delA	uc001hly.1	-							NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase						glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	AATACTATTTACAAGCATTTT	0.264													4	4	---	---	---	---	
DNAH14	127602	broad.mit.edu	37	1	225525299	225525300	+	Intron	INS	-	A	A	rs149594225	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225525299_225525300insA	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1						AACTGTCAGGGAAAAAATAATA	0.386													7	5	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234429149	234429149	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234429149delA	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GAAAACATCCAAAAACAAGGA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16254710	16254710	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16254710delG								MYCN (167582 upstream) : FAM49A (479191 downstream)																							AGTCATTATTGTCAGGCAGGA	0.483													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20808625	20808625	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20808625delT								RHOB (159425 upstream) : HS1BP3 (8939 downstream)																							TTCCTATGCCTCACTCCTGTG	0.517													4	2	---	---	---	---	
SULT6B1	391365	broad.mit.edu	37	2	37421723	37421723	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37421723delT	uc002rpv.2	-						SULT6B1_uc010fae.1_Intron|SULT6B1_uc010faf.1_Intron|SULT6B1_uc002rpw.2_Intron|SULT6B1_uc010fag.1_Intron|uc002rpx.1_5'Flank			Q6IMI4	ST6B1_HUMAN	Homo sapiens sulfotransferase SULT6B1 (SULT6B1) mRNA, partial 5'UTR; alternate transcript.							cytoplasm	sulfotransferase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(82;0.248)				ATCTCCTTCATTGCAAAATTT	0.468													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87069713	87069714	+	Intron	INS	-	T	T	rs149970450	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87069713_87069714insT	uc002srs.3	+						CD8B_uc002srw.2_Intron|CD8B_uc002srx.2_Intron|CD8B_uc002sry.2_Intron|CD8B_uc010fgt.2_Intron|CD8B_uc002srz.2_Intron|CD8B_uc002ssa.2_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						atctaagagaatcacaaattta	0.020													8	4	---	---	---	---	
POU3F3	5455	broad.mit.edu	37	2	105469701	105469701	+	5'Flank	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105469701delG	uc010ywg.1	+						uc002tck.1_5'Flank	NM_006236	NP_006227	P20264	PO3F3_HUMAN	POU class 3 homeobox 3						metanephric ascending thin limb development|metanephric DCT cell differentiation|metanephric macula densa development|metanephric thick ascending limb development|negative regulation of apoptosis|positive regulation of cell proliferation	nucleus	sequence-specific DNA binding			ovary(1)	1						gagggaggaagggagggagag	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106082273	106082273	+	IGR	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106082273delA								FHL2 (27043 upstream) : NCK2 (279081 downstream)																							actccatctcaaaaaaaaaaa	0.050													6	3	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107041829	107041831	+	Intron	DEL	ATG	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107041829_107041831delATG	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						gttaacaataatgatgatgatga	0.128													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	159719300	159719300	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159719300delT								DAPL1 (46806 upstream) : TANC1 (105846 downstream)																							TTTTGTTGTCTTTTTTTTTTC	0.443													4	3	---	---	---	---	
DPP4	1803	broad.mit.edu	37	2	162922761	162922761	+	Intron	DEL	T	-	-	rs3216640		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162922761delT	uc002ubz.2	-						DPP4_uc010fpb.2_Intron|DPP4_uc002uca.1_Intron|DPP4_uc002ucb.1_Intron	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	cctgcgtttcttttttttttt	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	168760721	168760721	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168760721delC								B3GALT1 (33355 upstream) : STK39 (49810 downstream)																							GATTTCTTTTCCTTCACAGGT	0.478													4	2	---	---	---	---	
CCDC141	285025	broad.mit.edu	37	2	179719941	179719941	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179719941delA	uc002unf.1	-							NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141								protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			tatcctaaggaaaAAAAATCA	0.129													6	3	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495222	187495224	+	Intron	DEL	AAA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495222_187495224delAAA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgtgatataaattataatctt	0.089													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	191582756	191582756	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191582756delG								NAB1 (25265 upstream) : GLS (162791 downstream)																							ccacacagatgggaggactgc	0.119													4	2	---	---	---	---	
STAT4	6775	broad.mit.edu	37	2	192009315	192009316	+	Intron	DEL	TG	-	-	rs35327468		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192009315_192009316delTG	uc002usm.1	-						STAT4_uc002usn.1_Intron|STAT4_uc002uso.2_Intron|STAT4_uc002usp.3_Intron	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			gaagcgtgactgggggtaactg	0.084													1	7	---	---	---	---	
DGKD	8527	broad.mit.edu	37	2	234356536	234356536	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234356536delT	uc002vui.1	+						DGKD_uc002vuj.1_Intron|DGKD_uc010fyh.1_Intron|DGKD_uc010fyi.1_Intron	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TTTTAAAATCTCTCACCTAGC	0.517													6	3	---	---	---	---	
LOC152024	152024	broad.mit.edu	37	3	24138699	24138699	+	RNA	DEL	A	-	-	rs114699947	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24138699delA	uc003ccu.3	-	4		c.2049delT								Homo sapiens hypothetical protein LOC152024, mRNA (cDNA clone IMAGE:4829078).												0						TTCATCTTTTACACAGCCCCT	0.418													4	2	---	---	---	---	
PRKAR2A	5576	broad.mit.edu	37	3	48794052	48794052	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48794052delA	uc010hki.1	-						PRKAR2A_uc003cux.1_Intron|PRKAR2A_uc003cuy.1_Intron	NM_004157	NP_004148	P13861	KAP2_HUMAN	cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|membrane fraction	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		TAGGAAAAGGAAAAAAAAAAG	0.204													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70568445	70568445	+	IGR	DEL	T	-	-	rs113432191		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70568445delT								MITF (550959 upstream) : FOXP1 (436292 downstream)																							CATAATGGACTTTTTTTTTGG	0.413													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	80743759	80743760	+	IGR	DEL	CA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80743759_80743760delCA								ROBO1 (926700 upstream) : GBE1 (795090 downstream)																							CAAGCTGTTTCAGTCCAGCCTC	0.426													3	3	---	---	---	---	
GSK3B	2932	broad.mit.edu	37	3	119748921	119748921	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119748921delA	uc003edo.2	-						GSK3B_uc003edn.2_Intron	NM_001146156	NP_001139628	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta isoform 2						axon guidance|epithelial to mesenchymal transition|ER overload response|glycogen metabolic process|hippocampus development|negative regulation of apoptosis|negative regulation of protein binding|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|positive regulation of cell-matrix adhesion|positive regulation of protein complex assembly|positive regulation of protein export from nucleus|positive regulation of Rac GTPase activity|regulation of microtubule-based process|superior temporal gyrus development	Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|nucleus|plasma membrane	ATP binding|beta-catenin binding|NF-kappaB binding|p53 binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|RNA polymerase II transcription factor binding|tau-protein kinase activity|ubiquitin protein ligase binding			lung(2)	2				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	ATCTAGTTGGAAAAAAAAAAT	0.259													4	2	---	---	---	---	
SEC22A	26984	broad.mit.edu	37	3	122927849	122927849	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122927849delC	uc003ege.2	+						SEC22A_uc003egf.2_5'UTR	NM_012430	NP_036562	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0548)		atcatgttggccaggctggtc	0.000													4	2	---	---	---	---	
STAG1	10274	broad.mit.edu	37	3	136468655	136468655	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136468655delT	uc003era.1	-						STAG1_uc003erb.1_Intron|STAG1_uc003erc.1_Intron|STAG1_uc010hua.1_Intron|STAG1_uc003ere.2_Intron	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1						cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						gacaccctgattttagcctga	0.000													6	4	---	---	---	---	
RASA2	5922	broad.mit.edu	37	3	141299674	141299674	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141299674delA	uc003etz.1	+						RASA2_uc010huq.1_Intron|RASA2_uc003eua.1_Intron|RASA2_uc011bnc.1_Intron	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2						intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6						TGAGAACATTAAAAAAAAAAA	0.239													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172123727	172123727	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172123727delT								FNDC3B (5237 upstream) : GHSR (39224 downstream)																							TGCACATACATTTTTTTTTTC	0.383													3	3	---	---	---	---	
GHSR	2693	broad.mit.edu	37	3	172165110	172165111	+	Intron	INS	-	A	A	rs9868459	byFrequency	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172165110_172165111insA	uc003fib.1	-							NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a						actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			agagaaaggagagacaggaaga	0.119													4	3	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173531126	173531126	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173531126delG	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			AACTTCAAGTGGGATCATATA	0.284													4	2	---	---	---	---	
MAP3K13	9175	broad.mit.edu	37	3	185015892	185015892	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185015892delT	uc010hyf.2	+						MAP3K13_uc011brt.1_Intron	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase						activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			AAAGCTGGTATTTTTGAGGCA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185864225	185864225	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185864225delG								ETV5 (37324 upstream) : DGKG (766 downstream)																							tggcggccaaggaagactgtg	0.209													4	2	---	---	---	---	
KNG1	3827	broad.mit.edu	37	3	186432807	186432816	+	5'Flank	DEL	ACACACACAC	-	-	rs112328658		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186432807_186432816delACACACACAC	uc011bsa.1	+						KNG1_uc003fqr.2_5'Flank	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1						blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	acacacacagacacacacacacacacacac	0.333													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7359013	7359013	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7359013delA	uc003gkb.3	+							NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						AAAATCCAATAAAAAATATGA	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	20018010	20018010	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20018010delT								None (None upstream) : SLIT2 (237225 downstream)																							atttcttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	92678094	92678095	+	IGR	DEL	AA	-	-	rs74681648		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92678094_92678095delAA								FAM190A (154725 upstream) : GRID2 (547455 downstream)																							ATTTGGAGCCAAAAAAAAAAAA	0.401													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	155000593	155000594	+	IGR	DEL	CT	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155000593_155000594delCT								SFRP2 (290365 upstream) : DCHS2 (154933 downstream)																							TACCTGTCTGCTACTAGAAAAG	0.396													4	2	---	---	---	---	
GOLPH3	64083	broad.mit.edu	37	5	32135385	32135386	+	Intron	DEL	AC	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32135385_32135386delAC	uc003jhp.1	-							NM_022130	NP_071413	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3						cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding			ovary(1)	1						ggggtttgttaccaccacagct	0.119													7	5	---	---	---	---	
RGNEF	64283	broad.mit.edu	37	5	73121704	73121704	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73121704delA	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		ggagatattgaggggatagtg	0.000													4	2	---	---	---	---	
COL4A3BP	10087	broad.mit.edu	37	5	74675414	74675414	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74675414delT	uc011csu.1	-						COL4A3BP_uc003kds.2_Intron|COL4A3BP_uc003kdt.2_Intron|COL4A3BP_uc003kdu.2_Intron	NM_005713	NP_005704	Q9Y5P4	C43BP_HUMAN	alpha 3 type IV collagen binding protein isoform						ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity			skin(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		AATTAGCATCttttttttttc	0.139													8	4	---	---	---	---	
AP3B1	8546	broad.mit.edu	37	5	77577984	77577984	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77577984delC	uc003kfj.2	-							NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1						endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		gtcaccaccaccaaggtcacc	0.000									Hermansky-Pudlak_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	98034486	98034486	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98034486delC								None (None upstream) : RGMB (70513 downstream)																							AGATTCACTGCCAGGAGGAAG	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135069192	135069192	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135069192delG								LOC340074 (79568 upstream) : LOC153328 (101173 downstream)																							tgcatcaggtgggaggaagaa	0.000													4	2	---	---	---	---	
AFAP1L1	134265	broad.mit.edu	37	5	148693861	148693862	+	Intron	DEL	GC	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148693861_148693862delGC	uc003lqh.2	+						AFAP1L1_uc010jgy.2_Intron|AFAP1L1_uc003lqi.1_5'Flank	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1								protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGTGTGTGTGCACGCACTTGC	0.530													4	2	---	---	---	---	
CSF1R	1436	broad.mit.edu	37	5	149465609	149465610	+	Intron	DEL	TC	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149465609_149465610delTC	uc003lrl.2	-						CSF1R_uc010jhc.2_Intron|CSF1R_uc003lrm.2_Intron|CSF1R_uc011dce.1_Intron|CSF1R_uc011dcf.1_Intron	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor						cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	actgCTCTGGTCTAGTCTATCA	0.094													4	2	---	---	---	---	
SH3PXD2B	285590	broad.mit.edu	37	5	171821317	171821317	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171821317delT	uc003mbr.2	-						SH3PXD2B_uc003mbs.1_Intron	NM_001017995	NP_001017995	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B						adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			agcaacaaaattacacataca	0.000													3	3	---	---	---	---	
BNIP1	662	broad.mit.edu	37	5	172586043	172586043	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172586043delT	uc003mcj.3	+						BNIP1_uc003mci.3_Intron|BNIP1_uc003mck.3_Intron|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1						anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AAATATTGAAttttttttttt	0.075													9	4	---	---	---	---	
RGS14	10636	broad.mit.edu	37	5	176784763	176784764	+	5'Flank	INS	-	GT	GT	rs146347741	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176784763_176784764insGT	uc003mgf.2	+							NM_006480	NP_006471	O43566	RGS14_HUMAN	regulator of G-protein signalling 14						chromosome segregation|long-term memory|long-term synaptic potentiation|negative regulation of ERK1 and ERK2 cascade|negative regulation of MAP kinase activity|negative regulation of synaptic plasticity|nucleocytoplasmic transport|platelet-derived growth factor receptor signaling pathway|positive regulation of neurogenesis|regulation of DNA-dependent transcription in response to stress|regulation of G-protein coupled receptor protein signaling pathway|response to oxidative stress|spindle organization|visual learning|zygote asymmetric cell division	cell junction|centrosome|dendritic spine|microtubule|PML body|postsynaptic density|postsynaptic membrane|spindle pole	GDP-dissociation inhibitor activity|GTPase activator activity|microtubule binding|receptor signaling complex scaffold activity|receptor signaling protein activity			lung(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			tgtgcgtgaacgtgtgtgtgtg	0.455													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6885093	6885093	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6885093delG								LY86 (229877 upstream) : RREB1 (223095 downstream)																							GGAGAGAAAAGGATCCCCCTG	0.557													4	2	---	---	---	---	
LRRC16A	55604	broad.mit.edu	37	6	25489016	25489016	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25489016delT	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						ACCACAATTATTTTTTTTTCT	0.284													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28384241	28384242	+	IGR	INS	-	AA	AA	rs150285247	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28384241_28384242insAA								ZSCAN12 (16697 upstream) : ZSCAN23 (9045 downstream)																							CCACTTTGAGTAAAGAGTCTAA	0.233													0	6	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38897515	38897516	+	Intron	DEL	AG	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38897515_38897516delAG	uc003ooe.1	+						DNAH8_uc003oog.1_Intron|uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						aaattaagaaagagaaagaaag	0.223													6	3	---	---	---	---	
LRRC1	55227	broad.mit.edu	37	6	53675710	53675710	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53675710delG	uc003pcd.1	+							NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CAACGTCTCTGCTCCCCCAGC	0.358													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57284785	57284786	+	Intron	INS	-	T	T	rs11442279		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57284785_57284786insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CTTCATCGAGCTTTTGTGTTTG	0.366													8	5	---	---	---	---	
SENP6	26054	broad.mit.edu	37	6	76331010	76331011	+	Intron	INS	-	GG	GG			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76331010_76331011insGG	uc003pid.3	+						SENP6_uc003pie.3_Intron|SENP6_uc003pic.2_Intron	NM_015571	NP_056386	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6 isoform 1						proteolysis	cytoplasm|nucleus	cysteine-type peptidase activity			breast(2)|urinary_tract(1)|ovary(1)|lung(1)|skin(1)	6		all_hematologic(105;0.189)				ATTATAGCTTTCTAATCTGAGC	0.302													1	5	---	---	---	---	
KIAA1244	57221	broad.mit.edu	37	6	138606890	138606891	+	Intron	INS	-	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138606890_138606891insG	uc003qhu.2	+							NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine						regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GAAGAATAAATACTCCAAAGTG	0.248													7	5	---	---	---	---	
DYNLT1	6993	broad.mit.edu	37	6	159058590	159058592	+	Intron	DEL	CCT	-	-	rs72129355		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159058590_159058592delCCT	uc003qrn.1	-							NM_006519	NP_006510	P63172	DYLT1_HUMAN	dynein, light chain, Tctex-type 1						cell division|establishment of mitotic spindle orientation|intracellular transport of viral proteins in host cell|mitosis|negative regulation of neurogenesis|regulation of G-protein coupled receptor protein signaling pathway	cytoplasmic dynein complex|Golgi apparatus|microtubule|spindle	identical protein binding|motor activity				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;4.02e-18)|BRCA - Breast invasive adenocarcinoma(81;9.53e-06)		TCTGATGGGACCTCCTGTAAGAT	0.355													3	4	---	---	---	---	
PDE10A	10846	broad.mit.edu	37	6	165827848	165827848	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165827848delG	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	ACATGTTTTTGGAAAACAGGA	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169186597	169186598	+	IGR	DEL	GA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169186597_169186598delGA								SMOC2 (117926 upstream) : THBS2 (429278 downstream)																							AAAATGTCTTGAGAGAGAGATT	0.262													4	2	---	---	---	---	
RADIL	55698	broad.mit.edu	37	7	4871523	4871524	+	Intron	INS	-	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4871523_4871524insA	uc003snj.1	-						RADIL_uc003sng.1_Intron|RADIL_uc003sni.1_Intron|RADIL_uc011jwc.1_Intron|RADIL_uc011jwd.1_Intron	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor						cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		caaaacaaaacaaaaacaaaca	0.208													4	2	---	---	---	---	
MACC1	346389	broad.mit.edu	37	7	20231106	20231106	+	Intron	DEL	T	-	-	rs79203841		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20231106delT	uc003sus.3	-						MACC1_uc010kug.2_Intron	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						GATGAGGAGGTGCTGCTCTGT	0.378													1	5	---	---	---	---	
PLEKHA8	84725	broad.mit.edu	37	7	30113605	30113605	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30113605delA	uc003tam.1	+						PLEKHA8_uc003tao.2_Intron|PLEKHA8_uc003tap.1_Intron|PLEKHA8_uc003tan.2_Intron	NM_032639	NP_116028	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A						protein transport	cytoplasm	glycolipid binding|glycolipid transporter activity			breast(3)|ovary(1)	4						ctgtctctttaaaaaaaaaaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	31352626	31352626	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31352626delT								ADCYAP1R1 (206315 upstream) : NEUROD6 (24456 downstream)																							cTGCCCTAACTTTTTTTTTTA	0.224													4	2	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	37248913	37248914	+	Intron	DEL	CT	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37248913_37248914delCT	uc003tfk.1	-						ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						GGCCCCCAACCTCTCTCTCTCC	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46264939	46264939	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46264939delC								IGFBP3 (304068 upstream) : None (None downstream)																							AGAGGAAGTGCCCCAGGGAAT	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47166117	47166118	+	IGR	INS	-	CAGCT	CAGCT	rs150403510	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47166117_47166118insCAGCT								None (None upstream) : TNS3 (148635 downstream)																							CCAGTAGCAGCCCAGCCACCAC	0.376													3	3	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48269743	48269744	+	Intron	INS	-	CA	CA			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48269743_48269744insCA	uc003toq.2	+						ABCA13_uc010kyr.2_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CTGAATTTGACTTTCTACCACT	0.213													4	2	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48269750	48269750	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48269750delC	uc003toq.2	+						ABCA13_uc010kyr.2_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TGACTTTCTACCACTGTTGAC	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	49171765	49171767	+	IGR	DEL	AGG	-	-	rs141158061		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49171765_49171767delAGG								CDC14C (204716 upstream) : VWC2 (641490 downstream)																							TCCACTATTTAGGAGGAGTCTGG	0.438													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56635379	56635382	+	IGR	DEL	AAAC	-	-	rs113452853		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56635379_56635382delAAAC								DKFZp434L192 (70402 upstream) : ZNF479 (551946 downstream)																							AACTGTTAAAAAACAAACAAACAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	66426351	66426352	+	IGR	INS	-	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66426351_66426352insG								C7orf42 (2814 upstream) : SBDS (26338 downstream)																							GAGGGACCCCAGGGGGTGGTCA	0.609													4	2	---	---	---	---	
TYW1	55253	broad.mit.edu	37	7	66520584	66520584	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66520584delA	uc003tvn.2	+						TYW1_uc010lai.2_Intron	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				ggactgtcttaaaaaaaaaaa	0.000													8	4	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	77711054	77711054	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77711054delG	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGTTAAGCATGGGGTAACCTG	0.368													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	106628246	106628246	+	IGR	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106628246delA								PIK3CG (80661 upstream) : PRKAR2B (56932 downstream)																							atttcaaaagaaaaaaaaaaG	0.254													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	117523462	117523463	+	IGR	DEL	AA	-	-	rs112456636		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117523462_117523463delAA								CTTNBP2 (9901 upstream) : NAA38 (300623 downstream)																							CTGTCAAATGaaaaaaaaaaaa	0.243													4	2	---	---	---	---	
KEL	3792	broad.mit.edu	37	7	142654701	142654701	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142654701delT	uc003wcb.2	-							NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					CCAGGCCTACTTCTGTCTTCC	0.299													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	153169757	153169757	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153169757delC								ACTR3B (617294 upstream) : DPP6 (414662 downstream)																							AAACTCAGTTCCGTTCGTGTT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9764823	9764824	+	IGR	DEL	GA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9764823_9764824delGA								MIR124-1 (3841 upstream) : MSRA (147006 downstream)																							gggagagagggagagagagaga	0.450													4	2	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12199198	12199199	+	Intron	DEL	TG	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12199198_12199199delTG	uc011kxp.1	+						uc003wvm.1_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						TGTGTGGATTTGTGTGTGTGTG	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	26767064	26767064	+	IGR	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26767064delA								ADRA1A (44142 upstream) : MIR548H-4 (139306 downstream)																							ACAGGGGCAGAAAAAGGTCAG	0.383													5	3	---	---	---	---	
BAG4	9530	broad.mit.edu	37	8	38065463	38065464	+	Intron	INS	-	GTACCTTAGAT	GTACCTTAGAT	rs141559186	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38065463_38065464insGTACCTTAGAT	uc003xky.1	+						BAG4_uc003xkz.1_Intron	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4						anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				TTTGGCTGAAGGTCATAATCAT	0.302													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	48153907	48153907	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48153907delG								BEYLA (386500 upstream) : KIAA0146 (19635 downstream)																							gggtcagagtggggggggggg	0.114													6	3	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48709150	48709150	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48709150delT	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				TTTTTCTTCAttttttttttt	0.179								NHEJ					6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60938502	60938503	+	IGR	DEL	CA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60938502_60938503delCA								TOX (906735 upstream) : CA8 (162920 downstream)																							gtaaaatggccacacacaccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76542437	76542438	+	IGR	INS	-	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76542437_76542438insT								HNF4G (63378 upstream) : LOC100192378 (980677 downstream)																							gagataaacacttttttttccc	0.000													4	2	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104705861	104705861	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104705861delG	uc003ylp.2	+							NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			cagcccatgtggtgattctgg	0.000										HNSCC(12;0.0054)			4	2	---	---	---	---	
FAM135B	51059	broad.mit.edu	37	8	139412387	139412387	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139412387delC	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GTGCTGGAAGCCCCCACAGCA	0.517										HNSCC(54;0.14)			4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139601386	139601386	+	3'UTR	DEL	A	-	-	rs72284088		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139601386delA	uc003yvd.2	-	65					COL22A1_uc011ljo.1_3'UTR	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			taaaagaaagaaaaaaaaaag	0.328										HNSCC(7;0.00092)			5	5	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139754688	139754689	+	Intron	INS	-	TGG	TGG			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139754688_139754689insTGG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ggtagagttgatgatggtacta	0.000										HNSCC(7;0.00092)			4	2	---	---	---	---	
OPLAH	26873	broad.mit.edu	37	8	145117899	145117900	+	5'Flank	DEL	GG	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145117899_145117900delGG	uc003zar.3	-							NM_017570	NP_060040	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)								5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding				0	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		L-Glutamic Acid(DB00142)	GGCCTCCCTTGGCTGCCCCACC	0.663													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	145943191	145943191	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145943191delC								ARHGAP39 (31997 upstream) : ZNF251 (3104 downstream)																							ggcctgtcttcATGGGGGCTG	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1786446	1786446	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1786446delC								DMRT2 (728893 upstream) : SMARCA2 (228896 downstream)																							gttcatccatccatcactgtg	0.020													4	2	---	---	---	---	
TTC39B	158219	broad.mit.edu	37	9	15250045	15250045	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15250045delA	uc003zlr.1	-						TTC39B_uc011lmp.1_5'UTR|TTC39B_uc010mie.1_Intron|TTC39B_uc011lmq.1_Intron|TTC39B_uc011lmr.1_Intron|TTC39B_uc010mif.1_Intron|TTC39B_uc010mig.1_Intron|TTC39B_uc011lms.1_Intron	NM_152574	NP_689787	Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B								binding			ovary(1)	1						TAGAGCCAACAAAAATCCTCA	0.403													4	2	---	---	---	---	
MELK	9833	broad.mit.edu	37	9	36583452	36583452	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36583452delA	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TATCATGGTTAAAAAAAAAAA	0.284													7	4	---	---	---	---	
PAX5	5079	broad.mit.edu	37	9	36962223	36962224	+	Intron	INS	-	A	A	rs151228835	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36962223_36962224insA	uc003zzo.1	-						PAX5_uc011lpt.1_Intron|PAX5_uc011lpu.1_Intron|PAX5_uc011lpv.1_Intron|PAX5_uc011lpw.1_Intron|PAX5_uc011lpx.1_Intron|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Intron|PAX5_uc011lpz.1_Intron|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_Intron|PAX5_uc011lqb.1_Intron|PAX5_uc010mlo.1_Intron|PAX5_uc010mlp.1_Intron|PAX5_uc011lqc.1_Intron|PAX5_uc010mlr.1_Intron	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5						cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(19)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		GAGAGTTCTGGATGACAGGCAG	0.564			T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								4	2	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	92019078	92019078	+	Intron	DEL	A	-	-	rs148376465	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92019078delA	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						AGAAATAACTAAAAAAAAACT	0.498													4	2	---	---	---	---	
LPAR1	1902	broad.mit.edu	37	9	113682173	113682174	+	Intron	DEL	CA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113682173_113682174delCA	uc004bfa.2	-						LPAR1_uc011lwm.1_Intron|LPAR1_uc004bfb.2_Intron|LPAR1_uc004bfc.2_Intron|LPAR1_uc011lwn.1_Intron|LPAR1_uc011lwo.1_Intron|LPAR1_uc010mub.2_Intron	NM_057159	NP_476500	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1						positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2						AGTGACTCAGCACACACACATC	0.431													4	2	---	---	---	---	
CDK5RAP2	55755	broad.mit.edu	37	9	123294931	123294931	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123294931delG	uc004bkf.2	-						CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Intron|CDK5RAP2_uc011lxx.1_Intron|CDK5RAP2_uc011lxy.1_Intron|CDK5RAP2_uc011lxz.1_Intron|CDK5RAP2_uc011lya.1_Intron|CDK5RAP2_uc004bkh.1_Intron|CDK5RAP2_uc004bki.2_Intron	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						ACCACAAAGAGGGCCACACCC	0.348													4	2	---	---	---	---	
ODF2	4957	broad.mit.edu	37	9	131222211	131222211	+	Intron	DEL	A	-	-	rs78453876		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131222211delA	uc011mbd.1	+						ODF2_uc011maz.1_Intron|ODF2_uc011mba.1_Intron|ODF2_uc010myb.2_Intron|ODF2_uc011mbb.1_Intron|ODF2_uc011mbc.1_Intron|ODF2_uc004bva.2_Intron|ODF2_uc004bvb.2_Intron|ODF2_uc011mbe.1_Intron|ODF2_uc004bvc.2_Intron|ODF2_uc010myc.2_Intron|ODF2_uc011mbf.1_Intron|ODF2_uc004bvd.3_Intron|ODF2_uc004bve.2_Intron	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1						cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						aaaagaagagaaaaaaaaagT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	137483694	137483694	+	IGR	DEL	T	-	-	rs33992096		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137483694delT								RXRA (151263 upstream) : COL5A1 (49958 downstream)																							CTGACTCCTGTTTTTTTTTTT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4850626	4850626	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4850626delC								LOC100216001 (130364 upstream) : AKR1E2 (17776 downstream)																							CCACTTGAATCCACTTGAGTC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	60708979	60708980	+	IGR	DEL	GT	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60708979_60708980delGT								BICC1 (120134 upstream) : PHYHIPL (227368 downstream)																							agatggaagagtggctgtgtaa	0.000													4	3	---	---	---	---	
LOC283050	283050	broad.mit.edu	37	10	80729775	80729775	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80729775delC	uc001jzz.2	-						LOC283050_uc001jzx.2_Intron|LOC283050_uc001jzy.2_Intron	NR_024431				Homo sapiens cDNA FLJ40604 fis, clone THYMU2011806.												0						TTGGTGAACGCAAGCTGGGCT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	102628574	102628574	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102628574delC								PAX2 (38877 upstream) : FAM178A (43752 downstream)																							ACCCAAATCTCCCAGACGTTG	0.577													4	2	---	---	---	---	
C10orf76	79591	broad.mit.edu	37	10	103789677	103789677	+	Intron	DEL	G	-	-	rs10786660	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103789677delG	uc009xwy.1	-						C10orf76_uc001kui.2_Intron	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		CGGtttttttgtttgtttgtt	0.179													9	5	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114847444	114847445	+	Intron	INS	-	G	G	rs139103301	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114847444_114847445insG	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CTTCCCTTCCTGGGGGCAGATC	0.584													4	4	---	---	---	---	
PARVA	55742	broad.mit.edu	37	11	12495065	12495065	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12495065delC	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN	parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)		CTCCCTGCTTCCCTGAGGAAA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34570343	34570343	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34570343delC								ELF5 (35013 upstream) : EHF (72325 downstream)																							ATCTTTGTTTCCCCAACCTTG	0.512													4	2	---	---	---	---	
FOLH1	2346	broad.mit.edu	37	11	49190491	49190491	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49190491delA	uc001ngy.2	-						FOLH1_uc001ngz.2_Intron|FOLH1_uc009yly.2_Intron|FOLH1_uc009ylz.2_Intron|FOLH1_uc009yma.2_Intron	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1						proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	ACTTCaaagcaaaaaaaaagt	0.234													4	3	---	---	---	---	
ARHGAP42	143872	broad.mit.edu	37	11	100820888	100820888	+	Intron	DEL	T	-	-	rs5794081		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100820888delT	uc001pge.2	+							NM_152432	NP_689645	A6NI28	RHG42_HUMAN	Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0						TTAATTTTTATTTCTTTGGTG	0.239													4	3	---	---	---	---	
POU2AF1	5450	broad.mit.edu	37	11	111229365	111229365	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111229365delT	uc001plg.3	-							NM_006235	NP_006226	Q16633	OBF1_HUMAN	POU class 2 associating factor 1						humoral immune response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			kidney(1)	1		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		tctctcacactatcacactct	0.060			T	BCL6	NHL								4	2	---	---	---	---	
C11orf52	91894	broad.mit.edu	37	11	111784895	111784895	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111784895delA	uc001pmh.2	+						CRYAB_uc001pmf.1_5'Flank|CRYAB_uc010rwp.1_5'Flank|HSPB2_uc009yyj.2_Intron	NM_080659	NP_542390	Q96A22	CK052_HUMAN	hypothetical protein LOC91894											ovary(1)	1		all_cancers(61;8.8e-15)|all_epithelial(67;6.27e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.63e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.7e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0512)		CCAGCTAGACAAAAAGCTCCT	0.537													4	2	---	---	---	---	
TAGLN	6876	broad.mit.edu	37	11	117075223	117075223	+	3'UTR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117075223delG	uc001pqm.2	+	5					uc001pqk.1_5'Flank|TAGLN_uc001pql.1_RNA|TAGLN_uc001pqn.2_3'UTR|TAGLN_uc001pqo.2_3'UTR|TAGLN_uc001pqp.2_3'UTR|uc001pqq.1_5'Flank	NM_003186	NP_003177	Q01995	TAGL_HUMAN	transgelin						muscle organ development	cytoplasm	actin binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|Epithelial(105;5.49e-05)|all cancers(92;0.000435)		AACTGCACCTGGGCAGCTCCT	0.622													4	2	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117299207	117299208	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117299207_117299208delCT	uc001prh.1	-	33	6180_6181	c.6178_6179delAG	c.(6178-6180)AGCfs	p.S2060fs		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	2000	Cytoplasmic (Potential).|Pro-rich.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AGGGGCAGCGCTGGGGGCGGTG	0.728													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	16585744	16585745	+	IGR	DEL	TT	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16585744_16585745delTT								MGST1 (62402 upstream) : LMO3 (115562 downstream)																							aaaagatttattacaaggagtt	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	30682252	30682252	+	IGR	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30682252delA								TMTC1 (744560 upstream) : IPO8 (99671 downstream)																							TAAGATCAATAAAAAAAAAAG	0.244													4	3	---	---	---	---	
FGD4	121512	broad.mit.edu	37	12	32667903	32667903	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32667903delA	uc001rkz.2	+						FGD4_uc001rlc.2_Intron|FGD4_uc001rky.2_Intron|FGD4_uc001rla.2_Intron|FGD4_uc001rkx.3_Intron	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4						actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					tgcctgcctcagcctcccaaa	0.129													4	2	---	---	---	---	
SLC48A1	55652	broad.mit.edu	37	12	48166459	48166459	+	5'Flank	DEL	A	-	-	rs112159115		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48166459delA	uc001rqd.2	+						RAPGEF3_uc009zks.2_5'Flank|SLC48A1_uc001rqc.2_Intron	NM_017842	NP_060312	Q6P1K1	HRG1_HUMAN	heme-responsive gene 1						transport	endosome membrane|integral to membrane|lysosomal membrane					0						gactctgtttaaaaaaaaaaa	0.219													3	3	---	---	---	---	
RACGAP1	29127	broad.mit.edu	37	12	50391191	50391191	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50391191delG	uc001rvt.2	-						RACGAP1_uc009zlm.1_Intron|RACGAP1_uc001rvs.2_Intron|RACGAP1_uc001rvu.2_Intron	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1						blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						ccgagtaactgggattacagg	0.000													4	2	---	---	---	---	
KCNMB4	27345	broad.mit.edu	37	12	70790653	70790653	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70790653delT	uc001svx.2	+							NM_014505	NP_055320	Q86W47	KCMB4_HUMAN	calcium-activated potassium channel beta 4						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of neurotransmitter secretion|regulation of vasoconstriction|synaptic transmission	voltage-gated potassium channel complex	calcium-activated potassium channel activity|protein binding				0	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TCTCGAGTTCTTTTTCCAGCA	0.393													4	2	---	---	---	---	
VEZT	55591	broad.mit.edu	37	12	95649835	95649835	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95649835delT	uc001tdz.2	+						VEZT_uc009zsy.1_Intron|VEZT_uc001tdr.2_Intron|VEZT_uc001tds.2_Intron|VEZT_uc001tdt.2_Intron|VEZT_uc009zsz.1_Intron|VEZT_uc001tdv.2_Intron|VEZT_uc001tdw.1_Intron|VEZT_uc009zta.1_Intron	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane							acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						TGATCttctcttttttttttg	0.234													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98655953	98655953	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98655953delT								RMST (697160 upstream) : LOC100128191 (250800 downstream)																							TGCATTTTAGTTTTTTTTTTC	0.393													4	2	---	---	---	---	
UBE3B	89910	broad.mit.edu	37	12	109922064	109922065	+	Intron	INS	-	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109922064_109922065insG	uc001top.2	+						UBE3B_uc001toq.2_Intron|UBE3B_uc001tol.1_Intron|UBE3B_uc001tom.2_Intron|UBE3B_uc001ton.2_Intron|UBE3B_uc001too.1_Intron|UBE3B_uc009zvj.1_Intron|UBE3B_uc001tor.2_Intron	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						TGAGATAAAACATAATACAAAA	0.391													3	3	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114374588	114374588	+	Intron	DEL	T	-	-	rs11349536		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114374588delT	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TTTTTTCCCCTAAAAGCTTTA	0.383													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27833847	27833847	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27833847delG								RPL21 (3147 upstream) : RASL11A (10617 downstream)																							ttatgaataagataaaagact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	33435359	33435359	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33435359delT								PDS5B (83204 upstream) : KL (154842 downstream)																							aatcatgtgcttgcaaagcca	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23362354	23362354	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23362354delG								REM2 (5465 upstream) : RBM23 (7501 downstream)																							CTTCTCTTCTGAAAGACTGCC	0.473													4	2	---	---	---	---	
SFRS5	6430	broad.mit.edu	37	14	70236174	70236175	+	Intron	INS	-	GA	GA			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70236174_70236175insGA	uc001xll.2	+						SFRS5_uc001xlm.2_Intron|SFRS5_uc001xln.1_3'UTR|SFRS5_uc001xlo.2_Intron|SFRS5_uc001xlp.2_Intron|SFRS5_uc001xlq.2_Intron	NM_006925	NP_008856	Q13243	SRSF5_HUMAN	splicing factor, arginine/serine-rich 5						mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)		GAGGATATTTTTCTTGTTTTTT	0.292													5	3	---	---	---	---	
TECPR2	9895	broad.mit.edu	37	14	102915798	102915798	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102915798delT	uc001ylw.1	+						TECPR2_uc010awl.2_Intron|TECPR2_uc010txx.1_Intron	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2								protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						TCCTGCCACATTTTTTTGGTC	0.413													4	2	---	---	---	---	
KLC1	3831	broad.mit.edu	37	14	104053846	104053846	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104053846delT	uc010tyd.1	+						C14orf153_uc001ynl.3_Intron|C14orf153_uc010tyc.1_Intron	NM_005552	NP_005543	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 1						blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				tctttttttcttttttttttt	0.129													7	4	---	---	---	---	
ZFYVE21	79038	broad.mit.edu	37	14	104185003	104185003	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104185003delG	uc001yoc.2	+						ZFYVE21_uc001yod.2_Intron	NM_024071	NP_076976	Q9BQ24	ZFY21_HUMAN	zinc finger, FYVE domain containing 21							cytoplasmic membrane-bounded vesicle|focal adhesion	metal ion binding				0		Melanoma(154;0.226)		Epithelial(152;0.245)		CAGTGGGCTTGGGGGTGGGCG	0.562													4	2	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	32145546	32145546	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32145546delC	uc001zfr.2	-						OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		TCTTTGAAAGCCCCAGAAACA	0.438													4	2	---	---	---	---	
PLCB2	5330	broad.mit.edu	37	15	40587725	40587726	+	Intron	DEL	GA	-	-	rs67908540		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40587725_40587726delGA	uc001zld.2	-						PLCB2_uc010bbo.2_Intron|PLCB2_uc010ucm.1_Intron	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2						activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CATGGATGTGGAGAGTGAGACC	0.554													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	40692055	40692055	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40692055delT								C15orf23 (5567 upstream) : IVD (5631 downstream)																							gcacacGatattacaggtata	0.005													4	2	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40894859	40894860	+	Intron	INS	-	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40894859_40894860insA	uc010bbs.1	+						CASC5_uc010ucq.1_Intron|CASC5_uc001zme.2_Intron|CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		taattttgtattttggtagaga	0.000													9	6	---	---	---	---	
SENP8	123228	broad.mit.edu	37	15	72427159	72427159	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72427159delA	uc002atp.2	+							NM_145204	NP_660205	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8						proteolysis		cysteine-type peptidase activity|protein binding			ovary(1)|skin(1)	2						TTACCATGGCAAAACTGGAAG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79027514	79027514	+	IGR	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79027514delC								CHRNB4 (74640 upstream) : ADAMTS7 (24032 downstream)																							tccctccaggcctttgtttcc	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79802465	79802466	+	IGR	INS	-	C	C	rs144704649	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79802465_79802466insC								KIAA1024 (37823 upstream) : MTHFS (334854 downstream)																							tctggcccttgcccacttatcc	0.193													4	2	---	---	---	---	
MESDC2	23184	broad.mit.edu	37	15	81260529	81260531	+	Intron	DEL	AGC	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81260529_81260531delAGC	uc002bfx.2	-						MESDC2_uc010uno.1_Intron	NM_015154		Q14696	MESD_HUMAN	mesoderm development candidate 2						mesoderm development|protein folding|Wnt receptor signaling pathway	endoplasmic reticulum					0						ggtatctgagagcagagcaccaa	0.443													4	2	---	---	---	---	
AGBL1	123624	broad.mit.edu	37	15	87164245	87164247	+	Intron	DEL	CTC	-	-	rs142425167		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87164245_87164247delCTC	uc002blz.1	+							NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						CATCTCTCTTCTCCTCGCTTTCC	0.414													3	5	---	---	---	---	
SEMA4B	10509	broad.mit.edu	37	15	90763301	90763302	+	Intron	DEL	GA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90763301_90763302delGA	uc002boy.2	+						SEMA4B_uc002boz.2_Intron|SEMA4B_uc010uqd.1_Intron|SEMA4B_uc002bpa.2_Intron|SEMA4B_uc010bnv.1_5'Flank	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			GCGCAGCCCTGACAGCCATGTC	0.624											OREG0023468	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	4	---	---	---	---	
CASKIN1	57524	broad.mit.edu	37	16	2234529	2234530	+	Intron	DEL	CA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2234529_2234530delCA	uc010bsg.1	-							NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1						signal transduction	cytoplasm				skin(2)	2						GTCCCACCATcacacacacaca	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5473705	5473705	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5473705delT	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																		CTGTCCCCCCTTCCATTGACG	0.448													4	2	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13323593	13323594	+	Intron	DEL	TG	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13323593_13323594delTG	uc010uyy.1	+							NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						gggaaacagatgtgaacacaga	0.030													4	2	---	---	---	---	
MYH11	4629	broad.mit.edu	37	16	15857442	15857442	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15857442delT	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron|MYH11_uc002dea.1_Intron	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						ATTAGGTTTGTTTTTTTTTAA	0.229			T	CBFB	AML								4	2	---	---	---	---	
C16orf63	123811	broad.mit.edu	37	16	15961098	15961098	+	3'UTR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15961098delT	uc002dec.1	-	5					C16orf63_uc002ded.1_3'UTR	NM_144600	NP_653201	Q96NB1	FOPNL_HUMAN	hypothetical protein LOC123811						cilium assembly|microtubule anchoring	centriolar satellite|microtubule basal body|motile cilium	identical protein binding				0						AAAACAATACTTTTTTTTTCA	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26782500	26782500	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26782500delT								HS3ST4 (633492 upstream) : C16orf82 (295719 downstream)																							aaaacccaccttctcatggct	0.000													4	2	---	---	---	---	
STX1B	112755	broad.mit.edu	37	16	31008552	31008552	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31008552delG	uc010cad.2	-						STX1B_uc010vfd.1_Intron	NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B						intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						CCCAAACCCTGACAAGTTCAT	0.527													4	2	---	---	---	---	
FTO	79068	broad.mit.edu	37	16	53821453	53821453	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53821453delA	uc002ehr.2	+						FTO_uc010vha.1_Intron	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AGCaaaaattaaaaaaaaatt	0.279													5	3	---	---	---	---	
CCDC135	84229	broad.mit.edu	37	16	57748547	57748548	+	Intron	DEL	CA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57748547_57748548delCA	uc002emi.2	+						CCDC135_uc002emj.2_Intron|CCDC135_uc002emk.2_Intron	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135							cytoplasm				central_nervous_system(1)	1						CTCTCTCTGTCACACACACACA	0.252													5	3	---	---	---	---	
RABEP1	9135	broad.mit.edu	37	17	5266498	5266498	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5266498delT	uc002gbm.3	+						RABEP1_uc010clc.1_Intron|RABEP1_uc010cld.1_Intron|RABEP1_uc010vsw.1_Intron|RABEP1_uc002gbl.3_Intron|NUP88_uc002gbn.2_Intron	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1						apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						AGGACTCTGCTTttttttttt	0.199													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	10717625	10717625	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10717625delG								TMEM220 (83979 upstream) : PIRT (8168 downstream)																							AGGGGAGTGTGGCAAACAGCA	0.423													4	2	---	---	---	---	
ALDH3A2	224	broad.mit.edu	37	17	19576700	19576700	+	Intron	DEL	T	-	-	rs66737570		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19576700delT	uc002gwb.1	+						ALDH3A2_uc002gwa.1_Intron|ALDH3A2_uc010cqr.1_Intron|ALDH3A2_uc002gwc.1_Intron|ALDH3A2_uc002gwd.1_Intron	NM_000382	NP_000373	P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3A2 isoform 2						cellular aldehyde metabolic process|central nervous system development|epidermis development|lipid metabolic process|peripheral nervous system development	endoplasmic reticulum membrane|integral to membrane	3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(2)	2	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)				NADH(DB00157)	tttatttttgttttttttttg	0.184													23	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21562510	21562514	+	IGR	DEL	ATTTA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21562510_21562514delATTTA								C17orf51 (84779 upstream) : FAM27L (262856 downstream)																							GTGATGAATGATTTATTTTTTTTTA	0.293													4	2	---	---	---	---	
LHX1	3975	broad.mit.edu	37	17	35294394	35294394	+	5'Flank	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35294394delG	uc002hnh.1	+						uc002hng.1_5'Flank|LHX1_uc010cux.1_5'Flank	NM_005568	NP_005559	P48742	LHX1_HUMAN	LIM homeobox protein 1						cerebellar Purkinje cell differentiation|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation|cervix development|comma-shaped body morphogenesis|dorsal/ventral pattern formation|ectoderm formation|embryonic pattern specification|embryonic retina morphogenesis in camera-type eye|embryonic viscerocranium morphogenesis|endoderm formation|forebrain regionalization|head development|motor axon guidance|negative regulation of transcription, DNA-dependent|nephric duct morphogenesis|nephron tubule epithelial cell differentiation|neuron migration|oviduct epithelium development|paramesonephric duct development|positive regulation of anterior head development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of embryonic development|positive regulation of gastrulation|positive regulation of transcription, DNA-dependent|post-embryonic development|primitive streak formation|renal vesicle morphogenesis|retina layer formation|S-shaped body morphogenesis|spinal cord association neuron differentiation|transcription from RNA polymerase II promoter|ureteric bud development|uterine epithelium development|vagina development	nucleus|protein complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(25;0.00607)				CCACCACAACGAAAAAAAGAA	0.542													4	2	---	---	---	---	
AATF	26574	broad.mit.edu	37	17	35368680	35368680	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35368680delA	uc002hni.2	+						AATF_uc002hnj.2_Intron	NM_012138	NP_036270	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of superoxide anion generation|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to DNA damage stimulus	centrosome|focal adhesion|nucleolus	leucine zipper domain binding|sequence-specific DNA binding transcription factor activity				0		Breast(25;0.00607)				cctcaaaaacaaaaaaaaaGT	0.035													4	2	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36351714	36351715	+	Intron	INS	-	A	A			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36351714_36351715insA	uc002hpr.2	-						TBC1D3_uc010cvk.2_Intron|TBC1D3_uc010wdn.1_Intron	NM_001123391	NP_001116863	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		gaactttaattaaaaaaaaaga	0.040													6	4	---	---	---	---	
TEX14	56155	broad.mit.edu	37	17	56663598	56663599	+	Intron	INS	-	T	T	rs143677617	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56663598_56663599insT	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTTGGCTTGAATGGGAGGTCAG	0.411													9	6	---	---	---	---	
UBE2O	63893	broad.mit.edu	37	17	74432866	74432866	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74432866delT	uc002jrm.3	-						UBE2O_uc002jrn.3_Intron	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O								ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						GTAACGCCTCTTAGGACAGAG	0.363													4	2	---	---	---	---	
CCDC137	339230	broad.mit.edu	37	17	79639371	79639371	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79639371delA	uc002kbc.3	+						CCDC137_uc002kbd.2_Intron	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137											central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			ctgtgtcaagaaaaaaaaaaa	0.269													6	4	---	---	---	---	
SPIRE1	56907	broad.mit.edu	37	18	12550400	12550400	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12550400delT	uc002kre.2	-						SPIRE1_uc002krc.2_Intron|SPIRE1_uc010wzw.1_Intron|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Intron	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a							cytoskeleton|perinuclear region of cytoplasm	actin binding				0						TTAtttcttcttttttttcta	0.159													9	4	---	---	---	---	
FHOD3	80206	broad.mit.edu	37	18	34160461	34160462	+	Intron	DEL	AA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34160461_34160462delAA	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron|FHOD3_uc002kzu.1_Intron	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CCATCCCACTAACTGTGATGTC	0.510													4	2	---	---	---	---	
ATP8B3	148229	broad.mit.edu	37	19	1809480	1809480	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1809480delA	uc002ltw.2	-						ATP8B3_uc002ltv.2_Intron|ATP8B3_uc002ltx.2_Intron|ATP8B3_uc002ltz.1_Intron	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3						ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actctgtctcaaaaaaaaaaa	0.139													7	5	---	---	---	---	
C3	718	broad.mit.edu	37	19	6697215	6697215	+	Intron	DEL	T	-	-	rs11569474		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6697215delT	uc002mfm.2	-							NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		GCTTCTGAAATTCTGGGACTT	0.473													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30631685	30631685	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30631685delT								C19orf2 (125074 upstream) : ZNF536 (231643 downstream)																							TGAGACGGAGttttctctctt	0.174													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	33317138	33317140	+	RNA	DEL	TTC	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33317138_33317140delTTC	uc002nts.1	+	4		c.528_530delTTC								Homo sapiens cDNA FLJ13072 fis, clone NT2RP3001844.																		GCGCAGGTCTTTCTTCTTCTAGC	0.433													10	9	---	---	---	---	
DYRK1B	9149	broad.mit.edu	37	19	40322748	40322748	+	Intron	DEL	A	-	-	rs35336772		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40322748delA	uc002omj.2	-						DYRK1B_uc002omi.2_Intron|DYRK1B_uc002omk.2_Intron|DYRK1B_uc002oml.2_Intron	NM_004714	NP_004705	Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation						positive regulation of transcription, DNA-dependent	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|transcription coactivator activity			ovary(4)|stomach(1)|central_nervous_system(1)|skin(1)	7	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			GATAGCAATGAAGAGAAGGGG	0.512													8	4	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41071881	41071883	+	Intron	DEL	ATG	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41071881_41071883delATG	uc002ony.2	+						SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGAAGGAGGAATGGGAGTCAGAA	0.557													6	3	---	---	---	---	
ATP5SL	55101	broad.mit.edu	37	19	41938395	41938396	+	Intron	DEL	GT	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41938395_41938396delGT	uc002oqw.1	-						CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_Intron|ATP5SL_uc002oqv.2_Intron|ATP5SL_uc010xwa.1_Intron|ATP5SL_uc002oqx.1_Intron|ATP5SL_uc002oqy.1_Intron|ATP5SL_uc002oqz.1_Intron|ATP5SL_uc002ora.1_3'UTR|ATP5SL_uc010xwb.1_3'UTR	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN	ATP5S-like											large_intestine(1)|breast(1)	2						CAGCGTGTGCGTGTGTGTGTGT	0.460													6	3	---	---	---	---	
TEAD2	8463	broad.mit.edu	37	19	49863868	49863868	+	Intron	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49863868delG	uc002pnj.2	-						TEAD2_uc002png.2_5'Flank|TEAD2_uc002pnh.2_Intron|TEAD2_uc002pni.2_Intron|TEAD2_uc010yao.1_Intron|TEAD2_uc010emw.2_Intron	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		AGTTAGTGGTGGGGAAGGAAG	0.502													4	2	---	---	---	---	
CCDC106	29903	broad.mit.edu	37	19	56163027	56163027	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56163027delT	uc002qlr.2	+						CCDC106_uc002qls.2_Intron|U2AF2_uc002qlt.2_5'Flank|U2AF2_uc002qlu.2_5'Flank	NM_013301	NP_037433	Q9BWC9	CC106_HUMAN	coiled-coil domain containing 106							nucleus					0		Colorectal(82;0.00403)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		Gtttactttcttttttttttt	0.284													3	4	---	---	---	---	
DTD1	92675	broad.mit.edu	37	20	18649803	18649803	+	Intron	DEL	A	-	-	rs11479549		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18649803delA	uc002wrf.3	+							NM_080820	NP_543010	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1						D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2						CATGGGGACCAGGGGGTAGTG	0.527													4	6	---	---	---	---	
PTPN1	5770	broad.mit.edu	37	20	49165948	49165948	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49165948delT	uc002xvl.2	+						PTPN1_uc010zys.1_Intron	NM_002827	NP_002818	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type						blood coagulation|interferon-gamma-mediated signaling pathway|negative regulation of insulin receptor signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytosol|endoplasmic reticulum membrane	protein tyrosine phosphatase activity|zinc ion binding				0		Lung NSC(126;0.163)			Clodronate(DB00720)|Tiludronate(DB01133)	CAGTTGATTGTTTTTTTTCCA	0.438													9	4	---	---	---	---	
DOK5	55816	broad.mit.edu	37	20	53152830	53152831	+	Intron	DEL	CA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53152830_53152831delCA	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901	Q9P104	DOK5_HUMAN	docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)			TGGCCTTAGTCACTGCCATAAT	0.436													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60460607	60460608	+	Intron	INS	-	G	G			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60460607_60460608insG	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			gacccttggctgttcggccctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62216391	62216391	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62216391delG								PRIC285 (10799 upstream) : GMEB2 (2564 downstream)																							ctgggcggcagagtgagactc	0.000													4	2	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34116927	34116927	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34116927delA	uc002yqn.2	-						GCFC1_uc002yql.2_Intron|GCFC1_uc002yqm.2_Intron|GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						TAAAAAAAAGAAAAAAAAAAC	0.338													6	3	---	---	---	---	
KCNJ6	3763	broad.mit.edu	37	21	39075277	39075277	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39075277delA	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)	gtgtggtgggaagggaagccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27117003	27117004	+	IGR	INS	-	G	G	rs150988863	by1000genomes	TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27117003_27117004insG								MIAT (2054 upstream) : None (None downstream)																							GTGGGGGTTGCGGGGAGCACCA	0.282													5	6	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2724467	2724467	+	Intron	DEL	T	-	-	rs55694680		TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2724467delT	uc011mhg.1	+						XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TTTGCTGGCATTTTTTTTTAT	0.373													8	4	---	---	---	---	
HDHD1A	8226	broad.mit.edu	37	X	6968145	6968145	+	3'UTR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6968145delG	uc004crv.2	-	4					HDHD1A_uc011mhm.1_3'UTR|HDHD1A_uc011mhn.1_3'UTR|HDHD1A_uc010ndl.2_3'UTR	NM_012080	NP_036212	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain						nucleotide metabolic process		metal ion binding|phosphatase activity				0		Colorectal(8;0.0114)|Medulloblastoma(8;0.184)				TGTATTTTTTGTCTCAACCGT	0.403													4	2	---	---	---	---	
SMS	6611	broad.mit.edu	37	X	21997306	21997307	+	Intron	INS	-	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21997306_21997307insT	uc004dag.2	+						SMS_uc010nfs.2_Intron|SMS_uc010nft.2_Intron	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase						methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	AAAATTAATtcttttttttttt	0.158													7	5	---	---	---	---	
CLCN5	1184	broad.mit.edu	37	X	49776797	49776797	+	Intron	DEL	C	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49776797delC	uc004dor.1	+						CLCN5_uc004doq.1_Intron|MIR660_hsa-mir-660|MI0003684_5'Flank|MIR502_hsa-mir-502|MI0003186_5'Flank	NM_001127899	NP_001121371	P51795	CLCN5_HUMAN	chloride channel 5 isoform a						excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					CCCTCTCCAACCCCCCAACAG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61714138	61714138	+	IGR	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61714138delT								None (None upstream) : SPIN4 (852970 downstream)																							aaaaagacagtttcaaaactg	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	90273434	90273434	+	IGR	DEL	G	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90273434delG								None (None upstream) : PABPC5 (416163 downstream)																							tcagtgtggtggggggaacac	0.005													4	2	---	---	---	---	
SYTL4	94121	broad.mit.edu	37	X	99934109	99934110	+	Intron	INS	-	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99934109_99934110insT	uc004egd.3	-						SYTL4_uc004egc.2_5'Flank|SYTL4_uc010nnb.2_Intron|SYTL4_uc010nnc.2_Intron|SYTL4_uc004ege.3_Intron|SYTL4_uc004egf.3_Intron	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4						exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCTGTCTGCAGCCCTCCTCTTT	0.436													10	6	---	---	---	---	
PAK3	5063	broad.mit.edu	37	X	110460034	110460034	+	Intron	DEL	A	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110460034delA	uc004epa.2	+						PAK3_uc010npt.1_Intron|PAK3_uc010npu.1_Intron|PAK3_uc004eoy.1_Intron|PAK3_uc004eoz.2_Intron|PAK3_uc011mst.1_Intron|PAK3_uc010npv.1_Intron|PAK3_uc010npw.1_Intron	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d						multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						TTTTGCAAGGAAAAAAAAAAA	0.398										TSP Lung(19;0.15)			3	8	---	---	---	---	
TRPC5	7224	broad.mit.edu	37	X	111325621	111325622	+	5'UTR	DEL	GA	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111325621_111325622delGA	uc004epl.1	-	1					TRPC5_uc004epm.1_5'UTR|ZCCHC16_uc004epo.1_5'Flank	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,						axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						agagagaggggagagagagaga	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	114714090	114714091	+	IGR	DEL	TG	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114714090_114714091delTG								LUZP4 (171971 upstream) : PLS3 (81115 downstream)																							cactgcaaaatgtgggctccac	0.000													4	2	---	---	---	---	
FAM122C	159091	broad.mit.edu	37	X	133979590	133979590	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133979590delT	uc004exz.1	+						FAM122C_uc011mvq.1_Intron|FAM122C_uc004exy.1_Intron	NM_138819	NP_620174	Q6P4D5	F222C_HUMAN	hypothetical protein LOC159091												0	Acute lymphoblastic leukemia(192;0.000127)					CTCtttttaattttttttttt	0.134													4	2	---	---	---	---	
CLIC2	1193	broad.mit.edu	37	X	154521949	154521949	+	Intron	DEL	T	-	-			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154521949delT	uc004fnf.2	-						CLIC2_uc010nvj.1_Intron	NM_001289	NP_001280	O15247	CLIC2_HUMAN	chloride intracellular channel 2						signal transduction	chloride channel complex|cytoplasm|nucleus	voltage-gated chloride channel activity			large_intestine(1)|ovary(1)|skin(1)	3	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					tagtcccagctactcgggagg	0.000													4	9	---	---	---	---	
CLIC2	1193	broad.mit.edu	37	X	154521951	154521952	+	Intron	INS	-	T	T			TCGA-A3-3347-01A-02D-1386-10	TCGA-A3-3347-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154521951_154521952insT	uc004fnf.2	-						CLIC2_uc010nvj.1_Intron	NM_001289	NP_001280	O15247	CLIC2_HUMAN	chloride intracellular channel 2						signal transduction	chloride channel complex|cytoplasm|nucleus	voltage-gated chloride channel activity			large_intestine(1)|ovary(1)|skin(1)	3	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					gtcccagctactcgggaggctg	0.000													4	9	---	---	---	---	
