Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
FAM131C	348487	broad.mit.edu	37	1	16361916	16361916	+	Silent	SNP	G	A	A	rs11811753	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16361916G>A	uc010obz.1	-	7	790	c.600C>T	c.(598-600)AGC>AGT	p.S200S	CLCNKB_uc001axw.3_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487	200											0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GTGAGGGGCCGCTGGGAAGGC	0.647													3	7	---	---	---	---	PASS
CELA3A	10136	broad.mit.edu	37	1	22333473	22333473	+	Silent	SNP	A	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22333473A>C	uc001bfl.2	+	5	484	c.465A>C	c.(463-465)ACA>ACC	p.T155T		NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein	155	Peptidase S1.				cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						CCAACAAGACACCCTGCTACA	0.612													6	119	---	---	---	---	PASS
ZDHHC18	84243	broad.mit.edu	37	1	27176851	27176851	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27176851T>A	uc001bnb.2	+	4	801	c.706T>A	c.(706-708)TTC>ATC	p.F236I	ZDHHC18_uc010ofh.1_Missense_Mutation_p.F101I	NM_032283	NP_115659	Q9NUE0	ZDH18_HUMAN	zinc finger, DHHC-type containing 18	236	Helical; (Potential).|DHHC-type.					integral to membrane	zinc ion binding				0		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)		GAACTATCGCTTCTTCTACGC	0.577													34	133	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55622657	55622657	+	Silent	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55622657C>T	uc001cyg.3	-	11	1074	c.1074G>A	c.(1072-1074)TTG>TTA	p.L358L		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	470					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						CATCTAACGACAATTTACTAC	0.368													39	253	---	---	---	---	PASS
SYDE2	84144	broad.mit.edu	37	1	85648743	85648743	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85648743T>C	uc009wcm.2	-	3	1631	c.1582A>G	c.(1582-1584)AAA>GAA	p.K528E	SYDE2_uc001dku.3_Missense_Mutation_p.K528E	NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	528					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		ATGGAAAGTTTCCTCACAGTT	0.353													67	299	---	---	---	---	PASS
FMO5	2330	broad.mit.edu	37	1	146696569	146696569	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146696569G>A	uc001epi.2	-	2	442	c.53C>T	c.(52-54)TCC>TTC	p.S18F	FMO5_uc001eph.3_Missense_Mutation_p.S18F|FMO5_uc001epj.2_Missense_Mutation_p.S18F|FMO5_uc001epk.3_Missense_Mutation_p.S18F	NM_001461	NP_001452	P49326	FMO5_HUMAN	flavin containing monooxygenase 5 isoform 1	18						integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			ovary(3)	3	all_hematologic(923;0.0487)					GCACTTGATGGAAGAGAGCCC	0.502													46	187	---	---	---	---	PASS
LELP1	149018	broad.mit.edu	37	1	153177408	153177408	+	Silent	SNP	C	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153177408C>A	uc001fbl.2	+	2	335	c.225C>A	c.(223-225)ACC>ACA	p.T75T		NM_001010857	NP_001010857	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	75	Cys/Pro-rich.									ovary(1)	1	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCCCTGCACCAAGCCCTGTC	0.627													25	83	---	---	---	---	PASS
KCNN3	3782	broad.mit.edu	37	1	154744736	154744736	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154744736G>A	uc001ffp.2	-	3	1477	c.1163C>T	c.(1162-1164)GCA>GTA	p.A388V	KCNN3_uc001ffo.2_Missense_Mutation_p.A83V|KCNN3_uc009wox.1_Missense_Mutation_p.A388V	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium	393						integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			GGCCAGGCGTGCCGTCCAGAA	0.607													18	57	---	---	---	---	PASS
FMO1	2326	broad.mit.edu	37	1	171244561	171244561	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171244561A>C	uc009wvz.2	+	4	534	c.398A>C	c.(397-399)GAG>GCG	p.E133A	FMO1_uc010pme.1_Missense_Mutation_p.E70A|FMO1_uc001ghl.2_Missense_Mutation_p.E133A|FMO1_uc001ghm.2_Missense_Mutation_p.E133A|FMO1_uc001ghn.2_Missense_Mutation_p.E133A	NM_002021	NP_002012	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	133					NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ATGCATGAAGAGAAGCAAGAG	0.433													40	196	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176993851	176993851	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176993851G>A	uc001glc.2	-	6	1350	c.1138C>T	c.(1138-1140)CCT>TCT	p.P380S	ASTN1_uc001glb.1_Missense_Mutation_p.P380S|ASTN1_uc001gld.1_Missense_Mutation_p.P380S|ASTN1_uc009wwx.1_Missense_Mutation_p.P380S|ASTN1_uc001gle.3_RNA	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	380					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						TTATTCACAGGACTTCGGGGA	0.493													12	34	---	---	---	---	PASS
PDC	5132	broad.mit.edu	37	1	186415580	186415580	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186415580G>A	uc001gsa.2	-	3	264	c.191C>T	c.(190-192)TCA>TTA	p.S64L	PDC_uc001grz.2_Missense_Mutation_p.S12L	NM_002597	NP_002588	P20941	PHOS_HUMAN	phosducin isoform a	64					G-protein coupled receptor protein signaling pathway|phototransduction|visual perception	actin cytoskeleton|cytosol|nucleus|photoreceptor inner segment|photoreceptor outer segment	phospholipase inhibitor activity			skin(1)	1		Breast(1374;1.53e-05)		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)		TCGTTCCTTTGAATCTTTGCC	0.338													29	117	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1677555	1677555	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1677555C>T	uc002qxa.2	-	9	942	c.878G>A	c.(877-879)CGC>CAC	p.R293H	PXDN_uc002qxb.1_Missense_Mutation_p.R293H|PXDN_uc002qxc.1_Missense_Mutation_p.R110H	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	293	Ig-like C2-type 1.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CAAGTTTAGGCGGGAATCTGT	0.507													42	157	---	---	---	---	PASS
TSPYL6	388951	broad.mit.edu	37	2	54483389	54483389	+	5'UTR	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54483389C>T	uc002rxr.2	-	1					ACYP2_uc002rxq.3_Intron	NM_001003937	NP_001003937	Q8N831	TSYL6_HUMAN	TSPY-like 6						nucleosome assembly	nucleus					0						CGCCCATTTGCGCCGCCCACT	0.463													3	46	---	---	---	---	PASS
WDR92	116143	broad.mit.edu	37	2	68361814	68361814	+	Intron	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68361814G>C	uc002see.1	-						WDR92_uc002sed.1_Intron|WDR92_uc002sef.1_3'UTR|WDR92_uc002seg.1_3'UTR	NM_138458	NP_612467	Q96MX6	WDR92_HUMAN	monad						apoptosis|histone lysine methylation		methylated histone residue binding				0						AAAAGGAGCAGTGTGCACTGG	0.458													31	89	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80097056	80097056	+	Nonsense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80097056C>T	uc010ysh.1	+	4	585	c.580C>T	c.(580-582)CAA>TAA	p.Q194*	CTNNA2_uc010yse.1_Nonsense_Mutation_p.Q194*|CTNNA2_uc010ysf.1_Nonsense_Mutation_p.Q194*|CTNNA2_uc010ysg.1_Nonsense_Mutation_p.Q194*	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	194					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AGCAAGAAGACAACAGGTGGG	0.403													21	128	---	---	---	---	PASS
CHRNA1	1134	broad.mit.edu	37	2	175612767	175612767	+	3'UTR	SNP	T	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175612767T>A	uc002ujd.2	-	10					uc002uiw.2_Intron|CHRNA1_uc002uje.2_3'UTR	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a						muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)|skin(1)	4						TAAGTGCGAGTGGAGCAAGTA	0.403													7	33	---	---	---	---	PASS
FRZB	2487	broad.mit.edu	37	2	183731161	183731161	+	Silent	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183731161G>T	uc002upa.1	-	1	338	c.120C>A	c.(118-120)ATC>ATA	p.I40I		NM_001463	NP_001454	Q92765	SFRP3_HUMAN	frizzled-related protein precursor	40	FZ.				brain development|cochlea morphogenesis|gonad development|mammary gland involution|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of hepatocyte differentiation|positive regulation of apoptosis|positive regulation of fat cell differentiation|skeletal system development|vasculature development|Wnt receptor signaling pathway	cytoplasm|extracellular space|membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			TGCACAGGGGGATGCGGACGG	0.672													8	33	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200213434	200213434	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200213434T>C	uc002uuy.1	-	7	1980	c.1163A>G	c.(1162-1164)AAC>AGC	p.N388S	SATB2_uc010fsq.1_Missense_Mutation_p.N270S|SATB2_uc002uuz.1_Missense_Mutation_p.N388S|SATB2_uc002uva.1_Missense_Mutation_p.N388S|SATB2_uc002uvb.1_Missense_Mutation_p.N131S	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	388	CUT 1.					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						CTGTGTGCGGTTGAATGCCAC	0.403													59	208	---	---	---	---	PASS
C2orf47	79568	broad.mit.edu	37	2	200826508	200826508	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200826508G>C	uc002uvm.2	+	5	976	c.654G>C	c.(652-654)AGG>AGC	p.R218S		NM_024520	NP_078796	Q8WWC4	CB047_HUMAN	hypothetical protein LOC79568 precursor	218						mitochondrion					0						TCTAAGGAAGGAAGTTTGTTA	0.358													30	116	---	---	---	---	PASS
PDCD6IP	10015	broad.mit.edu	37	3	33887039	33887039	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33887039A>T	uc003cfx.2	+	12	1755	c.1600A>T	c.(1600-1602)ATC>TTC	p.I534F	PDCD6IP_uc003cfy.2_Missense_Mutation_p.I539F|PDCD6IP_uc011axw.1_Missense_Mutation_p.I315F	NM_013374	NP_037506	Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	534	Interaction with EIAV p9.|Self-association.				apoptosis|cell cycle|cell division|interspecies interaction between organisms|protein transport	cytosol|melanosome|microtubule organizing center	calcium-dependent protein binding			ovary(1)|skin(1)	2						GAATGCTGCCATCCCTTCTGC	0.468													20	73	---	---	---	---	PASS
ZNF445	353274	broad.mit.edu	37	3	44488853	44488853	+	Silent	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44488853G>A	uc003cnf.2	-	8	2658	c.2310C>T	c.(2308-2310)GCC>GCT	p.A770A	ZNF445_uc011azv.1_Silent_p.A758A|ZNF445_uc011azw.1_Silent_p.A770A	NM_181489	NP_852466	P59923	ZN445_HUMAN	zinc finger protein 445	770	C2H2-type 8.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		GATTGCGGAAGGCCTTGCCAC	0.527													15	43	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66436782	66436782	+	Intron	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66436782G>T	uc003dmx.2	-						SLC25A26_uc011bft.1_RNA|LRIG1_uc011bfu.1_Intron|LRIG1_uc003dmw.2_Intron|LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Intron	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		AGAGGAACCAGCTGCTGTTCA	0.537													13	89	---	---	---	---	PASS
MITF	4286	broad.mit.edu	37	3	69928509	69928509	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69928509C>T	uc003dnz.2	+	2	445	c.329C>T	c.(328-330)ACG>ATG	p.T110M	MITF_uc011bgb.1_Missense_Mutation_p.T58M|MITF_uc003doa.2_Missense_Mutation_p.T109M|MITF_uc003dob.2_Missense_Mutation_p.T94M|MITF_uc003dod.2_Missense_Mutation_p.T85M|MITF_uc003doc.1_RNA	NM_198159	NP_937802	O75030	MITF_HUMAN	microphthalmia-associated transcription factor	110					melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			ovary(2)	2		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CCCTCTGCCACGCAGGTGCCG	0.527			A		melanoma 		Waardenburg syndrome type 2|Tietz syndrome						23	55	---	---	---	---	PASS
BDH1	622	broad.mit.edu	37	3	197238941	197238941	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197238941G>A	uc003fxr.2	-	8	1259	c.857C>T	c.(856-858)ACC>ATC	p.T286I	BDH1_uc003fxs.2_Missense_Mutation_p.T286I|BDH1_uc003fxt.2_Missense_Mutation_p.T199I|BDH1_uc003fxu.2_Missense_Mutation_p.T286I	NM_203314	NP_976059	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	286					cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)	GCTGCAGTAGGTCTCCATCTT	0.582													28	136	---	---	---	---	PASS
GPR125	166647	broad.mit.edu	37	4	22437012	22437012	+	Silent	SNP	A	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22437012A>T	uc003gqm.1	-	10	1630	c.1365T>A	c.(1363-1365)TCT>TCA	p.S455S	GPR125_uc010ieo.1_Silent_p.S329S|GPR125_uc003gqn.1_Silent_p.S229S|GPR125_uc003gqo.2_Silent_p.S455S	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	455	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				CCATTTTGTCAGAAAAGTTGG	0.378													25	118	---	---	---	---	PASS
PI4K2B	55300	broad.mit.edu	37	4	25258214	25258214	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25258214C>T	uc003grk.2	+	4	807	c.674C>T	c.(673-675)GCA>GTA	p.A225V	PI4K2B_uc011bxs.1_Missense_Mutation_p.A129V	NM_018323	NP_060793	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	225	PI3K/PI4K.					cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)				ATTGACCGTGCAAAATCAAGA	0.363													37	120	---	---	---	---	PASS
BMP3	651	broad.mit.edu	37	4	81952663	81952663	+	Silent	SNP	A	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81952663A>T	uc003hmg.3	+	1	545	c.225A>T	c.(223-225)ACA>ACT	p.T75T		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	75					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						CGGCCCGGACACCGGGCTCCC	0.687													7	31	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151511932	151511932	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151511932C>A	uc010ipj.2	-	40	6633	c.6159G>T	c.(6157-6159)GAG>GAT	p.E2053D	LRBA_uc003ilt.3_Missense_Mutation_p.E701D|LRBA_uc003ilu.3_Missense_Mutation_p.E2042D	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	2053						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					CCAGGAGGATCTCGTTTTCTG	0.413													36	96	---	---	---	---	PASS
ANKH	56172	broad.mit.edu	37	5	14751238	14751238	+	Silent	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14751238G>A	uc003jfm.3	-	5	958	c.627C>T	c.(625-627)TGC>TGT	p.C209C		NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein	209	Helical; (Potential).				locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						AGTAGCCCAGGCACAGGGTGG	0.572													18	111	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24593660	24593660	+	5'UTR	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24593660G>C	uc003jgr.1	-	2					CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		TTACCCAGTTGGTTTTACTGT	0.318										HNSCC(23;0.051)			8	45	---	---	---	---	PASS
PPWD1	23398	broad.mit.edu	37	5	64867889	64867889	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64867889T>C	uc003jtv.3	+	5	752	c.745T>C	c.(745-747)TAC>CAC	p.Y249H	PPWD1_uc011cqv.1_Missense_Mutation_p.Y219H|PPWD1_uc011cqw.1_Missense_Mutation_p.Y93H	NM_015342	NP_056157	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat	249	WD 3.				protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		GATGATTGAATACTGGACTGG	0.373													51	146	---	---	---	---	PASS
ST8SIA4	7903	broad.mit.edu	37	5	100147426	100147426	+	3'UTR	SNP	C	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100147426C>A	uc003knk.2	-	5						NM_005668	NP_005659	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			large_intestine(1)|central_nervous_system(1)	2		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		TTCTCATGAACGTCCTTTATT	0.393													9	19	---	---	---	---	PASS
PCDHA4	56144	broad.mit.edu	37	5	140188155	140188155	+	Silent	SNP	A	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140188155A>G	uc003lhi.2	+	1	1484	c.1383A>G	c.(1381-1383)ACA>ACG	p.T461T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Silent_p.T461T|PCDHA4_uc011daa.1_Silent_p.T461T	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	461	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGAGTACACAGTGTTCGTGA	0.647													4	94	---	---	---	---	PASS
PFN3	345456	broad.mit.edu	37	5	176827583	176827583	+	5'UTR	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176827583T>C	uc003mgl.2	-	1						NM_001029886	NP_001025057	P60673	PROF3_HUMAN	profilin 3						actin cytoskeleton organization	actin cytoskeleton|cytoplasm	actin binding				0	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCATCGCGCTCCGAGTGCGC	0.687													5	25	---	---	---	---	PASS
FAM50B	26240	broad.mit.edu	37	6	3850568	3850568	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3850568G>T	uc003mvu.2	+	2	635	c.523G>T	c.(523-525)GCG>TCG	p.A175S		NM_012135	NP_036267	Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	175						nucleus				pancreas(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				AGAGTGGGAGGCGCAGCGCGA	0.677													9	36	---	---	---	---	PASS
OR2J3	442186	broad.mit.edu	37	6	29079901	29079901	+	Silent	SNP	C	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29079901C>G	uc011dll.1	+	1	234	c.234C>G	c.(232-234)ACC>ACG	p.T78T		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	78	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCTACACCACCAGCTCTATCC	0.473													67	364	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51524031	51524031	+	Silent	SNP	A	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51524031A>G	uc003pah.1	-	61	11169	c.10893T>C	c.(10891-10893)TAT>TAC	p.Y3631Y		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3631	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	p.Y3631Y(1)		lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CAACTCTTCTATAATGACTAG	0.448													51	193	---	---	---	---	PASS
RBM16	22828	broad.mit.edu	37	6	155148314	155148314	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155148314C>T	uc003qqa.2	+	19	2312	c.2080C>T	c.(2080-2082)CCG>TCG	p.P694S	RBM16_uc011efj.1_Missense_Mutation_p.P760S|RBM16_uc011efk.1_Missense_Mutation_p.P739S|RBM16_uc003qpz.2_Missense_Mutation_p.P694S|RBM16_uc010kji.2_Missense_Mutation_p.P715S	NM_014892	NP_055707	Q9UPN6	SCAF8_HUMAN	RNA-binding motif protein 16	694	Pro-rich.				mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding				0		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)		AGGTTTCATGCCGCCTCCAGT	0.368													5	228	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161152232	161152232	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161152232T>C	uc003qtm.3	+	11	1469	c.1406T>C	c.(1405-1407)CTG>CCG	p.L469P		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	469					extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CCTGTTGTCCTGCTTCCAGAT	0.498													28	109	---	---	---	---	PASS
SNX13	23161	broad.mit.edu	37	7	17836399	17836399	+	3'UTR	SNP	C	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17836399C>G	uc003stw.1	-	25					SNX13_uc003stv.2_Intron|SNX13_uc010kuc.2_Intron|SNX13_uc010kub.2_Intron			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;						cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					ATGCTAAAAACTCAGAAGAAT	0.234													16	52	---	---	---	---	PASS
ZNF107	51427	broad.mit.edu	37	7	64166913	64166913	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64166913G>C	uc003ttd.2	+	7	1017	c.231G>C	c.(229-231)CAG>CAC	p.Q77H	ZNF107_uc003tte.2_Missense_Mutation_p.Q77H	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	77	C2H2-type 1; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				AAATATTCCAGTGTAATAAAT	0.333													16	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	65222986	65222986	+	Intron	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65222986G>T	uc003tud.1	-						CCT6P1_uc003tug.2_RNA|CCT6P1_uc003tuh.2_RNA|CCT6P1_uc003tui.2_RNA|uc003tuk.1_5'Flank					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		GAATTCTGGCGTTTTTTACAA	0.289													3	20	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82595363	82595363	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82595363C>G	uc003uhx.2	-	4	4030	c.3741G>C	c.(3739-3741)AAG>AAC	p.K1247N	PCLO_uc003uhv.2_Missense_Mutation_p.K1247N	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1186					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTGGGAGTAGCTTTTTGTCTT	0.393													12	534	---	---	---	---	PASS
EPHB4	2050	broad.mit.edu	37	7	100401094	100401094	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100401094G>C	uc003uwn.1	-	17	3444	c.2953C>G	c.(2953-2955)CCG>GCG	p.P985A	EPHB4_uc003uwm.1_Missense_Mutation_p.P892A|EPHB4_uc010lhj.1_Missense_Mutation_p.P933A	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor	985	Cytoplasmic (Potential).|PDZ-binding (Potential).				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					CAGTACTGCGGGGCCGGTCCT	0.662													5	12	---	---	---	---	PASS
HIPK2	28996	broad.mit.edu	37	7	139281488	139281488	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139281488C>T	uc003vvf.3	-	12	2866	c.2692G>A	c.(2692-2694)GAG>AAG	p.E898K	HIPK2_uc003vvd.3_Missense_Mutation_p.E871K	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	898	Interaction with TP53 and TP73.|Required for localization to nuclear speckles (By similarity).|Interaction with UBE2I (By similarity).|SUMO interaction motifs (SIM); required for nuclear localization and kinase activity.			DTDEEEE->NFNQQQQ: Loss of SUMO and CBX4 interaction, and impaired nuclear and PML-nuclear bodies localization.	apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					TTCTGTTCCTCCTCCTCGTCC	0.607													49	154	---	---	---	---	PASS
LRRC61	65999	broad.mit.edu	37	7	150034457	150034457	+	Silent	SNP	T	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150034457T>A	uc003wgv.2	+	3	1181	c.507T>A	c.(505-507)GGT>GGA	p.G169G	LRRC61_uc003wgx.2_Silent_p.G169G|LRRC61_uc003wgw.2_Silent_p.G169G|LRRC61_uc003wgz.3_Silent_p.G169G	NM_023942	NP_076431	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	169	LRRCT.										0			OV - Ovarian serous cystadenocarcinoma(82;0.011)			TTGGGCGTGGTAGTGAGTTCT	0.652													21	63	---	---	---	---	PASS
SLC20A2	6575	broad.mit.edu	37	8	42317465	42317465	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42317465C>T	uc010lxl.2	-	5	1256	c.562G>A	c.(562-564)GCT>ACT	p.A188T	SLC20A2_uc010lxm.2_Missense_Mutation_p.A188T|SLC20A2_uc003xpe.2_Missense_Mutation_p.A188T|SLC20A2_uc011lcu.1_5'UTR	NM_006749	NP_006740	Q08357	S20A2_HUMAN	solute carrier family 20, member 2	188	Cytoplasmic (Potential).				interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			ATGGTAGCAGCATAGAATACT	0.502													10	68	---	---	---	---	PASS
PTTG3P	26255	broad.mit.edu	37	8	67680233	67680233	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67680233G>T	uc011leu.1	-	1	8	c.8C>A	c.(7-9)ACT>AAT	p.T3N	SGK3_uc003xwp.2_Intron|SGK3_uc003xwr.2_Intron	NR_002734				RecName: Full=Securin-3; AltName: Full=Pituitary tumor transforming gene 3 protein;          Short=hPTTG3; AltName: Full=rcPTTG1;												0						ATAGATCAGAGTAGCCATTCT	0.308													6	15	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120638839	120638839	+	Silent	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120638839G>A	uc003yot.1	-	3	344	c.258C>T	c.(256-258)TGC>TGT	p.C86C	ENPP2_uc003yos.1_Silent_p.C86C|ENPP2_uc010mdd.1_Silent_p.C86C	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	86	SMB 1.				cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			AGTCATGGCAGCAACTGGTAT	0.468													3	73	---	---	---	---	PASS
GSDMD	79792	broad.mit.edu	37	8	144643480	144643480	+	Intron	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144643480G>A	uc010mfe.2	+						GSDMD_uc003yyf.2_Intron|GSDMD_uc003yyi.2_3'UTR|GSDMD_uc003yyg.2_Intron|GSDMD_uc003yyh.2_Intron	NM_024736	NP_079012	P57764	GSDMD_HUMAN	gasdermin D												0						TAGGGGAGGGGAGGGGATGCT	0.617													4	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413572	68413572	+	RNA	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413572C>T	uc004aex.2	+	1		c.127C>T								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		CCAGTGGCGCCGGATCTAGGA	0.567													3	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413573	68413573	+	RNA	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413573G>C	uc004aex.2	+	1		c.128G>C								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		CAGTGGCGCCGGATCTAGGAA	0.572													3	16	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116276859	116276859	+	Silent	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116276859G>A	uc004bhq.2	+	16	1808	c.1599G>A	c.(1597-1599)CCG>CCA	p.P533P	RGS3_uc004bhr.2_Silent_p.P421P|RGS3_uc004bhs.2_Silent_p.P423P|RGS3_uc004bht.2_Silent_p.P252P|RGS3_uc010muy.2_Silent_p.P252P|RGS3_uc004bhu.2_Silent_p.P159P	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	533					inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						TTGTGAGGCCGCATGCCACGC	0.587													4	148	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116303802	116303802	+	Intron	SNP	A	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116303802A>T	uc004bhq.2	+						RGS3_uc004bhr.2_3'UTR|RGS3_uc004bhs.2_Intron|RGS3_uc004bht.2_Intron|RGS3_uc010muy.2_Intron|RGS3_uc004bhu.2_3'UTR|RGS3_uc004bhv.2_Intron	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6						inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						GACCTGAAACAGAGGACCAAG	0.547													12	41	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119204736	119204736	+	Silent	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119204736T>C	uc004bjs.1	-	21	3695	c.3594A>G	c.(3592-3594)GCA>GCG	p.A1198A	ASTN2_uc004bjr.1_Silent_p.A1194A|ASTN2_uc004bjt.1_Silent_p.A1147A|ASTN2_uc004bjp.1_Silent_p.A291A|ASTN2_uc004bjq.1_Silent_p.A250A|ASTN2_uc011lxr.1_Silent_p.A250A|ASTN2_uc011lxs.1_Silent_p.A250A|ASTN2_uc011lxt.1_Silent_p.A250A|ASTN2_uc004bjo.1_5'UTR	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	1198	Extracellular (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						ACCTACCTTCTGCCTTGTTGT	0.498													43	197	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37520504	37520504	+	3'UTR	SNP	C	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37520504C>A	uc001iza.1	+	35						NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						GAAAATCTTACCAATAGTCTG	0.353													7	33	---	---	---	---	PASS
C10orf35	219738	broad.mit.edu	37	10	71392632	71392632	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71392632G>T	uc001jpq.3	+	4	353	c.183G>T	c.(181-183)CAG>CAT	p.Q61H		NM_145306	NP_660349	Q96D05	CJ035_HUMAN	hypothetical protein LOC219738	61						integral to membrane				ovary(1)|skin(1)	2						GTGCTGCTCAGTCCCCCTTCA	0.632													8	66	---	---	---	---	PASS
IFIT1	3434	broad.mit.edu	37	10	91162071	91162071	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91162071T>A	uc001kgi.2	+	2	187	c.39T>A	c.(37-39)AGT>AGA	p.S13R	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|IFIT1_uc009xtt.2_Missense_Mutation_p.S13R|IFIT1_uc001kgj.2_5'UTR	NM_001548	NP_001539	P09914	IFIT1_HUMAN	interferon-induced protein with	13					cellular response to exogenous dsRNA|intracellular transport of viral proteins in host cell|negative regulation of defense response to virus by host|negative regulation of helicase activity|negative regulation of protein binding|negative regulation of viral genome replication|positive regulation of viral genome replication|response to virus|type I interferon-mediated signaling pathway	cytoplasm	protein binding				0						TCAAGGATAGTCTGGAGCAAT	0.353													38	160	---	---	---	---	PASS
JAKMIP3	282973	broad.mit.edu	37	10	133961472	133961472	+	Missense_Mutation	SNP	C	T	T	rs138739966	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133961472C>T	uc001lkx.3	+	13	1766	c.1766C>T	c.(1765-1767)ACG>ATG	p.T589M	JAKMIP3_uc009yba.1_Missense_Mutation_p.T26M	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CAAATGGAGACGGAAGAGGCT	0.557													3	18	---	---	---	---	PASS
LRDD	55367	broad.mit.edu	37	11	803579	803579	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:803579G>A	uc001lro.1	-	3	446	c.304C>T	c.(304-306)CGC>TGC	p.R102C	LRDD_uc009yck.1_5'Flank|LRDD_uc001lrk.1_Missense_Mutation_p.R102C|LRDD_uc001lrl.1_Translation_Start_Site|LRDD_uc001lrm.1_Translation_Start_Site|LRDD_uc001lrn.1_Translation_Start_Site|LRDD_uc001lrp.1_Translation_Start_Site	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	102					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGTCCCGGCGTTGCCCTCCT	0.677													5	30	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1087470	1087470	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1087470C>A	uc001lsx.1	+	24	3248	c.3221C>A	c.(3220-3222)GCC>GAC	p.A1074D		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	1074						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TTCTACGAGGCCTGTGTGCAC	0.657													16	74	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18736130	18736130	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18736130C>T	uc009yht.2	-	12	1763	c.1573G>A	c.(1573-1575)GCG>ACG	p.A525T	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	525										ovary(4)|large_intestine(2)|kidney(1)	7						CCAGTGGCCGCGTGCACGTCG	0.612													28	90	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57077445	57077445	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57077445G>A	uc001njr.2	-	5	3052	c.2740C>T	c.(2740-2742)CAC>TAC	p.H914Y	TNKS1BP1_uc001njs.2_Missense_Mutation_p.H914Y|TNKS1BP1_uc009ymd.1_Missense_Mutation_p.H365Y	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	914	Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				CTACCATGGTGGTCCCTCTTC	0.572													66	285	---	---	---	---	PASS
SERPING1	710	broad.mit.edu	37	11	57373959	57373959	+	Missense_Mutation	SNP	C	G	G	rs61761890		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57373959C>G	uc001nkp.1	+	6	1159	c.968C>G	c.(967-969)CCC>CGC	p.P323R	SERPING1_uc001nkq.1_Missense_Mutation_p.P323R|SERPING1_uc010rju.1_Missense_Mutation_p.P271R|SERPING1_uc010rjv.1_Missense_Mutation_p.P328R|SERPING1_uc001nkr.1_Missense_Mutation_p.P323R|SERPING1_uc009ymi.1_Missense_Mutation_p.P332R|SERPING1_uc009ymj.1_Missense_Mutation_p.P323R|SERPING1_uc001nks.1_Missense_Mutation_p.P14R	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	323					blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1						ATAAAAGTGCCCATGATGAAT	0.428									Hereditary_Angioedema				46	200	---	---	---	---	PASS
SLC22A8	9376	broad.mit.edu	37	11	62760819	62760819	+	Intron	SNP	A	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62760819A>G	uc001nwo.2	-						SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_3'UTR|SLC22A8_uc009yom.2_Intron|SLC22A8_uc010rmm.1_Intron|SLC22A8_uc009yon.2_Intron	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8						response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						CTAGGGACAGAGAGCTAAGGA	0.607													20	74	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92018	92018	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92018T>C	uc010sdi.1	-	2	320	c.292A>G	c.(292-294)AGT>GGT	p.S98G	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		GACTCCACACTCTCCTGGGTT	0.592													6	11	---	---	---	---	PASS
SENP1	29843	broad.mit.edu	37	12	48442848	48442848	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48442848G>A	uc001rqx.2	-	14	1921	c.1475C>T	c.(1474-1476)GCA>GTA	p.A492V	SENP1_uc001rqw.2_Missense_Mutation_p.A492V|SENP1_uc001rqy.2_Missense_Mutation_p.A293V|SENP1_uc001rqz.2_Missense_Mutation_p.A293V|SENP1_uc009zkx.2_Missense_Mutation_p.A492V	NM_014554	NP_055369	Q9P0U3	SENP1_HUMAN	sentrin/SUMO-specific protease 1	492	Protease.				activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity			pancreas(2)|lung(1)	3		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				GGTATTAAATGCATGCACACT	0.363													40	140	---	---	---	---	PASS
KRT82	3888	broad.mit.edu	37	12	52793886	52793886	+	Silent	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52793886C>T	uc001sai.1	-	5	940	c.825G>A	c.(823-825)GTG>GTA	p.V275V		NM_033033	NP_149022	Q9NSB4	KRT82_HUMAN	keratin 82	275	Linker 12.|Rod.					keratin filament	protein binding|structural constituent of epidermis			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.193)		TGTCCATCTTCACAATGACCG	0.602													23	93	---	---	---	---	PASS
BLOC1S1	2647	broad.mit.edu	37	12	56113258	56113258	+	3'UTR	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56113258T>C	uc009zny.1	+	3					BLOC1S1_uc001shi.2_Intron|BLOC1S1_uc001shj.3_Intron|RDH5_uc010spt.1_5'Flank|RDH5_uc010spu.1_5'Flank|RDH5_uc001shk.2_5'Flank|RDH5_uc001shl.2_5'Flank			P78537	BL1S1_HUMAN	RecName: Full=Biogenesis of lysosome-related organelles complex 1 subunit 1;          Short=BLOC-1 subunit 1; AltName: Full=GCN5-like protein 1; AltName: Full=Protein RT14;						cellular membrane organization|melanosome organization|platelet dense granule organization|post-Golgi vesicle-mediated transport	BLOC-1 complex|lysosomal membrane	protein binding				0						ATTCCTGGGCTCCCACCTCCT	0.527													16	66	---	---	---	---	PASS
MYO1A	4640	broad.mit.edu	37	12	57437906	57437906	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57437906C>T	uc001smw.3	-	9	971	c.728G>A	c.(727-729)AGC>AAC	p.S243N	MYO1A_uc010sqz.1_Missense_Mutation_p.S81N|MYO1A_uc009zpd.2_Missense_Mutation_p.S243N	NM_005379	NP_005370	Q9UBC5	MYO1A_HUMAN	myosin IA	243	Myosin head-like.				sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|urinary_tract(1)	7						AGCCCTGAAGCTGGAGGCGTC	0.562													20	75	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85546098	85546098	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85546098G>A	uc001tac.2	+	20	4481	c.4370G>A	c.(4369-4371)CGC>CAC	p.R1457H		NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1457										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		GATTCCACCCGCTTCCCTTCA	0.378													16	119	---	---	---	---	PASS
CCDC63	160762	broad.mit.edu	37	12	111290728	111290728	+	Translation_Start_Site	SNP	C	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111290728C>A	uc001trv.1	+	2	165	c.-30C>A	c.(-32--28)GTCTG>GTATG		CCDC63_uc009zvt.1_Intron|CCDC63_uc010sye.1_Intron|CCDC63_uc001trw.1_Intron	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63											skin(6)|ovary(1)|pancreas(1)	8						GGTACAGTGTCTGAGTGGAGG	0.388													18	79	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29608253	29608253	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29608253G>T	uc001usl.3	+	2	2525	c.2467G>T	c.(2467-2469)GAT>TAT	p.D823Y		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	813	Sufficient for interaction with KIF2C.|Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						CTACAGTTCCGATCCTTCAGG	0.458													11	54	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33332255	33332255	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33332255G>C	uc010abf.2	+	27	3245	c.3087G>C	c.(3085-3087)ATG>ATC	p.M1029I	PDS5B_uc010abg.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	1029					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AAATATTAATGGCTAAAAATG	0.239													16	39	---	---	---	---	PASS
HNRNPC	3183	broad.mit.edu	37	14	21679266	21679266	+	3'UTR	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21679266G>A	uc001vzy.2	-	9					HNRNPC_uc001vzw.2_3'UTR|HNRNPC_uc001wad.2_3'UTR|HNRNPC_uc001vzx.2_RNA|HNRNPC_uc001vzz.2_3'UTR|HNRNPC_uc001waa.2_3'UTR|HNRNPC_uc010ail.2_3'UTR|HNRNPC_uc010tlq.1_RNA|HNRNPC_uc001wab.2_3'UTR|HNRNPC_uc001wac.2_3'UTR|HNRNPC_uc010tlr.1_3'UTR|HNRNPC_uc001waf.2_3'UTR|HNRNPC_uc001wae.2_3'UTR	NM_031314	NP_112604	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C							catalytic step 2 spliceosome|nucleoplasm	identical protein binding|nucleotide binding|RNA binding				0	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		AGGATGGGGAGAACAGTGAGC	0.418													3	51	---	---	---	---	PASS
GZMH	2999	broad.mit.edu	37	14	25076508	25076508	+	Silent	SNP	A	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25076508A>C	uc001wpr.1	-	4	489	c.444T>G	c.(442-444)GGT>GGG	p.G148G	GZMH_uc010aly.1_Intron|GZMH_uc010alz.1_Intron	NM_033423	NP_219491	P20718	GRAH_HUMAN	granzyme H precursor	148	Peptidase S1.				apoptosis|cytolysis|proteolysis	cytoplasm	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(265;0.0267)		TTGAGACATAACCCCAGCCAG	0.557													10	69	---	---	---	---	PASS
ZBTB1	22890	broad.mit.edu	37	14	64988623	64988623	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64988623A>T	uc001xhh.3	+	4	832	c.401A>T	c.(400-402)CAG>CTG	p.Q134L	ZBTB1_uc010aqg.2_Missense_Mutation_p.Q134L|ZBTB1_uc001xhi.2_Missense_Mutation_p.Q134L	NM_001123329	NP_001116801	Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1 isoform	134					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		TCCAGCAAACAGAACAGCAAA	0.418													37	148	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51758414	51758414	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51758414T>C	uc002abf.2	-	30	7709	c.7484A>G	c.(7483-7485)CAA>CGA	p.Q2495R	DMXL2_uc002abd.2_Missense_Mutation_p.Q566R|DMXL2_uc010ufy.1_Missense_Mutation_p.Q2496R|DMXL2_uc010bfa.2_Missense_Mutation_p.Q1859R	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2495						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		CTCCTGTATTTGTGTATCTGA	0.313													27	153	---	---	---	---	PASS
CYP1A1	1543	broad.mit.edu	37	15	75013623	75013623	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75013623G>C	uc002ayp.3	-	5	1205	c.1083C>G	c.(1081-1083)GAC>GAG	p.D361E	CYP1A1_uc010bjv.2_RNA|CYP1A1_uc010bjw.2_RNA|CYP1A1_uc010bju.2_Missense_Mutation_p.D97E|CYP1A1_uc010bjx.2_Missense_Mutation_p.D97E|CYP1A1_uc002ayq.3_Missense_Mutation_p.D361E|CYP1A1_uc010bjy.2_Missense_Mutation_p.D361E|CYP1A1_uc010bjz.1_Missense_Mutation_p.D97E	NM_000499	NP_000490	P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A,	361					cellular lipid metabolic process|drug metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|vitamin D 24-hydroxylase activity			ovary(2)|breast(2)|pancreas(1)	5					Arsenic trioxide(DB01169)|Benzphetamine(DB00865)|Bleomycin(DB00290)|Chlorzoxazone(DB00356)|Dacarbazine(DB00851)|Dactinomycin(DB00970)|Esomeprazole(DB00736)|Estrone(DB00655)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Ginseng(DB01404)|Granisetron(DB00889)|Ketoconazole(DB01026)|Menadione(DB00170)|Picrotoxin(DB00466)|Primaquine(DB01087)|Quinidine(DB00908)|Quinine(DB00468)|Thiabendazole(DB00730)	GATGGGATCTGTCAGAGAGCC	0.612									Endometrial_Cancer_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia				14	86	---	---	---	---	PASS
DNAJA4	55466	broad.mit.edu	37	15	78572439	78572439	+	Silent	SNP	C	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78572439C>G	uc002bdj.1	+	6	1047	c.930C>G	c.(928-930)CCC>CCG	p.P310P	DNAJA4_uc002bdi.2_Silent_p.P339P|DNAJA4_uc002bdk.2_Silent_p.P283P|DNAJA4_uc002bdm.1_Silent_p.P94P	NM_001130182	NP_001123654	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	310					protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding			skin(1)	1						AAGGAATGCCCATCTACAAAG	0.458													19	99	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81601087	81601087	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81601087T>A	uc002bgh.3	+	19	4323	c.3947T>A	c.(3946-3948)ATC>AAC	p.I1316N	IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.I1357N|IL16_uc002bgg.2_Missense_Mutation_p.I1315N|IL16_uc002bgj.2_Missense_Mutation_p.I809N|IL16_uc002bgk.2_Missense_Mutation_p.I615N	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	1316	PDZ 4.				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						ACGATTGTCATCAGGAGAAAA	0.527													4	109	---	---	---	---	PASS
RHCG	51458	broad.mit.edu	37	15	90039695	90039695	+	Silent	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90039695C>T	uc002bnz.2	-	1	105	c.81G>A	c.(79-81)GGG>GGA	p.G27G	RHCG_uc002boa.2_RNA|RHCG_uc010bnq.1_5'UTR	NM_016321	NP_057405	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	27	Helical; (Potential).				amine transport|cellular ion homeostasis|epithelial cell differentiation|transepithelial ammonium transport	apical plasma membrane|basolateral plasma membrane|cytoplasmic vesicle|integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			kidney(1)	1	Lung NSC(78;0.0237)|all_lung(78;0.0478)					GCACGAACACCCCGAAGAGAA	0.607													27	182	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652													4	13	---	---	---	---	PASS
DNASE1L2	1775	broad.mit.edu	37	16	2288520	2288520	+	3'UTR	SNP	A	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2288520A>G	uc002cpo.2	+	6					DNASE1L2_uc002cpn.2_3'UTR|DNASE1L2_uc002cpp.2_3'UTR|DNASE1L2_uc002cpq.2_3'UTR	NM_001374	NP_001365	Q92874	DNSL2_HUMAN	deoxyribonuclease I-like 2 precursor						DNA catabolic process	extracellular region	calcium ion binding|DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters|protein binding				0						GTGAGGCCCCAAGGCAGAGTC	0.438													8	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	15023180	15023180	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15023180C>T	uc010uzk.1	+	6	1025	c.749C>T	c.(748-750)TCG>TTG	p.S250L	NPIP_uc002dcx.3_RNA					SubName: Full=cDNA FLJ57488, highly similar to Polycystin-1;																		GAGTCACCATCGCGGATGGTG	0.667													3	28	---	---	---	---	PASS
TCF25	22980	broad.mit.edu	37	16	89949958	89949958	+	Intron	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89949958G>T	uc002fpb.2	+						TCF25_uc010vpp.1_3'UTR|TCF25_uc002fpc.2_5'Flank	NM_014972	NP_055787	Q9BQ70	TCF25_HUMAN	NULP1						heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		CATCAGACGGGAGAGTTCCAA	0.552													10	18	---	---	---	---	PASS
POLR2A	5430	broad.mit.edu	37	17	7417116	7417116	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7417116T>C	uc002ghf.3	+	29	5767	c.5533T>C	c.(5533-5535)TCT>CCT	p.S1845P		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	1845	36.|52 X 7 AA approximate tandem repeats of Y-[ST]-P-[STQ]-[ST]-P-[SRTEVKGN].				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				AACCAGTCCTTCTTACAGTCC	0.438													61	248	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7630455	7630455	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7630455T>C	uc002giu.1	+	3	258	c.244T>C	c.(244-246)TCC>CCC	p.S82P	DNAH2_uc002git.2_Missense_Mutation_p.S82P|DNAH2_uc010vuk.1_Missense_Mutation_p.S82P	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	82	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTCTTCCTTTCCCGAGCTGC	0.537													42	121	---	---	---	---	PASS
SLFN13	146857	broad.mit.edu	37	17	33767432	33767432	+	3'UTR	SNP	A	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33767432A>G	uc002hjk.1	-	4					SLFN13_uc010wch.1_3'UTR|SLFN13_uc002hjl.2_3'UTR|SLFN13_uc010ctt.2_3'UTR|SLFN13_uc002hjm.2_3'UTR	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13							intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		tgctgaaaagagttgggggag	0.000													3	16	---	---	---	---	PASS
HSF5	124535	broad.mit.edu	37	17	56565201	56565201	+	Silent	SNP	G	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56565201G>T	uc002iwi.1	-	1	559	c.435C>A	c.(433-435)CCC>CCA	p.P145P		NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	145	By similarity.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCGGGCGGCAGGGCACCTCCA	0.637													2	1	---	---	---	---	PASS
USP32	84669	broad.mit.edu	37	17	58282987	58282987	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58282987A>C	uc002iyo.1	-	26	3356	c.3070T>G	c.(3070-3072)TTC>GTC	p.F1024V	USP32_uc002iyn.1_Missense_Mutation_p.F694V	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	1024					protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			GTTAGGGTGAACATTTCATTT	0.398													27	162	---	---	---	---	PASS
ANGPTL4	51129	broad.mit.edu	37	19	8429515	8429515	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8429515A>T	uc002mjq.1	+	1	505	c.310A>T	c.(310-312)AGC>TGC	p.S104C	ANGPTL4_uc002mjr.1_Missense_Mutation_p.S104C|ANGPTL4_uc010xkc.1_5'UTR	NM_139314	NP_647475	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4 protein isoform a precursor	104	Potential.				angiogenesis|cell differentiation|cellular lipid metabolic process|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|positive regulation of angiogenesis|response to hypoxia|signal transduction|triglyceride homeostasis	extracellular space|proteinaceous extracellular matrix	enzyme inhibitor activity|receptor binding			ovary(1)	1						GGTCCTTCACAGCCTGCAGGT	0.706													4	15	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8997497	8997497	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8997497G>C	uc002mkp.2	-	59	41129	c.40925C>G	c.(40924-40926)ACC>AGC	p.T13642S	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.T459S|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13644	Extracellular (Potential).|SEA 11.			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTTGGTGATGGTGAAGTTGAG	0.527													20	79	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45857991	45857991	+	Silent	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45857991C>T	uc002pbj.2	-	17	1709	c.1662G>A	c.(1660-1662)GAG>GAA	p.E554E	ERCC2_uc002pbh.2_Silent_p.E117E|ERCC2_uc002pbi.2_Silent_p.E247E|ERCC2_uc010ejz.2_Silent_p.E476E|ERCC2_uc002pbk.2_Silent_p.E530E	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent	554	Mediates interaction with MMS19.				cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GGCGTACCTGCTCATACCAGG	0.602			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				30	165	---	---	---	---	PASS
HIF3A	64344	broad.mit.edu	37	19	46811988	46811988	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46811988A>C	uc002peh.2	+	5	546	c.517A>C	c.(517-519)ACC>CCC	p.T173P	HIF3A_uc002pef.1_Missense_Mutation_p.T173P|HIF3A_uc002peg.3_Missense_Mutation_p.T173P|HIF3A_uc010xxx.1_RNA|HIF3A_uc002pei.3_Missense_Mutation_p.T117P|HIF3A_uc002pej.1_Missense_Mutation_p.T104P|HIF3A_uc002pek.2_Missense_Mutation_p.T117P|HIF3A_uc010xxy.1_Missense_Mutation_p.T104P|HIF3A_uc002pel.2_Missense_Mutation_p.T171P|HIF3A_uc010xxz.1_Missense_Mutation_p.T122P	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	173					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		GAGTACACTCACCAGCCGCGG	0.721													4	19	---	---	---	---	PASS
TTYH1	57348	broad.mit.edu	37	19	54947546	54947546	+	3'UTR	SNP	A	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54947546A>C	uc002qfq.2	+	14					TTYH1_uc002qfr.2_Nonstop_Mutation_p.*461Y|TTYH1_uc002qft.2_3'UTR	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1						cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		GACCCCACTAACCCAGCCTGC	0.642													12	103	---	---	---	---	PASS
ZNF543	125919	broad.mit.edu	37	19	57839655	57839655	+	Silent	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57839655G>A	uc002qoi.1	+	4	1170	c.825G>A	c.(823-825)CGG>CGA	p.R275R		NM_213598	NP_998763	Q08ER8	ZN543_HUMAN	zinc finger protein 543	275	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GGCACCAGCGGATTCACAGTG	0.522													14	68	---	---	---	---	PASS
SEMG2	6407	broad.mit.edu	37	20	43835668	43835668	+	5'UTR	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43835668G>A	uc010ggz.2	+	1					SEMG1_uc002xni.2_5'UTR|SEMG1_uc002xnj.2_5'UTR|SEMG1_uc002xnh.2_5'Flank	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor						sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				GGTCGGCTCAGCTCTCAGACA	0.438													30	98	---	---	---	---	PASS
SEMG2	6407	broad.mit.edu	37	20	43835669	43835669	+	5'UTR	SNP	C	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43835669C>G	uc010ggz.2	+	1					SEMG1_uc002xni.2_5'UTR|SEMG1_uc002xnj.2_5'UTR|SEMG1_uc002xnh.2_5'Flank	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor						sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				GTCGGCTCAGCTCTCAGACAA	0.433													31	96	---	---	---	---	PASS
WFDC3	140686	broad.mit.edu	37	20	44402954	44402954	+	3'UTR	SNP	G	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44402954G>C	uc002xpf.1	-	7					WFDC3_uc002xpj.1_RNA|WFDC3_uc002xph.1_RNA|WFDC3_uc010ghh.1_RNA	NM_080614	NP_542181	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				AAGCAGAGCAGAGAGGGCCAT	0.547													3	18	---	---	---	---	PASS
CCT8	10694	broad.mit.edu	37	21	30442608	30442608	+	Silent	SNP	C	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30442608C>T	uc002ynb.2	-	2	210	c.111G>A	c.(109-111)AAG>AAA	p.K37K	CCT8_uc011acp.1_Silent_p.K18K|CCT8_uc002yna.2_5'UTR|CCT8_uc002ync.2_Silent_p.K37K|CCT8_uc010glm.2_Silent_p.K37K|CCT8_uc011acq.1_5'UTR	NM_006585	NP_006576	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	37					'de novo' posttranslational protein folding	aggresome|cytosol|intermediate filament cytoskeleton|microtubule organizing center	ATP binding|ATPase activity, coupled|unfolded protein binding				0						GGGCAAGCTCCTTGCAAGCTT	0.358													13	69	---	---	---	---	PASS
SLC5A3	6526	broad.mit.edu	37	21	35467431	35467431	+	5'UTR	SNP	T	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35467431T>G	uc002yto.2	+	2					MRPS6_uc002ytp.2_Intron	NM_006933	NP_008864	P53794	SC5A3_HUMAN	solute carrier family 5 (inositol transporters),							integral to plasma membrane	myo-inositol:sodium symporter activity			ovary(2)	2						TTGGCTGGGGTTACTAAAAAT	0.438													11	61	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37653892	37653892	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37653892A>C	uc002yvg.2	+	32	6222	c.6143A>C	c.(6142-6144)TAC>TCC	p.Y2048S	DOPEY2_uc011aeb.1_Missense_Mutation_p.Y1997S	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	2048					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TACCACCTTTACCTTCCACTG	0.264													8	33	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41566499	41566499	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41566499A>T	uc003azl.3	+	27	4771	c.4376A>T	c.(4375-4377)AAG>ATG	p.K1459M		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1459					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						AAGATACCCAAGCCCAAGCGA	0.468			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				30	126	---	---	---	---	PASS
MAGEB6	158809	broad.mit.edu	37	X	26212326	26212326	+	Silent	SNP	C	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26212326C>G	uc004dbr.2	+	2	512	c.363C>G	c.(361-363)GGC>GGG	p.G121G	MAGEB6_uc010ngc.1_Intron	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	121	Ser-rich.									ovary(3)	3						GTGTTTCAGGCTCAAAATATG	0.542													35	41	---	---	---	---	PASS
CFP	5199	broad.mit.edu	37	X	47483960	47483960	+	Intron	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47483960T>C	uc004dig.3	-						CFP_uc004dih.2_Intron|CFP_uc004dii.1_3'UTR|CFP_uc010nhu.2_3'UTR	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor						complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						ttttttttccttttttttttt	0.090													2	3	---	---	---	---	PASS
ZNF182	7569	broad.mit.edu	37	X	47836772	47836772	+	Silent	SNP	T	C	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47836772T>C	uc004dir.2	-	7	1060	c.714A>G	c.(712-714)GCA>GCG	p.A238A	ZNF182_uc004dis.2_Silent_p.A219A|ZNF182_uc004dit.2_Silent_p.A238A|ZNF182_uc011mlu.1_Silent_p.A218A	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1	238	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						TTTTCCTACATGCAGTACATT	0.408													40	76	---	---	---	---	PASS
BEX2	84707	broad.mit.edu	37	X	102564580	102564580	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102564580G>A	uc004ekb.2	-	3	564	c.325C>T	c.(325-327)CGG>TGG	p.R109W	BEX2_uc004eka.2_Missense_Mutation_p.R138W	NM_032621	NP_116010	Q9BXY8	BEX2_HUMAN	brain expressed X-linked 2	109					apoptosis|cell cycle|regulation of apoptosis|regulation of cell cycle	cytoplasm|nucleus				ovary(1)	1						CTGACTGCCCGCAAACTATGA	0.507													5	215	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	10241	10242	+	5'Flank	INS	-	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10241_10242insA	uc001aaa.3	+						uc010nxq.1_5'Flank|uc010nxr.1_5'Flank					Homo sapiens mRNA for DEAD/H box polypeptide 11 like 1 (DDX11L1 gene).																		cccctaaccctaaccctaaacc	0.000													8	8	---	---	---	---	
VPS13D	55187	broad.mit.edu	37	1	12429285	12429286	+	Intron	DEL	TG	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12429285_12429286delTG	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		tgtgtgtatctgtgtgtgtgtg	0.277													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	171768428	171768429	+	IGR	INS	-	GT	GT	rs150457744	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171768428_171768429insGT								METTL13 (1573 upstream) : DNM3 (42192 downstream)																							tgcgtgtgtgcgtgtgtgtgtg	0.104													3	3	---	---	---	---	
CFH	3075	broad.mit.edu	37	1	196684517	196684517	+	Intron	DEL	A	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196684517delA	uc001gtj.3	+							NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor						complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						TTAAGCAATGAAAAAAAATGT	0.274													4	2	---	---	---	---	
NAV1	89796	broad.mit.edu	37	1	201792498	201792499	+	3'UTR	INS	-	TA	TA	rs140203725	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201792498_201792499insTA	uc001gwu.2	+	29					NAV1_uc001gwx.2_3'UTR	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						ctgcgtgtgtgtgtgtgtgtgt	0.327													4	2	---	---	---	---	
C2orf63	130162	broad.mit.edu	37	2	55403284	55403285	+	Intron	INS	-	TCA	TCA	rs137945910	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55403284_55403285insTCA	uc002ryi.2	-						C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Intron	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1								binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			CTCAGTCAAGCTCATGGTAAGT	0.381													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	119017912	119017913	+	IGR	INS	-	GTGT	GTGT	rs148892473	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119017912_119017913insGTGT								INSIG2 (150316 upstream) : EN1 (581835 downstream)																							GAATAGGAGGGgtgtgtgtgtg	0.332													4	3	---	---	---	---	
COL3A1	1281	broad.mit.edu	37	2	189850622	189850625	+	Intron	DEL	TGTA	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189850622_189850625delTGTA	uc002uqj.1	+							NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	TCTGATTCAGTGTATTtaataaat	0.191													5	5	---	---	---	---	
C2orf60	129450	broad.mit.edu	37	2	200803934	200803935	+	Intron	DEL	TC	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200803934_200803935delTC	uc002uvi.3	-						C2orf60_uc002uvj.3_Intron|C2orf60_uc002uvk.3_Intron|C2orf60_uc010fss.2_Intron	NM_001039693	NP_001034782	A2RUC4	TYW5_HUMAN	hypothetical protein LOC129450						wybutosine biosynthetic process		iron ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein homodimerization activity|tRNA binding				0						tctctatctttctctctctctc	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	203044992	203044993	+	Intron	INS	-	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203044992_203044993insA	uc002uyy.1	+											RecName: Full=Uncharacterized protein KIAA2012;																		gaaactcctccaaaaaaaaaaa	0.119													8	4	---	---	---	---	
C3orf48	151649	broad.mit.edu	37	3	20049278	20049279	+	Intron	DEL	AG	-	-	rs11442155		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20049278_20049279delAG	uc003cbp.3	-						C3orf48_uc010hez.2_Intron					RecName: Full=PP2C-like domain-containing protein C3orf48;												0						aaaaaaaaaaaGAGAGAGAGAG	0.188													4	3	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49318012	49318012	+	Intron	DEL	G	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49318012delG	uc003cwq.2	-						USP4_uc003cwo.2_Intron|USP4_uc003cwp.2_Intron|USP4_uc003cwr.2_Intron	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		aaaaaaaaaagaattaaaaaa	0.209													6	3	---	---	---	---	
GBE1	2632	broad.mit.edu	37	3	81541861	81541868	+	Intron	DEL	TTCCTTCC	-	-	rs67220037		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541861_81541868delTTCCTTCC	uc003dqg.2	-							NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		ctttcttcctttccttccttccttcctt	0.000									Glycogen_Storage_Disease_type_IV				4	4	---	---	---	---	
ILDR1	286676	broad.mit.edu	37	3	121720858	121720866	+	Intron	DEL	GTGCCTATA	-	-	rs74268689		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121720858_121720866delGTGCCTATA	uc003ees.2	-						ILDR1_uc003eeq.2_Intron|ILDR1_uc003eer.2_Intron|ILDR1_uc010hrg.2_Intron	NM_175924	NP_787120	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor							cytosol|integral to membrane|plasma membrane	receptor activity			skin(1)	1				GBM - Glioblastoma multiforme(114;0.156)		atggtggcatgtgcctatagtcccagctt	0.067													6	3	---	---	---	---	
RPN1	6184	broad.mit.edu	37	3	128339072	128339072	+	3'UTR	DEL	G	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128339072delG	uc003ekr.1	-	10					RPN1_uc011bkq.1_3'UTR	NM_002950	NP_002941	P04843	RPN1_HUMAN	ribophorin I precursor						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.189)		aaaaaaaaaaGAAAGTTAAGG	0.338			T	EVI1	AML								3	3	---	---	---	---	
DNAJC13	23317	broad.mit.edu	37	3	132219394	132219394	+	Intron	DEL	C	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132219394delC	uc003eor.2	+							NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2						tttggcagtacaaagaccatg	0.129													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156978684	156978688	+	IGR	DEL	TTTTA	-	-	rs71740874		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156978684_156978688delTTTTA								CCNL1 (100202 upstream) : VEPH1 (10 downstream)																							CTGTAGCTCCTTTTATTTTATTTTA	0.361													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184392108	184392109	+	IGR	INS	-	GT	GT	rs141673109	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184392108_184392109insGT								EPHB3 (91913 upstream) : MAGEF1 (36047 downstream)																							tctcctttgtcgtgtgtgtgtg	0.119													3	3	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54374598	54374599	+	Intron	INS	-	T	T	rs142889716	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54374598_54374599insT	uc003haa.2	+						LNX1_uc003haf.3_Intron|LNX1_uc003hag.3_Intron|LNX1_uc003hah.3_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	ATAATTTGAGATTTTTTAAAGA	0.396			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			5	5	---	---	---	---	
NHEDC1	150159	broad.mit.edu	37	4	103832838	103832839	+	Intron	DEL	AT	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103832838_103832839delAT	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN	Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)		TTATAGTGACATATATGAAAAC	0.277													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	120299625	120299626	+	Intron	INS	-	T	T	rs72102607		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120299625_120299626insT	uc003icx.1	+											Homo sapiens cDNA FLJ40382 fis, clone TESTI2035775.																		GAATAGCTAGGttttttttttt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	131609735	131609736	+	IGR	DEL	TG	-	-	rs72359323		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131609735_131609736delTG								None (None upstream) : None (None downstream)																							TGTTTTTTGTtgtgtgtgtgtg	0.347													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	191043942	191043943	+	IGR	INS	-	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:191043942_191043943insA								LOC653545 (33766 upstream) : None (None downstream)																							gggttagggttgggttagggtt	0.000													7	5	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59183548	59183549	+	Intron	DEL	GT	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59183548_59183549delGT	uc003jsa.2	-						PDE4D_uc003jsb.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	CAAGCCATCAgtgtgtgtgtgt	0.267													5	4	---	---	---	---	
CEP120	153241	broad.mit.edu	37	5	122736399	122736399	+	Intron	DEL	A	-	-	rs35093126		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122736399delA	uc003ktk.2	-						CEP120_uc011cwq.1_Intron|CEP120_uc010jcz.1_Intron	NM_153223	NP_694955	Q8N960	CE120_HUMAN	coiled-coil domain containing 100							centrosome				ovary(1)	1						ATTTTGGACCAAAAAAAAAAA	0.338													4	3	---	---	---	---	
FAT2	2196	broad.mit.edu	37	5	150909139	150909139	+	Intron	DEL	T	-	-	rs113377880		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150909139delT	uc003lue.3	-						GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor						epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATCTCCCTCATTTTTCTTTAT	0.393													3	4	---	---	---	---	
ORC3L	23595	broad.mit.edu	37	6	88311389	88311390	+	Intron	INS	-	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88311389_88311390insA	uc003pmh.2	+						ORC3L_uc011dzl.1_Intron|ORC3L_uc011dzm.1_Intron|ORC3L_uc011dzn.1_Intron|ORC3L_uc003pmg.2_Intron|ORC3L_uc003pmi.2_Intron|ORC3L_uc011dzo.1_Intron|ORC3L_uc011dzp.1_Intron	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		gactccatatcaaaaaaaaaaa	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	128901157	128901158	+	IGR	INS	-	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128901157_128901158insT								PTPRK (59287 upstream) : LAMA2 (303128 downstream)																							tcttttctttcttttttttttt	0.267													5	6	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34193010	34193011	+	3'UTR	INS	-	TA	TA	rs140714031	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34193010_34193011insTA	uc011kap.1	+	15						NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						Gtatatatgtgtatatatatat	0.307													6	3	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76627902	76627903	+	Intron	INS	-	GTGTGGGGG	GTGTGGGGG	rs149990883	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76627902_76627903insGTGTGGGGG	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						tggagttgggtgtgtgggtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93031971	93031974	+	IGR	DEL	CGCA	-	-	rs60959428		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93031971_93031974delCGCA								CCDC132 (43634 upstream) : CALCR (21825 downstream)																							cgcgcgcgcgcgcacgcacgtgca	0.034													4	2	---	---	---	---	
AGPAT5	55326	broad.mit.edu	37	8	6576536	6576537	+	Intron	INS	-	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6576536_6576537insA	uc003wqo.2	+						AGPAT5_uc011kwm.1_Intron	NM_018361	NP_060831	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5						phospholipid biosynthetic process	integral to membrane|mitochondrion	1-acylglycerol-3-phosphate O-acyltransferase activity				0			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		AACAGGCTATGAATGAGTACCT	0.327													19	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142551266	142551284	+	IGR	DEL	CACACACACACCACACAGA	-	-	rs35734448		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142551266_142551284delCACACACACACCACACAGA								FLJ43860 (33936 upstream) : MIR1302-7 (316319 downstream)																							gcacacacaccacacacacaccacacagacacacacaca	0.000													4	3	---	---	---	---	
TMEM2	23670	broad.mit.edu	37	9	74344537	74344537	+	Intron	DEL	A	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74344537delA	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		ctgtctcgagaaaaaaaaaaa	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	91197527	91197530	+	IGR	DEL	CTTC	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91197527_91197530delCTTC								NXNL2 (6824 upstream) : LOC286238 (64564 downstream)																							tccttcctttcttccttccttcct	0.059													4	2	---	---	---	---	
C9orf5	23731	broad.mit.edu	37	9	111795939	111795954	+	Intron	DEL	AATATTGAGATGCAAC	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111795939_111795954delAATATTGAGATGCAAC	uc004bdt.3	-						C9orf5_uc004bds.3_Intron|C9orf5_uc004bdr.3_Intron	NM_032012	NP_114401	Q9H330	CI005_HUMAN	hypothetical protein LOC23731							integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)		TGACTGCAATAATATTGAGATGCAACAATATTGAGA	0.329													4	2	---	---	---	---	
PRPF4	9128	broad.mit.edu	37	9	116052508	116052508	+	Intron	DEL	A	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116052508delA	uc004bgx.2	+						PRPF4_uc004bgy.2_Intron	NM_004697	NP_004688	O43172	PRP4_HUMAN	PRP4 pre-mRNA processing factor 4 homolog							Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding			ovary(2)|pancreas(1)	3						tcaaaagaagaaaaaaaaaaa	0.189													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	5619190	5619191	+	IGR	DEL	CA	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5619190_5619191delCA								CALML3 (50965 upstream) : ASB13 (61629 downstream)																							acacataccccacacacacacc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38746696	38746698	+	IGR	DEL	ATC	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38746696_38746698delATC								LOC399744 (5616 upstream) : None (None downstream)																							GGAAGGAGAAATCATAGATTTTT	0.394													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467884	52467886	+	IGR	DEL	TCC	-	-	rs57441530		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467884_52467886delTCC								SGMS1 (82961 upstream) : ASAH2B (31810 downstream)																							CATCTTCACGTCCTTCTCTCACA	0.389													4	2	---	---	---	---	
TPH1	7166	broad.mit.edu	37	11	18042321	18042322	+	3'UTR	INS	-	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18042321_18042322insA	uc001mnp.2	-	10					TPH1_uc009yhe.2_RNA	NM_004179	NP_004170	P17752	TPH1_HUMAN	tryptophan hydroxylase 1						aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity				0					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	AAGCTGCTACCAAAAAAAAAAA	0.307													3	3	---	---	---	---	
ACCSL	390110	broad.mit.edu	37	11	44072390	44072390	+	Intron	DEL	C	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44072390delC	uc001mxw.1	+						ACCSL_uc009ykr.2_Intron	NM_001031854	NP_001027025	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase								1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(5)	5						GGCCTGAGttctttttttttt	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	47212650	47212651	+	IGR	INS	-	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47212650_47212651insA								PACSIN3 (4692 upstream) : DDB2 (23842 downstream)																							aactccgtctcaaaaaaaaaag	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	87191989	87191989	+	IGR	DEL	T	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87191989delT								TMEM135 (157421 upstream) : RAB38 (654442 downstream)																							CTCACCCAGCTTTTTTTTGCC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123908612	123908615	+	IGR	DEL	AACA	-	-	rs138236826	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123908612_123908615delAACA								OR10G8 (7347 upstream) : OR10G7 (158 downstream)																							CTAGGATTCTAACAAACACTCTGC	0.279													3	3	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48253630	48253649	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCT	-	-	rs60761635		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48253630_48253649delTTCCTTCCTTCCTTCCTTCT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	tttcccttccttccttccttccttccttctttccttcctt	0.036													6	4	---	---	---	---	
WNT10B	7480	broad.mit.edu	37	12	49365643	49365650	+	5'Flank	DEL	CGCGCACA	-	-	rs63189361		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49365643_49365650delCGCGCACA	uc001rss.2	-						WNT10B_uc001rst.2_5'Flank	NM_003394	NP_003385	O00744	WN10B_HUMAN	wingless-type MMTV integration site family,						axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			skin(4)|lung(3)	7						cgcgcgcgcgcgcgcacacacacacaca	0.466													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22546112	22546113	+	IGR	DEL	TG	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22546112_22546113delTG								FGF9 (267472 upstream) : None (None downstream)																							gtgtatggaatgtgtgtgtgtg	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	54616412	54616415	+	IGR	DEL	ACAC	-	-	rs35375264		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54616412_54616415delACAC								OLFM4 (990226 upstream) : MIR1297 (269692 downstream)																							TCTCCTTCTAacacacacacacac	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55014797	55014797	+	IGR	DEL	T	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55014797delT								MIR1297 (128614 upstream) : None (None downstream)																							ttcaggttcctttTTTTTTTT	0.189													3	3	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95813246	95813246	+	Intron	DEL	C	-	-	rs142592318		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95813246delC	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	AGATTGTATGCCCCCCCCTCC	0.373													4	2	---	---	---	---	
FRMD6	122786	broad.mit.edu	37	14	52188467	52188470	+	Intron	DEL	AGGA	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52188467_52188470delAGGA	uc001wzd.2	+						FRMD6_uc001wzb.2_Intron|FRMD6_uc001wzc.2_Intron|FRMD6_uc001wze.2_Intron|FRMD6_uc001wzf.2_Intron|FRMD6_uc001wzg.2_Intron	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					gaaggaagggaggaaggaaggagg	0.186													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	61068730	61068731	+	IGR	INS	-	A	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61068730_61068731insA								SIX6 (90207 upstream) : SIX1 (42687 downstream)																							aactctgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
EVL	51466	broad.mit.edu	37	14	100591590	100591591	+	Intron	INS	-	AC	AC	rs34556561		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100591590_100591591insAC	uc001ygt.2	+						EVL_uc001ygv.2_Intron|EVL_uc001ygu.2_Intron|EVL_uc010avu.2_Intron	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				AAggcaggaatacacacacaca	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	30459004	30459004	+	IGR	DEL	T	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30459004delT								FAM7A3 (35058 upstream) : DKFZP434L187 (29235 downstream)																							tgtgtgtgtgtgtgtgtgtgt	0.448													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70811726	70811727	+	IGR	DEL	AC	-	-	rs146449590		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70811726_70811727delAC								TLE3 (421470 upstream) : UACA (135168 downstream)																							GAacacacatacacacacacac	0.396													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	87757781	87757792	+	IGR	DEL	GGAAGGACGGAA	-	-	rs72161798		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87757781_87757792delGGAAGGACGGAA								AGBL1 (185498 upstream) : NCRNA00052 (362368 downstream)																							gagggaggggggaaggacggaaggaaggaagg	0.222													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1163890	1163890	+	IGR	DEL	C	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1163890delC								C1QTNF8 (17646 upstream) : CACNA1H (39351 downstream)																							accagcctcacccccactcac	0.249													5	4	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11064866	11064866	+	Intron	DEL	T	-	-	rs71404430		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11064866delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						ATTGGCAACATTTTTTTTTTT	0.428													4	2	---	---	---	---	
TMC5	79838	broad.mit.edu	37	16	19476434	19476445	+	Intron	DEL	CCTCCCTCCCTC	-	-	rs71812351		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19476434_19476445delCCTCCCTCCCTC	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron|TMC5_uc002dgd.1_Intron|TMC5_uc002dge.3_Intron|TMC5_uc002dgf.3_Intron|TMC5_uc002dgg.3_Intron	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1						ttccttccttcctccctccctccctccctccc	0.014													1	6	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74394379	74394380	+	Intron	INS	-	A	A	rs142790741	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394379_74394380insA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						TAGTCATCCTTAAACAAAATTC	0.327													9	4	---	---	---	---	
ZNRF1	84937	broad.mit.edu	37	16	75127283	75127283	+	Intron	DEL	A	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75127283delA	uc002fdk.2	+						ZNRF1_uc010vmz.1_Intron|ZNRF1_uc002fdl.1_Intron|ZNRF1_uc010cgr.1_Intron	NM_032268	NP_115644	Q8ND25	ZNRF1_HUMAN	zinc and ring finger protein 1							cell junction|endosome|lysosome|synaptic vesicle membrane	ligase activity|protein binding|zinc ion binding				0						acttcgtctcaaaaaaaaaaa	0.224													4	3	---	---	---	---	
LGALS9B	284194	broad.mit.edu	37	17	20370782	20370783	+	Frame_Shift_Ins	INS	-	TC	TC	rs147679570		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20370782_20370783insTC	uc002gxa.1	-	1	66_67	c.1_2insGA	c.(1-3)ATGfs	p.M1fs	LGALS9B_uc002gwz.1_Frame_Shift_Ins_p.M1fs|LGALS9B_uc010vzh.1_Translation_Start_Site	NM_001042685	NP_001036150	Q3B8N2	LEG9B_HUMAN	galectin-9 like	1							sugar binding			skin(1)	1						GCTGAAGGCCATCTCCACCGCC	0.584													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20746999	20746999	+	Intron	DEL	G	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20746999delG	uc010crb.1	+											Homo sapiens cDNA clone IMAGE:6269068, partial cds.																		AGCTGGGCCCGGGGACGCCCG	0.726													2	5	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													11	5	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64302445	64302446	+	Intron	INS	-	A	A	rs141495406		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64302445_64302446insA	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	TTTCTCATTGGAAAAAAAAAAA	0.322													6	3	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67210656	67210656	+	Intron	DEL	A	-	-	rs67751220		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67210656delA	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfb.1_Intron|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					actccgtctcaaaaaaaaaaa	0.114													5	3	---	---	---	---	
GAA	2548	broad.mit.edu	37	17	78084941	78084941	+	Intron	DEL	C	-	-	rs12945868	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78084941delC	uc002jxo.2	+						GAA_uc002jxp.2_Intron|GAA_uc002jxq.2_Intron	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein						cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	GGGAAAGGGGCGGGGGGGGGA	0.632													2	4	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78576273	78576274	+	Intron	INS	-	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78576273_78576274insG	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						gcagaggggctGGTTCAGTTTT	0.173													4	2	---	---	---	---	
AKT2	208	broad.mit.edu	37	19	40761345	40761346	+	Intron	INS	-	GT	GT	rs138053162	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40761345_40761346insGT	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			ctcagggtctagtgtgtgtgtg	0.000			A		ovarian|pancreatic 								6	10	---	---	---	---	
RBL1	5933	broad.mit.edu	37	20	35696195	35696195	+	Intron	DEL	C	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35696195delC	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron|RBL1_uc010gfv.1_Intron	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				aaaaaaaaaaCAACAACAGAA	0.124													4	3	---	---	---	---	
SALL4	57167	broad.mit.edu	37	20	50400592	50400593	+	3'UTR	INS	-	T	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50400592_50400593insT	uc002xwh.3	-	4					SALL4_uc010gii.2_3'UTR|SALL4_uc002xwi.3_3'UTR	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TTTGGTATGCATTTTTTTTTTA	0.223													2	4	---	---	---	---	
PRPF6	24148	broad.mit.edu	37	20	62626969	62626969	+	Intron	DEL	T	-	-	rs113295997		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62626969delT	uc002yho.2	+						PRPF6_uc002yhp.2_Intron	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					ctccttctccttttttttttt	0.100													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9829999	9830000	+	IGR	INS	-	G	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9829999_9830000insG								None (None upstream) : None (None downstream)																							AGAGACCCACAGTCTCGGGAGA	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10715466	10715466	+	IGR	DEL	A	-	-	rs145593257		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10715466delA								None (None upstream) : TPTE (191277 downstream)																							tgcagatcctaaaaaaagact	0.000													5	4	---	---	---	---	
IFNGR2	3460	broad.mit.edu	37	21	34809434	34809434	+	3'UTR	DEL	T	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34809434delT	uc002yrp.3	+	7					IFNGR2_uc002yrq.3_3'UTR|IFNGR2_uc010gma.2_3'UTR|IFNGR2_uc002yrr.3_3'UTR|TMEM50B_uc002yrs.1_Intron	NM_005534	NP_005525	P38484	INGR2_HUMAN	interferon gamma receptor 2 precursor						regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity				0					Interferon gamma-1b(DB00033)	GGTGACAAGCTTTTTTTTTTT	0.398													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44755913	44755914	+	IGR	INS	-	CAC	CAC	rs150119883	by1000genomes	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755913_44755914insCAC								CRYAA (163000 upstream) : SIK1 (78484 downstream)																							atcaccaccatcaccatcacca	0.000													8	4	---	---	---	---	
LOC644165	644165	broad.mit.edu	37	22	25029870	25029871	+	Intron	DEL	TG	-	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25029870_25029871delTG	uc011ajv.1	+							NR_024494				Homo sapiens cDNA FLJ57042 complete cds, moderately similar to Breakpoint cluster region protein (EC 2.7.11.1).												0						tgtgtgggtatgtgtgtgtgtg	0.198													3	6	---	---	---	---	
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45204521	45204521	+	Intron	DEL	T	-	-	rs35386894		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45204521delT	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|ARHGAP8_uc003bfi.2_Intron|ARHGAP8_uc010gzv.2_Intron|ARHGAP8_uc003bfj.2_Intron|ARHGAP8_uc003bfk.2_Intron|ARHGAP8_uc003bfl.2_Intron|PRR5-ARHGAP8_uc003bfg.1_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						TTGGCACTCAttttttttttt	0.398													3	4	---	---	---	---	
NUP50	10762	broad.mit.edu	37	22	45577017	45577019	+	Intron	DEL	CCC	-	-	rs66468525		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45577017_45577019delCCC	uc003bfr.2	+						NUP50_uc003bfs.2_Intron|NUP50_uc011aqn.1_Intron|NUP50_uc003bft.2_Intron|NUP50_uc011aqo.1_Intron	NM_007172	NP_009103	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa isoform b						carbohydrate metabolic process|glucose transport|intracellular transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore|nucleoplasm	protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CTTCTGGCATCCCCCCCCCCCCC	0.404													3	3	---	---	---	---	
