Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
GNB1	2782	broad.mit.edu	37	1	1721888	1721888	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1721888T>G	uc001aif.2	-	9	977	c.645A>C	c.(643-645)GAA>GAC	p.E215D	GNB1_uc009vky.2_Missense_Mutation_p.E115D	NM_002074	NP_002065	P62873	GBB1_HUMAN	guanine nucleotide-binding protein, beta-1	215					cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		GGCACATGCCTTCTCGCACAT	0.567													21	53	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27097703	27097703	+	Nonsense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27097703C>T	uc001bmv.1	+	12	3665	c.3292C>T	c.(3292-3294)CAG>TAG	p.Q1098*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q1098*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q1098*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q715*|ARID1A_uc001bmx.1_5'UTR|ARID1A_uc009vsm.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1098	ARID.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCAGTATATCCAGTGTCTCTA	0.483			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								8	80	---	---	---	---	PASS
COL16A1	1307	broad.mit.edu	37	1	32119210	32119210	+	Silent	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32119210G>A	uc001btk.1	-	70	4967	c.4602C>T	c.(4600-4602)CCC>CCT	p.P1534P	COL16A1_uc001bti.1_Silent_p.P148P|COL16A1_uc001btj.1_Silent_p.P1332P	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	1534	Triple-helical region 1 (COL1) with 2 imperfections.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTGGGGGGCCGGGAAGACCAT	0.453													3	68	---	---	---	---	PASS
EIF3I	8668	broad.mit.edu	37	1	32696854	32696854	+	3'UTR	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32696854T>G	uc001bur.3	+	12					EIF3I_uc009vuc.2_3'UTR|EIF3I_uc001bus.2_3'UTR	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				accactttttttttaaggcag	0.124													8	12	---	---	---	---	PASS
KLF17	128209	broad.mit.edu	37	1	44596402	44596402	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44596402G>T	uc001clp.2	+	3	1202	c.1144G>T	c.(1144-1146)GAC>TAC	p.D382Y		NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393	382					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					TGGAGAGCAGGACAGTCCTCC	0.438													37	102	---	---	---	---	PASS
TMEM61	199964	broad.mit.edu	37	1	55457606	55457606	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55457606G>T	uc001cyd.2	+	3	737	c.463G>T	c.(463-465)GCC>TCC	p.A155S		NM_182532	NP_872338	Q8N0U2	TMM61_HUMAN	transmembrane protein 61	155						integral to membrane					0						TACGGAGGAAGCCCTGGAGCC	0.627													74	117	---	---	---	---	PASS
PTPN22	26191	broad.mit.edu	37	1	114394727	114394727	+	Splice_Site	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114394727C>A	uc001eds.2	-	10	881	c.751_splice	c.e10-1	p.I251_splice	PTPN22_uc009wgq.2_Intron|PTPN22_uc010owo.1_Splice_Site_p.I7_splice|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Splice_Site_p.I251_splice|PTPN22_uc009wgs.2_Splice_Site_p.I124_splice|PTPN22_uc001edu.2_Splice_Site_p.I251_splice	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type						negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGGAATTATCTATCAAATTA	0.348													22	49	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612034	120612034	+	5'UTR	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612034T>G	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCGGTCGCCTCCTCCTccgc	0.622			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803433	142803433	+	Intron	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803433G>C	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		ctctcaagtagtttggattag	0.075													6	35	---	---	---	---	PASS
PGLYRP4	57115	broad.mit.edu	37	1	153303264	153303264	+	Silent	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153303264G>C	uc001fbo.2	-	9	1166	c.1101C>G	c.(1099-1101)ACC>ACG	p.T367T	PGLYRP4_uc001fbp.2_Silent_p.T363T	NM_020393	NP_065126	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein-I-beta	367					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)|skin(1)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			AATGAGGCCAGGTGCTGATGA	0.552													35	106	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171509126	171509126	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171509126G>A	uc010pmg.1	+	16	2781	c.2515G>A	c.(2515-2517)GAC>AAC	p.D839N	BAT2L2_uc010pmh.1_5'UTR	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	839							protein C-terminus binding				0						AGCTGCGTTGGACCAGGAACA	0.383													80	216	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39281850	39281850	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39281850T>G	uc002rrk.3	-	5	666	c.625A>C	c.(625-627)ATG>CTG	p.M209L	SOS1_uc010ynr.1_RNA|SOS1_uc002rrl.2_5'Flank	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	209	DH.				apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				ATTTCTGCCATAAATGCTTTT	0.308									Noonan_syndrome				27	227	---	---	---	---	PASS
SRBD1	55133	broad.mit.edu	37	2	45832575	45832575	+	Silent	SNP	T	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45832575T>A	uc002rus.2	-	2	82	c.6A>T	c.(4-6)TCA>TCT	p.S2S		NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	2					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			TTGGCAATGATGACATCTAGA	0.343													208	212	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71909676	71909676	+	Missense_Mutation	SNP	T	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71909676T>A	uc002sie.2	+	54	6449	c.6073T>A	c.(6073-6075)TTC>ATC	p.F2025I	DYSF_uc010feg.2_Missense_Mutation_p.F2056I|DYSF_uc010feh.2_Missense_Mutation_p.F2032I|DYSF_uc002sig.3_Missense_Mutation_p.F2011I|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.F2046I|DYSF_uc010fef.2_Missense_Mutation_p.F2063I|DYSF_uc010fei.2_Missense_Mutation_p.F2042I|DYSF_uc010fek.2_Missense_Mutation_p.F2043I|DYSF_uc010fej.2_Missense_Mutation_p.F2033I|DYSF_uc010fel.2_Missense_Mutation_p.F2012I|DYSF_uc010feo.2_Missense_Mutation_p.F2057I|DYSF_uc010fem.2_Missense_Mutation_p.F2047I|DYSF_uc010fen.2_Missense_Mutation_p.F2064I|DYSF_uc002sif.2_Missense_Mutation_p.F2026I|DYSF_uc010yqy.1_Missense_Mutation_p.F906I|DYSF_uc010yqz.1_Missense_Mutation_p.F786I	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	2025	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CGACACCTCCTTCCTGTGGTT	0.488													50	177	---	---	---	---	PASS
PCDP1	200373	broad.mit.edu	37	2	120388454	120388454	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120388454G>T	uc002tmb.2	+	20	2185	c.1093G>T	c.(1093-1095)GAT>TAT	p.D365Y	PCDP1_uc010yyq.1_Missense_Mutation_p.D495Y	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1	651						cilium	calmodulin binding				0	Colorectal(110;0.196)					CATGTCTCTAGATTATGATCC	0.443													99	333	---	---	---	---	PASS
SAP130	79595	broad.mit.edu	37	2	128757928	128757928	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128757928G>A	uc002tpp.2	-	8	1180	c.1048C>T	c.(1048-1050)CAC>TAC	p.H350Y	SAP130_uc002tpn.2_Missense_Mutation_p.H111Y|SAP130_uc002tpo.2_Missense_Mutation_p.H95Y|SAP130_uc010fmd.2_Missense_Mutation_p.H350Y|SAP130_uc002tpq.1_Missense_Mutation_p.H323Y	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	350					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		AATGCAGGGTGAGATGGTAGT	0.473													56	156	---	---	---	---	PASS
SAP130	79595	broad.mit.edu	37	2	128757929	128757929	+	Silent	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128757929A>G	uc002tpp.2	-	8	1179	c.1047T>C	c.(1045-1047)TCT>TCC	p.S349S	SAP130_uc002tpn.2_Silent_p.S110S|SAP130_uc002tpo.2_Silent_p.S94S|SAP130_uc010fmd.2_Silent_p.S349S|SAP130_uc002tpq.1_Silent_p.S322S	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	349					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ATGCAGGGTGAGATGGTAGTG	0.473													57	154	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135749074	135749074	+	Intron	SNP	T	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135749074T>A	uc002tue.1	-						YSK4_uc010fne.1_3'UTR|YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Intron|YSK4_uc010zbg.1_Intron|YSK4_uc002tui.3_Intron	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1								ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TTGGTTTTAATTCTCAAGTCA	0.264													58	55	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179460510	179460510	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179460510A>G	uc010zfg.1	-	244	50091	c.49867T>C	c.(49867-49869)TTC>CTC	p.F16623L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.F10318L|TTN_uc010zfi.1_Missense_Mutation_p.F10251L|TTN_uc010zfj.1_Missense_Mutation_p.F10126L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17550							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAGCTAGGAATGGTGTTCCA	0.393													10	24	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212530141	212530141	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212530141C>A	uc002veg.1	-	15	1876	c.1778G>T	c.(1777-1779)TGT>TTT	p.C593F	ERBB4_uc002veh.1_Missense_Mutation_p.C593F|ERBB4_uc010zji.1_Missense_Mutation_p.C593F|ERBB4_uc010zjj.1_Missense_Mutation_p.C593F|ERBB4_uc010fut.1_Missense_Mutation_p.C593F	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	593	Extracellular (Potential).|Cys-rich.				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		GCCATCTGGACATTTTTCCAC	0.428										TSP Lung(8;0.080)			52	130	---	---	---	---	PASS
ANKMY1	51281	broad.mit.edu	37	2	241465702	241465702	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241465702A>G	uc002vyz.1	-	5	1076	c.847T>C	c.(847-849)TTT>CTT	p.F283L	ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Missense_Mutation_p.F372L|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	283							zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GCACTAGCAAAGTTGTCCTTC	0.562													42	134	---	---	---	---	PASS
GPR35	2859	broad.mit.edu	37	2	241570154	241570154	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241570154G>A	uc002vzs.1	+	1	1360	c.785G>A	c.(784-786)AGC>AAC	p.S262N	GPR35_uc010fzh.1_Missense_Mutation_p.S293N|GPR35_uc010fzi.1_Missense_Mutation_p.S293N	NM_005301	NP_005292	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	262	Helical; Name=7; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			skin(2)|pancreas(1)	3		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		TACATAACCAGCAAGCTCTCA	0.632													17	415	---	---	---	---	PASS
C3orf32	51066	broad.mit.edu	37	3	8673776	8673776	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8673776C>A	uc003bqu.2	-	5	539	c.293G>T	c.(292-294)AGT>ATT	p.S98I	C3orf32_uc003bqz.2_Missense_Mutation_p.S98I|C3orf32_uc003bqt.2_Missense_Mutation_p.S47I|C3orf32_uc011atg.1_Missense_Mutation_p.S120I|C3orf32_uc003bqv.2_Missense_Mutation_p.S47I|C3orf32_uc003bqw.2_RNA|C3orf32_uc003bqx.2_RNA|C3orf32_uc003bqy.2_Missense_Mutation_p.S98I	NM_015931	NP_057015	Q9Y2M2	CC032_HUMAN	hypothetical protein LOC51066	98										skin(1)	1						CCTGGATTCACTAAAGGTCTC	0.423													30	36	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183725	10183725	+	Nonsense_Mutation	SNP	C	A	A	rs5030826		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183725C>A	uc003bvc.2	+	1	407	c.194C>A	c.(193-195)TCG>TAG	p.S65*	VHL_uc003bvd.2_Nonsense_Mutation_p.S65*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	65			S -> L (in VHLD; type I).|S -> A (in pheochromocytoma).|S -> W (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.S65*(8)|p.S65L(8)|p.S65S(2)|p.S65W(2)|p.S65fs*2(2)|p.S65P(1)|p.E52_S65del(1)|p.S65fs*92(1)|p.R60fs*35(1)|p.S65>Q(1)|p.S65_N67del(1)|p.P61fs*61(1)|p.R64fs*63(1)|p.V62fs*1(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTGCTGCGCTCGGTGAACTCG	0.721		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				8	6	---	---	---	---	PASS
QARS	5859	broad.mit.edu	37	3	49136701	49136701	+	Intron	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49136701C>T	uc003cvx.2	-						QARS_uc011bcc.1_Splice_Site|QARS_uc011bcd.1_Intron|QARS_uc003cvy.2_Intron|QARS_uc011bce.1_Intron	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase						glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CAGGAAAGTTCAGCATCAGTC	0.532													23	68	---	---	---	---	PASS
RBM6	10180	broad.mit.edu	37	3	50006077	50006077	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50006077C>T	uc003cyc.2	+	3	1352	c.1219C>T	c.(1219-1221)CGT>TGT	p.R407C	RBM6_uc011bdh.1_RNA|RBM6_uc010hlc.1_Intron|RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6	407					RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CATGGAGTACCGTGATGTGGA	0.527													3	81	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124211627	124211627	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124211627T>G	uc003ehg.2	+	32	4851	c.4724T>G	c.(4723-4725)ATT>AGT	p.I1575S	KALRN_uc010hrv.1_Missense_Mutation_p.I1566S|KALRN_uc003ehf.1_Missense_Mutation_p.I1575S|KALRN_uc011bjy.1_Missense_Mutation_p.I1566S	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	1575	PH 1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						ATCAAGAACATTCGAGAAGTG	0.463													47	70	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129324804	129324804	+	Silent	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129324804G>A	uc003emx.2	-	1	779	c.679C>T	c.(679-681)CTG>TTG	p.L227L		NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	227	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						TGGTCCTCCAGGCTGCGGTTG	0.597													6	23	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130400403	130400403	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130400403C>G	uc003enj.2	-	17	4221	c.3640G>C	c.(3640-3642)GAC>CAC	p.D1214H		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	1214	WD 5.				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						GTCTCCATGTCCCACATGGAC	0.423													11	128	---	---	---	---	PASS
FAM194A	131831	broad.mit.edu	37	3	150398270	150398270	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150398270G>T	uc003eyg.2	-	9	1153	c.1096C>A	c.(1096-1098)CAT>AAT	p.H366N	FAM194A_uc003eyh.2_Missense_Mutation_p.H220N	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN	hypothetical protein LOC131831	366										skin(2)|ovary(1)	3						TCAGAGAAATGAGTCTGTTCC	0.383													52	112	---	---	---	---	PASS
B3GNT5	84002	broad.mit.edu	37	3	182987783	182987783	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182987783A>G	uc003flk.2	+	2	727	c.197A>G	c.(196-198)CAC>CGC	p.H66R	MCF2L2_uc003fli.1_Intron|MCF2L2_uc003flj.1_Intron|MCF2L2_uc011bqr.1_Intron|B3GNT5_uc003fll.2_Missense_Mutation_p.H66R|B3GNT5_uc003flm.2_Missense_Mutation_p.H66R	NM_032047	NP_114436	Q9BYG0	B3GN5_HUMAN	UDP-GlcNAc:betaGal	66	Lumenal (Potential).				central nervous system development|glycolipid biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity|galactosyltransferase activity			ovary(1)	1	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TCTCTTAAGCACACCTCAGCG	0.408													59	124	---	---	---	---	PASS
EHHADH	1962	broad.mit.edu	37	3	184922240	184922240	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184922240C>T	uc003fpf.2	-	6	901	c.874G>A	c.(874-876)GCA>ACA	p.A292T	EHHADH_uc011brs.1_Missense_Mutation_p.A196T	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl	292	3-hydroxyacyl-CoA dehydrogenase.					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)	CGCGCTGATGCTGTTTTCCAC	0.453													53	92	---	---	---	---	PASS
SDHAP1	255812	broad.mit.edu	37	3	195692311	195692311	+	Missense_Mutation	SNP	T	C	C	rs62282793	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195692311T>C	uc003fvy.2	-	3	346	c.232A>G	c.(232-234)AGC>GGC	p.S78G	SDHAP1_uc003fvx.3_RNA					Homo sapiens full length insert cDNA clone ZC24D06.												0						TTCCCAGTGCTGACGTCCACA	0.607													8	28	---	---	---	---	PASS
RPL9	6133	broad.mit.edu	37	4	39459339	39459339	+	Intron	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39459339T>G	uc003gub.2	-						RPL9_uc003guc.2_Intron|RPL9_uc011byk.1_Intron|RPL9_uc011byl.1_Intron|RPL9_uc003gud.1_3'UTR|LIAS_uc003gue.3_5'Flank|LIAS_uc011bym.1_5'Flank|LIAS_uc003guf.2_5'Flank|LIAS_uc003gug.2_5'Flank|LIAS_uc003guh.2_5'Flank	NM_001024921	NP_001020092	P32969	RL9_HUMAN	ribosomal protein L9						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|nucleolus|ribosome	rRNA binding|structural constituent of ribosome			skin(1)	1						TCCAGAAATATGCAGGCTTAA	0.388													22	41	---	---	---	---	PASS
SPATA5	166378	broad.mit.edu	37	4	123855337	123855337	+	Silent	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123855337G>A	uc003iez.3	+	5	664	c.591G>A	c.(589-591)GGG>GGA	p.G197G	SPATA5_uc003iey.2_Silent_p.G196G	NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	197					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						GAGTGAAAGGGGCAGATGGCA	0.463													9	135	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126238838	126238838	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126238838C>A	uc003ifj.3	+	1	1272	c.1272C>A	c.(1270-1272)AGC>AGA	p.S424R		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	424	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						AGGTGGCCAGCGCCTTGGACC	0.597											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	53	---	---	---	---	PASS
TMEM184C	55751	broad.mit.edu	37	4	148555434	148555434	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148555434C>T	uc003ila.3	+	10	1735	c.1166C>T	c.(1165-1167)TCT>TTT	p.S389F		NM_018241	NP_060711	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	389						integral to membrane					0						ATTGCTTCTTCTATGCCACCT	0.418													14	155	---	---	---	---	PASS
NAF1	92345	broad.mit.edu	37	4	164087992	164087992	+	5'UTR	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164087992C>T	uc003iqj.2	-	1					NAF1_uc010iqw.1_5'UTR|NAF1_uc003iqk.2_RNA	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a						rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)				CTGCCTGGGCCCAACTTCCCG	0.572													5	14	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13865955	13865955	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13865955C>A	uc003jfd.2	-	27	4219	c.4177G>T	c.(4177-4179)GGC>TGC	p.G1393C		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1393	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GCTGGCAGGCCAAAAAGCTCC	0.333									Kartagener_syndrome				46	76	---	---	---	---	PASS
MYOT	9499	broad.mit.edu	37	5	137223116	137223116	+	3'UTR	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137223116T>G	uc011cye.1	+	10					PKD2L2_uc010jep.1_5'Flank|PKD2L2_uc003lbw.1_5'Flank|PKD2L2_uc003lbx.2_5'Flank|PKD2L2_uc003lby.2_5'Flank|MYOT_uc003lbv.2_3'UTR|MYOT_uc011cyg.1_3'UTR|MYOT_uc011cyh.1_3'UTR	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b						muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ACACCATTAGTAATATATTTG	0.259													21	58	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140724196	140724196	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140724196C>T	uc003ljm.1	+	1	596	c.596C>T	c.(595-597)GCC>GTC	p.A199V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.A199V	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	199	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGAGCGGGCCCTGGACCGT	0.542													39	146	---	---	---	---	PASS
FGFR4	2264	broad.mit.edu	37	5	176520544	176520544	+	Silent	SNP	C	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176520544C>G	uc003mfl.2	+	10	1556	c.1389C>G	c.(1387-1389)CCC>CCG	p.P463P	FGFR4_uc003mfm.2_Silent_p.P463P|FGFR4_uc011dfu.1_Intron|FGFR4_uc003mfo.2_Silent_p.P423P	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	463	Cytoplasmic (Potential).				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	GGGAGTTCCCCCGGGACAGGT	0.682										TSP Lung(9;0.080)			6	263	---	---	---	---	PASS
FGFR4	2264	broad.mit.edu	37	5	176524604	176524604	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176524604A>C	uc003mfl.2	+	18	2503	c.2336A>C	c.(2335-2337)GAT>GCT	p.D779A	FGFR4_uc003mfm.2_Missense_Mutation_p.D779A|FGFR4_uc011dfu.1_Missense_Mutation_p.D711A|FGFR4_uc003mfo.2_Missense_Mutation_p.D739A	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	779	Cytoplasmic (Potential).				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	TCCTCCAGCGATTCTGTCTTC	0.632										TSP Lung(9;0.080)			58	71	---	---	---	---	PASS
CDSN	1041	broad.mit.edu	37	6	31084879	31084879	+	Silent	SNP	C	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31084879C>G	uc003nsm.1	-	2	540	c.513G>C	c.(511-513)GGG>GGC	p.G171G	PSORS1C1_uc003nsl.1_Intron|PSORS1C1_uc010jsj.1_Intron	NM_001264	NP_001255	Q15517	CDSN_HUMAN	corneodesmosin precursor	171	Ser-rich.				cell-cell adhesion|keratinocyte differentiation|skin morphogenesis	cornified envelope|desmosome|extracellular region	protein homodimerization activity			ovary(1)|pancreas(1)	2						CAGAGCCATTCCCTACTTGGA	0.547													35	63	---	---	---	---	PASS
FBXO9	26268	broad.mit.edu	37	6	52943655	52943655	+	Silent	SNP	T	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52943655T>C	uc003pbo.2	+	5	447	c.396T>C	c.(394-396)ACT>ACC	p.T132T	FBXO9_uc003pbk.2_Silent_p.T88T|FBXO9_uc003pbl.2_Silent_p.T122T|FBXO9_uc003pbm.2_Silent_p.T12T|FBXO9_uc003pbn.2_Silent_p.T12T	NM_012347	NP_036479	Q9UK97	FBX9_HUMAN	F-box only protein 9 isoform 1	132						ubiquitin ligase complex	ubiquitin-protein ligase activity			pancreas(1)	1	Lung NSC(77;0.103)					TCAAGATTACTTATACCCGGT	0.363													39	87	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75827250	75827250	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75827250A>T	uc003phs.2	-	47	7533	c.7367T>A	c.(7366-7368)TTT>TAT	p.F2456Y	COL12A1_uc003pht.2_Missense_Mutation_p.F1292Y	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2456	Nonhelical region (NC3).|VWFA 4.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						ACCAACTACAAAGACACTGAA	0.393													17	74	---	---	---	---	PASS
SYNJ2	8871	broad.mit.edu	37	6	158464376	158464376	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158464376C>A	uc003qqx.1	+	5	815	c.740C>A	c.(739-741)TCT>TAT	p.S247Y	SYNJ2_uc011efm.1_RNA|SYNJ2_uc003qqw.1_Missense_Mutation_p.S247Y|SYNJ2_uc003qqy.1_5'UTR|SYNJ2_uc011efn.1_Missense_Mutation_p.S196Y|SYNJ2_uc010kjo.1_Missense_Mutation_p.S196Y	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	247	SAC.						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GGAGTGTCATCTTTTGTCCAG	0.493													34	72	---	---	---	---	PASS
FAM120B	84498	broad.mit.edu	37	6	170627090	170627090	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170627090C>T	uc003qxp.2	+	2	720	c.612C>T	c.(610-612)GTC>GTT	p.V204V	FAM120B_uc003qxo.1_Silent_p.V204V|FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	204					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		TGGACACCGTCATGCTCTGCA	0.532													50	103	---	---	---	---	PASS
KIAA0415	9907	broad.mit.edu	37	7	4830219	4830219	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4830219C>T	uc003sne.2	+	15	2018	c.1935C>T	c.(1933-1935)AGC>AGT	p.S645S	KIAA0415_uc010ksp.2_RNA|KIAA0415_uc003snf.2_Silent_p.S122S	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	645					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		TCGTCACCAGCGTGGTAAGGC	0.677													9	41	---	---	---	---	PASS
PMS2	5395	broad.mit.edu	37	7	6029494	6029494	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6029494C>G	uc003spl.2	-	10	1168	c.1081G>C	c.(1081-1083)GGA>CGA	p.G361R	PMS2_uc003spj.2_Missense_Mutation_p.G255R|PMS2_uc003spk.2_Missense_Mutation_p.G226R|PMS2_uc011jwl.1_Missense_Mutation_p.G226R|PMS2_uc010ktg.2_Missense_Mutation_p.G50R|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Missense_Mutation_p.G361R	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform	361					mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TCAAACATTCCTATCAAAGAG	0.373			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				38	119	---	---	---	---	PASS
VPS41	27072	broad.mit.edu	37	7	38807138	38807138	+	Missense_Mutation	SNP	G	A	A	rs139485137	byFrequency	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38807138G>A	uc003tgy.2	-	15	1272	c.1246C>T	c.(1246-1248)CGC>TGC	p.R416C	VPS41_uc003tgz.2_Missense_Mutation_p.R391C|VPS41_uc010kxn.2_Missense_Mutation_p.R327C	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	416					Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						CATCATTACCGTGCTGCTATG	0.318													18	75	---	---	---	---	PASS
POU6F2	11281	broad.mit.edu	37	7	39247033	39247033	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39247033G>A	uc003thb.1	+	4	367	c.325G>A	c.(325-327)GTG>ATG	p.V109M	POU6F2_uc010kxo.2_Missense_Mutation_p.V101M	NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1	109					central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						TGTGGCCGGCGTGATGCCGGG	0.577													16	307	---	---	---	---	PASS
IKZF1	10320	broad.mit.edu	37	7	50467916	50467916	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50467916C>T	uc003tow.3	+	9	1319	c.1151C>T	c.(1150-1152)TCG>TTG	p.S384L	IKZF1_uc003tox.3_Missense_Mutation_p.S342L|IKZF1_uc003toy.3_Missense_Mutation_p.S342L|IKZF1_uc011kck.1_Missense_Mutation_p.S297L|IKZF1_uc003toz.3_Missense_Mutation_p.S354L|IKZF1_uc010kyx.2_Missense_Mutation_p.S124L|IKZF1_uc003tpa.3_Missense_Mutation_p.S126L	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	384					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				TTGGTGCCCTCGGAGCGCGAG	0.667			D		ALL								6	19	---	---	---	---	PASS
FZD1	8321	broad.mit.edu	37	7	90894804	90894804	+	Missense_Mutation	SNP	C	G	G	rs148076270		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90894804C>G	uc003ula.2	+	1	1022	c.609C>G	c.(607-609)AAC>AAG	p.N203K		NM_003505	NP_003496	Q9UP38	FZD1_HUMAN	frizzled 1 precursor	203	FZ.|Extracellular (Potential).				autocrine signaling|axonogenesis|brain development|canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|embryo development|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|lung alveolus development|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to drug|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cell surface|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|receptor binding|Wnt receptor activity|Wnt-protein binding				0	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			CGCTCATGAACAAGTTCGGCT	0.687													8	169	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	92098577	92098577	+	IGR	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92098577G>T								GATAD1 (9835 upstream) : PEX1 (17761 downstream)																							ctgctagggagttaagttgat	0.000													32	103	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99801730	99801730	+	Silent	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99801730G>A	uc003utx.1	+	26	2942	c.2787G>A	c.(2785-2787)CTG>CTA	p.L929L	STAG3_uc011kjk.1_Silent_p.L871L|GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|STAG3_uc003uub.1_Silent_p.L153L	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	929					chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAATCCTGCTGCTGAGCCTCA	0.413													31	112	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99801731	99801731	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99801731C>T	uc003utx.1	+	26	2943	c.2788C>T	c.(2788-2790)CTG>TTG	p.L930L	STAG3_uc011kjk.1_Silent_p.L872L|GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|STAG3_uc003uub.1_Silent_p.L154L	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	930					chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AATCCTGCTGCTGAGCCTCAA	0.408													32	108	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137237186	137237186	+	Silent	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137237186C>A	uc003vtt.2	-	20	2077	c.2076G>T	c.(2074-2076)CGG>CGT	p.R692R	DGKI_uc003vtu.2_Silent_p.R392R	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	692					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						TCAGGGAGATCCGAATCATAG	0.502													19	299	---	---	---	---	PASS
AKR1D1	6718	broad.mit.edu	37	7	137791988	137791988	+	Intron	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137791988C>T	uc003vtz.2	+						AKR1D1_uc011kqe.1_Intron|AKR1D1_uc011kqf.1_Intron|AKR1D1_uc010lmy.1_RNA	NM_005989	NP_005980	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1						androgen metabolic process|bile acid biosynthetic process|bile acid catabolic process|C21-steroid hormone metabolic process|cholesterol catabolic process|digestion	cytosol	aldo-keto reductase (NADP) activity|delta4-3-oxosteroid 5beta-reductase activity|steroid binding			skin(1)	1						TCCCATACTACGAGTAACTCT	0.463													8	24	---	---	---	---	PASS
GIMAP8	155038	broad.mit.edu	37	7	150171609	150171609	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150171609G>C	uc003whj.2	+	4	1522	c.1192G>C	c.(1192-1194)GCC>CCC	p.A398P		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	398						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CAGATATAGTGCCTTCAACTA	0.443													80	238	---	---	---	---	PASS
SORBS3	10174	broad.mit.edu	37	8	22414254	22414254	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22414254G>C	uc003xbv.2	+	4	587	c.247G>C	c.(247-249)GGC>CGC	p.G83R	SORBS3_uc011kzk.1_RNA	NM_005775	NP_005766	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3 isoform 1	83					muscle contraction|positive regulation of stress fiber assembly	cytoskeleton|cytosol|nucleus	protein binding|structural constituent of cytoskeleton|vinculin binding				0		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GACCTGGCCAGGCCCTGGGAG	0.602													7	66	---	---	---	---	PASS
ZBTB10	65986	broad.mit.edu	37	8	81412314	81412314	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81412314G>A	uc003ybx.3	+	2	2156	c.1558G>A	c.(1558-1560)GGT>AGT	p.G520S	ZBTB10_uc003ybv.3_Missense_Mutation_p.G228S|ZBTB10_uc003ybw.3_Missense_Mutation_p.G520S|ZBTB10_uc010lzt.2_Missense_Mutation_p.G520S	NM_001105539	NP_001099009	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10 isoform	520					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			lung(1)	1	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			TGAAAATGATGGTTGTAATGT	0.403													31	116	---	---	---	---	PASS
LY6H	4062	broad.mit.edu	37	8	144240447	144240447	+	Intron	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144240447C>T	uc011lka.1	-						LY6H_uc011lkb.1_Intron|LY6H_uc003yxt.2_Missense_Mutation_p.R25Q|LY6H_uc011lkc.1_Intron	NM_002347	NP_002338	O94772	LY6H_HUMAN	lymphocyte antigen 6 complex, locus H isoform a						nervous system development|organ morphogenesis	anchored to membrane|plasma membrane					0	all_cancers(97;6.49e-11)|all_epithelial(106;2.77e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					TGGGAGAGCCCGACCCCACGG	0.706													4	4	---	---	---	---	PASS
ACER2	340485	broad.mit.edu	37	9	19446560	19446560	+	Intron	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19446560G>A	uc003zny.1	+						ACER2_uc003znx.1_RNA|ACER2_uc003znz.1_Intron	NM_001010887	NP_001010887	Q5QJU3	ACER2_HUMAN	alkaline ceramidase 2						ceramide metabolic process|negative regulation of cell adhesion mediated by integrin|negative regulation of cell-matrix adhesion|negative regulation of protein glycosylation in Golgi|positive regulation of cell proliferation|response to retinoic acid|sphingosine biosynthetic process	integral to Golgi membrane	ceramidase activity			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						AGATGGTTCAGAAGCCACTGA	0.527													6	6	---	---	---	---	PASS
KIAA1161	57462	broad.mit.edu	37	9	34371724	34371724	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34371724C>T	uc003zue.3	-	3	1385	c.1218G>A	c.(1216-1218)GTG>GTA	p.V406V		NM_020702	NP_065753	Q6NSJ0	K1161_HUMAN	hypothetical protein LOC57462	406	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane	hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|breast(1)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		GCTCGCGCTCCACGCCCTCGC	0.677													14	22	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37708465	37708465	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37708465A>G	uc004aag.1	+	4	373	c.329A>G	c.(328-330)GAC>GGC	p.D110G	FRMPD1_uc004aah.1_Missense_Mutation_p.D110G	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	110	PDZ.					cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		CCTGCTGAAGACCTTTCCTGG	0.453													43	104	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101765861	101765861	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101765861G>A	uc004azb.1	+	8	1398	c.1192G>A	c.(1192-1194)GTC>ATC	p.V398I		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	398	Nonhelical region 1 (NC1).|1.|4 X tandem repeats.				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				AGAGGAAGGGGTCACTCCAGT	0.607													47	86	---	---	---	---	PASS
PPP3R2	5535	broad.mit.edu	37	9	104357268	104357268	+	5'UTR	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104357268G>T	uc004bbr.2	-	1					GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta								calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	GGTGAGCTCGGGCGGGGCTCG	0.597													22	41	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116356377	116356377	+	Intron	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116356377G>C	uc004bhq.2	+						RGS3_uc004bhs.2_Intron|RGS3_uc004bht.2_Intron|RGS3_uc010muy.2_Intron|RGS3_uc004bhv.2_Intron|RGS3_uc004bhw.2_Intron|RGS3_uc011lxh.1_Intron|RGS3_uc004bhx.2_Intron|RGS3_uc004bhz.2_Intron|RGS3_uc004bia.2_Missense_Mutation_p.E60Q	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6						inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						CCTCCTGTCTGAGTCCCAGCC	0.622													121	207	---	---	---	---	PASS
SARDH	1757	broad.mit.edu	37	9	136578237	136578237	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136578237G>A	uc004cep.3	-	9	1294	c.1160C>T	c.(1159-1161)ACG>ATG	p.T387M	SARDH_uc004ceo.2_Missense_Mutation_p.T387M|SARDH_uc011mdn.1_Missense_Mutation_p.T387M|SARDH_uc011mdo.1_Missense_Mutation_p.T219M	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	387					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GTGGTCGGGCGTGAAGGATTC	0.602													6	21	---	---	---	---	PASS
WDR5	11091	broad.mit.edu	37	9	137007540	137007540	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137007540G>A	uc004cey.2	+	6	611	c.440G>A	c.(439-441)GGA>GAA	p.G147E	WDR5_uc004cez.2_Missense_Mutation_p.G147E	NM_017588	NP_060058	P61964	WDR5_HUMAN	WD repeat domain 5	147	WD 3.				histone H3 acetylation|histone H3-K4 methylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex|MLL1 complex|Set1C/COMPASS complex	protein binding				0		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		ATTGTCTCAGGATCCGTAAGT	0.502													39	87	---	---	---	---	PASS
PFKP	5214	broad.mit.edu	37	10	3151561	3151561	+	Silent	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3151561A>G	uc001igp.2	+	10	1014	c.978A>G	c.(976-978)GGA>GGG	p.G326G	PFKP_uc001igq.2_Silent_p.G318G|PFKP_uc009xhr.2_Silent_p.G288G|PFKP_uc009xhs.1_Silent_p.G110G|PFKP_uc009xht.2_Silent_p.G64G	NM_002627	NP_002618	Q01813	K6PP_HUMAN	phosphofructokinase, platelet	326					glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		GCCGCATGGGAGTGGAGGCAG	0.637													24	47	---	---	---	---	PASS
GDI2	2665	broad.mit.edu	37	10	5808591	5808591	+	Silent	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5808591G>C	uc001iil.3	-	9	1293	c.1002C>G	c.(1000-1002)GTC>GTG	p.V334V	GDI2_uc001iim.3_Silent_p.V289V|GDI2_uc009xid.2_Silent_p.V338V	NM_001494	NP_001485	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2 isoform 1	334					protein transport|small GTPase mediated signal transduction	cell surface|cytosol|membrane	protein binding|Rab GDP-dissociation inhibitor activity				0						AGATCATGCAGACGTAGATAT	0.453													6	116	---	---	---	---	PASS
FGFBP3	143282	broad.mit.edu	37	10	93668183	93668183	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93668183C>T	uc001khq.3	-	2	726	c.544G>A	c.(544-546)GGC>AGC	p.G182S		NM_152429	NP_689642	Q8TAT2	FGFP3_HUMAN	fibroblast growth factor binding protein 3	182					positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of vascular permeability	extracellular region	fibroblast growth factor binding|heparin binding				0		Colorectal(252;0.162)				GCGGCTGGGCCGGACGCACGC	0.751													11	25	---	---	---	---	PASS
MGEA5	10724	broad.mit.edu	37	10	103565869	103565869	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103565869C>T	uc001ktv.2	-	6	1127	c.684G>A	c.(682-684)GTG>GTA	p.V228V	MGEA5_uc010qqe.1_Silent_p.V228V|MGEA5_uc009xws.2_Silent_p.V228V|MGEA5_uc001ktw.2_Silent_p.V228V|MGEA5_uc009xwt.2_Silent_p.V86V|MGEA5_uc010qqf.1_RNA	NM_012215	NP_036347	O60502	NCOAT_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	228					glycoprotein catabolic process	cytoplasm|nucleus	histone acetyltransferase activity|hyalurononglucosaminidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		GAGACTGAGACACATTTGGAT	0.328													27	58	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	134650414	134650414	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134650414C>A	uc010qux.1	-	37	5621	c.5621G>T	c.(5620-5622)TGG>TTG	p.W1874L		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		GAGATTTTGCCAAGCCTGTGT	0.537													10	51	---	---	---	---	PASS
OR51E1	143503	broad.mit.edu	37	11	4674702	4674702	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4674702T>G	uc001lzi.3	+	2	1090	c.946T>G	c.(946-948)TCA>GCA	p.S316A		NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E,	315	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(3)|pancreas(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACACACGCTTCAGAGCCCTA	0.428													52	111	---	---	---	---	PASS
OR2AG1	144125	broad.mit.edu	37	11	6806985	6806985	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6806985C>T	uc001mer.1	+	1	717	c.717C>T	c.(715-717)GTC>GTT	p.V239V		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	239	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AAGCCCTTGTCACCTGCTCTT	0.493													12	99	---	---	---	---	PASS
E2F8	79733	broad.mit.edu	37	11	19259497	19259497	+	Silent	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19259497G>A	uc001mpm.2	-	3	720	c.198C>T	c.(196-198)CTC>CTT	p.L66L	E2F8_uc009yhv.2_RNA|E2F8_uc001mpn.3_Silent_p.L66L|E2F8_uc001mpo.1_Silent_p.L66L	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	66					cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						CAGCACTGATGAGCATTTTCA	0.517													29	373	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22364829	22364829	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22364829A>C	uc001mqk.2	+	3	789	c.376A>C	c.(376-378)ATG>CTG	p.M126L		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	126	Helical; (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						AACCGTGGGGATGATCCACGG	0.532													62	147	---	---	---	---	PASS
NDUFS3	4722	broad.mit.edu	37	11	47602201	47602201	+	Intron	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602201C>T	uc001nga.2	+						NDUFS3_uc001nft.3_5'UTR|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_Intron	NM_004551	NP_004542	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3						induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	TTATTTGGGTCTGGGTCAAGA	0.458													3	70	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468430	56468430	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468430C>T	uc010rjn.1	+	1	567	c.567C>T	c.(565-567)GGC>GGT	p.G189G		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	189	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGGCCTGTGGCGAGAAGGGCG	0.473													17	175	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61908398	61908398	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61908398T>C	uc001nsw.1	+	10	1677	c.1475T>C	c.(1474-1476)CTC>CCC	p.L492P	INCENP_uc009ynw.1_Missense_Mutation_p.L492P|INCENP_uc001nsx.1_Missense_Mutation_p.L492P	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	492					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						GTACGGCCCCTCCGGACCTTT	0.632													35	83	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93779079	93779079	+	Silent	SNP	A	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93779079A>C	uc001pep.2	+	2	568	c.411A>C	c.(409-411)TCA>TCC	p.S137S		NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	137	Plastocyanin-like 1.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				ACAAAGATTCAGAAGGTAAAT	0.378													15	70	---	---	---	---	PASS
CADM1	23705	broad.mit.edu	37	11	115102194	115102194	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115102194C>T	uc001ppi.3	-	4	570	c.441G>A	c.(439-441)CTG>CTA	p.L147L	CADM1_uc001ppf.3_Silent_p.L147L|CADM1_uc001ppk.3_Silent_p.L147L|CADM1_uc001ppj.3_Silent_p.L147L|CADM1_uc001ppl.2_Silent_p.L147L	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	147	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TATCGATCATCAGATTACGTG	0.418													57	118	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9305466	9305466	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9305466C>G	uc001qvl.2	-	31	4104	c.4075G>C	c.(4075-4077)GAT>CAT	p.D1359H	PZP_uc009zgl.2_Missense_Mutation_p.D1145H	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						TTGTGTCCATCGCAAGTTTGG	0.433													83	134	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12278312	12278312	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12278312C>T	uc001rah.3	-	21	4509	c.4367G>A	c.(4366-4368)AGT>AAT	p.S1456N	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.S1411N	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	1456	Cytoplasmic (Potential).				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				GGGGGGTCCACTGCTTCCCCC	0.433													9	113	---	---	---	---	PASS
ST8SIA1	6489	broad.mit.edu	37	12	22354654	22354654	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22354654A>T	uc001rfo.3	-	5	1385	c.903T>A	c.(901-903)AAT>AAA	p.N301K	ST8SIA1_uc009zix.2_Missense_Mutation_p.N158K	NM_003034	NP_003025	Q92185	SIA8A_HUMAN	alpha-2,8-sialyltransferase 1	301	Lumenal (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3						GCTCATGCATATTCACAGAGA	0.527													35	51	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41337895	41337895	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41337895C>T	uc001rmm.1	+	14	1719	c.1606C>T	c.(1606-1608)CTC>TTC	p.L536F	CNTN1_uc009zjy.1_Missense_Mutation_p.L536F|CNTN1_uc001rmn.1_Missense_Mutation_p.L525F|CNTN1_uc001rmo.2_Missense_Mutation_p.L536F	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	536	Ig-like C2-type 6.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TGCCTTGGATCTCACATTTGT	0.403													9	135	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41337962	41337962	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41337962G>T	uc001rmm.1	+	14	1786	c.1673G>T	c.(1672-1674)AGG>ATG	p.R558M	CNTN1_uc009zjy.1_Missense_Mutation_p.R558M|CNTN1_uc001rmn.1_Missense_Mutation_p.R547M|CNTN1_uc001rmo.2_Missense_Mutation_p.R558M	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	558	Ig-like C2-type 6.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CACTACCAGAGGAATTTTATG	0.358													7	92	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78362323	78362323	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78362323C>G	uc001syp.2	+	5	685	c.512C>G	c.(511-513)GCC>GGC	p.A171G	NAV3_uc001syo.2_Missense_Mutation_p.A171G	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	171	CH.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AACTTAAAAGCCATTCTAGGG	0.333										HNSCC(70;0.22)			25	95	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106772092	106772092	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106772092G>C	uc001tlp.2	+	8	766	c.544G>C	c.(544-546)GAG>CAG	p.E182Q	POLR3B_uc001tlq.2_Missense_Mutation_p.E124Q	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	182					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						TCTTATCCAAGAGCAGCTGTC	0.418													27	123	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52472479	52472479	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52472479C>T	uc001wzo.2	-	21	4327	c.4093G>A	c.(4093-4095)GCA>ACA	p.A1365T	NID2_uc010tqs.1_Missense_Mutation_p.A1317T|NID2_uc010tqt.1_Missense_Mutation_p.A1365T	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	1365	LDL-receptor class B 5.					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					GGGTAGACTGCAGTTATCCCG	0.418													20	89	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102516411	102516411	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102516411T>G	uc001yks.2	+	77	13852	c.13688T>G	c.(13687-13689)TTG>TGG	p.L4563W		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	4563					cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						CTCACAGGTTTGAAACTTCAA	0.587													29	59	---	---	---	---	PASS
GJD2	57369	broad.mit.edu	37	15	35045023	35045023	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35045023C>T	uc001zis.1	-	2	622	c.622G>A	c.(622-624)GCC>ACC	p.A208T	uc001zit.1_5'Flank	NM_020660	NP_065711	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	208	Helical; (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		ATTTCCAGGGCATTTCGGAAC	0.502													47	87	---	---	---	---	PASS
SPINT1	6692	broad.mit.edu	37	15	41136788	41136788	+	Silent	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41136788C>T	uc001zna.2	+	2	240	c.36C>T	c.(34-36)CTC>CTT	p.L12L	SPINT1_uc001znb.2_Silent_p.L12L|SPINT1_uc001znc.2_Silent_p.L12L|SPINT1_uc010ucs.1_Silent_p.L12L	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	12						extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		gcgcccgcctcgccccggccg	0.632													11	15	---	---	---	---	PASS
TGM5	9333	broad.mit.edu	37	15	43552757	43552757	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43552757C>A	uc001zrd.1	-	2	39	c.31G>T	c.(31-33)GAC>TAC	p.D11Y	TGM5_uc001zre.1_Missense_Mutation_p.D11Y	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	11					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	CTCTGGAGGTCTGTGAGGGCC	0.493													71	131	---	---	---	---	PASS
MCTP2	55784	broad.mit.edu	37	15	95001402	95001402	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95001402A>G	uc002btj.2	+	19	2352	c.2287A>G	c.(2287-2289)ATG>GTG	p.M763V	MCTP2_uc010boj.2_Missense_Mutation_p.M492V|MCTP2_uc010bok.2_Missense_Mutation_p.M708V|MCTP2_uc002btl.2_Missense_Mutation_p.M351V	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1	763					calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			AAGAATCTATATGGTACAGGA	0.318													27	54	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15198590	15198590	+	Intron	SNP	C	T	T	rs113675370		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198590C>T	uc002ddc.2	+						uc010uzr.1_Missense_Mutation_p.R100H|uc010uzs.1_RNA|uc002ddh.2_3'UTR|uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGAAGAATGACGATGCTCCGC	0.488													6	100	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47497874	47497874	+	Intron	SNP	G	T	T	rs145777693	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47497874G>T	uc002eev.3	+						ITFG1_uc002eet.2_5'Flank|ITFG1_uc010vgh.1_5'Flank|PHKB_uc010vgi.1_Missense_Mutation_p.V9F|PHKB_uc002eeu.3_Missense_Mutation_p.V9F	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TGATGCAGTCGTCTCTCCGTC	0.403													6	92	---	---	---	---	PASS
CES2	8824	broad.mit.edu	37	16	66976070	66976070	+	Silent	SNP	C	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66976070C>G	uc002eqr.2	+	9	2392	c.1392C>G	c.(1390-1392)CCC>CCG	p.P464P	CES2_uc002eqq.2_Silent_p.P464P|CES2_uc002eqs.2_Silent_p.P307P	NM_003869	NP_003860	O00748	EST2_HUMAN	carboxylesterase 2 isoform 1	400					catabolic process	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)		ATGGGGATCCCCAGACCCTCC	0.527													26	38	---	---	---	---	PASS
NQO1	1728	broad.mit.edu	37	16	69744708	69744708	+	3'UTR	SNP	T	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69744708T>A	uc002exp.2	-	6					NQO1_uc010cfm.2_3'UTR|NQO1_uc002exq.2_3'UTR|NQO1_uc002exr.2_3'UTR|NQO1_uc010vll.1_3'UTR	NM_000903	NP_000894	P15559	NQO1_HUMAN	NAD(P)H menadione oxidoreductase 1,						nitric oxide biosynthetic process|regulation of cellular amino acid metabolic process|response to toxin|synaptic transmission, cholinergic|xenobiotic metabolic process	cytosol	coenzyme binding|cytochrome-b5 reductase activity|electron carrier activity|NAD(P)H dehydrogenase (quinone) activity				0					Dicumarol(DB00266)|Menadione(DB00170)	ATAGTAATCATAAGAATCAGT	0.343													4	8	---	---	---	---	PASS
CDH15	1013	broad.mit.edu	37	16	89245863	89245863	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89245863C>A	uc002fmt.2	+	2	159	c.82C>A	c.(82-84)CCC>ACC	p.P28T	CDH15_uc010cij.1_Missense_Mutation_p.P28T	NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein	28					adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		ATGGAGGAGGCCCACCACCCT	0.672													10	148	---	---	---	---	PASS
WSCD1	23302	broad.mit.edu	37	17	6023803	6023803	+	Missense_Mutation	SNP	T	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6023803T>A	uc010cli.2	+	9	1929	c.1550T>A	c.(1549-1551)CTG>CAG	p.L517Q	WSCD1_uc002gcn.2_Missense_Mutation_p.L517Q|WSCD1_uc002gco.2_Missense_Mutation_p.L517Q|WSCD1_uc010clj.2_Missense_Mutation_p.L208Q	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN	WSC domain containing 1	517						integral to membrane	sulfotransferase activity				0						GAGGAGCGGCTGCTCTGCGTG	0.652													42	89	---	---	---	---	PASS
RCVRN	5957	broad.mit.edu	37	17	9801318	9801318	+	3'UTR	SNP	C	T	T	rs71680149		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9801318C>T	uc002gme.1	-	3						NM_002903	NP_002894	P35243	RECO_HUMAN	recoverin						visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						tgtgtgtgtgcgcgcgcgtgt	0.448													4	78	---	---	---	---	PASS
TTC19	54902	broad.mit.edu	37	17	15930613	15930613	+	Intron	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15930613T>G	uc002gph.1	+						TTC19_uc010cox.1_Intron|TTC19_uc002gpk.3_3'UTR|TTC19_uc002gpj.2_Intron	NM_017775	NP_060245	Q6DKK2	TTC19_HUMAN	tetratricopeptide repeat domain 19						cell cycle|cytokinesis|mitochondrial respiratory chain complex III assembly	centrosome|midbody|mitochondrial inner membrane	protein binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		ATATCTGCATTCATGCTCTCT	0.428													11	18	---	---	---	---	PASS
TOP3A	7156	broad.mit.edu	37	17	18188466	18188466	+	Nonsense_Mutation	SNP	T	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18188466T>A	uc002gsx.1	-	15	2096	c.1867A>T	c.(1867-1869)AAA>TAA	p.K623*	TOP3A_uc010cpz.1_Nonsense_Mutation_p.K75*|TOP3A_uc010vxr.1_Nonsense_Mutation_p.K153*|TOP3A_uc002gsw.1_Nonsense_Mutation_p.K75*|TOP3A_uc010vxs.1_Nonsense_Mutation_p.K521*	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	623					DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						TTCTTTGCTTTAGCCACCGCT	0.259													95	177	---	---	---	---	PASS
KRT39	390792	broad.mit.edu	37	17	39122859	39122859	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39122859C>T	uc002hvo.1	-	1	286	c.250G>A	c.(250-252)GAC>AAC	p.D84N	KRT39_uc010wfm.1_5'UTR	NM_213656	NP_998821	Q6A163	K1C39_HUMAN	type I hair keratin KA35	84	Head.					intermediate filament	structural molecule activity				0		Breast(137;0.00043)|Ovarian(249;0.15)				CAGCTGCAGTCATCCAGAGAA	0.498													15	295	---	---	---	---	PASS
DCAKD	79877	broad.mit.edu	37	17	43112204	43112204	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43112204A>G	uc002ihx.2	-	1	306	c.50T>C	c.(49-51)GTG>GCG	p.V17A	DCAKD_uc010daa.1_Missense_Mutation_p.V17A|DCAKD_uc010dab.1_Missense_Mutation_p.V17A|DCAKD_uc002ihy.2_Missense_Mutation_p.V17A	NM_024819	NP_079095	Q8WVC6	DCAKD_HUMAN	dephospho-CoA kinase domain containing	17	DPCK.				coenzyme A biosynthetic process		ATP binding|dephospho-CoA kinase activity				0		Prostate(33;0.155)				CACCTGGATCACTGAGCTCTT	0.617													14	59	---	---	---	---	PASS
SNX11	29916	broad.mit.edu	37	17	46198653	46198653	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46198653A>C	uc002inf.1	+	8	950	c.596A>C	c.(595-597)GAA>GCA	p.E199A	SNX11_uc010wlg.1_Missense_Mutation_p.E191A|SNX11_uc010wlh.1_Missense_Mutation_p.E191A|SNX11_uc010wli.1_Missense_Mutation_p.E138A|SNX11_uc010wlj.1_Missense_Mutation_p.E55A|SNX11_uc002ing.1_Missense_Mutation_p.E199A|SNX11_uc002inh.1_Missense_Mutation_p.E199A	NM_152244	NP_689450	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	199					cell communication|protein transport	membrane	phosphatidylinositol binding				0						CCTCCCAGTGAAGAAAAGGAC	0.483													41	208	---	---	---	---	PASS
HLF	3131	broad.mit.edu	37	17	53398085	53398085	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53398085G>A	uc002iug.1	+	4	1258	c.733G>A	c.(733-735)GCC>ACC	p.A245T	HLF_uc010dce.1_Missense_Mutation_p.A160T|HLF_uc002iuh.2_Missense_Mutation_p.A160T|HLF_uc010wni.1_Missense_Mutation_p.A192T	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor	245	Basic motif.				multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						CTCCCGCGACGCCCGGAGGCT	0.557			T	TCF3	ALL								9	39	---	---	---	---	PASS
MRPL38	64978	broad.mit.edu	37	17	73898001	73898001	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73898001G>C	uc010wso.1	-	4	608	c.383C>G	c.(382-384)GCC>GGC	p.A128G	FBF1_uc002jqa.1_Intron|MRPL38_uc002jpz.1_RNA	NM_032478	NP_115867	Q96DV4	RM38_HUMAN	mitochondrial ribosomal protein L38 precursor	128						actin cytoskeleton|mitochondrion|ribosome				pancreas(1)	1			all cancers(21;0.000154)|Epithelial(20;0.000156)|BRCA - Breast invasive adenocarcinoma(9;0.00936)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGGGACACTGGCTAGACAGGA	0.642													4	24	---	---	---	---	PASS
TMC6	11322	broad.mit.edu	37	17	76116777	76116777	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76116777C>T	uc002juj.1	-	12	1798	c.1672G>A	c.(1672-1674)GTC>ATC	p.V558I	TMC6_uc002jui.1_Intron|TMC6_uc010dhf.1_Missense_Mutation_p.V391I|TMC6_uc002juk.2_Missense_Mutation_p.V558I|TMC6_uc010dhg.1_Intron|TMC6_uc002jul.1_Missense_Mutation_p.V558I|TMC6_uc002jum.3_Missense_Mutation_p.V349I|TMC6_uc002jun.3_Missense_Mutation_p.V558I|TMC6_uc002juo.2_3'UTR	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	558	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AACATGAGGACGAAGTCCATC	0.637									Epidermodysplasia_Verruciformis_Familial_Clustering_of				97	214	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14513764C>T	uc010dln.2	-	10	1884	c.1430G>A	c.(1429-1431)CGG>CAG	p.R477Q	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	477										skin(3)	3						AAGTTGTTTCCGGGTATCATT	0.358													5	86	---	---	---	---	PASS
WDR18	57418	broad.mit.edu	37	19	994079	994079	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:994079A>G	uc002lqm.1	+	9	1185	c.1159A>G	c.(1159-1161)ATG>GTG	p.M387V	WDR18_uc002lqn.1_RNA|WDR18_uc010drx.1_Missense_Mutation_p.M350V|WDR18_uc010dry.1_Intron	NM_024100	NP_077005	Q9BV38	WDR18_HUMAN	WD repeat domain 18	387										skin(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGCAGCACCATGGAGAAGGT	0.721													2	6	---	---	---	---	PASS
TMIGD2	126259	broad.mit.edu	37	19	4298004	4298004	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4298004T>C	uc002lzx.1	-	2	431	c.385A>G	c.(385-387)ACA>GCA	p.T129A	TMIGD2_uc010dtv.1_Missense_Mutation_p.T129A	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	129	Extracellular (Potential).|Ig-like.					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGAGCCTTGTTATGTTGCCC	0.587													85	268	---	---	---	---	PASS
RNASEH2A	10535	broad.mit.edu	37	19	12921170	12921170	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12921170G>C	uc002mvg.1	+	6	649	c.589G>C	c.(589-591)GAG>CAG	p.E197Q	RNASEH2A_uc002mvf.1_Missense_Mutation_p.E115Q	NM_006397	NP_006388	O75792	RNH2A_HUMAN	ribonuclease H2, large subunit	197					DNA replication|RNA catabolic process	nucleus|ribonuclease H2 complex	metal ion binding|ribonuclease H activity|RNA binding			breast(2)|central_nervous_system(1)	3						GCAGTTCGTGGAGAAACTGCA	0.567													36	94	---	---	---	---	PASS
NUDT19	390916	broad.mit.edu	37	19	33183154	33183154	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33183154C>A	uc010edf.2	+	1	288	c.288C>A	c.(286-288)TTC>TTA	p.F96L		NM_001105570	NP_001099040	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety	96	Nudix hydrolase.					mitochondrion|peroxisome	hydrolase activity|metal ion binding				0	Esophageal squamous(110;0.137)					CGGCGCCATTCAGCCGCACCG	0.726													18	40	---	---	---	---	PASS
WTIP	126374	broad.mit.edu	37	19	34984527	34984527	+	Missense_Mutation	SNP	C	A	A	rs151001266	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34984527C>A	uc002nvm.2	+	5	1031	c.1031C>A	c.(1030-1032)ACG>AAG	p.T344K		NM_001080436	NP_001073905			Wilms tumor 1 interacting protein												0	all_lung(56;5.94e-07)|Lung NSC(56;9.35e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GACTATCACACGTGAGTTGCT	0.592													6	142	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533022	41533022	+	Intron	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533022G>C	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CCTTTGAAGAGCCAGTCGAAG	0.662													5	78	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42848626	42848626	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42848626C>A	uc002otl.3	+	11	2457	c.1822C>A	c.(1822-1824)CTC>ATC	p.L608I	MEGF8_uc002otm.3_Missense_Mutation_p.L149I	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	608	Extracellular (Potential).|PSI 1.					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				CCTGGGCCGCCTCCTGGGTGA	0.672													15	54	---	---	---	---	PASS
LIPE	3991	broad.mit.edu	37	19	42912198	42912198	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42912198C>T	uc002otr.2	-	4	1863	c.1586G>A	c.(1585-1587)CGG>CAG	p.R529Q	uc010eif.1_Intron|LIPE_uc002ots.1_Missense_Mutation_p.R274Q	NM_005357	NP_005348	Q05469	LIPS_HUMAN	hormone-sensitive lipase	529					cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding			ovary(1)|breast(1)	2		Prostate(69;0.00682)				CTGTGTGATCCGCTCAAACTC	0.552													31	67	---	---	---	---	PASS
KCNA7	3743	broad.mit.edu	37	19	49575301	49575301	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49575301G>T	uc002pmg.2	-	1	898	c.542C>A	c.(541-543)GCC>GAC	p.A181D		NM_031886	NP_114092	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related	181						voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(1)	1		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)		GCCGGCTGCGGCTGCAGCAGC	0.697													3	3	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50098148	50098148	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50098148C>A	uc002poo.3	+	4	556	c.556C>A	c.(556-558)CAT>AAT	p.H186N		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCTGTCCCCTCATGACGTGCT	0.687													7	16	---	---	---	---	PASS
OPRL1	4987	broad.mit.edu	37	20	62730060	62730060	+	Missense_Mutation	SNP	C	T	T	rs150300242	byFrequency	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62730060C>T	uc002yic.2	+	5	1423	c.1021C>T	c.(1021-1023)CGG>TGG	p.R341W	OPRL1_uc002yid.2_Missense_Mutation_p.R341W|OPRL1_uc002yif.3_Missense_Mutation_p.R336W	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1	341	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					TGCCCTGCGCCGGGACGTGCA	0.632													6	84	---	---	---	---	PASS
UMODL1	89766	broad.mit.edu	37	21	43529671	43529671	+	Splice_Site	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43529671G>A	uc002zaf.1	+	10	1520	c.1520_splice	c.e10-1	p.D507_splice	UMODL1_uc002zad.1_Splice_Site_p.D435_splice|UMODL1_uc002zae.1_Splice_Site_p.D435_splice|UMODL1_uc002zag.1_Splice_Site_p.D507_splice|C21orf128_uc002zak.2_5'Flank	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						CCCCCTGGCAGACTGGGACGA	0.577													49	164	---	---	---	---	PASS
GATSL3	652968	broad.mit.edu	37	22	30682432	30682432	+	Intron	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30682432G>T	uc003ahd.2	-						GATSL3_uc003ahc.2_Intron|GATSL3_uc003ahe.2_Intron|GATSL3_uc003ahf.2_Intron|GATSL3_uc003ahg.2_Intron|GATSL3_uc003ahh.2_Intron|GATSL3_uc010gvq.2_Intron|GATSL3_uc003ahi.2_Intron|GATSL3_uc010gvr.2_3'UTR	NM_001037666	NP_001032755	Q8WTX7	GATL3_HUMAN	GATS protein-like 3											breast(1)	1						CTCCCGATCAGCCTCCAGAAC	0.647													5	8	---	---	---	---	PASS
MLC1	23209	broad.mit.edu	37	22	50518782	50518782	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50518782G>T	uc003bjg.1	-	4	585	c.312C>A	c.(310-312)AAC>AAA	p.N104K	MLC1_uc011arl.1_Intron|MLC1_uc003bjh.1_Missense_Mutation_p.N104K|MLC1_uc011arm.1_Missense_Mutation_p.N74K|MLC1_uc011arn.1_Missense_Mutation_p.N25K|MLC1_uc011aro.1_Missense_Mutation_p.N104K	NM_139202	NP_631941	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with	104						basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		CCACATTGGCGTTCCTCCTGG	0.587													4	13	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17742451	17742451	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17742451T>C	uc004cxx.2	+	5	1416	c.1078T>C	c.(1078-1080)TGC>CGC	p.C360R	NHS_uc011mix.1_Missense_Mutation_p.C381R|NHS_uc004cxy.2_Missense_Mutation_p.C204R|NHS_uc004cxz.2_Missense_Mutation_p.C183R|NHS_uc004cya.2_Missense_Mutation_p.C83R	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	360						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					TAGTATACGCTGCTCTCTGGT	0.433													13	159	---	---	---	---	PASS
MAGEB3	4114	broad.mit.edu	37	X	30253983	30253983	+	5'UTR	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30253983G>A	uc004dca.1	+	5						NM_002365	NP_002356	O15480	MAGB3_HUMAN	melanoma antigen family B, 3												0						TCCTCCAGGTGCCTGTATCAC	0.527													14	36	---	---	---	---	PASS
VSIG4	11326	broad.mit.edu	37	X	65253460	65253460	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65253460G>A	uc004dwh.2	-	2	395	c.268C>T	c.(268-270)CAC>TAC	p.H90Y	VSIG4_uc004dwi.2_Missense_Mutation_p.H90Y|VSIG4_uc010nkq.1_Missense_Mutation_p.H90Y|VSIG4_uc004dwj.2_Missense_Mutation_p.H90Y|VSIG4_uc011moy.1_Missense_Mutation_p.H90Y|VSIG4_uc004dwk.2_Missense_Mutation_p.H90Y|VSIG4_uc004dwl.2_5'UTR	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	90	Ig-like 1.|Extracellular (Potential).				complement activation, alternative pathway	integral to membrane	protein binding				0						GGAACCTTGTGGCTCACATGC	0.552													101	184	---	---	---	---	PASS
NOX1	27035	broad.mit.edu	37	X	100098824	100098824	+	3'UTR	SNP	T	G	G			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100098824T>G	uc004egj.2	-	13					NOX1_uc004egl.3_3'UTR|NOX1_uc010nne.2_3'UTR	NM_007052	NP_008983	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1 isoform long						angiogenesis|cell migration|electron transport chain|FADH2 metabolic process|hydrogen peroxide metabolic process|inflammatory response|intracellular pH elevation|positive regulation of integrin biosynthetic process|positive regulation of smooth muscle cell proliferation|positive regulation vascular endothelial growth factor production|respiratory burst|response to pH|signal transduction|superoxide anion generation	cell junction|early endosome|invadopodium membrane|NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|Rac GTPase binding|superoxide-generating NADPH oxidase activity|voltage-gated proton channel activity			ovary(1)	1						TACCAGGGAGTCAAGGCTTGA	0.383													9	19	---	---	---	---	PASS
DRP2	1821	broad.mit.edu	37	X	100515603	100515603	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100515603C>T	uc004egz.2	+	24	3236	c.2867C>T	c.(2866-2868)GCC>GTC	p.A956V	DRP2_uc011mrh.1_Missense_Mutation_p.A878V	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	956					central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						ACCCTGCTGGCCTCTTGATGG	0.537													9	461	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129149349	129149349	+	Silent	SNP	G	A	A	rs147051252	byFrequency	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129149349G>A	uc004evb.1	+	4	2715	c.2601G>A	c.(2599-2601)TCG>TCA	p.S867S	BCORL1_uc010nrd.1_Silent_p.S769S	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	867					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						GCGTTGTTTCGGAGTTTTCTG	0.642													14	204	---	---	---	---	PASS
IDS	3423	broad.mit.edu	37	X	148586585	148586585	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148586585G>C	uc011mxe.1	-	1	281	c.83C>G	c.(82-84)ACG>AGG	p.T28R	IDS_uc011mxf.1_5'UTR|IDS_uc011mxg.1_5'UTR|IDS_uc010nsu.1_Intron|IDS_uc004fcw.3_Intron|IDS_uc011mxh.1_Missense_Mutation_p.T28R|IDS_uc011mxi.1_RNA|IDS_uc011mxj.1_Missense_Mutation_p.T28R	NM_000202	NP_000193	P22304	IDS_HUMAN	iduronate-2-sulfatase isoform a precursor	28						lysosome	iduronate-2-sulfatase activity|metal ion binding				0	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GTTGGCCTGCGTTTCGGATCC	0.468													32	75	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13813	13813	+	RNA	SNP	G	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13813G>A	uc004cox.3	+	1		c.1477G>A			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CAGCCCTCGCTGTCACTTTCC	0.443													5	35	---	---	---	---	PASS
NBPF3	84224	broad.mit.edu	37	1	21807368	21807368	+	Intron	DEL	A	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21807368delA	uc001ber.2	+						NBPF3_uc001bes.2_Intron|NBPF3_uc009vqb.2_Intron|NBPF3_uc010odm.1_Intron	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3							cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GTGGACTGTTAATGGGTGTAG	0.478													3	3	---	---	---	---	
FUCA1	2517	broad.mit.edu	37	1	24175456	24175456	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24175456delT	uc001bie.2	-							NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor						fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GCTGTTTTAAttttttttttt	0.184													4	2	---	---	---	---	
CYP4A22	284541	broad.mit.edu	37	1	47611302	47611303	+	Intron	INS	-	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47611302_47611303insA	uc001cqv.1	+						CYP4A22_uc009vyo.2_Intron|CYP4A22_uc009vyp.2_Intron	NM_001010969	NP_001010969	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A,							endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding			skin(2)|ovary(1)|breast(1)	4						CTCTAAAGAGTAATGCTCTGAT	0.317													14	10	---	---	---	---	
NFIA	4774	broad.mit.edu	37	1	61921199	61921199	+	3'UTR	DEL	A	-	-	rs74089375		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61921199delA	uc001czw.2	+	11					NFIA_uc001czy.2_3'UTR|NFIA_uc010oos.1_3'UTR|NFIA_uc001czv.2_3'UTR|NFIA_uc001czx.2_3'UTR|NFIA_uc009wae.2_RNA	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						TTTTTTTTTTAAAATACTTTA	0.378													9	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145109975	145109976	+	Intron	INS	-	C	C	rs11458983		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109975_145109976insC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CAGGAACTTTGCTAAAGATCTA	0.386													3	3	---	---	---	---	
LMX1A	4009	broad.mit.edu	37	1	165322654	165322655	+	Intron	INS	-	A	A	rs145554599	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165322654_165322655insA	uc001gcy.1	-						LMX1A_uc001gcz.1_Intron	NM_177398	NP_796372	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)					CTGAAACCTGGAAAAAATCAAG	0.500													0	6	---	---	---	---	
KLHL20	27252	broad.mit.edu	37	1	173735618	173735619	+	Intron	INS	-	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173735618_173735619insA	uc001gjc.2	+						KLHL20_uc010pmr.1_Intron|KLHL20_uc009wwf.2_Intron	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20						cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						ataaaaaatacaaaaaaaaaaa	0.000													4	3	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237850666	237850666	+	Intron	DEL	C	-	-	rs41267515		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237850666delC	uc001hyl.1	+						RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ttttcttcttctttttttttt	0.328													3	5	---	---	---	---	
RNF144A	9781	broad.mit.edu	37	2	7164326	7164326	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7164326delT	uc002qys.2	+						RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		TTCTGGTTAAttttttttttc	0.229													9	5	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	88003864	88003865	+	Intron	INS	-	TAC	TAC			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88003864_88003865insTAC	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						CTGGGAATATTTACTAAATTCA	0.292													15	17	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100052594	100052595	+	Intron	INS	-	GTTT	GTTT	rs145209140	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100052594_100052595insGTTT	uc002tad.2	-						REV1_uc002tac.2_Intron	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						GTCTCTAATTAGTCAAAAAGTG	0.292								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					3	4	---	---	---	---	
MRPS9	64965	broad.mit.edu	37	2	105706585	105706589	+	Intron	DEL	AAAAC	-	-	rs67433632		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105706585_105706589delAAAAC	uc002tcn.3	+							NM_182640	NP_872578	P82933	RT09_HUMAN	mitochondrial ribosomal protein S9 precursor						DNA damage response, detection of DNA damage|translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0						TCTTTCTTTAaaaacaaaacaaaac	0.341													5	7	---	---	---	---	
RALB	5899	broad.mit.edu	37	2	121046889	121046890	+	Intron	INS	-	ACTT	ACTT	rs140593306	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121046889_121046890insACTT	uc002tmk.2	+						RALB_uc010yys.1_Intron|RALB_uc002tml.2_Intron|RALB_uc002tmm.2_Intron|RALB_uc010yyt.1_Intron	NM_002881	NP_002872	P11234	RALB_HUMAN	v-ral simian leukemia viral oncogene homolog B						apoptosis|cell cycle|cytokinesis|nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of exocyst assembly|regulation of exocyst localization	cytosol|midbody|plasma membrane	GTP binding|GTPase activity|protein binding			lung(3)	3		Prostate(154;0.122)				cctatccagacacttctgtaag	0.094													1	5	---	---	---	---	
ACCN4	55515	broad.mit.edu	37	2	220399638	220399639	+	Intron	INS	-	C	C	rs141295062	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220399638_220399639insC	uc002vma.2	+						ACCN4_uc002vlz.2_Intron|ACCN4_uc002vmb.2_Intron	NM_182847	NP_878267	Q96FT7	ACCN4_HUMAN	amiloride-sensitive cation channel 4 isoform 2							integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity			ovary(2)	2		Renal(207;0.0183)		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)		GGCCACGAGGACCCCCCCCCAG	0.589													4	2	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	241992105	241992108	+	Intron	DEL	GGCG	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241992105_241992108delGGCG	uc002wah.1	+							NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		TGAGAGGGTCGGCGGGGGGGGGGG	0.672													5	3	---	---	---	---	
VPRBP	9730	broad.mit.edu	37	3	51471278	51471279	+	Intron	INS	-	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51471278_51471279insA	uc003dbe.1	-							NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		gactccatgtcaaaaaaaaaaa	0.168													6	3	---	---	---	---	
NIT2	56954	broad.mit.edu	37	3	100074010	100074011	+	Intron	INS	-	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100074010_100074011insT	uc003dtv.2	+							NM_020202	NP_064587	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2						nitrogen compound metabolic process		omega-amidase activity			ovary(1)	1						GCACTTTCCTGTTTTTTGCAGA	0.421													46	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125400039	125400039	+	IGR	DEL	G	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125400039delG								OSBPL11 (85658 upstream) : MIR548I1 (109208 downstream)																							ATGGATCTGAGCAAGCATGAC	0.572													3	3	---	---	---	---	
SRP72	6731	broad.mit.edu	37	4	57344337	57344337	+	Intron	DEL	C	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57344337delC	uc003hbv.2	+						SRP72_uc010ihe.2_Intron|SRP72_uc003hbw.1_Intron	NM_006947	NP_008878	O76094	SRP72_HUMAN	signal recognition particle 72kDa						response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding			ovary(1)	1	Glioma(25;0.08)|all_neural(26;0.101)					ttttttttttctttAGATACT	0.313													4	2	---	---	---	---	
TBCK	93627	broad.mit.edu	37	4	107169485	107169488	+	Intron	DEL	TAAT	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107169485_107169488delTAAT	uc010ilv.2	-						TBCK_uc003hyb.2_5'Flank|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						AGAGAGAAAATAATTAATTAAAAT	0.255													42	23	---	---	---	---	
RRH	10692	broad.mit.edu	37	4	110756944	110756944	+	Intron	DEL	T	-	-	rs71595523		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110756944delT	uc003hzv.2	+							NM_006583	NP_006574	O14718	OPSX_HUMAN	peropsin						phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		cttaaatgtctttttttTTTT	0.159													5	6	---	---	---	---	
HMGCR	3156	broad.mit.edu	37	5	74651576	74651577	+	Intron	INS	-	A	A			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74651576_74651577insA	uc003kdp.2	+						HMGCR_uc011cst.1_Intron|HMGCR_uc003kdq.2_Intron|HMGCR_uc010izo.2_5'Flank|HMGCR_uc010izp.2_5'Flank	NM_000859	NP_000850	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-Coenzyme A reductase						cholesterol biosynthetic process|coenzyme A metabolic process|germ cell migration|gonad development|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal membrane	hydroxymethylglutaryl-CoA reductase (NADPH) activity|NADP binding			ovary(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Cerivastatin(DB00439)|Fluvastatin(DB01095)|Lovastatin(DB00227)|NADH(DB00157)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	AAATTAGTAAGAAAAAAAAAAA	0.287													4	3	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131306105	131306105	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131306105delT	uc010jdo.1	-						ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Intron|ACSL6_uc003kvy.1_Intron|ACSL6_uc003kwb.2_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Intron|ACSL6_uc003kvw.1_Intron|ACSL6_uc010jdn.1_Intron	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGAAGTGCTAttttttttttt	0.259													6	3	---	---	---	---	
FAT2	2196	broad.mit.edu	37	5	150911778	150911778	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150911778delT	uc003lue.3	-						GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_5'Flank	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor						epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCGAAAATATTATGTGGGGA	0.343													5	4	---	---	---	---	
STC2	8614	broad.mit.edu	37	5	172752679	172752679	+	Intron	DEL	C	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172752679delC	uc003mco.1	-						STC2_uc003mcn.1_Intron	NM_003714	NP_003705	O76061	STC2_HUMAN	stanniocalcin 2 precursor						cell surface receptor linked signaling pathway|cell-cell signaling	extracellular region	hormone activity			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GTCCACCCTGCCTGTGTAGAC	0.488													82	86	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177407602	177407604	+	IGR	DEL	CCA	-	-	rs13156399	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177407602_177407604delCCA								LOC728554 (96335 upstream) : PROP1 (11632 downstream)																							ACGTGGGAGCCCATTTCTCCCtg	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180699086	180699087	+	RNA	INS	-	A	A	rs11381664		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180699086_180699087insA	uc003mnq.2	+	3		c.450_451insA								Homo sapiens cDNA clone IMAGE:3910094, partial cds.																		CTTTCCATCAGAAAAAAAAAAA	0.406													4	2	---	---	---	---	
ZKSCAN4	387032	broad.mit.edu	37	6	28217849	28217850	+	Intron	INS	-	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28217849_28217850insT	uc003nks.1	-						ZKSCAN4_uc011dlb.1_Intron	NM_019110	NP_061983	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						TGGtttttttgttttttttttt	0.183													4	4	---	---	---	---	
SRPK1	6732	broad.mit.edu	37	6	35810504	35810504	+	Intron	DEL	A	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35810504delA	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TAGATCATTTAAAAAAAAAAA	0.308													5	3	---	---	---	---	
CCNC	892	broad.mit.edu	37	6	100009755	100009765	+	Intron	DEL	AAACAACAACA	-	-	rs149172031	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100009755_100009765delAAACAACAACA	uc003pqe.2	-						uc003pqc.2_Intron|CCNC_uc003pqd.2_Intron|CCNC_uc010kcr.2_Intron|CCNC_uc010kcs.2_Intron|CCNC_uc011eah.1_Intron|CCNC_uc003pqf.2_Intron	NM_005190	NP_005181	P24863	CCNC_HUMAN	cyclin C isoform a						regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	DNA-directed RNA polymerase II, holoenzyme	protein kinase binding				0		all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		AGGTATGCATaaacaacaacaaaacaacaac	0.265													3	3	---	---	---	---	
MED23	9439	broad.mit.edu	37	6	131911325	131911325	+	Intron	DEL	A	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131911325delA	uc003qcs.1	-						MED23_uc003qcq.2_Intron|MED23_uc003qcr.1_Intron	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		TAAGTCCTCTAAAATTGCTCT	0.234													8	6	---	---	---	---	
NOX3	50508	broad.mit.edu	37	6	155749721	155749721	+	Intron	DEL	T	-	-	rs111606766		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155749721delT	uc003qqm.2	-							NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3								electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TCtttttttcttttttttttt	0.363													5	3	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157522543	157522543	+	Frame_Shift_Del	DEL	G	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157522543delG	uc003qqn.2	+	18	4913	c.4761delG	c.(4759-4761)GAGfs	p.E1587fs	ARID1B_uc003qqo.2_Frame_Shift_Del_p.E1547fs|ARID1B_uc003qqp.2_Frame_Shift_Del_p.E1534fs	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1592	Pro-rich.				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TCAGAAGGGAGATCACCTTTC	0.512													240	126	---	---	---	---	
TAGAP	117289	broad.mit.edu	37	6	159457430	159457430	+	Frame_Shift_Del	DEL	C	-	-	rs116639718	byFrequency	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159457430delC	uc003qrz.2	-	10	1957	c.1625delG	c.(1624-1626)GGTfs	p.G542fs	TAGAP_uc011eft.1_Frame_Shift_Del_p.G479fs|TAGAP_uc003qsa.2_Frame_Shift_Del_p.G364fs	NM_054114	NP_473455	Q8N103	TAGAP_HUMAN	T-cell activation Rho GTPase-activating protein	542					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTTTCTGACACCCCTCGGGAC	0.567													167	80	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1396144	1396145	+	IGR	INS	-	T	T	rs149226520		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1396144_1396145insT								UNCX (119532 upstream) : MICALL2 (77851 downstream)																							tccttccttccttttttttttt	0.010													4	4	---	---	---	---	
AMZ1	155185	broad.mit.edu	37	7	2749072	2749073	+	Intron	INS	-	GGCCTCCCCAG	GGCCTCCCCAG	rs142816481	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2749072_2749073insGGCCTCCCCAG	uc003smr.1	+						AMZ1_uc003sms.1_Intron|AMZ1_uc011jwa.1_Intron	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1								metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CTATCCTGTGTGGCCTCCCACC	0.629											OREG0017838	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	7	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6840334	6840334	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6840334delT	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		TATAAAGTCATTTTTTTTTTT	0.204													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64722027	64722028	+	IGR	INS	-	A	A	rs34277183		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64722027_64722028insA								INTS4L1 (27428 upstream) : ZNF92 (116740 downstream)																							agactctgtctaaaaaaaaaaa	0.178													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74160435	74160436	+	Intron	INS	-	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74160435_74160436insT	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|GTF2I_uc003uba.2_5'Flank	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						AACTATTTTTCTTTTTTTTTTT	0.347													4	5	---	---	---	---	
CNPY4	245812	broad.mit.edu	37	7	99719673	99719673	+	Intron	DEL	A	-	-	rs76152850		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99719673delA	uc003uto.2	+						TAF6_uc003uti.2_5'Flank|TAF6_uc003utk.2_5'Flank|TAF6_uc011kji.1_5'Flank|TAF6_uc003utj.2_5'Flank|TAF6_uc003utl.2_5'Flank|TAF6_uc003utm.2_5'Flank|TAF6_uc003utn.1_5'Flank	NM_152755	NP_689968	Q8N129	CNPY4_HUMAN	canopy 4 homolog precursor							extracellular region					0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					agtccgtctgaaaaaaaaaaa	0.000													6	3	---	---	---	---	
DCAF12	25853	broad.mit.edu	37	9	34109908	34109908	+	Intron	DEL	G	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34109908delG	uc003ztt.2	-							NM_015397	NP_056212	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12							centrosome|CUL4 RING ubiquitin ligase complex					0						TGGACGGAGAGGGTGACATTG	0.423													14	7	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78790226	78790227	+	Intron	INS	-	AGAAC	AGAAC	rs45587131	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790226_78790227insAGAAC	uc004ajz.2	+						PCSK5_uc004ajy.2_3'UTR|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						tagaatagaatagaacagaaca	0.119													2	5	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79842991	79842992	+	Intron	DEL	TA	-	-	rs34249411		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79842991_79842992delTA	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						TTGTTATGCTTATATATATATA	0.257													4	3	---	---	---	---	
ORM1	5004	broad.mit.edu	37	9	117092599	117092599	+	Intron	DEL	G	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117092599delG	uc011lxo.1	+						ORM2_uc004bil.2_Intron	NM_000607	NP_000598	P02763	A1AG1_HUMAN	orosomucoid 1 precursor						acute-phase response|regulation of immune system process|transport	extracellular space	protein binding				0		Myeloproliferative disorder(63;0.163)			Acenocoumarol(DB01418)|Alfentanil(DB00802)|Aprindine(DB01429)|Disopyramide(DB00280)|Penbutolol(DB01359)|Phenprocoumon(DB00946)|Quinidine(DB00908)|Tamsulosin(DB00706)	CTGCCCACCAGgggcctcatc	0.408													9	4	---	---	---	---	
NEBL	10529	broad.mit.edu	37	10	21097279	21097279	+	Intron	DEL	A	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21097279delA	uc001iqi.2	-						NEBL_uc001iqj.2_Intron|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform						regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						TTTTTTCTTTAAAAAAAAAAA	0.299													4	2	---	---	---	---	
PDE6C	5146	broad.mit.edu	37	10	95382045	95382046	+	Intron	INS	-	TTTT	TTTT	rs138713277	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95382045_95382046insTTTT	uc001kiu.3	+							NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C						visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)				cagcaagtcTGTTTTTttttta	0.020													3	5	---	---	---	---	
ADRBK1	156	broad.mit.edu	37	11	67050942	67050959	+	Intron	DEL	CTTTTTATGTTTATCAAA	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67050942_67050959delCTTTTTATGTTTATCAAA	uc009yrn.1	+						ADRBK1_uc009yrm.1_Intron	NM_001619	NP_001610	P25098	ARBK1_HUMAN	beta-adrenergic receptor kinase 1						activation of phospholipase C activity|cardiac muscle contraction|desensitization of G-protein coupled receptor protein signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of striated muscle contraction|negative regulation of the force of heart contraction by chemical signal|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of catecholamine secretion|tachykinin receptor signaling pathway	cytosol|soluble fraction	alpha-2A adrenergic receptor binding|ATP binding|beta-adrenergic receptor kinase activity|Edg-2 lysophosphatidic acid receptor binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	ATGATAGCAGCTTTTTatgtttatcaaacatttattaa	0.266													6	7	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178316	134178316	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178316delT	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		accaccatcatcaccatcacc	0.000													7	4	---	---	---	---	
KDM5A	5927	broad.mit.edu	37	12	492921	492921	+	Intron	DEL	T	-	-	rs71839973		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:492921delT	uc001qif.1	-						KDM5A_uc001qie.1_Intron|KDM5A_uc010sdn.1_Intron|KDM5A_uc010sdo.1_Intron	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TTCATTGTCCttttttttttt	0.109			T 	NUP98	AML								8	4	---	---	---	---	
LARP4	113251	broad.mit.edu	37	12	50861115	50861115	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50861115delT	uc001rwp.1	+						LARP4_uc001rwo.1_Intron|LARP4_uc001rwq.1_Intron|LARP4_uc001rwr.1_Intron|LARP4_uc001rws.1_Intron|LARP4_uc009zlr.1_Intron|LARP4_uc001rwt.1_Intron	NM_052879	NP_443111	Q71RC2	LARP4_HUMAN	c-Mpl binding protein isoform a								nucleotide binding|RNA binding			ovary(1)	1						CATGTCTTTGTTTTTTTTTTT	0.159													4	2	---	---	---	---	
ESYT1	23344	broad.mit.edu	37	12	56525500	56525500	+	Intron	DEL	G	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56525500delG	uc001sjq.2	+						ESYT1_uc001sjr.2_Intron	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1							integral to membrane				ovary(4)|skin(1)	5						ACACCCCATAGGATCTGTCCT	0.522													130	62	---	---	---	---	
AGAP2	116986	broad.mit.edu	37	12	58129302	58129303	+	Intron	INS	-	C	C	rs149789274	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58129302_58129303insC	uc001spq.2	-						AGAP2_uc001spp.2_Intron|AGAP2_uc001spr.2_Intron	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L						axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						CAGCTTTCCAACCCCCCCCCAA	0.634													6	3	---	---	---	---	
POLE	5426	broad.mit.edu	37	12	133226298	133226298	+	Frame_Shift_Del	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133226298delT	uc001uks.1	-	30	3804	c.3760delA	c.(3760-3762)ATCfs	p.I1254fs	POLE_uc001ukr.1_Frame_Shift_Del_p.I58fs|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Frame_Shift_Del_p.I1227fs	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1254					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		TGCCCCAAGATTTCCTGCCAG	0.627								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					226	104	---	---	---	---	
CARS2	79587	broad.mit.edu	37	13	111335435	111335435	+	Frame_Shift_Del	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111335435delT	uc001vrd.2	-	6	658	c.618delA	c.(616-618)AAAfs	p.K206fs	CARS2_uc010tjm.1_RNA	NM_024537	NP_078813	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial	206					cysteinyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|cysteine-tRNA ligase activity|metal ion binding				0	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	CGCCGACCAATTTGCCATACT	0.522													120	66	---	---	---	---	
WDHD1	11169	broad.mit.edu	37	14	55422594	55422595	+	Intron	INS	-	TTCAGA	TTCAGA	rs140324706	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55422594_55422595insTTCAGA	uc001xbm.1	-						WDHD1_uc010aom.1_Intron|WDHD1_uc001xbn.1_Intron	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1							cytoplasm|nucleoplasm	DNA binding			skin(1)	1						AAAAACTACACTTCAGATTCCA	0.168													4	2	---	---	---	---	
PPP2R5E	5529	broad.mit.edu	37	14	63888616	63888616	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63888616delT	uc001xgd.1	-						PPP2R5E_uc010tsf.1_Intron|PPP2R5E_uc010tsg.1_Intron|PPP2R5E_uc001xge.2_Intron|PPP2R5E_uc010tsh.1_Intron|PPP2R5E_uc001xgf.1_Intron	NM_006246	NP_006237	Q16537	2A5E_HUMAN	epsilon isoform of regulatory subunit B56,						signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		TCTAATTTGATTTCTTGGTGA	0.299													21	11	---	---	---	---	
TSHR	7253	broad.mit.edu	37	14	81498646	81498646	+	Intron	DEL	A	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81498646delA	uc001xvd.1	+						TSHR_uc001xvb.1_Intron|TSHR_uc001xvc.2_Intron|TSHR_uc010tvs.1_Intron	NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1						cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	CTGCATCCAGACATGCCTTGA	0.463			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22118395	22118396	+	IGR	DEL	AC	-	-	rs139043886		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22118395_22118396delAC								CXADRP2 (101517 upstream) : LOC727924 (159636 downstream)																							ATAAATTATAACATTCTTTTTG	0.342													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23409130	23409131	+	Intron	INS	-	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23409130_23409131insT	uc010uab.1	-						uc010uac.1_5'Flank|uc002ceb.2_5'Flank	NM_001001413	NP_001001413			golgi autoantigen, golgin subfamily a, 6-like 1																		CCTGGACCCCCCACCTCCCAGC	0.436													7	5	---	---	---	---	
TLE3	7090	broad.mit.edu	37	15	70347816	70347817	+	Intron	INS	-	G	G	rs72531987	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70347816_70347817insG	uc002asm.2	-						TLE3_uc002ask.2_Intron|TLE3_uc002asl.2_Intron|TLE3_uc010ukd.1_Intron|TLE3_uc010bik.1_Intron|TLE3_uc010bil.1_Intron|TLE3_uc002asn.2_Intron|TLE3_uc002asp.2_Intron|TLE3_uc002aso.2_Intron	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a						organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						CGAGGTAGACATGATTAACAGA	0.520													2	5	---	---	---	---	
USP31	57478	broad.mit.edu	37	16	23119533	23119533	+	Intron	DEL	A	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23119533delA	uc002dll.2	-							NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		CACCATGAACAGCTGTGAGTT	0.423													79	40	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46409653	46409656	+	IGR	DEL	TTCA	-	-	rs112162925		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46409653_46409656delTTCA								None (None upstream) : ANKRD26P1 (93593 downstream)																							tccattcgatttcattcaatgatt	0.000													4	2	---	---	---	---	
GAN	8139	broad.mit.edu	37	16	81387847	81387847	+	Intron	DEL	A	-	-	rs139978939		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81387847delA	uc002fgo.2	+							NM_022041	NP_071324	Q9H2C0	GAN_HUMAN	gigaxonin						cell death	cytoplasm|neurofilament	protein binding			ovary(2)	2		Colorectal(91;0.153)				CAACTCTTGGAAAAAAAAAAA	0.259													6	3	---	---	---	---	
WDR81	124997	broad.mit.edu	37	17	1631341	1631343	+	Intron	DEL	GAG	-	-	rs66598941		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1631341_1631343delGAG	uc002fti.2	+						WDR81_uc002fth.2_5'UTR|WDR81_uc010vqp.1_Intron|WDR81_uc002ftj.2_In_Frame_Del_p.E1033del|WDR81_uc010vqq.1_5'Flank	NM_001163811	NP_001157283	Q562E7	WDR81_HUMAN	WD repeat domain 81 isoform 4											skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AGGGGCTGCTGAGGAGGAGGAGA	0.695													4	8	---	---	---	---	
SHBG	6462	broad.mit.edu	37	17	7529525	7529525	+	Intron	DEL	G	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7529525delG	uc010cmt.2	+						SHBG_uc010cmo.2_Intron|SHBG_uc010cmp.2_Intron|SHBG_uc010cmq.2_Intron|SHBG_uc010cmr.2_Intron|SHBG_uc010cms.2_Intron|SHBG_uc010cmu.2_Intron|SHBG_uc010cmz.2_5'Flank|SHBG_uc010cmv.2_5'Flank|SHBG_uc010cmw.2_5'Flank|SHBG_uc010cmx.2_5'Flank|SHBG_uc010cmy.2_5'Flank|SHBG_uc002gid.3_5'Flank	NM_001040	NP_001031	P04278	SHBG_HUMAN	sex hormone-binding globulin isoform 1						hormone transport	extracellular region	androgen binding|protein homodimerization activity	p.?(1)			0		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Dromostanolone(DB00858)|Estradiol(DB00783)|Estrone(DB00655)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Mitotane(DB00648)|Norethindrone(DB00717)|Testosterone(DB00624)	aaaaaaaaaagaaataaaaga	0.184													4	4	---	---	---	---	
ALOX12B	242	broad.mit.edu	37	17	7980190	7980200	+	Intron	DEL	CCCCAGATGCC	-	-	rs72152877		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7980190_7980200delCCCCAGATGCC	uc002gjy.1	-						uc010cnq.1_5'Flank	NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type						epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						CTCTTGTGGTCCCCAGATGCCCCCCAGGCTG	0.616										Multiple Myeloma(8;0.094)			1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25754046	25754047	+	Intron	INS	-	T	T			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25754046_25754047insT	uc002gzg.2	+											Homo sapiens similar to ubiquitin specific protease 6, mRNA (cDNA clone IMAGE:5168266), with apparent retained intron.																		TGACGCTGTTCTTttttttttt	0.277													4	2	---	---	---	---	
PSMD11	5717	broad.mit.edu	37	17	30800601	30800601	+	Intron	DEL	T	-	-	rs112811195		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30800601delT	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			gtgcccagcattttttttttt	0.000													3	4	---	---	---	---	
DNAJC7	7266	broad.mit.edu	37	17	40134058	40134058	+	Intron	DEL	A	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40134058delA	uc002hyo.2	-						DNAJC7_uc010cxu.2_Intron|DNAJC7_uc010cxv.2_Intron|DNAJC7_uc010wgb.1_Intron|DNAJC7_uc010wgc.1_Intron|DNAJC7_uc002hyp.2_Intron	NM_003315	NP_003306	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7						chaperone cofactor-dependent protein refolding	cytoplasm|cytoskeleton|nucleus	heat shock protein binding|unfolded protein binding			ovary(1)	1		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				AACTCAGTGGAAATCAAAGTT	0.413													47	25	---	---	---	---	
RALBP1	10928	broad.mit.edu	37	18	9516929	9516929	+	Frame_Shift_Del	DEL	G	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9516929delG	uc002kob.2	+	3	554	c.331delG	c.(331-333)GTTfs	p.V111fs	RALBP1_uc002koc.2_Frame_Shift_Del_p.V111fs	NM_006788	NP_006779	Q15311	RBP1_HUMAN	ralA binding protein 1	111					chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding			central_nervous_system(1)	1						GGGAATCCATGTTTTCAAGAA	0.279													104	48	---	---	---	---	
ATP5A1	498	broad.mit.edu	37	18	43678329	43678330	+	5'Flank	DEL	CC	-	-	rs60623098		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43678329_43678330delCC	uc002lbr.1	-						ATP5A1_uc010dnl.1_5'Flank|ATP5A1_uc002lbs.1_5'Flank|ATP5A1_uc002lbt.1_Intron|ATP5A1_uc010dnm.1_5'Flank	NM_004046	NP_004037	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1						ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0						CTCGCGTTCACCACCTCTCCCC	0.525													4	2	---	---	---	---	
LMAN1	3998	broad.mit.edu	37	18	57000584	57000584	+	Intron	DEL	A	-	-	rs76213902		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57000584delA	uc002lhz.2	-							NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor						blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TACATCATTTAAAAAAAAAAA	0.234													4	2	---	---	---	---	
STXBP2	6813	broad.mit.edu	37	19	7703700	7703700	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7703700delT	uc002mha.3	+						STXBP2_uc002mhb.3_Intron|STXBP2_uc010dvj.2_Intron|STXBP2_uc010xjr.1_Intron|STXBP2_uc010dvk.2_Intron|STXBP2_uc002mhc.3_Intron|STXBP2_uc010dvl.1_5'Flank	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a						leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						CAGAGGCAGCTCATCATCAGG	0.577													49	27	---	---	---	---	
ZNF559	84527	broad.mit.edu	37	19	9452027	9452028	+	Intron	DEL	CT	-	-	rs140135479		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9452027_9452028delCT	uc002mlg.2	+						ZNF559_uc002mlf.2_Intron|ZNF559_uc010dwl.1_Intron|ZNF559_uc010xkn.1_Intron|ZNF559_uc010dwm.1_Frame_Shift_Del_p.T137fs|ZNF559_uc002mle.3_Intron|ZNF559_uc010dwk.1_Intron|ZNF559_uc002mld.2_Frame_Shift_Del_p.T201fs|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTGACAAACACTCTAAACATCC	0.347													4	3	---	---	---	---	
HIF3A	64344	broad.mit.edu	37	19	46811249	46811264	+	Intron	DEL	AGACAGACAGATAGAT	-	-	rs59977344	by1000genomes	TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46811249_46811264delAGACAGACAGATAGAT	uc002peh.2	+						HIF3A_uc002pef.1_Intron|HIF3A_uc002peg.3_Intron|HIF3A_uc010xxx.1_Intron|HIF3A_uc002pei.3_Intron|HIF3A_uc002pej.1_Intron|HIF3A_uc002pek.2_Intron|HIF3A_uc010xxy.1_Intron|HIF3A_uc002pel.2_Intron|HIF3A_uc010xxz.1_Intron	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		acagacagacagacagacagatagatagatagatag	0.000													3	7	---	---	---	---	
HSPBP1	23640	broad.mit.edu	37	19	55777865	55777867	+	Intron	DEL	TAT	-	-	rs147554734		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55777865_55777867delTAT	uc002qjx.2	-						HSPBP1_uc002qjy.2_Intron|HSPBP1_uc002qkb.2_Intron|HSPBP1_uc002qka.2_Intron|HSPBP1_uc002qkd.2_Intron|HSPBP1_uc002qkc.2_Intron|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		ccaccatcactatcaccatcacc	0.020													4	2	---	---	---	---	
CDK5RAP1	51654	broad.mit.edu	37	20	31960720	31960720	+	Intron	DEL	T	-	-	rs67566730		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31960720delT	uc010gek.2	-						CDK5RAP1_uc002wyy.2_Intron|CDK5RAP1_uc002wyz.2_Intron|CDK5RAP1_uc002wza.2_Intron|CDK5RAP1_uc010gel.2_Intron|CDK5RAP1_uc010gem.2_Intron|CDK5RAP1_uc002wzc.1_Intron|CDK5RAP1_uc002wzb.1_5'UTR	NM_016408	NP_057492	Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1						brain development|negative regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation|tRNA modification	cytoplasm	4 iron, 4 sulfur cluster binding|metal ion binding|neuronal Cdc2-like kinase binding|transferase activity			ovary(2)|skin(2)|lung(1)	5						GGACATAAACttttttttttt	0.159													4	2	---	---	---	---	
CRYZL1	9946	broad.mit.edu	37	21	34969919	34969920	+	Intron	INS	-	CTTTA	CTTTA	rs150222858		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34969919_34969920insCTTTA	uc011adw.1	-						DONSON_uc002ysn.1_Intron|CRYZL1_uc002ysr.1_Intron|CRYZL1_uc002yss.1_Intron|CRYZL1_uc002yst.1_Intron|DONSON_uc002ysm.2_5'Flank|uc002ysp.2_5'Flank|CRYZL1_uc002ysq.2_5'Flank	NM_145858	NP_665857	O95825	QORL1_HUMAN	crystallin, zeta-like 1						quinone cofactor metabolic process	cytosol	NADP binding|NADPH:quinone reductase activity|zinc ion binding				0						gCCGGCACTCTCtttttgtttt	0.040													2	4	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37661723	37661744	+	Intron	DEL	GTGTGTGTGTGTGTGTGTGTGT	-	-	rs71926197		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37661723_37661744delGTGTGTGTGTGTGTGTGTGTGT	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TGTTTCTATGgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgt	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16920274	16920275	+	IGR	DEL	AT	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16920274_16920275delAT								OR11H1 (470470 upstream) : CCT8L2 (151373 downstream)																							TTATAGTGACATGTATGAAAAC	0.267													4	3	---	---	---	---	
ZDHHC8	29801	broad.mit.edu	37	22	20132537	20132537	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20132537delT	uc002zrq.2	+						ZDHHC8_uc002zrr.1_Intron|ZDHHC8_uc010gsa.2_Intron	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8							cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					GTCTGTCCTGTGACAGCACAG	0.647													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151656	20151657	+	IGR	INS	-	ACC	ACC	rs141600104		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151656_20151657insACC								ZDHHC8 (16127 upstream) : LOC150197 (42198 downstream)																							ccaccatcactaccaccaccac	0.000													4	2	---	---	---	---	
HORMAD2	150280	broad.mit.edu	37	22	30533493	30533494	+	Intron	INS	-	AGGG	AGGG			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30533493_30533494insAGGG	uc003agy.2	+							NM_152510	NP_689723	Q8N7B1	HORM2_HUMAN	HORMA domain containing 2						meiosis|mitosis	chromosome|nucleus					0			Epithelial(10;0.125)			ggaaggaaggaagggagggagg	0.015													4	3	---	---	---	---	
RAC2	5880	broad.mit.edu	37	22	37627083	37627083	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37627083delT	uc003arc.2	-							NM_002872	NP_002863	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2						axon guidance|platelet activation|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding			breast(2)|central_nervous_system(1)|skin(1)	4						tatcccatgcttttctgataa	0.000													3	3	---	---	---	---	
FAM120C	54954	broad.mit.edu	37	X	54186195	54186195	+	Intron	DEL	T	-	-			TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54186195delT	uc004dsz.3	-						FAM120C_uc011moh.1_Intron	NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954											ovary(1)|central_nervous_system(1)	2						CATTTTTTACTTTTttttttt	0.144													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	126864216	126864217	+	IGR	INS	-	TT	TT	rs112292917		TCGA-AK-3444-01A-01D-0966-08	TCGA-AK-3444-10A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:126864216_126864217insTT								CXorf64 (908450 upstream) : ACTRT1 (320726 downstream)																							ACACAATTAGAttttttttttg	0.129													6	3	---	---	---	---	
