Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11303271	11303271	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11303271C>A	uc001asd.2	-	9	1433	c.1312G>T	c.(1312-1314)GGG>TGG	p.G438W		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	438					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GAAAGTAGCCCCAGGGCTTGG	0.527													5	128	---	---	---	---	PASS
PRAMEF11	440560	broad.mit.edu	37	1	12885059	12885059	+	Missense_Mutation	SNP	C	G	G	rs143004725	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12885059C>G	uc001auk.2	-	4	1248	c.1052G>C	c.(1051-1053)TGC>TCC	p.C351S		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	351	LRR 6.										0						GGTGGCCATGCAGATGGGATT	0.532													3	162	---	---	---	---	PASS
PI4KB	5298	broad.mit.edu	37	1	151288136	151288136	+	Silent	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151288136G>A	uc001ext.2	-	2	1237	c.822C>T	c.(820-822)CGC>CGT	p.R274R	PI4KB_uc001exr.2_Silent_p.R286R|PI4KB_uc001exs.2_Silent_p.R274R|PI4KB_uc001exu.2_Silent_p.R274R|PI4KB_uc010pcw.1_Intron|PI4KB_uc009wmq.1_Silent_p.R286R	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	catalytic phosphatidylinositol 4-kinase beta	274					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(2)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTGACTTAGAGCGCTGGTGAG	0.547													61	200	---	---	---	---	PASS
ILDR2	387597	broad.mit.edu	37	1	166908755	166908755	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166908755C>T	uc001gdx.1	-	4	608	c.552G>A	c.(550-552)ATG>ATA	p.M184I		NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor	184	Extracellular (Potential).					integral to membrane				ovary(1)	1						GAATACCTGGCATAATCTCCA	0.423													12	51	---	---	---	---	PASS
ZNF670	93474	broad.mit.edu	37	1	247202840	247202840	+	Splice_Site	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247202840C>T	uc001icd.1	-	2	175	c.4_splice	c.e2-1	p.D2_splice	ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990	Q9BS34	ZN670_HUMAN	zinc finger protein 670						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			ACACTGAATCCTAGAATATCG	0.418													16	69	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55522699	55522699	+	Intron	SNP	A	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55522699A>G	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc002ryt.2_Intron|CCDC88A_uc010fbw.2_Intron|CCDC88A_uc002ryu.2_Intron|CCDC88A_uc002rys.2_Intron|CCDC88A_uc002ryw.2_Missense_Mutation_p.I1145T	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						GATGTCAAGTATATGAGAGGA	0.448													14	91	---	---	---	---	PASS
UNC80	285175	broad.mit.edu	37	2	210642080	210642080	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210642080G>A	uc010zjc.1	+	4	477	c.397G>A	c.(397-399)GGG>AGG	p.G133R	UNC80_uc002vdj.1_Missense_Mutation_p.G133R	NM_032504	NP_115893	Q8N2C7	UNC80_HUMAN	chromosome 2 open reading frame 21 isoform 1	133						integral to membrane					0						TGAGCGGTTTGGGGGTACAGA	0.567													3	106	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228881360	228881360	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228881360C>G	uc002vpq.2	-	7	4257	c.4210G>C	c.(4210-4212)GAA>CAA	p.E1404Q	SPHKAP_uc002vpp.2_Missense_Mutation_p.E1404Q|SPHKAP_uc010zlx.1_Missense_Mutation_p.E1404Q	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1404						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GAGGAAGTTTCTTTTTTAGAA	0.448													51	144	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241528858	241528858	+	Silent	SNP	C	T	T	rs142113962	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241528858C>T	uc002vzk.1	+	2	424	c.240C>T	c.(238-240)GCC>GCT	p.A80A	CAPN10_uc010zoh.1_Silent_p.A80A|CAPN10_uc002vzl.1_Silent_p.A80A|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_5'UTR|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Silent_p.A80A	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a	80	Calpain catalytic.				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		GTGCCTGCGCCGCGCTGCAGA	0.627													4	181	---	---	---	---	PASS
IL17RC	84818	broad.mit.edu	37	3	9960258	9960258	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9960258G>T	uc003bua.2	+	5	879	c.643G>T	c.(643-645)GTG>TTG	p.V215L	CIDEC_uc003bto.2_Intron|IL17RC_uc010hcr.2_RNA|IL17RC_uc011ato.1_RNA|IL17RC_uc010hcs.2_Missense_Mutation_p.V119L|IL17RC_uc003btz.2_Missense_Mutation_p.V144L|IL17RC_uc011atp.1_Missense_Mutation_p.V15L|IL17RC_uc003bud.2_5'UTR|IL17RC_uc003bub.2_Missense_Mutation_p.V144L|IL17RC_uc010hct.2_Missense_Mutation_p.V144L|IL17RC_uc010hcu.2_Missense_Mutation_p.V144L|IL17RC_uc010hcv.2_Missense_Mutation_p.V144L|IL17RC_uc011atq.1_Missense_Mutation_p.V144L|IL17RC_uc003buc.2_5'UTR	NM_153461	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C isoform 1 precursor	215	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)|pancreas(1)	2						GGAGGTGCAAGTGCCTGCTGC	0.502													20	81	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48608533	48608533	+	Splice_Site	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48608533C>A	uc003ctz.2	-	93	7165	c.7164_splice	c.e93+1	p.K2388_splice		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor						cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CATTGACTTACCTTCACACCT	0.622													3	79	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65342560	65342560	+	Silent	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65342560G>A	uc003dmn.2	-	23	4408	c.3882C>T	c.(3880-3882)TGC>TGT	p.C1294C	MAGI1_uc003dmm.2_3'UTR	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	1323					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CCTTGGGTCGGCATGCCCCGC	0.672													4	179	---	---	---	---	PASS
TIGIT	201633	broad.mit.edu	37	3	114027084	114027084	+	3'UTR	SNP	A	G	G	rs72509136		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114027084A>G	uc003ebg.1	+	4						NM_173799	NP_776160	Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains						negative regulation of interleukin-12 production|negative regulation of T cell activation|positive regulation of interleukin-10 production	cell surface|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)	1						gtgtgtgtgtatgtgtgtgtg	0.323													6	55	---	---	---	---	PASS
NPHP3	27031	broad.mit.edu	37	3	132416207	132416207	+	Splice_Site	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132416207C>A	uc003epe.1	-	14	2063	c.1986_splice	c.e14-1	p.R662_splice	NPHP3_uc003epd.1_Splice_Site	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						AGGCCACAACCTTTTATGTAA	0.299													79	148	---	---	---	---	PASS
RPL22L1	200916	broad.mit.edu	37	3	170585834	170585834	+	Silent	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170585834G>T	uc003fhc.3	-	3	281	c.192C>A	c.(190-192)ATC>ATA	p.I64I	RPL22L1_uc003fhb.3_RNA	NM_001099645	NP_001093115	Q6P5R6	RL22L_HUMAN	ribosomal protein L22-like 1	64					translation	ribosome	structural constituent of ribosome				0	all_cancers(22;1.96e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.137)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)			AAACAACTGTGATTTTATTCT	0.308													3	31	---	---	---	---	PASS
CLCN2	1181	broad.mit.edu	37	3	184064449	184064449	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184064449C>T	uc003foi.2	-	24	2766	c.2642G>A	c.(2641-2643)CGT>CAT	p.R881H	CLCN2_uc003foh.2_Missense_Mutation_p.R370H|CLCN2_uc010hya.1_Missense_Mutation_p.R864H|CLCN2_uc011brl.1_Missense_Mutation_p.R852H|CLCN2_uc011brm.1_Missense_Mutation_p.R837H	NM_004366	NP_004357	P51788	CLCN2_HUMAN	chloride channel 2	881	Cytoplasmic (By similarity).					chloride channel complex	voltage-gated chloride channel activity				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	GAGGCCATGACGGGAGTGGGG	0.667													46	81	---	---	---	---	PASS
FGFR3	2261	broad.mit.edu	37	4	1804696	1804696	+	Intron	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1804696C>A	uc003gdr.3	+						FGFR3_uc003gdu.2_Nonsense_Mutation_p.S329*|FGFR3_uc003gds.3_Intron|FGFR3_uc003gdq.3_Intron|FGFR3_uc010icb.1_Intron|FGFR3_uc003gdt.1_Intron	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1						bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding			urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	GCCAATGTGTCGGAGCGGGAC	0.667		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				6	12	---	---	---	---	PASS
GBA3	57733	broad.mit.edu	37	4	22820365	22820365	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22820365A>G	uc003gqp.3	+	5	1320	c.1229A>G	c.(1228-1230)AAT>AGT	p.N410S	GBA3_uc010iep.2_Missense_Mutation_p.N103S|GBA3_uc011bxo.1_Missense_Mutation_p.N411S	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a	410					glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						GATAAAGTCAATCTTCAAGTA	0.393													18	25	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47538506	47538506	+	Silent	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47538506C>A	uc003gxk.1	+	8	1232	c.1068C>A	c.(1066-1068)CCC>CCA	p.P356P	ATP10D_uc003gxl.1_5'UTR|ATP10D_uc003gxj.3_Silent_p.P356P	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	356	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TCAATGTTCCCGAGCCTGATG	0.358													6	462	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76817468	76817468	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76817468C>T	uc003hix.2	-	2	368	c.11G>A	c.(10-12)GGC>GAC	p.G4D	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.G4D	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	4					detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GGTGGAGGTGCCGCTTCCCAT	0.483											OREG0016229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	215	---	---	---	---	PASS
AGPAT9	84803	broad.mit.edu	37	4	84516094	84516094	+	Silent	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84516094C>A	uc003how.2	+	8	1053	c.835C>A	c.(835-837)CGA>AGA	p.R279R	AGPAT9_uc003hox.2_Silent_p.R279R|AGPAT9_uc003hoy.2_Silent_p.R279R	NM_032717	NP_116106	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	279					phospholipid biosynthetic process|regulation of TOR signaling cascade|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	glycerol-3-phosphate O-acyltransferase activity			skin(1)	1		Hepatocellular(203;0.114)				AATGAAGGATCGACACCTGGT	0.478													4	224	---	---	---	---	PASS
TRIM36	55521	broad.mit.edu	37	5	114513529	114513529	+	Intron	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114513529C>T	uc003kqs.2	-						TRIM36_uc003kqt.2_Intron|TRIM36_uc003kqu.2_Intron|TRIM36_uc003kqv.2_Missense_Mutation_p.R35Q	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1							acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		AGAAGTCAACCGGGAATGCTC	0.413													28	126	---	---	---	---	PASS
SEPT8	23176	broad.mit.edu	37	5	132094374	132094374	+	Intron	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132094374G>A	uc003kxr.2	-						SEPT8_uc003kxs.1_3'UTR|SEPT8_uc003kxu.2_Intron|SEPT8_uc011cxi.1_3'UTR|SEPT8_uc003kxv.2_Intron|SEPT8_uc003kxt.2_3'UTR	NM_001098811	NP_001092281	Q92599	SEPT8_HUMAN	septin 8 isoform a						cell cycle	septin complex	GTP binding|protein binding			ovary(2)	2		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGAAAGCAAGGCTGTAAACAC	0.557													5	18	---	---	---	---	PASS
PCDHGB3	56102	broad.mit.edu	37	5	140750550	140750550	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140750550A>T	uc003ljw.1	+	1	589	c.589A>T	c.(589-591)AAA>TAA	p.K197*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc011dat.1_Nonsense_Mutation_p.K197*	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	197	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTAGTACTGAAAGCACCCCT	0.562													26	121	---	---	---	---	PASS
MIR145	406937	broad.mit.edu	37	5	148808587	148808587	+	5'Flank	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148808587C>A	hsa-mir-145|MI0000461	+						LOC728264_uc003lqs.2_RNA|LOC728264_uc003lqp.2_RNA																	0						GTTCTGCAGCCATCAGCCTGG	0.552													3	37	---	---	---	---	PASS
CCNJL	79616	broad.mit.edu	37	5	159680467	159680467	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159680467G>C	uc003lyb.1	-	7	1478	c.1226C>G	c.(1225-1227)CCC>CGC	p.P409R	CCNJL_uc011dee.1_Missense_Mutation_p.P361R|CCNJL_uc003lyc.1_RNA	NM_024565	NP_078841	Q8IV13	CCNJL_HUMAN	cyclin J-like	409						nucleus					0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCAGTGCCTGGGCTCAGCTGC	0.602													15	70	---	---	---	---	PASS
DAXX	1616	broad.mit.edu	37	6	33287900	33287900	+	Silent	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33287900C>T	uc003oec.2	-	5	1557	c.1353G>A	c.(1351-1353)GAG>GAA	p.E451E	ZBTB22_uc003oeb.2_5'Flank|ZBTB22_uc010juu.2_5'Flank|DAXX_uc011drd.1_Silent_p.E376E|DAXX_uc011dre.1_Silent_p.E463E|DAXX_uc003oed.2_Silent_p.E451E	NM_001350	NP_001341	Q9UER7	DAXX_HUMAN	death-domain associated protein isoform a	451	Asp/Glu-rich (acidic).|Potential.|Necessary for interaction with USP7.				activation of JUN kinase activity|androgen receptor signaling pathway|apoptosis|induction of apoptosis via death domain receptors|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|regulation of protein ubiquitination|transcription, DNA-dependent	chromosome, centromeric region|cytosol|nucleolus|PML body	androgen receptor binding|heat shock protein binding|p53 binding|protein homodimerization activity|protein N-terminus binding|receptor signaling protein activity|transcription factor binding|ubiquitin protein ligase binding			pancreas(18)|ovary(2)|skin(2)|prostate(1)	23						cttcttcttcctcctcctcct	0.254			Mis|F|N		Pancreatic neuroendocrine tumors								3	58	---	---	---	---	PASS
PNPLA1	285848	broad.mit.edu	37	6	36259314	36259314	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36259314G>T	uc010jwf.2	+	2	423	c.423G>T	c.(421-423)AAG>AAT	p.K141N	PNPLA1_uc003olw.1_Missense_Mutation_p.K46N|PNPLA1_uc010jwe.1_Missense_Mutation_p.K46N	NM_001145717	NP_001139189	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	141	Patatin.				lipid catabolic process		hydrolase activity			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4						TCACGTCCAAGGAGGAGCTCA	0.637													3	23	---	---	---	---	PASS
MAP7	9053	broad.mit.edu	37	6	136682267	136682267	+	Missense_Mutation	SNP	C	T	T	rs35107962		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136682267C>T	uc003qgz.2	-	12	1823	c.1577G>A	c.(1576-1578)CGC>CAC	p.R526H	MAP7_uc011edf.1_Missense_Mutation_p.R511H|MAP7_uc011edg.1_Missense_Mutation_p.R556H|MAP7_uc010kgu.2_Missense_Mutation_p.R548H|MAP7_uc011edh.1_Missense_Mutation_p.R511H|MAP7_uc010kgv.2_Missense_Mutation_p.R548H|MAP7_uc010kgs.2_Missense_Mutation_p.R380H|MAP7_uc011edi.1_Missense_Mutation_p.R380H|MAP7_uc010kgq.1_Missense_Mutation_p.R432H|MAP7_uc003qha.1_Missense_Mutation_p.R489H	NM_003980	NP_003971	Q14244	MAP7_HUMAN	microtubule-associated protein 7	526	Potential.				establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		CTCCTCACGGCGAGTCGTCCT	0.602													12	26	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180451	20180451	+	3'UTR	SNP	C	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180451C>G	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacagacacacacacac	0.159													3	58	---	---	---	---	PASS
SPDYE1	285955	broad.mit.edu	37	7	44040585	44040585	+	5'UTR	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44040585G>C	uc003tjf.2	+	1					POLR2J4_uc003tjc.2_Intron|POLR2J4_uc003tjd.2_Intron|POLR2J4_uc010kxw.2_Intron|POLR2J4_uc003tje.3_Intron	NM_175064	NP_778234	Q8NFV5	SPDE1_HUMAN	Williams Beuren syndrome chromosome region 19											ovary(1)	1						GGAGGATGGAGAGTGGTTTGG	0.547													16	37	---	---	---	---	PASS
IKZF1	10320	broad.mit.edu	37	7	50467716	50467716	+	Silent	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50467716C>T	uc003tow.3	+	9	1119	c.951C>T	c.(949-951)AAC>AAT	p.N317N	IKZF1_uc003tox.3_Silent_p.N275N|IKZF1_uc003toy.3_Silent_p.N275N|IKZF1_uc011kck.1_Silent_p.N230N|IKZF1_uc003toz.3_Silent_p.N287N|IKZF1_uc010kyx.2_Silent_p.N57N|IKZF1_uc003tpa.3_Silent_p.N59N	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	317					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				CCATCAACAACGCCATCAACT	0.642			D		ALL								3	10	---	---	---	---	PASS
FKBP6	8468	broad.mit.edu	37	7	72745747	72745747	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72745747C>T	uc003tya.2	+	5	688	c.556C>T	c.(556-558)CGT>TGT	p.R186C	FKBP6_uc003twz.2_Missense_Mutation_p.R156C|FKBP6_uc011kew.1_Missense_Mutation_p.R181C|FKBP6_uc010lbe.1_RNA	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	186	TPR 1.				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				CCGCCAGAATCGTTTCTATGA	0.423													42	145	---	---	---	---	PASS
ZSCAN21	7589	broad.mit.edu	37	7	99662005	99662005	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99662005G>A	uc003uso.2	+	4	1331	c.1187G>A	c.(1186-1188)AGC>AAC	p.S396N	ZSCAN21_uc003usn.1_Missense_Mutation_p.A361T|ZNF3_uc003usp.2_3'UTR	NM_145914	NP_666019	Q9Y5A6	ZSC21_HUMAN	zinc finger protein 38	396	C2H2-type 5.				positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TGTGGGAAGAGCTTCAGTCAG	0.532													30	104	---	---	---	---	PASS
PODXL	5420	broad.mit.edu	37	7	131194328	131194328	+	Silent	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131194328C>T	uc003vqw.3	-	4	1077	c.819G>A	c.(817-819)TCG>TCA	p.S273S	PODXL_uc003vqx.3_Silent_p.S241S	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	273	Thr-rich.|Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					GAGTTCTTTGCGAGATAACCG	0.517													39	182	---	---	---	---	PASS
PRKAG2	51422	broad.mit.edu	37	7	151262817	151262817	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151262817A>C	uc003wkk.2	-	12	1999	c.1388T>G	c.(1387-1389)GTG>GGG	p.V463G	PRKAG2_uc003wki.2_Missense_Mutation_p.V222G|PRKAG2_uc011kvl.1_Missense_Mutation_p.V338G|PRKAG2_uc003wkj.2_Missense_Mutation_p.V419G|PRKAG2_uc003wkl.2_Intron	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit	463	CBS 3.				ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		TGACTCATCCACAACAGGCAG	0.443													30	159	---	---	---	---	PASS
SPAG11A	653423	broad.mit.edu	37	8	7721244	7721244	+	3'UTR	SNP	C	T	T	rs77003603	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7721244C>T	uc003wsa.2	+	3					SPAG11A_uc003wrz.2_3'UTR|SPAG11A_uc003wsb.2_RNA	NM_058202	NP_478109	Q6PDA7	SG11A_HUMAN	sperm associated antigen 11B isoform H							extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		GACTGGCTCCCCAGGGATCCA	0.577													3	11	---	---	---	---	PASS
FGF20	26281	broad.mit.edu	37	8	16850730	16850730	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16850730G>A	uc003wxc.1	-	3	620	c.487C>T	c.(487-489)CGC>TGC	p.R163C	FGF20_uc010lsv.1_RNA|FGF20_uc010lsw.1_3'UTR	NM_019851	NP_062825	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	163					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	extracellular region|soluble fraction	growth factor activity			lung(1)	1				Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		AAATACCTGCGGCCAGTGTCT	0.428													5	318	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62212433	62212433	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62212433G>T	uc003xuh.2	+	2	371	c.47G>T	c.(46-48)TGG>TTG	p.W16L	CLVS1_uc003xug.2_Missense_Mutation_p.W16L|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Missense_Mutation_p.W16L	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	16					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						TTAAACACTTGGAACGGAGAT	0.453													24	96	---	---	---	---	PASS
SPAG1	6674	broad.mit.edu	37	8	101243470	101243470	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101243470G>T	uc003yjh.1	+	15	2028	c.1942G>T	c.(1942-1944)GAA>TAA	p.E648*	SPAG1_uc003yji.1_Nonsense_Mutation_p.E648*	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1	648	TPR 7.				single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		TAAATACAGCGAATGCTTAAA	0.264													4	274	---	---	---	---	PASS
OMD	4958	broad.mit.edu	37	9	95177538	95177538	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95177538C>A	uc004asd.3	-	3	1531	c.1162G>T	c.(1162-1164)GAT>TAT	p.D388Y	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron	NM_005014	NP_005005	Q99983	OMD_HUMAN	osteomodulin precursor	388	Asp/Glu-rich (acidic).				cell adhesion	proteinaceous extracellular matrix				ovary(2)	2						TCACTTTCATCATCATCATCT	0.383			T	USP6	aneurysmal bone cysts								51	109	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107558370	107558370	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107558370G>C	uc004bcl.2	-	39	5659	c.5346C>G	c.(5344-5346)AGC>AGG	p.S1782R		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1782	Helical; (Potential).				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGGTGGCCACGCTGCCATTAA	0.498													20	77	---	---	---	---	PASS
SPTAN1	6709	broad.mit.edu	37	9	131345086	131345086	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131345086G>C	uc004bvl.3	+	14	1877	c.1764G>C	c.(1762-1764)TGG>TGC	p.W588C	SPTAN1_uc011mbg.1_Missense_Mutation_p.W588C|SPTAN1_uc011mbh.1_Missense_Mutation_p.W600C|SPTAN1_uc004bvm.3_Missense_Mutation_p.W588C|SPTAN1_uc004bvn.3_Missense_Mutation_p.W588C	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	588	Spectrin 7.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						TCAAGAGTTGGGTCAATGAGA	0.473													78	123	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139909971	139909971	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139909971C>A	uc011mem.1	-	23	3737	c.3589G>T	c.(3589-3591)GGG>TGG	p.G1197W	ABCA2_uc011mel.1_Missense_Mutation_p.G1198W|ABCA2_uc004ckl.1_Missense_Mutation_p.G1128W|ABCA2_uc004ckm.1_Missense_Mutation_p.G1228W|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	1197	ABC transporter 1.				cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TTGAGCTTCCCATGGGAGATG	0.667													10	48	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15573119	15573119	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15573119A>G	uc001ioc.1	-	28	2912	c.2912T>C	c.(2911-2913)CTG>CCG	p.L971P	ITGA8_uc010qcb.1_Missense_Mutation_p.L956P	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	971	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						AAAGGACACCAGGGATGCAAG	0.328													4	255	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	27551917	27551917	+	RNA	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27551917C>T	uc001itt.1	+	2		c.173C>T								Homo sapiens cDNA FLJ43247 fis, clone HEART2000611.																		TGAGCACTGGCGGATCCCATG	0.478													3	26	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33538452	33538452	+	Intron	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33538452G>C	uc001iwx.3	-						NRP1_uc001iwv.3_Intron|NRP1_uc009xlz.2_Intron|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Intron|NRP1_uc001iwz.2_Intron|NRP1_uc001ixa.2_Intron|NRP1_uc001ixb.1_Intron|NRP1_uc001ixc.1_Intron	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a						axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	TCGCACCACTGATACACGGAG	0.358													4	32	---	---	---	---	PASS
CSGALNACT2	55454	broad.mit.edu	37	10	43659363	43659363	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43659363A>G	uc001jan.2	+	5	1365	c.1030A>G	c.(1030-1032)AAT>GAT	p.N344D		NM_018590	NP_061060	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate	344	Lumenal (Potential).				chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process	Golgi cisterna membrane|integral to Golgi membrane	glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding			ovary(1)	1						TGAAGAATTTAATCGTGGACG	0.403													6	136	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55944912	55944912	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55944912C>A	uc001jju.1	-	12	1817	c.1422G>T	c.(1420-1422)CAG>CAT	p.Q474H	PCDH15_uc010qhq.1_Missense_Mutation_p.Q479H|PCDH15_uc010qhr.1_Missense_Mutation_p.Q474H|PCDH15_uc010qhs.1_Missense_Mutation_p.Q486H|PCDH15_uc010qht.1_Missense_Mutation_p.Q481H|PCDH15_uc010qhu.1_Missense_Mutation_p.Q474H|PCDH15_uc001jjv.1_Missense_Mutation_p.Q452H|PCDH15_uc010qhv.1_Missense_Mutation_p.Q474H|PCDH15_uc010qhw.1_Missense_Mutation_p.Q437H|PCDH15_uc010qhx.1_Missense_Mutation_p.Q474H|PCDH15_uc010qhy.1_Missense_Mutation_p.Q479H|PCDH15_uc010qhz.1_Missense_Mutation_p.Q474H|PCDH15_uc010qia.1_Missense_Mutation_p.Q452H|PCDH15_uc010qib.1_Missense_Mutation_p.Q452H|PCDH15_uc001jjw.2_Missense_Mutation_p.Q474H	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	474	Cadherin 4.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TGTAAGTTTGCTGTTCTTCCC	0.348										HNSCC(58;0.16)			12	131	---	---	---	---	PASS
HECTD2	143279	broad.mit.edu	37	10	93258806	93258806	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93258806G>A	uc001khl.2	+	18	1949	c.1849G>A	c.(1849-1851)GTA>ATA	p.V617I	LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_Missense_Mutation_p.V621I|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_Missense_Mutation_p.V206I|HECTD2_uc001khn.1_Missense_Mutation_p.V267I	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	617	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1						TTCAGAATATGTACAGCTTTA	0.284													23	165	---	---	---	---	PASS
IPO7	10527	broad.mit.edu	37	11	9446754	9446754	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9446754G>A	uc001mho.2	+	12	1422	c.1280G>A	c.(1279-1281)CGA>CAA	p.R427Q		NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7	427					interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		GCTGACCCTCGAAAAAAAGAT	0.368													42	153	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14793556	14793556	+	Intron	SNP	A	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14793556A>C	uc001mln.2	+						PDE3B_uc001mlm.2_Missense_Mutation_p.D351A|PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						AATATCTGTGATGAATATCTA	0.284													18	80	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47746360	47746360	+	Intron	SNP	A	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47746360A>G	uc009ylv.2	-						FNBP4_uc001ngi.2_5'UTR|FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						TCAGGGAAAAAGCAAGAAAAA	0.363													12	28	---	---	---	---	PASS
LRP5	4041	broad.mit.edu	37	11	68125161	68125161	+	Silent	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68125161C>A	uc001ont.2	+	3	607	c.532C>A	c.(532-534)CGG>AGG	p.R178R	LRP5_uc009ysg.2_5'UTR	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	178	Beta-propeller 1.|LDL-receptor class B 3.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						CCGGATTGAGCGGGCAGGGAT	0.547													4	27	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	89486328	89486328	+	IGR	SNP	A	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89486328A>G								TRIM77 (35290 upstream) : TRIM49 (44496 downstream)																							CCTGGCTCTTAAAATGATCCT	0.483													18	50	---	---	---	---	PASS
ZC3H12C	85463	broad.mit.edu	37	11	110030250	110030250	+	Intron	SNP	T	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110030250T>C	uc009yxw.2	+						ZC3H12C_uc010rwc.1_Intron|ZC3H12C_uc010rwd.1_Intron|ZC3H12C_uc001pkr.3_Intron|ZC3H12C_uc001pkq.2_3'UTR	NM_033390	NP_203748	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C								endonuclease activity|nucleic acid binding|zinc ion binding				0		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		ATGATACTGCTTCTGTAAAAA	0.373													2	6	---	---	---	---	PASS
GPR162	27239	broad.mit.edu	37	12	6936017	6936017	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6936017A>T	uc001qqw.1	+	5	1950	c.1415A>T	c.(1414-1416)GAA>GTA	p.E472V	LEPREL2_uc001qqz.1_5'Flank|LEPREL2_uc001qra.1_5'Flank|LEPREL2_uc001qrb.1_5'Flank|GPR162_uc001qqx.1_Missense_Mutation_p.E188V|GPR162_uc009zfd.1_Missense_Mutation_p.E168V|GPR162_uc001qqy.1_Intron	NM_019858	NP_062832	Q16538	GP162_HUMAN	G protein-coupled receptor 162 isoform 2	472	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GAAGAGGCTGAAGGTGGGGGG	0.662													45	73	---	---	---	---	PASS
PRKAG1	5571	broad.mit.edu	37	12	49398573	49398573	+	Intron	SNP	T	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49398573T>A	uc001rsy.2	-						uc001rsw.2_Intron|PRKAG1_uc010smd.1_Intron|PRKAG1_uc001rsx.2_Intron|PRKAG1_uc001rsz.2_Intron|PRKAG1_uc009zlb.2_Intron|PRKAG1_uc010sme.1_3'UTR	NM_002733	NP_002724	P54619	AAKG1_HUMAN	AMP-activated protein kinase, noncatalytic						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|positive regulation of protein kinase activity|regulation of fatty acid oxidation|regulation of glycolysis|spermatogenesis	cytosol	cAMP-dependent protein kinase activity|cAMP-dependent protein kinase regulator activity|protein kinase binding			kidney(1)	1						agagagagagtgagaatgaga	0.264													4	38	---	---	---	---	PASS
PRR13	54458	broad.mit.edu	37	12	53839910	53839910	+	3'UTR	SNP	T	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53839910T>C	uc001scz.3	+	4					PRR13_uc001scy.3_3'UTR|PCBP2_uc010soh.1_Intron|PRR13_uc001sda.3_3'UTR	NM_018457	NP_060927	Q9NZ81	PRR13_HUMAN	proline rich 13 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						TCAGATGCCATGTTGTACTGG	0.562													4	85	---	---	---	---	PASS
PRR13	54458	broad.mit.edu	37	12	53839919	53839919	+	3'UTR	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53839919G>T	uc001scz.3	+	4					PRR13_uc001scy.3_3'UTR|PCBP2_uc010soh.1_Intron|PRR13_uc001sda.3_3'UTR	NM_018457	NP_060927	Q9NZ81	PRR13_HUMAN	proline rich 13 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						ATGTTGTACTGGGGGAATGTA	0.562													5	71	---	---	---	---	PASS
LUM	4060	broad.mit.edu	37	12	91502697	91502697	+	Nonsense_Mutation	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91502697G>C	uc001tbm.2	-	2	449	c.60C>G	c.(58-60)TAC>TAG	p.Y20*	LUM_uc001tbn.2_Intron	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	20					collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						CATAATCATAGTACTGGCCAC	0.403													21	85	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101504334	101504334	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101504334G>C	uc010svm.1	+	23	2874	c.2302G>C	c.(2302-2304)GGA>CGA	p.G768R	ANO4_uc001thw.2_Missense_Mutation_p.G733R|ANO4_uc001thx.2_Missense_Mutation_p.G768R|ANO4_uc001thy.2_Missense_Mutation_p.G288R	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	768	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CAAAGACATAGGTAAGTTGGA	0.318										HNSCC(74;0.22)			27	119	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106820975	106820975	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106820975C>T	uc001tlp.2	+	13	1324	c.1102C>T	c.(1102-1104)CTT>TTT	p.L368F	POLR3B_uc001tlq.2_Missense_Mutation_p.L310F	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	368					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						TTTTTTTTAGCTTTTATCTCT	0.274													5	21	---	---	---	---	PASS
TRAFD1	10906	broad.mit.edu	37	12	112572664	112572664	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112572664C>A	uc001ttp.2	+	3	256	c.170C>A	c.(169-171)GCA>GAA	p.A57E	TRAFD1_uc001tto.2_Missense_Mutation_p.A57E|TRAFD1_uc009zwb.2_Missense_Mutation_p.A57E|TRAFD1_uc010syj.1_RNA	NM_006700	NP_006691	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	57	TRAF-type.				negative regulation of innate immune response	intracellular	protein binding|zinc ion binding				0						CACATGGCTGCAGAACACTGT	0.408													4	262	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77817235	77817235	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77817235C>G	uc001vkf.2	-	18	2565	c.2474G>C	c.(2473-2475)CGG>CCG	p.R825P	MYCBP2_uc010aev.2_Missense_Mutation_p.R229P	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	825					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TACACGTTGCCGTTTTTCTTC	0.413													38	180	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23890215	23890215	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23890215A>T	uc001wjx.2	-	26	3394	c.3288T>A	c.(3286-3288)GAT>GAA	p.D1096E	MIR208B_hsa-mir-208b|MI0005570_5'Flank	NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1096	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GGGCCTGTTCATCCTCAATCC	0.577													16	65	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58831552	58831552	+	Silent	SNP	A	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58831552A>C	uc001xdp.2	+	20	2999	c.2745A>C	c.(2743-2745)ATA>ATC	p.I915I	ARID4A_uc001xdo.2_Silent_p.I915I|ARID4A_uc001xdq.2_Silent_p.I915I|ARID4A_uc010apg.1_Silent_p.I593I	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	915					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						CATCATTGATAGCAGAGTCAA	0.363													40	99	---	---	---	---	PASS
CSPG4	1464	broad.mit.edu	37	15	75977757	75977757	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75977757G>C	uc002baw.2	-	4	4168	c.4075C>G	c.(4075-4077)CCA>GCA	p.P1359A		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	1359	Interaction with COL5A1 (By similarity).|Extracellular (Potential).|Gly/Ser-rich (glycosaminoglycan attachment domain).				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						GCCTCTAGTGGGATGGCAGCG	0.672													6	28	---	---	---	---	PASS
JMJD8	339123	broad.mit.edu	37	16	731897	731897	+	3'UTR	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:731897C>A	uc002ciw.1	-	9					STUB1_uc002cit.2_Intron|STUB1_uc002ciu.2_Intron|STUB1_uc010bqz.2_Intron|STUB1_uc002civ.2_Intron|JMJD8_uc002cix.1_3'UTR|JMJD8_uc002ciy.1_3'UTR	NM_001005920	NP_001005920	Q96S16	JMJD8_HUMAN	jumonji domain containing 8											breast(1)	1						GTGCCCCCCACCCACATGTGG	0.657													14	53	---	---	---	---	PASS
ATF7IP2	80063	broad.mit.edu	37	16	10525162	10525162	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10525162G>T	uc002czu.2	+	3	912	c.685G>T	c.(685-687)GTT>TTT	p.V229F	ATF7IP2_uc002czv.2_Missense_Mutation_p.V229F|ATF7IP2_uc010uyo.1_RNA|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Missense_Mutation_p.V229F|ATF7IP2_uc010uyq.1_RNA	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting	229					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						TTTTGTGCCTGTTGAGAAAAC	0.353													41	127	---	---	---	---	PASS
DDX28	55794	broad.mit.edu	37	16	68055772	68055772	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68055772T>C	uc002evh.1	-	1	2188	c.1334A>G	c.(1333-1335)AAG>AGG	p.K445R	DUS2L_uc002evi.2_5'Flank|DUS2L_uc002evj.2_5'Flank|DUS2L_uc010vkk.1_5'Flank	NM_018380	NP_060850	Q9NUL7	DDX28_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 28	445	Helicase C-terminal.					mitochondrial nucleoid|nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0116)|Epithelial(162;0.0474)|all cancers(182;0.233)		TCGGGAGCTCTTCTGGAAGGA	0.522													9	71	---	---	---	---	PASS
MAP1LC3B	81631	broad.mit.edu	37	16	87436808	87436808	+	3'UTR	SNP	G	C	C	rs7865	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87436808G>C	uc002fjx.2	+	4					MAP1LC3B_uc010chs.2_RNA	NM_022818	NP_073729	Q9GZQ8	MLP3B_HUMAN	microtubule-associated proteins 1A/1B light						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule	protein binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0249)		CACAGATCATGAAACAGTAGT	0.388													4	40	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7701105	7701105	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7701105G>A	uc002giu.1	+	52	8202	c.8188G>A	c.(8188-8190)GTG>ATG	p.V2730M		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2730	AAA 4 (By similarity).|TPR 2.				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ACCCTCTGTCGTGCCCATGCA	0.522													45	203	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10309525	10309525	+	Intron	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10309525C>T	uc002gmm.2	-						uc002gml.1_RNA	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,						muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						AAATCATCTCCATACTGCAGG	0.368									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				21	96	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	18344842	18344842	+	RNA	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18344842C>T	uc010vya.1	+	4		c.934C>T								Homo sapiens cDNA FLJ56791 complete cds, highly similar to Keratin, type I cytoskeletal 16.																		TGAGCTGCATCCTGAATGAGA	0.607													5	15	---	---	---	---	PASS
KRT23	25984	broad.mit.edu	37	17	39081564	39081564	+	Intron	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39081564G>C	uc002hvm.1	-						KRT23_uc010wfl.1_Intron|KRT23_uc010cxf.1_Intron|KRT23_uc010cxg.2_3'UTR	NM_015515	NP_056330	Q9C075	K1C23_HUMAN	keratin 23							intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)|Ovarian(249;0.15)				ACAGGAGCTGGAGGTCCCTCG	0.522													38	105	---	---	---	---	PASS
DHX40P1	653645	broad.mit.edu	37	17	58066651	58066651	+	Silent	SNP	C	T	T	rs144367363	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58066651C>T	uc002iyf.2	-	9	721	c.486G>A	c.(484-486)CAG>CAA	p.Q162Q	uc002iye.1_Intron	NR_002924				Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 40 pseudogene, mRNA (cDNA clone IMAGE:5170263).												0						ACTGGTAAAGCTGTTTAAGAG	0.333													3	35	---	---	---	---	PASS
ABCA5	23461	broad.mit.edu	37	17	67243579	67243579	+	3'UTR	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67243579G>T	uc002jif.2	-	38					ABCA10_uc010dfa.1_5'Flank|ABCA5_uc002jib.2_3'UTR|ABCA5_uc002jic.2_3'UTR|ABCA5_uc002jid.2_3'UTR|ABCA5_uc002jie.2_RNA|ABCA5_uc002jig.2_3'UTR	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5						cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					GTGCGTTCTTGGTTCTCCAGT	0.308													3	38	---	---	---	---	PASS
SOX9	6662	broad.mit.edu	37	17	70119701	70119701	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70119701C>G	uc002jiw.2	+	3	1075	c.703C>G	c.(703-705)CCG>GCG	p.P235A	uc002jiv.2_5'Flank	NM_000346	NP_000337	P48436	SOX9_HUMAN	transcription factor SOX9	235					cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription				0		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CCAGGGCCCACCGACCCCACC	0.632													71	189	---	---	---	---	PASS
USH1G	124590	broad.mit.edu	37	17	72919137	72919137	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72919137T>G	uc002jme.1	-	1	215	c.32A>C	c.(31-33)GAT>GCT	p.D11A	USH1G_uc010wro.1_5'UTR|OTOP2_uc002jmf.1_5'Flank|OTOP2_uc010wrp.1_5'Flank	NM_173477	NP_775748	Q495M9	USH1G_HUMAN	Usher syndrome 1G protein	11					equilibrioception|photoreceptor cell maintenance|sensory perception of sound	actin cytoskeleton				skin(2)	2	all_lung(278;0.172)|Lung NSC(278;0.207)					CAGGTAGCCATCCCGGGCTGC	0.687													2	6	---	---	---	---	PASS
ST6GALNAC1	55808	broad.mit.edu	37	17	74621351	74621351	+	3'UTR	SNP	G	C	C			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74621351G>C	uc002jsh.2	-	9					ST6GALNAC1_uc002jsi.2_3'UTR|ST6GALNAC1_uc002jsj.2_RNA	NM_018414	NP_060884	Q9NSC7	SIA7A_HUMAN	sialyltransferase 7A						protein glycosylation	integral to Golgi membrane	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity				0						AGAGTCTCAAGATTCCCACTG	0.557													5	7	---	---	---	---	PASS
MFSD11	79157	broad.mit.edu	37	17	74734379	74734379	+	5'UTR	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74734379C>T	uc002jta.2	+	2					SFRS2_uc002jsv.2_5'Flank|SFRS2_uc002jsw.1_5'Flank|SFRS2_uc002jsx.1_5'Flank|SFRS2_uc002jsy.3_5'Flank|SFRS2_uc010wtg.1_5'Flank|MFSD11_uc002jsz.1_RNA|MIR636_hsa-mir-636|MI0003651_5'Flank|MFSD11_uc002jtb.2_5'UTR|MFSD11_uc010dha.2_5'UTR|MFSD11_uc002jtc.2_5'UTR|MFSD11_uc002jtd.3_5'UTR|MFSD11_uc010dhb.2_5'UTR|MFSD11_uc002jte.2_5'UTR	NM_024311	NP_077287	O43934	MFS11_HUMAN	major facilitator superfamily domain containing							integral to membrane				ovary(1)	1						TCAGTGGCTTCGCCCCGAGGA	0.532													5	22	---	---	---	---	PASS
SLC39A6	25800	broad.mit.edu	37	18	33689577	33689577	+	Silent	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33689577G>A	uc010dmy.2	-	10	2537	c.2247C>T	c.(2245-2247)ATC>ATT	p.I749I		NM_012319	NP_036451	Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter),	749	Extracellular (Potential).					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity			ovary(1)|pancreas(1)	2						TACGAAACACGATTTTATGTT	0.348													40	154	---	---	---	---	PASS
TPRX1	284355	broad.mit.edu	37	19	48306137	48306137	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48306137G>A	uc002php.1	-	2	202	c.131C>T	c.(130-132)GCG>GTG	p.A44V		NM_198479	NP_940881	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox	44						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		GACTAGGGGCGCAGCGCGGGC	0.711													4	8	---	---	---	---	PASS
NLRP11	204801	broad.mit.edu	37	19	56297054	56297054	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56297054G>T	uc010ygf.1	-	12	3750	c.3039C>A	c.(3037-3039)TTC>TTA	p.F1013L	NLRP11_uc002qlz.2_Missense_Mutation_p.F860L|NLRP11_uc002qmb.2_Missense_Mutation_p.F914L|NLRP11_uc002qmc.2_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	1013							ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TGGGAAATTTGAAAAACATGT	0.368													5	166	---	---	---	---	PASS
CSE1L	1434	broad.mit.edu	37	20	47682942	47682942	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47682942C>A	uc002xty.2	+	5	505	c.371C>A	c.(370-372)CCA>CAA	p.P124Q	CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Missense_Mutation_p.P124Q	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein	124					apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			GAAGATTTTCCACAGAAATGG	0.393													40	152	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38151617	38151617	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38151617G>T	uc003atr.2	+	15	5909	c.5638G>T	c.(5638-5640)GAG>TAG	p.E1880*	TRIOBP_uc003atu.2_Nonsense_Mutation_p.E1708*|TRIOBP_uc003atv.2_Nonsense_Mutation_p.E167*|TRIOBP_uc003atw.2_Nonsense_Mutation_p.E167*|TRIOBP_uc003atx.1_5'Flank|TRIOBP_uc010gxh.2_5'Flank	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	1880	PH.				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GAACTGGATCGAGGCTCTGAG	0.582													8	39	---	---	---	---	PASS
CHST7	56548	broad.mit.edu	37	X	46433704	46433704	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46433704G>A	uc004dgt.2	+	1	513	c.338G>A	c.(337-339)GGC>GAC	p.G113D		NM_019886	NP_063939	Q9NS84	CHST7_HUMAN	chondroitin 6-sulfotransferase 7	113	PAPS (By similarity).|Lumenal (Potential).				chondroitin sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity|N-acetylglucosamine 6-O-sulfotransferase activity			breast(3)	3						TGGCGCACCGGCTCGTCCTTC	0.612													3	11	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73051012	73051012	+	RNA	SNP	C	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73051012C>A	uc004ebm.1	-	4		c.11671G>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						TGAGCTTTTCCCCTGGAGGAT	0.473													6	9	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	155254706	155254706	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155254706C>T	uc004fnx.3	+	8	1056	c.602C>T	c.(601-603)ACG>ATG	p.T201M		NM_182905	NP_878908			WAS protein family homolog 1																		GTGAGAGCCACGAGCCAAGGT	0.637													4	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	5761921	5761932	+	IGR	DEL	AAGAAGGGAGGG	-	-	rs770716	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5761921_5761932delAAGAAGGGAGGG								AJAP1 (918071 upstream) : NPHP4 (160938 downstream)																							gaaggaaggaaagaagggagggaggaaggaag	0.000													5	4	---	---	---	---	
MECR	51102	broad.mit.edu	37	1	29542385	29542388	+	Intron	DEL	AAAT	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29542385_29542388delAAAT	uc001brq.1	-						MECR_uc001brp.1_Intron|MECR_uc001brr.1_Intron|MECR_uc001brs.1_Intron|MECR_uc001brt.1_Intron|MECR_uc010ofz.1_Intron	NM_016011	NP_057095	Q9BV79	MECR_HUMAN	trans-2-enoyl-CoA reductase, mitochondrial						fatty acid biosynthetic process	mitochondrion	trans-2-enoyl-CoA reductase (NADPH) activity|zinc ion binding			ovary(1)	1		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		ctccgtctcaaaataaataaataa	0.196													4	2	---	---	---	---	
CCDC18	343099	broad.mit.edu	37	1	93692082	93692083	+	Intron	DEL	AT	-	-	rs71875718		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93692082_93692083delAT	uc001dpq.2	+						CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41											ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GTAGGACAAAatatatatatat	0.124													9	4	---	---	---	---	
MAGI3	260425	broad.mit.edu	37	1	113992210	113992210	+	Intron	DEL	T	-	-	rs34091729		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113992210delT	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCAAGTGCATTTTTTTTTCC	0.353													2	5	---	---	---	---	
ERO1LB	56605	broad.mit.edu	37	1	236385071	236385072	+	Intron	INS	-	TTAATA	TTAATA	rs10647377		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236385071_236385072insTTAATA	uc001hxt.2	-							NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			ACACATATACTTTAATTTTTTC	0.282													3	5	---	---	---	---	
GPN1	11321	broad.mit.edu	37	2	27852150	27852151	+	Intron	INS	-	G	G	rs146892484	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27852150_27852151insG	uc010ymc.1	+						ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_5'Flank|CCDC121_uc002rld.2_5'Flank|CCDC121_uc002rle.2_5'Flank|GPN1_uc010ezf.2_Intron|GPN1_uc010yma.1_Intron|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_Intron|GPN1_uc010yme.1_Intron|GPN1_uc010ezg.1_5'UTR	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a							cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						GCATGGCTTTCGGGGGCTTCCC	0.589													7	8	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39073998	39073998	+	Intron	DEL	T	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39073998delT	uc002rrf.2	-						DHX57_uc002rrd.3_Intron|DHX57_uc002rre.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				TCACTGAATCttttttttttt	0.124													4	2	---	---	---	---	
SMEK2	57223	broad.mit.edu	37	2	55842425	55842428	+	Intron	DEL	TTTT	-	-	rs72177058		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55842425_55842428delTTTT	uc002rzc.2	-						SMEK2_uc002rzb.2_Intron|SMEK2_uc002rzd.2_Intron	NM_001122964	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 isoform 1							microtubule organizing center|nucleus	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GTACAAAAACTTTTTTTCAGTCTG	0.319													8	5	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	116593691	116593694	+	Intron	DEL	GTGA	-	-	rs145523243	byFrequency	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116593691_116593694delGTGA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						gtgtgtgtgtgtgAGatatatata	0.245													4	2	---	---	---	---	
C3orf63	23272	broad.mit.edu	37	3	56675209	56675215	+	Intron	DEL	TTGTAAC	-	-	rs3215018		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56675209_56675215delTTGTAAC	uc003did.3	-						C3orf63_uc003dic.3_Intron|C3orf63_uc003die.3_Intron	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b											ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		ATTTATCTCTTTGTAACAAGGAATAAC	0.324													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75703977	75703978	+	IGR	INS	-	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75703977_75703978insT								MIR1324 (23968 upstream) : ZNF717 (54816 downstream)																							TCTTTTCTGAATTTTTTATTTT	0.322													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154616641	154616641	+	IGR	DEL	T	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154616641delT								GPR149 (469137 upstream) : MME (125272 downstream)																							TGTTCACATCTTTTTTCTGTT	0.368													4	2	---	---	---	---	
SMC4	10051	broad.mit.edu	37	3	160131533	160131534	+	Intron	INS	-	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160131533_160131534insA	uc003fdh.2	+						IFT80_uc003fda.2_Intron|SMC4_uc003fdf.1_Intron|SMC4_uc003fdg.1_Intron|SMC4_uc010hwc.1_Intron|SMC4_uc003fdi.2_Intron|SMC4_uc003fdj.2_Intron|SMC4_uc010hwd.2_Intron|SMC4_uc003fdl.2_5'Flank	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CCCCCTTAGTGAAAAAAAAAAA	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	20620790	20620790	+	IGR	DEL	A	-	-	rs75247881		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20620790delA								SLIT2 (2 upstream) : PACRGL (77115 downstream)																							CTGCATTTGGAAAAAAAAAAA	0.303													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	32780006	32780006	+	IGR	DEL	T	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32780006delT								None (None upstream) : None (None downstream)																							tttctttttcttttttttttt	0.005													3	3	---	---	---	---	
TARS	6897	broad.mit.edu	37	5	33454858	33454859	+	Intron	INS	-	TT	TT	rs142855087	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33454858_33454859insTT	uc003jhy.2	+						TARS_uc011cob.1_Intron|TARS_uc010iup.1_Intron|TARS_uc011coc.1_Intron|TARS_uc003jhz.2_Intron|TARS_uc011cod.1_Intron	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase						threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)	TAAAAATACACTAGTAATTGGA	0.272													4	6	---	---	---	---	
RBM27	54439	broad.mit.edu	37	5	145649306	145649306	+	Intron	DEL	T	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145649306delT	uc003lnz.3	+							NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27						mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTATAGTACCTTTTTTTTTtt	0.025													4	2	---	---	---	---	
LCP2	3937	broad.mit.edu	37	5	169680306	169680307	+	Intron	INS	-	A	A	rs141527769	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169680306_169680307insA	uc003man.1	-						LCP2_uc011des.1_Intron|LCP2_uc011det.1_Intron	NM_005565	NP_005556	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2						immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		CCCACTCCCCCAAAAAAATACC	0.396													6	5	---	---	---	---	
MAPK14	1432	broad.mit.edu	37	6	36060378	36060379	+	Intron	DEL	AT	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36060378_36060379delAT	uc003olp.2	+						MAPK14_uc011dth.1_Intron|MAPK14_uc003olo.2_Intron|MAPK14_uc003olq.2_Intron|MAPK14_uc003olr.2_Intron|MAPK14_uc011dti.1_Intron	NM_001315	NP_001306	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14 isoform 1						activation of MAPK activity|cellular component movement|cellular response to ionizing radiation|chemotaxis|innate immune response|mRNA metabolic process|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of muscle cell differentiation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|signal transduction in response to DNA damage|stress-activated MAPK cascade|stress-induced premature senescence|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|MAP kinase kinase activity|protein binding			ovary(2)|stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	6						CTCTGAAATAATATAGTGTTTC	0.391													5	4	---	---	---	---	
GPR115	221393	broad.mit.edu	37	6	47686398	47686398	+	Intron	DEL	T	-	-	rs11476874		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47686398delT	uc003oza.1	+						GPR115_uc003ozb.1_Intron	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						TCAGCTTACATGACCAAACCC	0.363													4	2	---	---	---	---	
BCKDHB	594	broad.mit.edu	37	6	81053717	81053719	+	Intron	DEL	TTG	-	-	rs142572622		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81053717_81053719delTTG	uc003pjd.2	+						BCKDHB_uc003pje.2_3'UTR	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		ATTTACAtttttgttgttgttgt	0.118													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	142158145	142158148	+	Intron	DEL	ACAC	-	-	rs66829555		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142158145_142158148delACAC	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																		ACCTGTCAAGacacacacacacac	0.235													4	2	---	---	---	---	
CCNE2	9134	broad.mit.edu	37	8	95897956	95897957	+	Intron	DEL	TT	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95897956_95897957delTT	uc003yhc.2	-						CCNE2_uc003yhd.2_Intron	NM_057749	NP_477097	O96020	CCNE2_HUMAN	cyclin E2						cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)					Attttctttctttttttttttt	0.054													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110509659	110509659	+	Intron	DEL	C	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110509659delC	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAAAACCGttctttttttttt	0.224										HNSCC(38;0.096)			5	4	---	---	---	---	
SLC35D2	11046	broad.mit.edu	37	9	99130722	99130723	+	Intron	INS	-	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99130722_99130723insT	uc004awc.2	-						SLC35D2_uc010msd.2_Intron|SLC35D2_uc010mse.2_Intron|SLC35D2_uc010msf.2_Intron|SLC35D2_uc004awd.2_Intron|SLC35D2_uc004awe.2_Intron	NM_007001	NP_008932	Q76EJ3	S35D2_HUMAN	solute carrier family 35, member D2							Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity				0		Acute lymphoblastic leukemia(62;0.0167)				tcatttaattcttttttttttt	0.089													6	3	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	17875520	17875520	+	Intron	DEL	A	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17875520delA	uc001ipk.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						actctgtctcaaaaaaaaaaa	0.085													5	3	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51623014	51623015	+	Intron	INS	-	A	A			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51623014_51623015insA	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|uc010qhh.1_5'Flank|uc001jiu.2_Intron|uc010qhg.1_Intron|uc009xop.2_5'Flank	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		TGCCAGCAAGGAAAAAAAAAAC	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	60673007	60673007	+	IGR	DEL	A	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60673007delA								BICC1 (84162 upstream) : PHYHIPL (263341 downstream)																							ggaggcaaagaaAAGGCACAA	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													4	3	---	---	---	---	
BRSK2	9024	broad.mit.edu	37	11	1464904	1464904	+	Intron	DEL	G	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1464904delG	uc001lti.2	+						BRSK2_uc009ycv.1_Intron|BRSK2_uc001lth.1_Intron|BRSK2_uc001ltj.2_Intron|BRSK2_uc001ltk.2_Intron|BRSK2_uc001ltl.2_Intron|BRSK2_uc001ltm.2_Intron|BRSK2_uc001ltn.2_Intron|BRSK2_uc010qwx.1_Intron	NM_003957	NP_003948	Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2						establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		AGAGCGTggcgggggggcgcg	0.617													6	5	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118243701	118243701	+	Intron	DEL	A	-	-	rs34104337		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118243701delA	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		ccccagctctaaaaaaaaaaa	0.139													10	6	---	---	---	---	
C1RL	51279	broad.mit.edu	37	12	7249880	7249881	+	Intron	DEL	TT	-	-	rs71743195		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7249880_7249881delTT	uc001qsn.2	-						C1RL_uc009zft.2_Intron	NM_016546	NP_057630	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like						complement activation, classical pathway|innate immune response|proteolysis		serine-type endopeptidase activity			pancreas(1)	1						GATCAGGACGtttttttttttt	0.267													7	8	---	---	---	---	
LASS5	91012	broad.mit.edu	37	12	50535722	50535723	+	Intron	INS	-	A	A	rs35739493		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50535722_50535723insA	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron|LASS5_uc010smq.1_Intron	NM_147190	NP_671723	Q8N5B7	CERS5_HUMAN	LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0						gactccgtctcaaaaaaaaaaa	0.124													8	4	---	---	---	---	
HOXC12	3228	broad.mit.edu	37	12	54348579	54348579	+	5'Flank	DEL	A	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54348579delA	uc010soq.1	+							NM_173860	NP_776272	P31275	HXC12_HUMAN	homeobox C12						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						GGGGGGGGGGATCGGTTGTCC	0.602													4	2	---	---	---	---	
DPY19L2	283417	broad.mit.edu	37	12	63991415	63991416	+	Intron	INS	-	T	T	rs138201669	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63991415_63991416insT	uc001srp.1	-						DPY19L2_uc009zqk.1_Intron	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		tagaggctatctttttttttta	0.050													4	2	---	---	---	---	
ULK1	8408	broad.mit.edu	37	12	132403325	132403326	+	Intron	INS	-	GT	GT	rs67230512		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132403325_132403326insGT	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		tggggtgtcgggtgtggggtgt	0.134													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	77402068	77402071	+	IGR	DEL	GGAA	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77402068_77402071delGGAA								LMO7 (968064 upstream) : KCTD12 (52233 downstream)																							gggggaggggggaaggaaggaagg	0.152													10	8	---	---	---	---	
SEL1L	6400	broad.mit.edu	37	14	81993783	81993784	+	Intron	DEL	AC	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81993783_81993784delAC	uc010tvv.1	-						SEL1L_uc001xvo.3_Intron	NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor						Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		CTTCAAACTTacacacacacac	0.252													4	2	---	---	---	---	
ARHGAP17	55114	broad.mit.edu	37	16	24990136	24990137	+	Intron	INS	-	A	A	rs77415652	by1000genomes	TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24990136_24990137insA	uc002dnb.2	-						ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dng.1_Intron	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		cAACAAAACTGTTTTCTTTCCT	0.158													5	5	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72163921	72163921	+	Intron	DEL	T	-	-	rs67023960		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72163921delT	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron|PMFBP1_uc010cgo.1_5'Flank	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				aatgtttgtattttttttttt	0.000													4	2	---	---	---	---	
HELZ	9931	broad.mit.edu	37	17	65119433	65119433	+	Intron	DEL	A	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65119433delA	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AGCATATTACaaaaaaaaaaa	0.239													3	3	---	---	---	---	
USP36	57602	broad.mit.edu	37	17	76795960	76795975	+	Intron	DEL	TTTTTTTTTTTTTTTT	-	-	rs72137979		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76795960_76795975delTTTTTTTTTTTTTTTT	uc002jvz.1	-						USP36_uc002jwa.1_Intron|USP36_uc002jvy.1_Intron	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36						ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GATGCTTGCCtttttttttttttttttttttttttt	0.185													14	7	---	---	---	---	
GRIN3B	116444	broad.mit.edu	37	19	1009551	1009577	+	In_Frame_Del	DEL	GCCCCCGCGGAGGCCCCACCACACTCT	-	-	rs58448123		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1009551_1009577delGCCCCCGCGGAGGCCCCACCACACTCT	uc002lqo.1	+	9	3082_3108	c.3082_3108delGCCCCCGCGGAGGCCCCACCACACTCT	c.(3082-3108)GCCCCCGCGGAGGCCCCACCACACTCTdel	p.APAEAPPHS1028del	uc002lqp.1_5'UTR	NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	1028_1036	Cytoplasmic (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	GGCCAGAGCGGCCCCCGCGGAGGCCCCACCACACTCTGGCCGACCGG	0.692													4	4	---	---	---	---	
CDKN2D	1032	broad.mit.edu	37	19	10679068	10679070	+	Intron	DEL	AGA	-	-	rs33926515		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10679068_10679070delAGA	uc002mpa.2	-						KRI1_uc002mox.1_5'Flank|KRI1_uc002moy.1_5'Flank|CDKN2D_uc002mpb.2_Intron	NM_001800	NP_001791	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D						anti-apoptosis|autophagic cell death|cell cycle arrest|DNA synthesis involved in DNA repair|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|negative regulation of caspase activity|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|response to retinoic acid|response to UV|response to vitamin D	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding				0			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GAAAGCCTAGAGAAGAAGGACCG	0.616									Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55209855	55209855	+	IGR	DEL	G	-	-	rs11332118		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55209855delG								LILRB4 (30011 upstream) : LILRP2 (9746 downstream)																							GACAGGGGATGGGGGGGAGGG	0.657													2	5	---	---	---	---	
DDX27	55661	broad.mit.edu	37	20	47840108	47840109	+	Intron	DEL	TC	-	-	rs75755283		TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47840108_47840109delTC	uc002xuh.2	+							NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CTCCTTTCTTTCTTTTTTTTTT	0.228													4	2	---	---	---	---	
PRIC285	85441	broad.mit.edu	37	20	62190831	62190832	+	Intron	INS	-	T	T			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62190831_62190832insT	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			tcaggtgggaggagtcagggtc	0.139													3	7	---	---	---	---	
WRB	7485	broad.mit.edu	37	21	40768631	40768631	+	Intron	DEL	G	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40768631delG	uc002yxs.2	+						WRB_uc002yxt.3_Intron|WRB_uc010goj.2_Intron	NM_004627	NP_004618	O00258	WRB_HUMAN	tryptophan rich basic protein isoform 1							integral to membrane|nucleolus					0		Prostate(19;1.2e-06)				aaaaaaaaaagaaaGTGACAA	0.184													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48305869	48305869	+	IGR	DEL	T	-	-			TCGA-B0-5109-01A-02D-1421-08	TCGA-B0-5109-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48305869delT								SSX4 (53084 upstream) : SLC38A5 (11059 downstream)																							ATAATACCCATTTTTTTTCTG	0.353													4	2	---	---	---	---	
