Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
HSPG2	3339	broad.mit.edu	37	1	22176570	22176570	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22176570C>T	uc001bfj.2	-	57	7450	c.7410G>A	c.(7408-7410)TGG>TGA	p.W2470*	HSPG2_uc009vqd.2_Nonsense_Mutation_p.W2471*	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	2470	Ig-like C2-type 10.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CGCGCTTGTGCCACGTGACCT	0.647													5	245	---	---	---	---	PASS
AK2	204	broad.mit.edu	37	1	33476353	33476353	+	3'UTR	SNP	C	T	T	rs66599471		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33476353C>T	uc001bwo.1	-	7					uc001bwn.2_Intron|AK2_uc010ohq.1_3'UTR|AK2_uc009vud.1_3'UTR	NM_013411	NP_037543	P54819	KAD2_HUMAN	adenylate kinase 2 isoform b						nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CACCCTTCCCCTCTGCCCAGC	0.552													3	30	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39823255	39823255	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39823255A>G	uc010oiu.1	+	9	7084	c.6953A>G	c.(6952-6954)GAG>GGG	p.E2318G	MACF1_uc010ois.1_Missense_Mutation_p.E1816G|MACF1_uc001cda.1_Missense_Mutation_p.E1724G|MACF1_uc001cdc.1_Missense_Mutation_p.E903G|MACF1_uc001cdb.1_Missense_Mutation_p.E903G	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3883	Spectrin 1.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTTCAGGATGAGTTGCAGAAA	0.498													13	34	---	---	---	---	PASS
PRPF38A	84950	broad.mit.edu	37	1	52870503	52870503	+	Silent	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52870503C>A	uc001ctv.3	+	1	285	c.82C>A	c.(82-84)CGA>AGA	p.R28R	ORC1L_uc001ctt.2_5'Flank|ORC1L_uc010oni.1_5'Flank|ORC1L_uc001ctu.2_5'Flank|ORC1L_uc009vzd.2_5'Flank|PRPF38A_uc001ctw.3_5'UTR	NM_032864	NP_116253	Q8NAV1	PR38A_HUMAN	PRP38 pre-mRNA processing factor 38 (yeast)	28					mRNA processing|RNA splicing	spliceosomal complex					0						CATTCGAACGCGAATCTATGA	0.512											OREG0013487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	128	---	---	---	---	PASS
ANKRD13C	81573	broad.mit.edu	37	1	70781173	70781173	+	Silent	SNP	G	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70781173G>C	uc001dex.3	-	4	980	c.654C>G	c.(652-654)GCC>GCG	p.A218A	ANKRD13C_uc009wbk.2_Silent_p.A183A	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	218					protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						CCTCTTTCAGGGCTTTTAATA	0.294													22	131	---	---	---	---	PASS
TSEN15	116461	broad.mit.edu	37	1	184023905	184023905	+	Silent	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184023905C>A	uc001gqt.3	+	3	340	c.261C>A	c.(259-261)CTC>CTA	p.L87L	TSEN15_uc009wyg.2_RNA|TSEN15_uc001gqu.3_Silent_p.L87L	NM_052965	NP_443197	Q8WW01	SEN15_HUMAN	tRNA splicing endonuclease 15 isoform 1	87					mRNA processing|tRNA processing	nucleolus	protein binding				0						TACCAGAACTCCAGCTCATCT	0.433													19	32	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201010703	201010703	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201010703C>G	uc001gvv.2	-	41	5290	c.5063G>C	c.(5062-5064)AGG>ACG	p.R1688T		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1688	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TGGGAACTCCCTTTCATAGTG	0.562													7	35	---	---	---	---	PASS
KIAA1383	54627	broad.mit.edu	37	1	232942950	232942950	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232942950G>C	uc001hvh.2	+	1	2313	c.2181G>C	c.(2179-2181)GAG>GAC	p.E727D		NM_019090	NP_061963	Q9P2G4	K1383_HUMAN	hypothetical protein LOC54627	585										ovary(1)	1		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)				TTTTTGATGAGCCCAGCACAA	0.338													28	19	---	---	---	---	PASS
CLIP4	79745	broad.mit.edu	37	2	29383260	29383260	+	Silent	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29383260C>T	uc002rmv.2	+	12	1700	c.1461C>T	c.(1459-1461)CTC>CTT	p.L487L	CLIP4_uc002rmu.2_Silent_p.L487L|CLIP4_uc010ezm.1_Silent_p.L487L|CLIP4_uc002rmw.2_RNA	NM_024692	NP_078968	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family,	487										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					AACTCCGCCTCGGAGAGAGAG	0.488													23	64	---	---	---	---	PASS
TACR1	6869	broad.mit.edu	37	2	75278449	75278449	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75278449G>T	uc002sng.2	-	4	1446	c.861C>A	c.(859-861)TAC>TAA	p.Y287*	TACR1_uc002snh.2_Nonsense_Mutation_p.Y287*	NM_001058	NP_001049	P25103	NK1R_HUMAN	tachykinin receptor 1 isoform long	287	Helical; Name=7; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|detection of abiotic stimulus|mechanosensory behavior	integral to plasma membrane	protein binding			ovary(1)	1					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	TGATGGCCAGGTAGACCTGCT	0.537													39	77	---	---	---	---	PASS
TACR1	6869	broad.mit.edu	37	2	75278450	75278450	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75278450T>A	uc002sng.2	-	4	1445	c.860A>T	c.(859-861)TAC>TTC	p.Y287F	TACR1_uc002snh.2_Missense_Mutation_p.Y287F	NM_001058	NP_001049	P25103	NK1R_HUMAN	tachykinin receptor 1 isoform long	287	Helical; Name=7; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|detection of abiotic stimulus|mechanosensory behavior	integral to plasma membrane	protein binding			ovary(1)	1					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	GATGGCCAGGTAGACCTGCTG	0.542													41	74	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86718069	86718069	+	Silent	SNP	T	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86718069T>C	uc002sri.3	+	24	3966	c.3639T>C	c.(3637-3639)TAT>TAC	p.Y1213Y	KDM3A_uc010ytj.1_Silent_p.Y1213Y|KDM3A_uc010ytk.1_Silent_p.Y1161Y	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A	1213	JmjC.				androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						AAAGCTGGTATTTAGACCGAT	0.413													4	130	---	---	---	---	PASS
FAHD2B	151313	broad.mit.edu	37	2	97749417	97749417	+	3'UTR	SNP	C	T	T	rs140620633		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97749417C>T	uc002sxm.2	-	8						NM_199336	NP_955368	Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing								hydrolase activity|metal ion binding				0						CCCACACCTGCCACTGGGCCT	0.587													9	24	---	---	---	---	PASS
UBXN4	23190	broad.mit.edu	37	2	136513229	136513229	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136513229C>A	uc002tur.2	+	5	787	c.476C>A	c.(475-477)CCC>CAC	p.P159H	UBXN4_uc002tus.2_5'UTR	NM_014607	NP_055422	Q92575	UBXN4_HUMAN	UBX domain containing 2	159	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|nuclear envelope	protein binding			skin(2)	2						GAGATACCACCCACTTCTGAT	0.368													4	131	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179587658	179587658	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179587658G>C	uc010zfg.1	-	73	18460	c.18236C>G	c.(18235-18237)CCT>CGT	p.P6079R	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P2740R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	7006							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACAAAATAAGGCGGTTCTAA	0.403													8	38	---	---	---	---	PASS
PXK	54899	broad.mit.edu	37	3	58368374	58368374	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58368374G>T	uc003djz.1	+	4	434	c.335G>T	c.(334-336)TGT>TTT	p.C112F	PXK_uc003djx.1_Missense_Mutation_p.C112F|PXK_uc003djy.1_Missense_Mutation_p.C95F|PXK_uc003dka.1_Missense_Mutation_p.C112F|PXK_uc003dkb.1_Missense_Mutation_p.C29F|PXK_uc003dkc.1_Missense_Mutation_p.C95F|PXK_uc011bfe.1_Missense_Mutation_p.C79F|PXK_uc010hnj.1_Missense_Mutation_p.C79F|PXK_uc003dkd.1_Intron|PXK_uc010hnk.1_5'UTR	NM_017771	NP_060241	Q7Z7A4	PXK_HUMAN	PX domain containing serine/threonine kinase	112	Protein kinase.|PX.				cell communication|inflammatory response|negative regulation of ATPase activity|negative regulation of ion transport|regulation of synaptic transmission	centrosome|cytoplasm|nucleus|plasma membrane	actin binding|ATP binding|phosphatidylinositol binding|phosphatidylinositol binding|protein C-terminus binding|protein kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		TTGTCTAATTGTGAGCTGGTT	0.378													4	113	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125828895	125828895	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125828895C>T	uc003eim.1	-	20	2429	c.2239G>A	c.(2239-2241)GGG>AGG	p.G747R	ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Missense_Mutation_p.G646R|ALDH1L1_uc003ein.1_Missense_Mutation_p.G282R	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	747	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	TTCTGCGGCCCGTGGTCGGTG	0.607													58	29	---	---	---	---	PASS
NEK11	79858	broad.mit.edu	37	3	130992364	130992364	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130992364G>A	uc003eny.2	+	17	1990	c.1664G>A	c.(1663-1665)GGA>GAA	p.G555E	NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Missense_Mutation_p.G373E|NEK11_uc010htn.2_RNA|NEK11_uc011blk.1_Missense_Mutation_p.G371E|NEK11_uc011bll.1_Missense_Mutation_p.G450E	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1	555					cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						ATGTCCCCAGGACCACCAATT	0.493													16	66	---	---	---	---	PASS
SDHAP2	727956	broad.mit.edu	37	3	195395394	195395394	+	5'UTR	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195395394C>A	uc003fuw.2	+	6					SDHAP2_uc003fuu.3_Silent_p.R102R|SDHAP2_uc011btb.1_5'UTR|SDHAP2_uc011btc.1_RNA|SDHAP2_uc003fuv.2_RNA					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						CCATAGGCTACGGGCGCACCT	0.622													3	29	---	---	---	---	PASS
REST	5978	broad.mit.edu	37	4	57798103	57798103	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57798103A>G	uc003hch.2	+	4	3426	c.3079A>G	c.(3079-3081)AGT>GGT	p.S1027G	REST_uc003hci.2_Missense_Mutation_p.S1027G|REST_uc010ihf.2_Missense_Mutation_p.S701G	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	1027	Interaction with RCOR1.				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					GTCAGAGGGTAGTGATGATTC	0.468													12	23	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95583632	95583632	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95583632G>A	uc003hti.2	+	12	1796	c.1645G>A	c.(1645-1647)GAC>AAC	p.D549N	PDLIM5_uc011cdx.1_Missense_Mutation_p.D446N|PDLIM5_uc003hth.2_Missense_Mutation_p.D440N|PDLIM5_uc003htj.2_Missense_Mutation_p.D224N|PDLIM5_uc003htk.2_Missense_Mutation_p.D578N|PDLIM5_uc011cdy.1_Missense_Mutation_p.D427N|PDLIM5_uc003htl.2_Missense_Mutation_p.D224N	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	549	LIM zinc-binding 3.				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		AGAAGCTGGTGACATGTTCCT	0.413													30	102	---	---	---	---	PASS
MATR3	9782	broad.mit.edu	37	5	138643267	138643267	+	Silent	SNP	T	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138643267T>C	uc003ldu.2	+	5	590	c.163T>C	c.(163-165)TTA>CTA	p.L55L	MATR3_uc003lds.2_Silent_p.L55L|MATR3_uc010jfb.2_Silent_p.L55L|MATR3_uc003ldt.2_Intron|MATR3_uc003ldw.2_Silent_p.L55L|MATR3_uc003ldx.2_Silent_p.L55L|MATR3_uc010jfc.2_Silent_p.L55L|MATR3_uc003ldy.2_Intron|MATR3_uc011czb.1_Intron|MATR3_uc003ldz.2_Silent_p.L55L|MATR3_uc003lea.2_Silent_p.L55L	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3	55						nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCTTGCTAGTTTAATGAATCT	0.438													69	113	---	---	---	---	PASS
ZNF354A	6940	broad.mit.edu	37	5	178139045	178139045	+	3'UTR	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178139045C>A	uc003mjj.2	-	5						NM_005649	NP_005640	O60765	Z354A_HUMAN	zinc finger protein 354A						regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		GGCTTTCACACATACAAATCT	0.333													26	104	---	---	---	---	PASS
MUC21	394263	broad.mit.edu	37	6	30951660	30951660	+	5'UTR	SNP	T	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30951660T>G	uc003nsh.2	+	1					MUC21_uc003nsi.1_RNA	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor							integral to membrane|plasma membrane				ovary(1)|skin(1)	2						TTCTCAAGAATCCTCTGTTCT	0.478													17	22	---	---	---	---	PASS
RGL2	5863	broad.mit.edu	37	6	33263616	33263616	+	Intron	SNP	G	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33263616G>T	uc003odv.2	-						RGL2_uc003odu.2_5'UTR|RGL2_uc010jur.2_Intron|RGL2_uc003odw.2_Intron|RGL2_uc011drb.1_Intron	NM_004761	NP_004752	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation						Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity			skin(3)|lung(1)|breast(1)|pancreas(1)	6						AGGATCTCAGGTGGCCAAGGA	0.493													5	32	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51612988	51612988	+	Silent	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51612988G>A	uc003pah.1	-	58	9702	c.9426C>T	c.(9424-9426)ACC>ACT	p.T3142T	PKHD1_uc010jzn.1_Silent_p.T1125T|PKHD1_uc003pai.2_Silent_p.T3142T	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3142	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CAGAGATTCTGGTACAGTTGT	0.433													6	355	---	---	---	---	PASS
HDAC2	3066	broad.mit.edu	37	6	114279865	114279865	+	Silent	SNP	T	C	C	rs149797556	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114279865T>C	uc003pwd.1	-	3	513	c.513A>G	c.(511-513)CTA>CTG	p.L171L	HDAC2_uc003pwc.1_Silent_p.L47L|HDAC2_uc003pwe.1_Silent_p.L47L	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2	77	Histone deacetylase.				blood coagulation|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of proteolysis|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|transcription factor binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Vorinostat(DB02546)	TTATTGACCGTAGAAATTTGA	0.348													10	246	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128318044	128318044	+	Splice_Site	SNP	A	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128318044A>G	uc003qbk.2	-	17	3131	c.2764_splice	c.e17+1	p.Y922_splice	PTPRK_uc003qbj.2_Splice_Site_p.Y923_splice|PTPRK_uc010kfc.2_Splice_Site_p.Y923_splice|PTPRK_uc011ebu.1_Splice_Site_p.Y939_splice	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		ATGGGAACTTACATGCTATAA	0.328													5	27	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128318045	128318045	+	Splice_Site	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128318045C>T	uc003qbk.2	-	17	3131	c.2764_splice	c.e17+1	p.Y922_splice	PTPRK_uc003qbj.2_Splice_Site_p.Y923_splice|PTPRK_uc010kfc.2_Splice_Site_p.Y923_splice|PTPRK_uc011ebu.1_Splice_Site_p.Y939_splice	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TGGGAACTTACATGCTATAAT	0.328													5	28	---	---	---	---	PASS
ALDH8A1	64577	broad.mit.edu	37	6	135253987	135253987	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135253987G>C	uc003qew.2	-	5	829	c.776C>G	c.(775-777)CCT>CGT	p.P259R	ALDH8A1_uc003qex.2_Missense_Mutation_p.P259R|ALDH8A1_uc010kgh.2_Missense_Mutation_p.P91R|ALDH8A1_uc011ecx.1_Missense_Mutation_p.P209R	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8A1 isoform 1	259					retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		GATGATGGCAGGATTCTTGCC	0.612													25	74	---	---	---	---	PASS
KIAA0415	9907	broad.mit.edu	37	7	4824670	4824670	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4824670A>C	uc003sne.2	+	7	1005	c.922A>C	c.(922-924)AGT>CGT	p.S308R	KIAA0415_uc010ksp.2_RNA	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	308					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		CATTGAGCAAAGTAACCGACG	0.682													14	22	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55269438	55269438	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55269438G>A	uc003tqk.2	+	26	3371	c.3125G>A	c.(3124-3126)AGC>AAC	p.S1042N	EGFR_uc010kzg.1_Missense_Mutation_p.S997N|EGFR_uc011kco.1_Missense_Mutation_p.S989N	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	1042	Cytoplasmic (Potential).|Ser-rich.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGTGCAACCAGCAACAATTCC	0.448		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			60	124	---	---	---	---	PASS
DTX2	113878	broad.mit.edu	37	7	76131597	76131597	+	Intron	SNP	A	G	G	rs150657215	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76131597A>G	uc003uff.3	+						DTX2_uc011kgk.1_Intron|DTX2_uc003ufg.3_Intron|DTX2_uc003ufh.3_Intron|DTX2_uc003ufj.3_Intron|DTX2_uc003ufk.3_Intron|DTX2_uc003ufl.1_Intron|DTX2_uc003ufm.3_Intron|DTX2_uc003ufn.3_5'UTR	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a						Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						AGCATGACCCATGTTTGGTCT	0.537													4	53	---	---	---	---	PASS
PPP1R9A	55607	broad.mit.edu	37	7	94881092	94881092	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94881092A>T	uc003unp.2	+	10	2631	c.2349A>T	c.(2347-2349)AAA>AAT	p.K783N	PPP1R9A_uc010lfj.2_Missense_Mutation_p.K805N|PPP1R9A_uc011kif.1_Missense_Mutation_p.K783N|PPP1R9A_uc003unq.2_Missense_Mutation_p.K783N|PPP1R9A_uc011kig.1_Missense_Mutation_p.K783N	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	783	Interacts with TGN38 (By similarity).|Potential.					cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			ATTTCATCAAAAGACAGGAAG	0.343										HNSCC(28;0.073)			20	53	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106508218	106508218	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508218A>T	uc003vdv.3	+	2	297	c.212A>T	c.(211-213)AAG>ATG	p.K71M	PIK3CG_uc003vdu.2_Missense_Mutation_p.K71M|PIK3CG_uc003vdw.2_Missense_Mutation_p.K71M	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	71					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						GAGCAGATGAAGGCCCAGGTG	0.652													13	21	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120773891	120773891	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120773891A>C	uc003vjq.3	+	13	2039	c.1592A>C	c.(1591-1593)GAA>GCA	p.E531A	C7orf58_uc003vjr.1_Missense_Mutation_p.E531A|C7orf58_uc003vjs.3_Missense_Mutation_p.E531A|C7orf58_uc003vjt.3_Missense_Mutation_p.E311A|C7orf58_uc010lkk.1_Missense_Mutation_p.E311A	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	531						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					TCTTTCACAGAAGATAAGAAC	0.303													72	120	---	---	---	---	PASS
CPA1	1357	broad.mit.edu	37	7	130021569	130021569	+	Silent	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130021569C>T	uc003vpx.2	+	3	318	c.246C>T	c.(244-246)CAC>CAT	p.H82H	CPA1_uc011kpf.1_Translation_Start_Site|CPA1_uc003vpw.2_Intron	NM_001868	NP_001859	P15085	CBPA1_HUMAN	carboxypeptidase A1 precursor	82					proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					TGGAGTCCCACGGCATCAGCT	0.652											OREG0018314	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	77	---	---	---	---	PASS
SOX7	83595	broad.mit.edu	37	8	10692282	10692282	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10692282C>A	uc011kwz.1	-	2	56	c.23G>T	c.(22-24)CGG>CTG	p.R8L	PINX1_uc003wth.2_Missense_Mutation_p.R8L|PINX1_uc003wti.2_Missense_Mutation_p.R8L	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN	SRY-box 7	Error:Variant_position_missing_in_Q9BT81_after_alignment					endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)		CTGCTTCCGCCGACCTGTAAA	0.443													3	54	---	---	---	---	PASS
GTF2E2	2961	broad.mit.edu	37	8	30492585	30492585	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30492585C>G	uc003xig.2	-	3	475	c.222G>C	c.(220-222)AAG>AAC	p.K74N		NM_002095	NP_002086	P29084	T2EB_HUMAN	general transcription factor IIE, polypeptide 2,	74	TFIIE beta.				regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	transcription factor TFIIE complex	DNA binding|protein binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.113)|Kidney(114;0.135)		GAACACCAAACTTATATCCAG	0.333													27	48	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	15001679	15001679	+	Intron	SNP	A	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15001679A>C	uc003zln.1	-						LOC389705_uc010mid.1_RNA					Homo sapiens cDNA FLJ46077 fis, clone TESTI2003768, weakly  similar to Chloride channel protein 3.																		AATGAAGCAAAGAAAAATTGT	0.289													39	128	---	---	---	---	PASS
FKBP15	23307	broad.mit.edu	37	9	115932898	115932898	+	Silent	SNP	G	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115932898G>T	uc004bgs.2	-	25	2788	c.2670C>A	c.(2668-2670)ATC>ATA	p.I890I	FKBP15_uc004bgr.2_Silent_p.I327I|FKBP15_uc011lxc.1_Silent_p.I471I|FKBP15_uc011lxd.1_Silent_p.I822I	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	890					endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						CCTGGTTCATGATCTTCTTGA	0.428													40	105	---	---	---	---	PASS
TTLL11	158135	broad.mit.edu	37	9	124751511	124751511	+	Missense_Mutation	SNP	T	C	C	rs150846608		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124751511T>C	uc004blt.1	-	4	1690	c.1502A>G	c.(1501-1503)GAC>GGC	p.D501G	TTLL11_uc011lyl.1_Missense_Mutation_p.D501G|TTLL11_uc004blr.2_RNA|TTLL11_uc011lym.1_Missense_Mutation_p.D178G|TTLL11_uc004blu.1_3'UTR	NM_194252	NP_919228	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	501	TTL.				protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0						CGTGGGGATGTCTGACTGGTA	0.577													3	117	---	---	---	---	PASS
C9orf78	51759	broad.mit.edu	37	9	132594216	132594216	+	Silent	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132594216C>A	uc004byp.2	-	5	375	c.303G>T	c.(301-303)TCG>TCT	p.S101S	C9orf78_uc004byo.2_Silent_p.S26S|C9orf78_uc004byq.1_Silent_p.S47S	NM_016520	NP_057604	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78	101											0		Ovarian(14;0.00556)				CTGCAGAAAACGATGTCCCCA	0.512													4	84	---	---	---	---	PASS
PDE6C	5146	broad.mit.edu	37	10	95415548	95415548	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95415548G>A	uc001kiu.3	+	16	2105	c.1967G>A	c.(1966-1968)CGG>CAG	p.R656Q		NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C	656					visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)				CTAAATAAGCGGCAGTTTGAA	0.343													61	283	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3797144	3797144	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3797144C>G	uc001lyh.2	-	5	754	c.463G>C	c.(463-465)GCT>CCT	p.A155P	NUP98_uc001lyi.2_Missense_Mutation_p.A155P|NUP98_uc001lyj.1_Missense_Mutation_p.A155P|NUP98_uc001lyk.1_Missense_Mutation_p.A155P|NUP98_uc010qxv.1_Missense_Mutation_p.A118P	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	155	Gly/Thr-rich.				carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		GTAGGAGCAGCTGTAAAACTA	0.408			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								37	126	---	---	---	---	PASS
OR51I2	390064	broad.mit.edu	37	11	5475160	5475160	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5475160G>A	uc010qzf.1	+	1	442	c.442G>A	c.(442-444)GCA>ACA	p.A148T	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004754	NP_001004754	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGTTTAGGTGCAGCTGCTCG	0.498													40	146	---	---	---	---	PASS
C11orf16	56673	broad.mit.edu	37	11	8948498	8948498	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8948498T>A	uc001mhb.3	-	4	672	c.548A>T	c.(547-549)GAT>GTT	p.D183V	C11orf16_uc001mhc.3_Missense_Mutation_p.D183V	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN	hypothetical protein LOC56673	183										upper_aerodigestive_tract(1)|pancreas(1)	2				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		TCTCTGGGGATCTCTCATCTC	0.572													21	37	---	---	---	---	PASS
PRG2	5553	broad.mit.edu	37	11	57156096	57156096	+	Missense_Mutation	SNP	G	A	A	rs147596433	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57156096G>A	uc001njz.2	-	3	479	c.452C>T	c.(451-453)GCG>GTG	p.A151V	PRG2_uc001njw.1_RNA|PRG2_uc001njx.1_RNA|PRG2_uc001njy.1_RNA|PRG2_uc001nka.2_Missense_Mutation_p.A151V|PRG2_uc001nkb.2_Missense_Mutation_p.A151V|PRG2_uc001nkd.2_Missense_Mutation_p.A140V|PRG2_uc001nkc.2_Missense_Mutation_p.A151V|PRG2_uc001nke.2_Missense_Mutation_p.A431V	NM_002728	NP_002719	P13727	PRG2_HUMAN	proteoglycan 2 preproprotein	151	C-type lectin.				defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	CTGGTTGAGCGCGCTGACAGA	0.507													8	251	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61908476	61908476	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61908476C>A	uc001nsw.1	+	10	1755	c.1553C>A	c.(1552-1554)TCC>TAC	p.S518Y	INCENP_uc009ynw.1_Missense_Mutation_p.S518Y|INCENP_uc001nsx.1_Missense_Mutation_p.S518Y	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	518					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						GTCATGAAGTCCTTTATTAAG	0.627													3	38	---	---	---	---	PASS
KRTAP5-9	3846	broad.mit.edu	37	11	71260168	71260168	+	Silent	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71260168C>A	uc001oqs.1	+	1	703	c.465C>A	c.(463-465)TCC>TCA	p.S155S		NM_005553	NP_005544	P26371	KRA59_HUMAN	keratin associated protein 5-9	155	8 X 4 AA repeats of C-C-X-P.				epidermis development	keratin filament					0						CCTGCTGCTCCCAGTCCAGAT	0.577													28	91	---	---	---	---	PASS
C12orf57	113246	broad.mit.edu	37	12	7054995	7054995	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7054995C>A	uc001qrz.2	+	3	373	c.291C>A	c.(289-291)AGC>AGA	p.S97R	PTPN6_uc001qsa.1_5'Flank|PTPN6_uc010sfr.1_5'Flank	NM_138425	NP_612434	Q99622	C10_HUMAN	C10 protein	97											0						AGATCGCCAGCCTGTCAGGCA	0.612													5	36	---	---	---	---	PASS
NPFF	8620	broad.mit.edu	37	12	53900526	53900526	+	3'UTR	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53900526G>A	uc001sdw.1	-	3						NM_003717	NP_003708	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide preproprotein						neuropeptide signaling pathway|synaptic transmission	extracellular region|soluble fraction	neuropeptide hormone activity				0						TTTGGGTGTGGACCTTGCATG	0.517													42	110	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81675111	81675111	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81675111A>G	uc001szo.1	-	27	3298	c.3137T>C	c.(3136-3138)GTA>GCA	p.V1046A	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	945										ovary(3)|lung(2)|pancreas(1)	6						TCTTGCATCTACCAAGCATTC	0.393													22	83	---	---	---	---	PASS
GLT8D2	83468	broad.mit.edu	37	12	104390596	104390596	+	Silent	SNP	A	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104390596A>G	uc001tkh.1	-	8	923	c.517T>C	c.(517-519)TTG>CTG	p.L173L	GLT8D2_uc001tki.1_Silent_p.L173L	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	173	Lumenal (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						CCCAGGGCCAAGGTGGTGTCA	0.478													44	69	---	---	---	---	PASS
ALKBH2	121642	broad.mit.edu	37	12	109530325	109530325	+	Silent	SNP	T	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109530325T>A	uc001tnx.2	-	2	660	c.267A>T	c.(265-267)GTA>GTT	p.V89V	ALKBH2_uc001tny.2_Silent_p.V89V|ALKBH2_uc010sxj.1_Silent_p.V89V|ALKBH2_uc009zvd.2_Silent_p.V89V|ALKBH2_uc010sxk.1_Silent_p.V89V	NM_001145374	NP_001138846	Q6NS38	ALKB2_HUMAN	AlkB homolog 2	89					DNA dealkylation involved in DNA repair|oxidative DNA demethylation	nucleoplasm	cytosine C-5 DNA demethylase activity|damaged DNA binding|DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0					Vitamin C(DB00126)	TAAAATATTCTACTTCTTTCT	0.418								Direct_reversal_of_damage					30	47	---	---	---	---	PASS
ALKBH2	121642	broad.mit.edu	37	12	109530381	109530381	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109530381C>T	uc001tnx.2	-	2	604	c.211G>A	c.(211-213)GTC>ATC	p.V71I	ALKBH2_uc001tny.2_Missense_Mutation_p.V71I|ALKBH2_uc010sxj.1_Missense_Mutation_p.V71I|ALKBH2_uc009zvd.2_Missense_Mutation_p.V71I|ALKBH2_uc010sxk.1_Missense_Mutation_p.V71I	NM_001145374	NP_001138846	Q6NS38	ALKB2_HUMAN	AlkB homolog 2	71					DNA dealkylation involved in DNA repair|oxidative DNA demethylation	nucleoplasm	cytosine C-5 DNA demethylase activity|damaged DNA binding|DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0					Vitamin C(DB00126)	CCAAACAGGACTGTGTAACTG	0.493								Direct_reversal_of_damage					66	128	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19420016	19420016	+	RNA	SNP	C	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19420016C>G	uc010tcj.1	-	1		c.26094G>C				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						AGACTATAATCTTTATAAAAA	0.269													8	28	---	---	---	---	PASS
OR4K2	390431	broad.mit.edu	37	14	20344686	20344686	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20344686C>G	uc001vwh.1	+	1	260	c.260C>G	c.(259-261)ACA>AGA	p.T87R		NM_001005501	NP_001005501	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K,	87	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GATTACCTAACAGGTCACAAA	0.413													67	437	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20403917	20403917	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20403917T>C	uc001vwj.1	+	1	92	c.92T>C	c.(91-93)TTC>TCC	p.F31S		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TTTGCCATCTTCTCTATAGTC	0.378													82	707	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63447836	63447836	+	Silent	SNP	A	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63447836A>T	uc001xfx.2	-	6	747	c.696T>A	c.(694-696)GTT>GTA	p.V232V	KCNH5_uc001xfy.2_Silent_p.V232V|KCNH5_uc001xfz.1_Silent_p.V174V|KCNH5_uc001xga.2_Silent_p.V174V	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	232	Helical; Name=Segment S1; (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CATTATAAGGAACCATAATGG	0.378													12	44	---	---	---	---	PASS
DCAF5	8816	broad.mit.edu	37	14	69589045	69589045	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69589045T>C	uc001xkp.2	-	2	466	c.247A>G	c.(247-249)ATG>GTG	p.M83V	DCAF5_uc001xkq.2_Missense_Mutation_p.M83V|DCAF5_uc001xkr.3_Missense_Mutation_p.M83V|DCAF5_uc001xks.2_Missense_Mutation_p.M83V	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN	WD repeat domain 22	83	WD 1.					CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)	2						GCTTGTTCCATGTGCCATAGC	0.478													19	79	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42147094	42147094	+	Silent	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42147094C>T	uc001zos.2	-	56	9732	c.9399G>A	c.(9397-9399)TTG>TTA	p.L3133L		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3168	Spectrin 28.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GGGTGCCTGCCAACTTCCTCA	0.582													17	43	---	---	---	---	PASS
USP50	373509	broad.mit.edu	37	15	50833303	50833303	+	Silent	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50833303G>A	uc001zyq.3	-	4	798	c.618C>T	c.(616-618)AAC>AAT	p.N206N		NM_203494	NP_987090	E9PP86	E9PP86_HUMAN	ubiquitin specific protease 50	201					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			lung(1)|breast(1)	2				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		TGAAGACTTCGTTCTTGTAGG	0.438													4	49	---	---	---	---	PASS
MAN2A2	4122	broad.mit.edu	37	15	91450577	91450577	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91450577C>A	uc010bnz.2	+	8	1163	c.1048C>A	c.(1048-1050)CCC>ACC	p.P350T	MAN2A2_uc010boa.2_Missense_Mutation_p.P392T|MAN2A2_uc002bqc.2_Missense_Mutation_p.P350T|MAN2A2_uc010uql.1_Missense_Mutation_p.P54T|MAN2A2_uc010uqm.1_5'UTR	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	350	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TCACATGATGCCCTTCTACAG	0.587													7	154	---	---	---	---	PASS
ABCA3	21	broad.mit.edu	37	16	2373508	2373508	+	Intron	SNP	T	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2373508T>C	uc002cpy.1	-						ABCA3_uc010bsk.1_Intron|ABCA3_uc010bsl.1_Intron|ABCA3_uc002cpz.1_Nonstop_Mutation_p.*210W	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3						response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				ACACGAACCCTAACCGAGCTT	0.498													60	215	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56904064	56904064	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56904064G>T	uc010ccm.2	+	5	687	c.658G>T	c.(658-660)GGC>TGC	p.G220C	SLC12A3_uc002ekd.3_Missense_Mutation_p.G220C|SLC12A3_uc010ccn.2_Missense_Mutation_p.G219C	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	220	Helical; (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	GGGCTCCATCGGCCTCATTTT	0.632													38	79	---	---	---	---	PASS
PDXDC2	283970	broad.mit.edu	37	16	70010650	70010650	+	3'UTR	SNP	A	G	G	rs144900726	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70010650A>G	uc010vlq.1	-	6					CLEC18C_uc002exy.2_Intron|PDXDC2_uc002eyb.2_Intron|PDXDC2_uc002eyc.2_Intron					SubName: Full=Putative uncharacterized protein;												0						AGGGCCGAAGAAGGGAATGTT	0.468													3	56	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161902	90161902	+	3'UTR	SNP	A	G	G	rs6500471	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161902A>G	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		ATATGTTCCAAGACCCTAAAA	0.537													5	30	---	---	---	---	PASS
TRIM16	10626	broad.mit.edu	37	17	15516051	15516051	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15516051C>T	uc002gor.1	-	11	2353	c.2016G>A	c.(2014-2016)ATG>ATA	p.M672I	CDRT1_uc002gov.3_Missense_Mutation_p.M362I			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;	Error:Variant_position_missing_in_O95361_after_alignment					histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		GTTTCACACGCATGCTCTTCC	0.443													30	277	---	---	---	---	PASS
CCDC144C	348254	broad.mit.edu	37	17	20241534	20241534	+	RNA	SNP	G	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20241534G>C	uc010cqy.1	+	4		c.872G>C				NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						GCGAAAATAAGCAGCCACAAG	0.353													5	7	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26942001	26942001	+	3'UTR	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26942001C>T	uc002hbu.2	-	39					SGK494_uc010waq.1_5'Flank|SGK494_uc010war.1_5'Flank|SGK494_uc002hbr.1_5'Flank|uc002hbs.1_Intron|KIAA0100_uc002hbt.2_3'UTR	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor							extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					TCGTGGATAACGGGAAGCCCC	0.562													34	125	---	---	---	---	PASS
RPL23	9349	broad.mit.edu	37	17	37006522	37006522	+	Intron	SNP	G	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37006522G>T	uc002hqx.1	-						RPL23_uc002hqw.1_Intron|RPL23_uc002hqy.1_3'UTR	NM_000978	NP_000969	P62829	RL23_HUMAN	ribosomal protein L23						endocrine pancreas development|ribosomal protein import into nucleus|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0						GACAGATTAAGACATCGTCAA	0.408													3	45	---	---	---	---	PASS
STAT5A	6776	broad.mit.edu	37	17	40458350	40458350	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40458350A>G	uc002hzj.1	+	14	2207	c.1565A>G	c.(1564-1566)AAC>AGC	p.N522S	STAT5A_uc010cya.1_Missense_Mutation_p.N522S|STAT5A_uc010cyb.1_Missense_Mutation_p.N491S|STAT5A_uc010cyc.1_Missense_Mutation_p.N492S|STAT5A_uc010cyd.1_Missense_Mutation_p.N10S|STAT5A_uc010cye.1_Missense_Mutation_p.N10S	NM_003152	NP_003143	P42229	STA5A_HUMAN	signal transducer and activator of transcription	522					2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|oxaloacetate metabolic process|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		GTGCAGAGCAACCGGGGCCTG	0.597													3	47	---	---	---	---	PASS
C17orf47	284083	broad.mit.edu	37	17	56620725	56620725	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56620725G>A	uc002iwq.1	-	1	959	c.823C>T	c.(823-825)CTC>TTC	p.L275F	SEPT4_uc010wnx.1_5'Flank|SEPT4_uc010wny.1_5'Flank	NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN	hypothetical protein LOC284083	275										breast(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGACAGAGAGTTTGAGCAAT	0.453													65	88	---	---	---	---	PASS
DCXR	51181	broad.mit.edu	37	17	79993888	79993888	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79993888C>T	uc002kdg.2	-	8	698	c.683G>A	c.(682-684)GGC>GAC	p.G228D		NM_016286	NP_057370	Q7Z4W1	DCXR_HUMAN	dicarbonyl/L-xylulose reductase	228					D-xylose metabolic process|glucose metabolic process|protein homotetramerization|xylulose metabolic process	membrane	binding|L-xylulose reductase (NADP+) activity				0	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CGTGGTCATGCCACTTCGGTC	0.642													3	64	---	---	---	---	PASS
MALT1	10892	broad.mit.edu	37	18	56376640	56376640	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56376640T>C	uc002lhm.1	+	5	938	c.680T>C	c.(679-681)TTG>TCG	p.L227S	MALT1_uc002lhn.1_Missense_Mutation_p.L227S	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma	227	Ig-like C2-type 2.				activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4						GAATCCAAGTTGCAAATCTGT	0.363			T	BIRC3	MALT								3	122	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9077024	9077024	+	Silent	SNP	G	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9077024G>A	uc002mkp.2	-	3	10626	c.10422C>T	c.(10420-10422)CTC>CTT	p.L3474L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3475	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGGGATTGGTGAGGCTTGTAA	0.488													6	33	---	---	---	---	PASS
ZNF561	93134	broad.mit.edu	37	19	9720930	9720930	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9720930T>A	uc002mlu.2	-	6	1612	c.1407A>T	c.(1405-1407)AGA>AGT	p.R469S	ZNF561_uc010dwu.2_Missense_Mutation_p.R400S|ZNF561_uc010xkr.1_Missense_Mutation_p.R333S	NM_152289	NP_689502	Q8N587	ZN561_HUMAN	zinc finger protein 561	469	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CAGTGTGAATTCTTTCATGTC	0.294													45	149	---	---	---	---	PASS
CHST8	64377	broad.mit.edu	37	19	34263556	34263556	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34263556T>A	uc002nus.3	+	5	1368	c.863T>A	c.(862-864)CTG>CAG	p.L288Q	CHST8_uc002nut.3_Missense_Mutation_p.L288Q|CHST8_uc002nuu.2_Missense_Mutation_p.L288Q	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)	288	Lumenal (Potential).				carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)					AAGGCCATCCTGGCCCGGTAC	0.657													22	55	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36054147	36054147	+	Silent	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36054147C>T	uc002oal.1	-	3	209	c.180G>A	c.(178-180)GCG>GCA	p.A60A		NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	60	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	GTTCCAGCTCCGCCACTGACA	0.547													102	152	---	---	---	---	PASS
PSG3	5671	broad.mit.edu	37	19	43244635	43244635	+	5'UTR	SNP	C	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43244635C>T	uc002oue.2	-	1					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG3_uc010eil.2_5'UTR	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3						defense response|female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				CCTCCTTCTGCGCTGAGCCTC	0.607													4	63	---	---	---	---	PASS
RELB	5971	broad.mit.edu	37	19	45515352	45515352	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45515352G>T	uc002paj.1	+	5	448	c.322G>T	c.(322-324)GGC>TGC	p.G108C		NM_006509	NP_006500	Q01201	RELB_HUMAN	reticuloendotheliosis viral oncogene homolog B	108						nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		GCCGCCTTGGGGCTGCCCCCT	0.776													9	3	---	---	---	---	PASS
MRPS26	64949	broad.mit.edu	37	20	3028493	3028493	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3028493G>C	uc002whs.2	+	4	636	c.596G>C	c.(595-597)AGG>ACG	p.R199T		NM_030811	NP_110438	Q9BYN8	RT26_HUMAN	mitochondrial ribosomal protein S26 precursor	199					DNA damage response, detection of DNA damage	mitochondrial small ribosomal subunit					0						CTGGTGGTCAGGCCACAACGC	0.587													29	41	---	---	---	---	PASS
ACSS2	55902	broad.mit.edu	37	20	33508376	33508376	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33508376A>G	uc002xbd.2	+	9	1128	c.1007A>G	c.(1006-1008)TAT>TGT	p.Y336C	ACSS2_uc002xbc.2_Missense_Mutation_p.Y241C|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Missense_Mutation_p.Y349C|ACSS2_uc002xbe.2_Missense_Mutation_p.Y44C|ACSS2_uc002xbf.2_Intron	NM_018677	NP_061147	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	336					ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding				0					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TACATGCTCTATGTAGCCACA	0.517													41	86	---	---	---	---	PASS
KIAA0406	9675	broad.mit.edu	37	20	36634747	36634747	+	Silent	SNP	T	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36634747T>C	uc002xhl.2	-	4	2564	c.2355A>G	c.(2353-2355)TTA>TTG	p.L785L	KIAA0406_uc002xhm.2_Silent_p.L785L	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	785							binding				0		Myeloproliferative disorder(115;0.00874)				CCTCTTCTCCTAAACTTTGCT	0.453													60	139	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33642768	33642768	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33642768A>C	uc002ypi.2	-	3	525	c.474T>G	c.(472-474)AAT>AAG	p.N158K	C21orf45_uc011adn.1_Missense_Mutation_p.N158K	NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45	158					cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						TGTAATCAAGATTCTTGGGCG	0.423													30	53	---	---	---	---	PASS
C21orf29	54084	broad.mit.edu	37	21	45950936	45950936	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45950936C>A	uc002zfe.1	-	4	689	c.623G>T	c.(622-624)GGC>GTC	p.G208V	C21orf29_uc010gpv.1_Missense_Mutation_p.G140V	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	208	TSP N-terminal.				cell adhesion	extracellular region	structural molecule activity				0						CATGAACAGGCCTTTGGCTCT	0.582													4	40	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42522550	42522550	+	3'UTR	SNP	G	A	A	rs142105976	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42522550G>A	uc003bce.2	-	9					uc003bcd.1_Intron|CYP2D6_uc010gyu.2_3'UTR|CYP2D6_uc003bcf.2_3'UTR	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,								electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						TGGCTAGGGAGCAGGCTGGGG	0.582													3	16	---	---	---	---	PASS
SLC25A14	9016	broad.mit.edu	37	X	129499647	129499647	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129499647A>C	uc004evn.1	+	9	1065	c.852A>C	c.(850-852)TTA>TTC	p.L284F	SLC25A14_uc011mut.1_3'UTR|SLC25A14_uc011muu.1_3'UTR|SLC25A14_uc010nrg.2_3'UTR|SLC25A14_uc004evo.1_Missense_Mutation_p.L105F|SLC25A14_uc004evp.1_Missense_Mutation_p.L284F|SLC25A14_uc004evq.1_Missense_Mutation_p.L281F|SLC25A14_uc004evr.1_Missense_Mutation_p.L312F	NM_003951	NP_003942	O95258	UCP5_HUMAN	solute carrier family 25, member 14 isoform	284	Solcar 3.				aerobic respiration|mitochondrial transport	integral to plasma membrane|mitochondrial inner membrane	binding			ovary(1)	1						ATGGTATTTTAAAGGTAAGTA	0.418													65	128	---	---	---	---	PASS
CCDC160	347475	broad.mit.edu	37	X	133379666	133379666	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133379666G>T	uc011mvj.1	+	2	1157	c.836G>T	c.(835-837)AGT>ATT	p.S279I		NM_001101357	NP_001094827	A6NGH7	CC160_HUMAN	coiled-coil domain containing 160	279	Potential.									skin(1)	1						GGAGAGCTCAGTGTCATCAAG	0.383													16	5	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140995587	140995587	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140995587G>C	uc004fbt.2	+	4	2683	c.2397G>C	c.(2395-2397)CAG>CAC	p.Q799H	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	799							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					AGAGTCCTCAGAGTCCTCCTG	0.567										HNSCC(15;0.026)			55	175	---	---	---	---	PASS
OTUD3	23252	broad.mit.edu	37	1	20220846	20220846	+	Intron	DEL	C	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20220846delC	uc001bcs.3	+							NM_015207	NP_056022	Q5T2D3	OTUD3_HUMAN	OTU domain containing 3												0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ATTTTTCTTTCCTATTTCCAT	0.353													33	26	---	---	---	---	
CATSPER4	378807	broad.mit.edu	37	1	26527208	26527214	+	Intron	DEL	GGCCTTA	-	-	rs71697047		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26527208_26527214delGGCCTTA	uc010oez.1	+						CATSPER4_uc010oey.1_Intron|CATSPER4_uc009vsf.2_Intron	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		CTGAAATGAGGGCCTTAGAACCCTGGG	0.565													4	4	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	43047006	43047007	+	Intron	DEL	AC	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43047006_43047007delAC	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						TTAATGCTTTACTTGTAAATGT	0.337													96	49	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	60910654	60910655	+	IGR	INS	-	TC	TC			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60910654_60910655insTC								C1orf87 (371228 upstream) : NFIA (632291 downstream)																							gtgtgtgtgtgtgtgtgtgtgt	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	76412549	76412552	+	IGR	DEL	CTTC	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76412549_76412552delCTTC								ASB17 (14433 upstream) : ST6GALNAC3 (127837 downstream)																							gctgatttatcttccttccttcct	0.000													3	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144852633	144852634	+	Intron	DEL	AA	-	-	rs10565305		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852633_144852634delAA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AGGATGAGCTAAGAGCATGCGC	0.574			T	PDGFRB	MPD								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233282753	233282753	+	IGR	DEL	T	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233282753delT								ALPPL2 (7331 upstream) : ALPI (38080 downstream)																							GGGGGGGGGGTGATCTTCTGC	0.577													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	44742540	44742540	+	IGR	DEL	G	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44742540delG								ZNF35 (40258 upstream) : ZNF502 (11595 downstream)																							gagggaggaaggaaggaagga	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	83790732	83790733	+	IGR	INS	-	GGAG	GGAG	rs13089076		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83790732_83790733insGGAG								None (None upstream) : None (None downstream)																							aaggaaggaaaggagggaggga	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116213566	116213567	+	IGR	DEL	AC	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116213566_116213567delAC								LSAMP (689548 upstream) : LOC285194 (215068 downstream)																							aattgagggtacacacacacac	0.000													3	4	---	---	---	---	
IQCB1	9657	broad.mit.edu	37	3	121517893	121517893	+	Intron	DEL	T	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121517893delT	uc010hre.1	-						IQCB1_uc003eek.2_Intron|IQCB1_uc010hrf.1_Intron	NM_001023570	NP_001018864	Q15051	IQCB1_HUMAN	IQ motif containing B1 isoform a						cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)		ATATAAAGACTTTTTTTTTTC	0.294													4	2	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143081662	143081662	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143081662delA	uc003iix.3	-	18	2007	c.1412delT	c.(1411-1413)TTAfs	p.L471fs	INPP4B_uc003iiw.3_Frame_Shift_Del_p.L471fs|INPP4B_uc011chm.1_RNA|INPP4B_uc011chn.1_Frame_Shift_Del_p.L286fs|INPP4B_uc011cho.1_RNA|INPP4B_uc011chp.1_Frame_Shift_Del_p.L342fs	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,	471					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					GTAGAGTGCTAAAAGAGCACT	0.488													59	31	---	---	---	---	
DDX60L	91351	broad.mit.edu	37	4	169344731	169344736	+	Intron	DEL	AAAGTA	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169344731_169344736delAAAGTA	uc003irq.3	-						DDX60L_uc003irr.1_Intron|DDX60L_uc003irs.1_Intron	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		GTAAAAATTTAAAGTATAAGAAATTC	0.282													4	2	---	---	---	---	
PDGFRB	5159	broad.mit.edu	37	5	149514656	149514656	+	Intron	DEL	A	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149514656delA	uc003lro.2	-						PDGFRB_uc010jhd.2_Intron|PDGFRB_uc011dcg.1_Intron	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta						aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	gtggcaagtcatttgccatct	0.144			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								14	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161427345	161427348	+	IGR	DEL	GTGA	-	-	rs5872738		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161427345_161427348delGTGA								GABRA1 (100382 upstream) : GABRG2 (67300 downstream)																							gtgtgtgtgtgtgagtgtgtgtgt	0.319													2	5	---	---	---	---	
MEP1A	4224	broad.mit.edu	37	6	46765669	46765672	+	Intron	DEL	TTCC	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46765669_46765672delTTCC	uc010jzh.1	+						MEP1A_uc011dwg.1_Intron|MEP1A_uc011dwh.1_Intron|MEP1A_uc011dwi.1_Intron	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor						digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			ccttccttctttccttccttcctt	0.000													3	4	---	---	---	---	
L3MBTL3	84456	broad.mit.edu	37	6	130387432	130387433	+	Intron	DEL	TA	-	-	rs66543366		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130387432_130387433delTA	uc003qbt.2	+						L3MBTL3_uc003qbu.2_Intron	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		tatttttgtgtatatatatata	0.257													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	92724141	92724144	+	IGR	DEL	ACAC	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92724141_92724144delACAC								CDK6 (258200 upstream) : SAMD9 (4688 downstream)																							cctagcTAAGacacacacacacac	0.083													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68413605	68413606	+	RNA	DEL	CT	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413605_68413606delCT	uc004aex.2	+	1		c.160_161delCT								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		TTTGCTGAAACTCTGGGGTTGA	0.609													4	2	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92286637	92286645	+	Intron	DEL	ATGGTGGTT	-	-	rs138909303	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92286637_92286645delATGGTGGTT	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						ggtggtggtgatggtggttatggtggtga	0.033													8	4	---	---	---	---	
B4GALNT3	283358	broad.mit.edu	37	12	661459	661460	+	Intron	DEL	AC	-	-	rs149729869		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:661459_661460delAC	uc001qii.1	+						B4GALNT3_uc001qij.1_Intron|B4GALNT3_uc001qik.1_5'Flank	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta							Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CCTGAGTACTacacacacacac	0.475													8	5	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42671823	42671824	+	Intron	INS	-	A	A	rs146256723	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42671823_42671824insA	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		aagaccctgtcaaaaaaagaga	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77151261	77151263	+	IGR	DEL	TGG	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77151261_77151263delTGG								OSBPL8 (197672 upstream) : ZDHHC17 (6591 downstream)																							AATCTTGGTATGGTGATGATCTT	0.266													80	35	---	---	---	---	
CCDC63	160762	broad.mit.edu	37	12	111326573	111326573	+	Intron	DEL	T	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111326573delT	uc001trv.1	+						CCDC63_uc010sye.1_Intron|CCDC63_uc001trw.1_Intron	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63											skin(6)|ovary(1)|pancreas(1)	8						aACTTCCAACTTTTTTTTTGG	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27925934	27925935	+	IGR	INS	-	TCCC	TCCC	rs9551362	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27925934_27925935insTCCC								RASL11A (78107 upstream) : GTF3A (72746 downstream)																							ccttccttccttccttccttct	0.035													4	3	---	---	---	---	
DGKH	160851	broad.mit.edu	37	13	42772505	42772505	+	Intron	DEL	A	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42772505delA	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron|DGKH_uc010tfi.1_Intron|DGKH_uc010tfj.1_Intron|DGKH_uc001uyn.1_Intron|DGKH_uc001uyo.1_Intron|DGKH_uc001uyp.2_Intron	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TAAGGCACTGAAAACCTTGCT	0.343													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	86232125	86232125	+	IGR	DEL	A	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86232125delA								None (None upstream) : SLITRK6 (134797 downstream)																							ggaaggaaggaaggaaagaag	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20081407	20081408	+	IGR	DEL	AC	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20081407_20081408delAC								P704P (61135 upstream) : OR4Q3 (134179 downstream)																							ATATATGTGGacacacacacac	0.257													3	3	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347465	92347466	+	Intron	INS	-	CACC	CACC	rs140834248	by1000genomes	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347465_92347466insCACC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTTCTATTCTacacacacacac	0.193													6	3	---	---	---	---	
CORO2B	10391	broad.mit.edu	37	15	69006276	69006276	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69006276delA	uc002arj.3	+	6	690	c.661delA	c.(661-663)AAAfs	p.K221fs	CORO2B_uc010bic.2_Frame_Shift_Del_p.K216fs|CORO2B_uc002ark.2_5'UTR	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	221	WD 4.				actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6						GGCCAACTGCAAAAACCACAG	0.502													30	23	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90617221	90617222	+	Intron	INS	-	A	A	rs35145118		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90617221_90617222insA	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			gagtctgtctcaaaaaaaaaac	0.223													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13356489	13356496	+	IGR	DEL	GGAAGGAA	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13356489_13356496delGGAAGGAA								SHISA9 (22217 upstream) : ERCC4 (657518 downstream)																							TTGTTATTGTggaaggaaggaaggaagg	0.091													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21393228	21393229	+	IGR	DEL	TT	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21393228_21393229delTT								NCRNA00169 (63316 upstream) : NPIPL3 (20222 downstream)																							TGGGAGGttgtttttttttttt	0.257													4	3	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10424898	10424899	+	Intron	DEL	AT	-	-	rs147245930		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10424898_10424899delAT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TATTGATGTCATatatatatat	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57429204	57429205	+	IGR	INS	-	A	A			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57429204_57429205insA								CCBE1 (64560 upstream) : PMAIP1 (137987 downstream)																							AAATTGTACTTAAAAAAAAAAA	0.272													4	2	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59920036	59920037	+	Intron	DEL	TA	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59920036_59920037delTA	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				CCTGATTTCTTAAGAAGATACA	0.351													20	13	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074004	62074006	+	Intron	DEL	CAC	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074004_62074006delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaaaaccatcaccaccaccatc	0.025													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	30274401	30274401	+	IGR	DEL	C	-	-	rs79176097	byFrequency	TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30274401delC								N6AMT1 (16708 upstream) : RNF160 (26065 downstream)																							ttttttttttcctaatgctct	0.164													6	3	---	---	---	---	
MX1	4599	broad.mit.edu	37	21	42811515	42811515	+	Intron	DEL	A	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42811515delA	uc002yzh.2	+						MX1_uc002yzi.2_Intron|MX1_uc010goq.2_Intron	NM_001144925	NP_001138397	P20591	MX1_HUMAN	myxovirus resistance protein 1						induction of apoptosis|response to virus|type I interferon-mediated signaling pathway	cytosol	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				ATATGCTTTTATCCATGACTC	0.408													56	37	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33176966	33176969	+	Intron	DEL	TCCT	-	-	rs68188956		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33176966_33176969delTCCT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						cttccttccctccttccttcctct	0.064													5	4	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36717002	36717002	+	Intron	DEL	T	-	-			TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36717002delT	uc003apg.2	-						MYH9_uc003aph.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						ACTTTCCTCAttttttttttt	0.239			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	36507744	36507745	+	IGR	INS	-	TT	TT	rs66602609		TCGA-B0-5116-01A-02D-1421-08	TCGA-B0-5116-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36507744_36507745insTT								CXorf30 (104311 upstream) : FAM47C (518725 downstream)																							tttcttTCGGGttttttttttt	0.020													5	3	---	---	---	---	
