Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NPHP4	261734	broad.mit.edu	37	1	5934954	5934954	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5934954C>A	uc001alq.1	-	21	3290	c.3024G>T	c.(3022-3024)GAG>GAT	p.E1008D		NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	1008					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GGTTGTCGATCTCCACAGTCA	0.632													10	35	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10434522	10434522	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10434522A>C	uc001aqx.3	+	46	5297	c.5095A>C	c.(5095-5097)AGC>CGC	p.S1699R	KIF1B_uc001aqw.3_Missense_Mutation_p.S1653R|KIF1B_uc001aqy.2_Missense_Mutation_p.S1673R|KIF1B_uc001aqz.2_Missense_Mutation_p.S1699R|KIF1B_uc001ara.2_Missense_Mutation_p.S1659R|KIF1B_uc001arb.2_Missense_Mutation_p.S1685R	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1699					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AATTAGACCAAGGTGAGTACT	0.428													41	89	---	---	---	---	PASS
AADACL3	126767	broad.mit.edu	37	1	12785830	12785830	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12785830G>T	uc009vnn.1	+	4	1153	c.920G>T	c.(919-921)GGA>GTA	p.G307V	AADACL3_uc001aug.1_Missense_Mutation_p.G237V	NM_001103170	NP_001096640	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3 isoform 1	307							hydrolase activity				0	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGACCTGGGAGTGCCCGTG	0.517													25	64	---	---	---	---	PASS
YRDC	79693	broad.mit.edu	37	1	38269558	38269558	+	3'UTR	SNP	T	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38269558T>G	uc001cca.1	-	5						NM_024640	NP_078916	Q86U90	YRDC_HUMAN	ischemia/reperfusion inducible protein						negative regulation of transport	membrane|mitochondrion					0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ACACATAGTATCCAGCACCAG	0.542													10	16	---	---	---	---	PASS
CYB5RL	606495	broad.mit.edu	37	1	54644949	54644949	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54644949T>G	uc009vzo.2	-	7	937	c.617A>C	c.(616-618)AAT>ACT	p.N206T	CYB5RL_uc001cww.2_Missense_Mutation_p.N96T|CYB5RL_uc001cwx.3_RNA|CYB5RL_uc001cwy.3_Missense_Mutation_p.N58T	NM_001031672	NP_001026842	Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	206	FAD (By similarity).						cytochrome-b5 reductase activity				0						GTCATTCTCATTGTCTGTGAT	0.537													21	19	---	---	---	---	PASS
PRKACB	5567	broad.mit.edu	37	1	84670172	84670172	+	Intron	SNP	G	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84670172G>C	uc001djj.2	+						PRKACB_uc001djl.2_Intron|PRKACB_uc010ort.1_Intron|PRKACB_uc001djn.2_Intron|PRKACB_uc010oru.1_Intron|PRKACB_uc001djp.2_Intron|PRKACB_uc001djq.2_Intron|PRKACB_uc010orv.1_Intron|PRKACB_uc001dji.2_Nonstop_Mutation_p.*258S|PRKACB_uc001djk.2_Nonstop_Mutation_p.*305S|PRKACB_uc009wcf.1_Nonstop_Mutation_p.*265S	NM_002731	NP_002722	P22694	KAPCB_HUMAN	cAMP-dependent protein kinase catalytic subunit						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding			lung(2)|ovary(1)	3				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		CAGAACTTTTGATATGAACAA	0.328													23	115	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113635893	113635893	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113635893T>A	uc001edf.1	+	3	569	c.371T>A	c.(370-372)CTA>CAA	p.L124Q	LRIG2_uc009wgn.1_Missense_Mutation_p.L21Q	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	124	LRR 3.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		AATATTACTCTACTTTCATTG	0.254													11	26	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198678874	198678874	+	Missense_Mutation	SNP	G	C	C	rs139425744		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198678874G>C	uc001gur.1	+	11	1266	c.1086G>C	c.(1084-1086)GAG>GAC	p.E362D	PTPRC_uc001gus.1_Missense_Mutation_p.E314D|PTPRC_uc001gut.1_Missense_Mutation_p.E201D|PTPRC_uc009wzf.1_Missense_Mutation_p.E250D|PTPRC_uc010ppg.1_Missense_Mutation_p.E298D	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	362	Extracellular (Potential).		Missing (in T(-)B(+)NK(+) SCID; associated with lack of surface expression).		axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						CCGAACATGAGTATAAGTGTG	0.269													38	72	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198678876	198678876	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198678876A>T	uc001gur.1	+	11	1268	c.1088A>T	c.(1087-1089)TAT>TTT	p.Y363F	PTPRC_uc001gus.1_Missense_Mutation_p.Y315F|PTPRC_uc001gut.1_Missense_Mutation_p.Y202F|PTPRC_uc009wzf.1_Missense_Mutation_p.Y251F|PTPRC_uc010ppg.1_Missense_Mutation_p.Y299F	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	363	Extracellular (Potential).		Missing (in T(-)B(+)NK(+) SCID; associated with lack of surface expression).		axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						GAACATGAGTATAAGTGTGAC	0.269													38	73	---	---	---	---	PASS
SUSD4	55061	broad.mit.edu	37	1	223408420	223408420	+	Intron	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223408420G>A	uc001hnx.2	-						SUSD4_uc001hny.3_Intron|SUSD4_uc010puw.1_Intron|SUSD4_uc001hnz.2_Silent_p.F249F	NM_017982	NP_060452	Q5VX71	SUSD4_HUMAN	sushi domain containing 4 isoform a							integral to membrane					0				GBM - Glioblastoma multiforme(131;0.0611)		AAAGGACAGGGAAAAGATGTT	0.398													19	55	---	---	---	---	PASS
BRE	9577	broad.mit.edu	37	2	28531155	28531155	+	Intron	SNP	A	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28531155A>C	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|BRE_uc002rlx.2_Intron|uc002rly.2_RNA	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					TCCACACATCACCCACCTGCC	0.512													13	19	---	---	---	---	PASS
FAM179A	165186	broad.mit.edu	37	2	29268312	29268312	+	Intron	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29268312G>A	uc010ezl.2	+						FAM179A_uc010ymm.1_Intron|FAM179A_uc002rmr.3_Intron|FAM179A_uc002rms.1_Missense_Mutation_p.G218S	NM_199280	NP_954974	Q6ZUX3	F179A_HUMAN	hypothetical protein LOC165186								binding			ovary(3)|skin(1)	4						CCCATCTCCTGGCAGATTTCT	0.537													14	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90044371	90044371	+	Intron	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90044371C>A	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		AGATTTCACACTGAAAATCAG	0.507													48	136	---	---	---	---	PASS
EDAR	10913	broad.mit.edu	37	2	109547486	109547486	+	5'UTR	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109547486C>T	uc002teq.3	-	2					EDAR_uc010fjn.2_5'UTR|EDAR_uc010yws.1_5'UTR	NM_022336	NP_071731	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor precursor						apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity			skin(1)	1						CCCAAGGGCTCACCTGAAAGA	0.612													26	44	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	160042345	160042345	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160042345G>C	uc002uag.2	+	15	2828	c.2554G>C	c.(2554-2556)GGC>CGC	p.G852R	TANC1_uc010zcm.1_Missense_Mutation_p.G844R|TANC1_uc010fom.1_Missense_Mutation_p.G658R	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	852						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						GCGTCAGGAGGGCAAGTTGAA	0.552											OREG0015033	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	25	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179404241	179404241	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179404241G>A	uc010zfg.1	-	301	91071	c.90847C>T	c.(90847-90849)CGA>TGA	p.R30283*	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.R23978*|TTN_uc010zfi.1_Nonsense_Mutation_p.R23911*|TTN_uc010zfj.1_Nonsense_Mutation_p.R23786*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31210							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGTACCTCGGACTCTGGAA	0.473													46	108	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179476554	179476554	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179476554C>A	uc010zfg.1	-	217	43002	c.42778G>T	c.(42778-42780)GCT>TCT	p.A14260S	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A7955S|TTN_uc010zfi.1_Missense_Mutation_p.A7888S|TTN_uc010zfj.1_Missense_Mutation_p.A7763S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15187							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATTTTCAGCCCGAACCTGA	0.458													41	103	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179485685	179485685	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179485685G>A	uc010zfg.1	-	196	38172	c.37948C>T	c.(37948-37950)CGG>TGG	p.R12650W	TTN_uc010zfh.1_Missense_Mutation_p.R6345W|TTN_uc010zfi.1_Missense_Mutation_p.R6278W|TTN_uc010zfj.1_Missense_Mutation_p.R6153W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13577							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTTCACCCGGGTGTCCTTA	0.373													15	53	---	---	---	---	PASS
SF3B1	23451	broad.mit.edu	37	2	198266611	198266611	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198266611C>T	uc002uue.2	-	16	2273	c.2225G>A	c.(2224-2226)GGT>GAT	p.G742D		NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1	742					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			AGCAGCCAAACCCtattttta	0.303													13	53	---	---	---	---	PASS
LOC728323	728323	broad.mit.edu	37	2	243056808	243056808	+	RNA	SNP	T	A	A	rs144220014	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:243056808T>A	uc010zpd.1	+	3		c.269T>A			LOC728323_uc010zpe.1_RNA|LOC728323_uc010zpf.1_RNA|LOC728323_uc010zpg.1_Intron	NR_024437				Homo sapiens cDNA FLJ60027 complete cds, moderately similar to F-box only protein 25.												0						ATAGCGAAGATGGAGAAATAC	0.279													3	32	---	---	---	---	PASS
LOC728323	728323	broad.mit.edu	37	2	243056818	243056818	+	RNA	SNP	C	T	T	rs140719525	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:243056818C>T	uc010zpd.1	+	3		c.279C>T			LOC728323_uc010zpe.1_RNA|LOC728323_uc010zpf.1_RNA|LOC728323_uc010zpg.1_Intron	NR_024437				Homo sapiens cDNA FLJ60027 complete cds, moderately similar to F-box only protein 25.												0						TGGAGAAATACTCAATAATGA	0.269													3	32	---	---	---	---	PASS
GNAI2	2771	broad.mit.edu	37	3	50294255	50294255	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50294255G>T	uc003cyq.1	+	6	815	c.694G>T	c.(694-696)GAC>TAC	p.D232Y	GNAI2_uc003cyo.1_Missense_Mutation_p.D216Y|GNAI2_uc003cyp.1_Missense_Mutation_p.D216Y|GNAI2_uc010hlg.1_Missense_Mutation_p.D151Y|GNAI2_uc011bdn.1_Missense_Mutation_p.D195Y|GNAI2_uc003cyr.1_Missense_Mutation_p.D151Y	NM_002070	NP_002061	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein),	232					adenosine receptor signaling pathway|cell cycle|cell division|gamma-aminobutyric acid signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|platelet activation|response to nutrient|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GAGCGCCTATGACTTGGTGCT	0.582													12	34	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114070318	114070318	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114070318C>T	uc003ebi.2	-	4	787	c.607G>A	c.(607-609)GGG>AGG	p.G203R	ZBTB20_uc003ebj.2_Missense_Mutation_p.G130R|ZBTB20_uc010hqp.2_Missense_Mutation_p.G130R|ZBTB20_uc003ebk.2_Missense_Mutation_p.G130R|ZBTB20_uc003ebl.2_Missense_Mutation_p.G130R|ZBTB20_uc003ebm.2_Missense_Mutation_p.G130R|ZBTB20_uc003ebn.2_Missense_Mutation_p.G130R|uc003ebo.1_5'Flank	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	203					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		TCCTGGATCCCCGGGAACACA	0.652													15	55	---	---	---	---	PASS
IL20RB	53833	broad.mit.edu	37	3	136729130	136729130	+	3'UTR	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136729130C>A	uc003eri.1	+	7					IL20RB_uc003erj.1_RNA|IL20RB_uc010hud.1_3'UTR|uc003erk.1_5'Flank	NM_144717	NP_653318	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta precursor							integral to membrane	receptor activity			ovary(1)	1						CATGAGGGGACAAGTTGTGTT	0.483													13	15	---	---	---	---	PASS
IL1RAP	3556	broad.mit.edu	37	3	190321925	190321925	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190321925G>A	uc003fsm.1	+	4	279	c.73G>A	c.(73-75)GAT>AAT	p.D25N	IL1RAP_uc003fsk.2_Missense_Mutation_p.D25N|IL1RAP_uc003fsl.2_Missense_Mutation_p.D25N|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Missense_Mutation_p.D25N|IL1RAP_uc003fsn.1_RNA|IL1RAP_uc003fso.1_Missense_Mutation_p.D25N|IL1RAP_uc003fsp.1_RNA|IL1RAP_uc003fsq.2_Missense_Mutation_p.D25N	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform	25	Ig-like C2-type 1.|Extracellular (Potential).				inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		AGAACGCTGCGATGACTGGGG	0.448													14	41	---	---	---	---	PASS
STK32B	55351	broad.mit.edu	37	4	5461876	5461876	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5461876T>C	uc003gih.1	+	9	894	c.830T>C	c.(829-831)ATA>ACA	p.I277T	STK32B_uc010ida.1_Missense_Mutation_p.I230T	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B	277	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						CTTCATGACATACAGAGCGTG	0.552											OREG0016061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	49	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134071550	134071550	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134071550C>A	uc003iha.2	+	1	1081	c.255C>A	c.(253-255)TGC>TGA	p.C85*	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Nonsense_Mutation_p.C85*	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	85	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		AACAAATCTGCAAACAGAGCC	0.542													19	56	---	---	---	---	PASS
PET112L	5188	broad.mit.edu	37	4	152592258	152592258	+	3'UTR	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152592258C>T	uc003iml.2	-	13					PET112L_uc003imk.2_RNA	NM_004564	NP_004555	O75879	GATB_HUMAN	PET112-like precursor							mitochondrion	ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor|translation factor activity, nucleic acid binding				0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)			L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TCAGCTTTCACAGGATCCTGT	0.532													18	52	---	---	---	---	PASS
YTHDC2	64848	broad.mit.edu	37	5	112888982	112888982	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112888982G>C	uc003kqn.2	+	13	1976	c.1793G>C	c.(1792-1794)AGT>ACT	p.S598T	YTHDC2_uc010jce.1_Missense_Mutation_p.S598T|YTHDC2_uc010jcf.1_Missense_Mutation_p.S298T	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	598							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		TATCATCATAGTTTCGATGAT	0.373													11	24	---	---	---	---	PASS
ACSL6	23305	broad.mit.edu	37	5	131296216	131296216	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131296216A>T	uc010jdo.1	-	19	1964	c.1881T>A	c.(1879-1881)AAT>AAA	p.N627K	ACSL6_uc003kvv.1_RNA|ACSL6_uc003kvx.1_Missense_Mutation_p.N652K|ACSL6_uc003kvy.1_Missense_Mutation_p.N652K|ACSL6_uc003kwb.2_Missense_Mutation_p.N617K|ACSL6_uc003kvz.1_Missense_Mutation_p.N552K|ACSL6_uc003kwa.1_Missense_Mutation_p.N638K|ACSL6_uc003kvw.1_Missense_Mutation_p.N273K|ACSL6_uc010jdn.1_Missense_Mutation_p.N642K	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	627	Cytoplasmic (Potential).				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TACCAACCTTATTTGTGCAGA	0.448													18	72	---	---	---	---	PASS
CDYL	9425	broad.mit.edu	37	6	4735076	4735076	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4735076C>G	uc003mwi.2	+	3	315	c.184C>G	c.(184-186)CAG>GAG	p.Q62E		NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform	62	Chromo.				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		TCCCGCTTTACAGGTAGGTCT	0.547													22	26	---	---	---	---	PASS
PRRT1	80863	broad.mit.edu	37	6	32117130	32117130	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32117130C>T	uc003nzt.2	-	4	906	c.790G>A	c.(790-792)GCT>ACT	p.A264T	PRRT1_uc003nzs.2_Missense_Mutation_p.A305T|PRRT1_uc003nzu.2_Missense_Mutation_p.R156H	NM_030651	NP_085154	Q99946	PRRT1_HUMAN	NG5 protein	264					response to biotic stimulus	integral to membrane				breast(1)	1						TCGCGTGAAGCGATCTCGGCC	0.652													7	8	---	---	---	---	PASS
PRPH2	5961	broad.mit.edu	37	6	42666085	42666085	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42666085T>C	uc003osk.2	-	3	1275	c.989A>G	c.(988-990)AAC>AGC	p.N330S		NM_000322	NP_000313	P23942	PRPH2_HUMAN	peripherin 2	330	Cytoplasmic (Potential).				cell adhesion|visual perception	integral to membrane				ovary(4)|central_nervous_system(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			TTCCACCTGGTTGCCCTTGCC	0.657													22	59	---	---	---	---	PASS
TMEM63B	55362	broad.mit.edu	37	6	44107217	44107217	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44107217C>T	uc003owr.2	+	7	485	c.421C>T	c.(421-423)CGG>TGG	p.R141W	TMEM63B_uc003owq.1_Missense_Mutation_p.R141W|TMEM63B_uc010jyy.1_Missense_Mutation_p.R44W|TMEM63B_uc003ows.2_Missense_Mutation_p.R44W|TMEM63B_uc010jyz.2_5'Flank	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	141						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			TGATGAGATCCGGGACAAATG	0.597													20	56	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66063414	66063414	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66063414G>T	uc011dxu.1	-	9	1934	c.1396C>A	c.(1396-1398)CAT>AAT	p.H466N	EYS_uc003peq.2_Missense_Mutation_p.H466N|EYS_uc003per.1_Missense_Mutation_p.H466N	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	466					response to stimulus|visual perception	extracellular region	calcium ion binding	p.H466N(2)		lung(4)|ovary(1)|skin(1)	6						CAAATACCATGGAAGGTGACT	0.373													35	69	---	---	---	---	PASS
PPIL4	85313	broad.mit.edu	37	6	149833352	149833352	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149833352G>C	uc003qmo.1	-	12	1196	c.1166C>G	c.(1165-1167)ACC>AGC	p.T389S	PPIL4_uc010kic.2_Intron	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4	389				T -> A (in Ref. 3; CAD97776).	protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		ACAGTGATGGGTTTTCTTCTT	0.363													62	116	---	---	---	---	PASS
DPY19L2P1	554236	broad.mit.edu	37	7	35221082	35221082	+	5'UTR	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35221082C>A	uc003teq.1	-	3										RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						AGAGAAATGACGATCATTTTC	0.284													10	45	---	---	---	---	PASS
PIWIL2	55124	broad.mit.edu	37	8	22138976	22138976	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22138976G>C	uc003xbn.2	+	4	521	c.373G>C	c.(373-375)GTG>CTG	p.V125L	PIWIL2_uc011kzf.1_Missense_Mutation_p.V125L|PIWIL2_uc010ltv.2_Missense_Mutation_p.V125L	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	125					DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		GGATCCAAAAGTGTTGGCGGC	0.483													53	100	---	---	---	---	PASS
LOC728024	728024	broad.mit.edu	37	8	37604944	37604944	+	Silent	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37604944G>A	uc010lvx.1	-	1	578	c.432C>T	c.(430-432)GGC>GGT	p.G144G	ERLIN2_uc003xke.3_Intron	NR_003671				SubName: Full=cDNA FLJ38978 fis, clone NT2RI2004209; SubName: Full=Chromosome X open reading frame 56, isoform CRA_b; SubName: Full=Putative uncharacterized protein CXorf56;												0						TCTTGCTCATGCCTTTGCGCT	0.468													51	89	---	---	---	---	PASS
CPA6	57094	broad.mit.edu	37	8	68396051	68396051	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68396051G>T	uc003xxq.3	-	8	1046	c.790C>A	c.(790-792)CGC>AGC	p.R264S	CPA6_uc003xxr.3_Missense_Mutation_p.R116S|CPA6_uc003xxs.2_Missense_Mutation_p.R264S	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor	264					proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			CCACGGCAGCGAAACCTTGAG	0.423													80	167	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72975792	72975792	+	Silent	SNP	A	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72975792A>C	uc003xza.2	-	5	742	c.567T>G	c.(565-567)GCT>GCG	p.A189A		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	189	Cytoplasmic (Potential).|ANK 4.					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TACATGGCTTAGCTCCTTTTT	0.383													17	53	---	---	---	---	PASS
DNAI1	27019	broad.mit.edu	37	9	34490013	34490013	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34490013C>T	uc003zum.2	+	6	585	c.392C>T	c.(391-393)TCT>TTT	p.S131F		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	131					cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		TACCAAGGTTCTCAGGAGTCT	0.498									Kartagener_syndrome				9	26	---	---	---	---	PASS
KIAA0649	9858	broad.mit.edu	37	9	138379621	138379621	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138379621T>G	uc004cfr.1	+	4	3814	c.3265T>G	c.(3265-3267)TTT>GTT	p.F1089V		NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	1089						nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)		GCTCTTCCACTTTGGAAAGGG	0.716													6	6	---	---	---	---	PASS
HSPA14	51182	broad.mit.edu	37	10	14890648	14890648	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14890648A>C	uc001inf.2	+	4	403	c.262A>C	c.(262-264)AAA>CAA	p.K88Q	HSPA14_uc010qbw.1_Missense_Mutation_p.K88Q	NM_016299	NP_057383	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14 isoform 1	88					'de novo' cotranslational protein folding	cytosol	ATP binding|protein binding			ovary(2)|breast(2)|lung(1)	5						CGCGGAAAGTAAATGTTTAGT	0.318													21	37	---	---	---	---	PASS
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	Missense_Mutation	SNP	A	G	G	rs2257765		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38654432A>G	uc010qex.1	+	5	599	c.524A>G	c.(523-525)AAT>AGT	p.N175S	HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N173S					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0						TCATCTCGCAATGCAAGGAAA	0.453													6	67	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50873032	50873032	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50873032G>T	uc001jhz.2	+	15	2340	c.2187G>T	c.(2185-2187)GAG>GAT	p.E729D	CHAT_uc001jhv.1_Missense_Mutation_p.E611D|CHAT_uc001jhx.1_Missense_Mutation_p.E611D|CHAT_uc001jhy.1_Missense_Mutation_p.E611D|CHAT_uc001jia.2_Missense_Mutation_p.E611D|CHAT_uc010qgs.1_Intron	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	729					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	CGCCTACTGAGAGCAAGCCAT	0.522													6	177	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1029578	1029578	+	Silent	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1029578G>A	uc001lsw.2	-	9	1104	c.1053C>T	c.(1051-1053)TGC>TGT	p.C351C		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	351	TIL.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGACGGGCACGCAGGTGTGGT	0.637													19	20	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	100226891	100226891	+	Silent	SNP	C	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100226891C>G	uc001pga.2	+	25	3582	c.3243C>G	c.(3241-3243)TCC>TCG	p.S1081S	CNTN5_uc001pgb.2_Silent_p.S1007S|CNTN5_uc010ruk.1_Silent_p.S352S	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	1081					cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ACTCTCTCTCCACATCTTCGT	0.418													11	10	---	---	---	---	PASS
PDZD3	79849	broad.mit.edu	37	11	119059108	119059108	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119059108G>A	uc001pwb.2	+	6	1629	c.1105G>A	c.(1105-1107)GCT>ACT	p.A369T	PDZD3_uc001pvy.2_Missense_Mutation_p.A289T|PDZD3_uc001pvz.2_Missense_Mutation_p.A303T|PDZD3_uc010rzd.1_Missense_Mutation_p.A290T|PDZD3_uc001pwa.2_5'UTR			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	369	PDZ 3.				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		AGCCAAGAAGGCTGGGATGCA	0.647													29	45	---	---	---	---	PASS
STAT2	6773	broad.mit.edu	37	12	56745117	56745117	+	Silent	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56745117G>A	uc001slc.2	-	9	978	c.900C>T	c.(898-900)CGC>CGT	p.R300R	STAT2_uc001slb.2_5'Flank|STAT2_uc001sld.2_Silent_p.R296R|STAT2_uc010sqn.1_Silent_p.R296R	NM_005419	NP_005410	P52630	STAT2_HUMAN	signal transducer and activator of transcription	300					interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						CCTGGGCGTTGCGTAGGTCCA	0.557													115	193	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78553024	78553024	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78553024G>A	uc001syp.2	+	23	5000	c.4827G>A	c.(4825-4827)ATG>ATA	p.M1609I	NAV3_uc001syo.2_Missense_Mutation_p.M1609I|NAV3_uc010sub.1_Missense_Mutation_p.M1095I|NAV3_uc009zsf.2_Missense_Mutation_p.M440I	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1609	Potential.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TAGGGAATATGACTGGCCGAT	0.398										HNSCC(70;0.22)			29	39	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122812709	122812709	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122812709C>T	uc001ucg.1	-	16	3140	c.3034G>A	c.(3034-3036)GAA>AAA	p.E1012K	CLIP1_uc001uch.1_Missense_Mutation_p.E1001K|CLIP1_uc001uci.1_Missense_Mutation_p.E966K|CLIP1_uc001ucj.1_Missense_Mutation_p.E587K	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	1012	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		ATTTTCTTTTCCTGCAGAGAC	0.493													17	158	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129558540	129558540	+	Silent	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129558540G>T	uc009zyl.1	-	9	3508	c.3180C>A	c.(3178-3180)CCC>CCA	p.P1060P	TMEM132D_uc001uia.2_Silent_p.P598P	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	1060	Cytoplasmic (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGTTCCTGGTGGGGTACTCGT	0.517													46	98	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130935856	130935856	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130935856C>T	uc001uil.2	-	5	501	c.337G>A	c.(337-339)GCG>ACG	p.A113T	RIMBP2_uc001uim.2_Missense_Mutation_p.A21T	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	113						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCACCGATCGCAGAGCTGCCT	0.552													12	30	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132511994	132511994	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132511994G>A	uc001ujn.2	+	25	5062	c.5027G>A	c.(5026-5028)GGC>GAC	p.G1676D	EP400_uc001ujl.2_Missense_Mutation_p.G1675D|EP400_uc001ujm.2_Missense_Mutation_p.G1595D	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1712					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GGCGTTCCGGGCCGCGTGGCG	0.557													15	41	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32852733	32852733	+	Intron	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32852733G>A	uc001utx.2	+						FRY_uc010tdw.1_Intron|FRY_uc001uty.2_3'UTR|FRY_uc001utz.2_Intron|FRY_uc010tdx.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CTAACATTGTGTATTAGTTTT	0.428													42	101	---	---	---	---	PASS
ELF1	1997	broad.mit.edu	37	13	41507956	41507956	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41507956G>A	uc001uxs.2	-	9	1838	c.1465C>T	c.(1465-1467)CAA>TAA	p.Q489*	ELF1_uc010tfc.1_Nonsense_Mutation_p.Q465*|ELF1_uc010acd.2_Nonsense_Mutation_p.Q382*	NM_172373	NP_758961	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription	489					positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		CCCGCCTTTTGTGACTGCAGC	0.473													48	107	---	---	---	---	PASS
SLITRK6	84189	broad.mit.edu	37	13	86370082	86370082	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86370082G>T	uc001vll.1	-	2	1021	c.562C>A	c.(562-564)CTA>ATA	p.L188I	SLITRK6_uc010afe.1_5'Flank	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	188	Extracellular (Potential).|LRR 5.					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		CGAAGATCTAGATGGGTTAAA	0.388													61	89	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101720287	101720287	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101720287C>A	uc001vox.1	-	39	4618	c.4429G>T	c.(4429-4431)GTG>TTG	p.V1477L		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1477	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTATCATCCACCATGTTCCAT	0.388													30	48	---	---	---	---	PASS
L2HGDH	79944	broad.mit.edu	37	14	50736035	50736035	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50736035C>G	uc001wxu.2	-	7	831	c.752G>C	c.(751-753)CGA>CCA	p.R251P	L2HGDH_uc010tqn.1_Missense_Mutation_p.R251P|L2HGDH_uc010tqo.1_Missense_Mutation_p.R251P	NM_024884	NP_079160	Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase precursor	251					2-oxoglutarate metabolic process|cellular protein metabolic process	integral to mitochondrial inner membrane	2-hydroxyglutarate dehydrogenase activity			ovary(2)	2	all_epithelial(31;0.000599)|Breast(41;0.0102)					ATACTGACATCGAATTTCCTC	0.403													18	99	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	75022277	75022277	+	Missense_Mutation	SNP	G	A	A	rs148766628	byFrequency	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75022277G>A	uc001xqa.2	-	4	1337	c.950C>T	c.(949-951)CCG>CTG	p.P317L		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	317					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GCCTGGTCCCGGGGGCAGGGC	0.642													4	95	---	---	---	---	PASS
KIAA1370	56204	broad.mit.edu	37	15	52892355	52892355	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52892355A>G	uc002acg.3	-	9	2771	c.2618T>C	c.(2617-2619)ATA>ACA	p.I873T	KIAA1370_uc002ach.3_RNA|KIAA1370_uc010bfg.1_Missense_Mutation_p.I785T|KIAA1370_uc010ugf.1_Missense_Mutation_p.I880T	NM_019600	NP_062546	Q32MH5	K1370_HUMAN	hypothetical protein LOC56204	873											0				all cancers(107;0.0803)		AAGACTTGTTATAGGTGGAGC	0.323													14	39	---	---	---	---	PASS
NEO1	4756	broad.mit.edu	37	15	73585755	73585755	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73585755A>G	uc002avm.3	+	26	3909	c.3767A>G	c.(3766-3768)CAT>CGT	p.H1256R	NEO1_uc010ukx.1_Missense_Mutation_p.H1245R|NEO1_uc010uky.1_Intron|NEO1_uc010ukz.1_Missense_Mutation_p.H669R|NEO1_uc002avn.3_Missense_Mutation_p.H894R	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor	1256	Cytoplasmic (Potential).				axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						CATCCCATCCATTCCCTCGAT	0.502													68	129	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102303120	102303120	+	5'Flank	SNP	C	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102303120C>G	uc010usy.1	-						uc002car.2_5'Flank|uc002cbo.2_RNA|uc002cbr.2_5'Flank|uc002cbs.2_5'Flank|uc002cbt.1_5'Flank|uc002cbu.1_5'Flank|uc002cbv.2_5'Flank|uc010utf.1_5'Flank|uc002cbw.2_5'Flank|uc002cby.2_5'Flank|uc002cca.2_5'Flank|uc010utg.1_5'Flank|uc002ccb.3_5'Flank|uc002ccd.2_5'Flank|uc002ccf.3_5'Flank|uc002ccg.3_5'Flank|uc010uth.1_5'Flank|uc002cci.2_5'Flank|uc002ccj.2_5'Flank|uc002cck.2_5'Flank|uc002ccl.1_5'Flank					DQ575740																		CTTCTCAGAGCTGCTGTCCAA	0.592													3	21	---	---	---	---	PASS
ZNF75A	7627	broad.mit.edu	37	16	3361885	3361885	+	5'UTR	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3361885G>A	uc002cut.3	+	2					ZNF75A_uc002cuv.3_RNA	NM_153028	NP_694573	Q96N20	ZN75A_HUMAN	zinc finger protein 75a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						GAATACATACGAGGGTCTGCA	0.488													4	2	---	---	---	---	PASS
XPO6	23214	broad.mit.edu	37	16	28115915	28115915	+	Silent	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28115915G>T	uc002dpa.1	-	21	3399	c.2898C>A	c.(2896-2898)ATC>ATA	p.I966I	XPO6_uc002dpb.1_Silent_p.I952I|XPO6_uc010vcp.1_Silent_p.I966I	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6	966					protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						GCTCCTCAGCGATCCCCCTCT	0.577													22	29	---	---	---	---	PASS
C16orf87	388272	broad.mit.edu	37	16	46836753	46836753	+	3'UTR	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46836753C>A	uc002eek.1	-	4						NM_001001436	NP_001001436	Q6PH81	CP087_HUMAN	hypothetical protein LOC388272												0						GAGAAAGAAACAATCGATGGC	0.448													7	22	---	---	---	---	PASS
ITFG1	81533	broad.mit.edu	37	16	47493063	47493063	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47493063C>A	uc002eet.2	-	2	294	c.232G>T	c.(232-234)GCA>TCA	p.A78S	ITFG1_uc010vgh.1_5'UTR|PHKB_uc010vgi.1_5'Flank|PHKB_uc002eeu.3_5'Flank|PHKB_uc002eev.3_5'Flank|ITFG1_uc010cbf.1_5'UTR	NM_030790	NP_110417	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	78						extracellular region|integral to membrane				ovary(1)|central_nervous_system(1)	2		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				TTCTGGTCTGCCAAAAAGACG	0.264													17	62	---	---	---	---	PASS
FTSJD1	55783	broad.mit.edu	37	16	71318530	71318530	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71318530T>C	uc010cga.2	-	3	1700	c.1294A>G	c.(1294-1296)AAA>GAA	p.K432E	FTSJD1_uc002ezy.3_Missense_Mutation_p.K432E|FTSJD1_uc002ezz.3_Missense_Mutation_p.K432E	NM_001099642	NP_001093112	Q8IYT2	FTSJ1_HUMAN	FtsJ methyltransferase domain containing 1	432						integral to membrane	methyltransferase activity|nucleic acid binding			skin(1)	1						CCAAACCATTTTGTATTTGTA	0.294													27	62	---	---	---	---	PASS
ZNF232	7775	broad.mit.edu	37	17	5012545	5012545	+	Intron	SNP	A	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5012545A>G	uc002gas.2	-						ZNF232_uc002gar.1_Intron|ZNF232_uc002gat.2_Intron|ZNF232_uc010vsv.1_Silent_p.F214F	NM_014519	NP_055334	Q9UNY5	ZN232_HUMAN	zinc finger protein 232						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						CGAGGGCAGAAAAGACAGACA	0.532													8	15	---	---	---	---	PASS
TMIGD1	388364	broad.mit.edu	37	17	28659092	28659092	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28659092T>G	uc002hfa.1	-	2	133	c.60A>C	c.(58-60)TTA>TTC	p.L20F	TMIGD1_uc010csh.1_Missense_Mutation_p.L20F	NM_206832	NP_996663	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain	20						integral to membrane					0						GTGGCAGAAATAAAATTACTA	0.333													25	27	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	34235997	34235997	+	RNA	SNP	T	C	C	rs11657908	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34235997T>C	uc010ctx.1	-	1		c.957A>G								Homo sapiens cDNA FLJ43944 fis, clone TESTI4014392.																		GGATGTGTCATTTCAGGATGC	0.473													3	40	---	---	---	---	PASS
LASP1	3927	broad.mit.edu	37	17	37075097	37075097	+	3'UTR	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37075097G>A	uc002hra.2	+	7					LASP1_uc010cvq.2_Missense_Mutation_p.R162H|LASP1_uc010wdz.1_3'UTR	NM_006148	NP_006139	Q14847	LASP1_HUMAN	LIM and SH3 protein 1							cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1						GGCGTGACCCGTCCATTCTTC	0.552			T	MLL	AML								3	19	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274235	39274235	+	Silent	SNP	G	A	A	rs11654403	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274235G>A	uc002hvz.2	-	1	372	c.333C>T	c.(331-333)CGC>CGT	p.R111R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	111	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].|18.					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcagctggggcgacagcagc	0.194													3	36	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40647651	40647651	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40647651A>T	uc002hzr.2	+	14	1644	c.1477A>T	c.(1477-1479)ACG>TCG	p.T493S	ATP6V0A1_uc002hzq.2_Missense_Mutation_p.T493S|ATP6V0A1_uc002hzs.2_Missense_Mutation_p.T500S|ATP6V0A1_uc010wgj.1_Missense_Mutation_p.T450S|ATP6V0A1_uc010wgk.1_Missense_Mutation_p.T450S|ATP6V0A1_uc010cyg.2_Missense_Mutation_p.T139S|ATP6V0A1_uc010wgl.1_Missense_Mutation_p.T352S	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	493	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TAGTGAAGAGACGCTTCGGGG	0.468													14	36	---	---	---	---	PASS
NFE2L1	4779	broad.mit.edu	37	17	46134732	46134732	+	Silent	SNP	A	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46134732A>T	uc002imz.3	+	5	1491	c.840A>T	c.(838-840)ACA>ACT	p.T280T	NFE2L1_uc002ina.3_Silent_p.T250T|NFE2L1_uc002inb.3_Silent_p.T250T|NFE2L1_uc010wle.1_Silent_p.T92T|NFE2L1_uc010wlf.1_Silent_p.T124T	NM_003204	NP_003195	Q14494	NF2L1_HUMAN	nuclear factor erythroid 2-like 1	280	Asp/Glu-rich (acidic).				anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1						CCAGCATAACAGAAGCAGTGC	0.488													56	96	---	---	---	---	PASS
SMARCD2	6603	broad.mit.edu	37	17	61911351	61911351	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61911351G>A	uc010deb.1	-	9	1416	c.1099C>T	c.(1099-1101)CGA>TGA	p.R367*	SMARCD2_uc010wpt.1_Nonsense_Mutation_p.R319*|SMARCD2_uc010dea.1_Nonsense_Mutation_p.R292*|SMARCD2_uc010dec.1_Nonsense_Mutation_p.R346*	NM_001098426	NP_001091896	Q92925	SMRD2_HUMAN	SWI/SNF-related matrix-associated	367	SWIB.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	SWI/SNF complex	protein binding|transcription coactivator activity				0						AAACGGAGTCGGCCACAACTG	0.547													6	107	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14543161	14543161	+	5'UTR	SNP	C	A	A	rs45446896		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14543161C>A	uc010dln.2	-	1					POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2											skin(3)	3						TTTAACAGCCCGGGGAGGCCG	0.512													5	51	---	---	---	---	PASS
CDH19	28513	broad.mit.edu	37	18	64235684	64235684	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64235684A>T	uc002lkc.1	-	3	597	c.459T>A	c.(457-459)TAT>TAA	p.Y153*	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Nonsense_Mutation_p.Y153*|CDH19_uc002lkd.2_Nonsense_Mutation_p.Y153*	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	153	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				CAATGGCCTCATAAGGTTCAT	0.363													6	123	---	---	---	---	PASS
CTDP1	9150	broad.mit.edu	37	18	77475251	77475251	+	Silent	SNP	G	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77475251G>C	uc002lnh.1	+	8	1938	c.1791G>C	c.(1789-1791)CTG>CTC	p.L597L	CTDP1_uc002lni.1_Silent_p.L597L|CTDP1_uc010drd.1_Silent_p.L597L	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	597					positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		AGGAGATCCTGGTCCGTGTAC	0.522													6	9	---	---	---	---	PASS
DAZAP1	26528	broad.mit.edu	37	19	1433802	1433802	+	Intron	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1433802C>T	uc002lsn.2	+						DAZAP1_uc002lsm.2_Silent_p.V371V|DAZAP1_uc002lso.2_Intron|DAZAP1_uc002lsl.1_Intron	NM_018959	NP_061832	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1 isoform b						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleotide binding|RNA binding			breast(1)	1		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCTTATGGTCAGGCTGAGCA	0.642													31	73	---	---	---	---	PASS
PIP5K1C	23396	broad.mit.edu	37	19	3651997	3651997	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3651997G>T	uc002lyj.1	-	8	1011	c.954C>A	c.(952-954)AGC>AGA	p.S318R	PIP5K1C_uc010xhq.1_Missense_Mutation_p.S318R|PIP5K1C_uc010xhr.1_Missense_Mutation_p.S318R	NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	318	PIPK.				axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CCAGCAGCAGGCTGTAGTCCA	0.657													6	53	---	---	---	---	PASS
OR10H4	126541	broad.mit.edu	37	19	16059970	16059970	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16059970G>A	uc010xov.1	+	1	153	c.153G>A	c.(151-153)TGG>TGA	p.W51*		NM_001004465	NP_001004465	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H,	51	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						CCACAATCTGGATTGAACACA	0.542													108	172	---	---	---	---	PASS
GTPBP3	84705	broad.mit.edu	37	19	17448782	17448782	+	Intron	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17448782C>T	uc010eas.2	+						GTPBP3_uc010xpo.1_Intron|GTPBP3_uc010eaq.1_RNA|GTPBP3_uc010ear.1_RNA|GTPBP3_uc002ngh.3_Intron|GTPBP3_uc002ngg.3_Intron|GTPBP3_uc002ngi.3_5'UTR	NM_032620	NP_116009	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial) isoform V						tRNA modification	mitochondrion	GTP binding|GTPase activity			skin(1)	1						GCTGAGCCTCCCAGGTGCGCT	0.657													10	20	---	---	---	---	PASS
FAM125A	93343	broad.mit.edu	37	19	17533164	17533164	+	Missense_Mutation	SNP	C	T	T	rs146357246		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17533164C>T	uc002ngo.1	+	4	343	c.310C>T	c.(310-312)CGC>TGC	p.R104C	FAM125A_uc002ngp.1_Missense_Mutation_p.R12C|FAM125A_uc002ngq.1_Translation_Start_Site	NM_138401	NP_612410	Q96EY5	F125A_HUMAN	family with sequence similarity 125, member A	104	MABP.				protein transport	late endosome membrane|microtubule organizing center|nucleus	SH3 domain binding				0						CAAGAAGAAACGCATGTGTGT	0.582													17	57	---	---	---	---	PASS
RHPN2	85415	broad.mit.edu	37	19	33490548	33490548	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33490548G>A	uc002nuf.2	-	10	1235	c.1169C>T	c.(1168-1170)CCA>CTA	p.P390L	RHPN2_uc010xro.1_Missense_Mutation_p.P239L|RHPN2_uc002nue.2_Missense_Mutation_p.P120L	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	390	BRO1.				signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					CAGCCCCTCTGGCATGTGGTC	0.607													4	55	---	---	---	---	PASS
U2AF1L4	199746	broad.mit.edu	37	19	36235063	36235063	+	Intron	SNP	T	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36235063T>C	uc002obg.2	-						TMEM149_uc002obb.2_5'Flank|TMEM149_uc002obc.2_5'Flank|TMEM149_uc002obd.3_5'Flank|TMEM149_uc010xsy.1_5'Flank|TMEM149_uc010eej.2_Intron|U2AF1L4_uc002obh.1_5'UTR|U2AF1L4_uc002obe.2_Intron|U2AF1L4_uc002obf.2_Intron|PSENEN_uc002obi.1_5'Flank|PSENEN_uc002obj.1_5'Flank|PSENEN_uc002obk.1_5'Flank			Q8WU68	U2AF4_HUMAN	Homo sapiens cDNA FLJ35525 fis, clone SPLEN2001650.						mRNA processing|RNA splicing	nuclear speck|spliceosomal complex	nucleotide binding|RNA binding|zinc ion binding				0	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAAATGTCAGTCAGGGTCAGC	0.572													11	19	---	---	---	---	PASS
ZNF345	25850	broad.mit.edu	37	19	37367781	37367781	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37367781G>T	uc002oex.2	+	3	427	c.49G>T	c.(49-51)GAT>TAT	p.D17Y	ZNF345_uc002oey.3_Missense_Mutation_p.D17Y|ZNF345_uc002oez.2_Intron	NM_003419	NP_003410	Q14585	ZN345_HUMAN	zinc finger protein 345	17					negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTCAGAGGTGATTGGGAATG	0.358													7	127	---	---	---	---	PASS
SHKBP1	92799	broad.mit.edu	37	19	41094601	41094601	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41094601G>A	uc002oob.2	+	14	1457	c.1408G>A	c.(1408-1410)GGC>AGC	p.G470S	SHKBP1_uc002ooc.2_Missense_Mutation_p.G445S|SHKBP1_uc002ood.2_Missense_Mutation_p.G470S|SHKBP1_uc010xvl.1_Missense_Mutation_p.G393S|SHKBP1_uc002ooe.2_Missense_Mutation_p.G307S|SHKBP1_uc002oof.2_Missense_Mutation_p.G307S|SHKBP1_uc010xvm.1_Missense_Mutation_p.G250S|SHKBP1_uc010xvn.1_Missense_Mutation_p.G348S	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	470						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|pancreas(1)	2			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CACCCAGCCCGGCTCCACCCC	0.602													32	85	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41120306	41120306	+	Silent	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41120306G>A	uc002ooh.1	+	22	2967	c.2967G>A	c.(2965-2967)CGG>CGA	p.R989R	LTBP4_uc002oog.1_Silent_p.R952R|LTBP4_uc002ooi.1_Silent_p.R922R|LTBP4_uc002ooj.1_5'UTR|LTBP4_uc002ook.1_Silent_p.R209R|LTBP4_uc002ool.1_Silent_p.R87R|LTBP4_uc002oom.1_RNA|LTBP4_uc010xvp.1_5'UTR	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	989	Cys-rich.				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTGTGTCCGGGACTGCGATC	0.692													6	14	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32377331	32377331	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32377331A>C	uc002wzy.2	+	14	1992	c.1972A>C	c.(1972-1974)ACA>CCA	p.T658P	ZNF341_uc002wzx.2_Missense_Mutation_p.T651P|ZNF341_uc010geq.2_Missense_Mutation_p.T568P|ZNF341_uc010ger.2_RNA|ZNF341_uc002wzz.2_Missense_Mutation_p.T85P	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	658	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TAGGACGCACACAGGCTGCAG	0.592													19	39	---	---	---	---	PASS
GSS	2937	broad.mit.edu	37	20	33530526	33530526	+	Intron	SNP	A	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33530526A>G	uc002xbg.2	-						GSS_uc010zun.1_5'UTR|GSS_uc010zuo.1_Intron|GSS_uc010zup.1_Intron|GSS_uc002xbh.2_Intron|GSS_uc010gez.1_Intron	NM_000178	NP_000169	P48637	GSHB_HUMAN	glutathione synthetase						nervous system development|response to oxidative stress|xenobiotic metabolic process	cytosol	ATP binding|glutathione binding|glutathione synthase activity|magnesium ion binding|protein homodimerization activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(18;0.035)		Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	CTACACAGAGATTAGAGGTAC	0.517													9	10	---	---	---	---	PASS
SIK1	150094	broad.mit.edu	37	21	44840177	44840177	+	Silent	SNP	G	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44840177G>A	uc002zdf.2	-	8	1036	c.909C>T	c.(907-909)GAC>GAT	p.D303D		NM_173354	NP_775490	P57059	SIK1_HUMAN	salt-inducible kinase 1	303	UBA.				anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7						GCTCATCGTAGTCGCCCAGGT	0.692													9	22	---	---	---	---	PASS
CLTCL1	8218	broad.mit.edu	37	22	19210260	19210260	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19210260G>C	uc002zpb.2	-	15	2440	c.2365C>G	c.(2365-2367)CTA>GTA	p.L789V	CLTCL1_uc011agv.1_Missense_Mutation_p.L789V|CLTCL1_uc011agw.1_Missense_Mutation_p.L789V	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1	789	Proximal segment.|Heavy chain arm.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					TATAAATATAGGACAAGGTCA	0.527			T	?	ALCL								4	11	---	---	---	---	PASS
TBX1	6899	broad.mit.edu	37	22	19767018	19767018	+	3'UTR	SNP	G	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19767018G>T	uc002zqb.2	+	9					TBX1_uc002zqc.2_Intron	NM_080646	NP_542377	O43435	TBX1_HUMAN	T-box 1 isoform A						embryonic viscerocranium morphogenesis|heart development|parathyroid gland development|pharyngeal system development|regulation of transcription from RNA polymerase II promoter|soft palate development|thymus development	nucleus	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|breast(1)	2	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				TAAAAAAACAGTGACTTGTTC	0.378													5	15	---	---	---	---	PASS
C22orf15	150248	broad.mit.edu	37	22	24107238	24107238	+	Intron	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24107238C>T	uc011aja.1	+						C22orf15_uc002zxv.1_3'UTR|C22orf15_uc002zxu.2_Intron	NM_182520	NP_872326	Q8WYQ4	CV015_HUMAN	hypothetical protein LOC150248												0		Medulloblastoma(6;6.27e-05)|all_neural(6;0.00518)				ACCAACTCCACGCACATATAC	0.413													3	7	---	---	---	---	PASS
MN1	4330	broad.mit.edu	37	22	28146852	28146852	+	3'UTR	SNP	C	G	G			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28146852C>G	uc003adj.2	-	2					MN1_uc010gvg.2_RNA	NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						gggaaggaaacagacaggggg	0.264			T	ETV6	AML|meningioma								16	15	---	---	---	---	PASS
PKDREJ	10343	broad.mit.edu	37	22	46654306	46654306	+	Silent	SNP	C	T	T	rs146045479	byFrequency	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46654306C>T	uc003bhh.2	-	1	4914	c.4914G>A	c.(4912-4914)ACG>ACA	p.T1638T		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	1638	Cytoplasmic (Potential).				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TGGGTTTATTCGTTCTGAAGC	0.388													5	77	---	---	---	---	PASS
MAPK12	6300	broad.mit.edu	37	22	50695076	50695076	+	Splice_Site	SNP	C	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50695076C>T	uc003bkm.1	-	6	608	c.457_splice	c.e6-1	p.D153_splice	MAPK12_uc003bkn.2_Splice_Site|MAPK12_uc003bko.2_Splice_Site_p.D63_splice|MAPK12_uc003bkl.1_Splice_Site_p.D143_splice|MAPK12_uc003bkp.2_5'Flank|MAPK12_uc003bkq.2_Splice_Site	NM_002969	NP_002960	P53778	MK12_HUMAN	mitogen-activated protein kinase 12						cell cycle arrest|DNA damage induced protein phosphorylation|muscle organ development|myoblast differentiation|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|Ras protein signal transduction	mitochondrion|nucleoplasm	ATP binding|magnesium ion binding|MAP kinase activity|protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCTTCAGGTCCTGGGGGCAGA	0.672													24	57	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53224222	53224222	+	Nonsense_Mutation	SNP	G	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53224222G>C	uc004drz.2	-	22	3862	c.3329C>G	c.(3328-3330)TCA>TGA	p.S1110*	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Nonsense_Mutation_p.S1043*|KDM5C_uc004dsa.2_Nonsense_Mutation_p.S1109*	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	1110					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						GGTGCTGTCTGAGCCGGCATC	0.622			N|F|S		clear cell renal carcinoma								7	3	---	---	---	---	PASS
UBIAD1	29914	broad.mit.edu	37	1	11345857	11345858	+	Frame_Shift_Ins	INS	-	C	C			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11345857_11345858insC	uc001asg.2	+	2	1020_1021	c.686_687insC	c.(685-687)CTCfs	p.L229fs		NM_013319	NP_037451	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	229	Helical; (Potential).				menaquinone biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrion|nucleus	prenyltransferase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		GAGGCCATTCTCCATTCCAACA	0.609													98	56	---	---	---	---	
CDA	978	broad.mit.edu	37	1	20945252	20945253	+	3'UTR	INS	-	C	C	rs141070763	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20945252_20945253insC	uc001bdk.2	+	4					CDA_uc001bdl.2_RNA|CDA_uc009vpv.2_RNA	NM_001785	NP_001776	P32320	CDD_HUMAN	cytidine deaminase						cell surface receptor linked signaling pathway|cytosine metabolic process|negative regulation of cell growth|negative regulation of nucleotide metabolic process|protein homotetramerization|pyrimidine nucleoside salvage	cytosol|extracellular region	cytidine deaminase activity|nucleoside binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	GAACACCGCCGCCCCCTGCCCC	0.564													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	81564723	81564723	+	IGR	DEL	C	-	-	rs1146421	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81564723delC								None (None upstream) : LPHN2 (207122 downstream)																							ttttttttttccttttttgac	0.199													3	3	---	---	---	---	
ST7L	54879	broad.mit.edu	37	1	113134245	113134245	+	Intron	DEL	A	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113134245delA	uc001ecd.2	-						ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Intron|ST7L_uc010owg.1_Intron|ST7L_uc010owh.1_Intron|ST7L_uc001ece.2_Intron|ST7L_uc001ecf.2_Intron|ST7L_uc001ecg.2_Intron|ST7L_uc010owi.1_Intron|ST7L_uc001ech.2_Intron|ST7L_uc001eci.2_Intron|ST7L_uc009wgi.1_Intron|ST7L_uc010owj.1_Intron	NM_017744	NP_060214	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAATTCCATAAAATAGATGA	0.308													50	24	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153800932	153800939	+	Intron	DEL	ACACACAC	-	-	rs71677766		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800932_153800939delACACACAC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCTcacacatacacacacacacacacac	0.236													3	3	---	---	---	---	
NUP133	55746	broad.mit.edu	37	1	229631436	229631436	+	Intron	DEL	A	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229631436delA	uc001htn.2	-							NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				TGTATACATTAAAAAAAAAAT	0.169													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96652817	96652818	+	Intron	DEL	AA	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96652817_96652818delAA	uc010yug.1	-											Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																		TCTCATGCTCAAAAAGAGTCAG	0.406													4	2	---	---	---	---	
SLC4A10	57282	broad.mit.edu	37	2	162661045	162661046	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162661045_162661046delAG	uc002ubx.3	+	3	401_402	c.217_218delAG	c.(217-219)AGAfs	p.R73fs	SLC4A10_uc010fpa.1_Frame_Shift_Del_p.R85fs|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Frame_Shift_Del_p.R73fs|SLC4A10_uc010zcs.1_Frame_Shift_Del_p.R84fs	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	73	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						TCATAAACACAGAAAGAGAGAC	0.406													23	19	---	---	---	---	
CYP27A1	1593	broad.mit.edu	37	2	219674165	219674166	+	Intron	INS	-	TTT	TTT	rs72044542		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219674165_219674166insTTT	uc002viz.3	+							NM_000784	NP_000775	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A,						bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Cholecalciferol(DB00169)	ACACAATGCCCttttttttttt	0.450													5	3	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52610584	52610584	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52610584delC	uc003des.2	-	22	3676	c.3664delG	c.(3664-3666)GAAfs	p.E1222fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.E1222fs|PBRM1_uc003der.2_Frame_Shift_Del_p.E1190fs|PBRM1_uc003det.2_Frame_Shift_Del_p.E1237fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.E1237fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.E1222fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.E1197fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.E1197fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.E1221fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1222	BAH 2.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GGGCAGGTTTCTTCCAGATTA	0.299			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								54	49	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113218217	113218217	+	Intron	DEL	T	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113218217delT	uc003eag.3	-						CCDC52_uc003eaf.3_Intron|CCDC52_uc011bie.1_3'UTR|CCDC52_uc003eai.1_3'UTR	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						GTGAATCAAATTGAAGAAAAA	0.274													17	15	---	---	---	---	
STAG1	10274	broad.mit.edu	37	3	136240212	136240212	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136240212delT	uc003era.1	-	7	811	c.519delA	c.(517-519)AAAfs	p.K173fs	STAG1_uc003erb.1_Frame_Shift_Del_p.K173fs|STAG1_uc003erc.1_5'UTR|STAG1_uc010hua.1_Frame_Shift_Del_p.K36fs|STAG1_uc003erd.2_Frame_Shift_Del_p.K76fs|STAG1_uc003ere.2_Frame_Shift_Del_p.K173fs	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	173					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						TTGAACGAAATTTTTTCCACT	0.348													96	62	---	---	---	---	
C4orf37	285555	broad.mit.edu	37	4	99055730	99055731	+	Intron	INS	-	TAA	TAA	rs143595982	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99055730_99055731insTAA	uc003htt.1	-							NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		ATTTTCAGAACTGTCTAGTCAG	0.262													3	3	---	---	---	---	
CCRN4L	25819	broad.mit.edu	37	4	139964674	139964675	+	Intron	INS	-	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139964674_139964675insT	uc003ihl.2	+						CCRN4L_uc003ihk.1_3'UTR	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					CTGGTTTTCACTTTTTTTTTTT	0.381													3	3	---	---	---	---	
MTRR	4552	broad.mit.edu	37	5	7885676	7885676	+	Intron	DEL	T	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7885676delT	uc003jed.2	+						MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CAATTGTGTGTTTTTTTTTTT	0.254													4	2	---	---	---	---	
RGNEF	64283	broad.mit.edu	37	5	73142411	73142412	+	Intron	INS	-	T	T	rs142259999	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73142411_73142412insT	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		CATATGAACTATTTTTTTGAGA	0.287													4	2	---	---	---	---	
LYRM7	90624	broad.mit.edu	37	5	130515637	130515638	+	Intron	INS	-	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130515637_130515638insT	uc003kvg.1	+							NM_181705	NP_859056	Q5U5X0	LYRM7_HUMAN	Lyrm7 homolog												0		all_cancers(142;0.0377)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tcaaaaaaaaattttttttttg	0.000													9	4	---	---	---	---	
KIF3A	11127	broad.mit.edu	37	5	132056222	132056222	+	Intron	DEL	A	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132056222delA	uc003kxo.2	-						KIF3A_uc003kxn.2_Intron|KIF3A_uc011cxf.1_Intron|KIF3A_uc003kxp.2_Intron	NM_007054	NP_008985	Q9Y496	KIF3A_HUMAN	kinesin family member 3A						blood coagulation|organelle organization|plus-end-directed vesicle transport along microtubule	centrosome|cytosol|kinesin II complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|protein binding			pancreas(1)	1		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTACAGGGTAAAGTGCCATA	0.363													10	8	---	---	---	---	
CLINT1	9685	broad.mit.edu	37	5	157236506	157236506	+	Intron	DEL	A	-	-	rs72318416		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157236506delA	uc003lxj.1	-						CLINT1_uc003lxi.1_Intron|CLINT1_uc011ddv.1_Intron	NM_014666	NP_055481	Q14677	EPN4_HUMAN	epsin 4						endocytosis|post-Golgi vesicle-mediated transport	clathrin-coated vesicle|cytosol|Golgi apparatus|membrane|perinuclear region of cytoplasm	clathrin binding|lipid binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			gaagtctattaaAAAAAAAAA	0.154													4	2	---	---	---	---	
ZNF311	282890	broad.mit.edu	37	6	28967350	28967350	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28967350delT	uc003nlu.2	-	5	737	c.224delA	c.(223-225)AACfs	p.N75fs	ZNF311_uc011dlk.1_5'UTR|ZNF311_uc003nlv.2_5'UTR	NM_001010877	NP_001010877	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	75					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0						CCACTCCCTGTTAGTGAAGTT	0.448													35	26	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29865448	29865448	+	Intron	DEL	G	-	-	rs9278416		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29865448delG	uc011dmb.1	+						HCG2P7_uc003nof.2_5'Flank	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						GGGGAGCACAGCCACCCCAAA	0.512													4	2	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5353601	5353601	+	Intron	DEL	T	-	-	rs67749478		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5353601delT	uc003soi.3	-							NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		tttgtttttgttttttttttg	0.219													4	3	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6859772	6859773	+	Intron	INS	-	A	A	rs147091531	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6859772_6859773insA	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		AAAGTTCAAACTATCTACTTAA	0.257													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57698565	57698566	+	5'Flank	INS	-	TGGG	TGGG			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57698565_57698566insTGGG	uc003tso.1	+											Homo sapiens macronuclear mRNA.																		CACAGGAGACCTGGGCTGCAGG	0.584													4	2	---	---	---	---	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72664019	72664020	+	Translation_Start_Site	INS	-	A	A			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72664019_72664020insA	uc003txs.1	-	11	881_882	c.-47_-46insT	c.(-49--44)ATGCCC>ATGTCCC		FKBP6_uc003twz.2_Intron	NR_002164				RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;												0						CACCCCCGGGGCATGCCATCAA	0.505													4	2	---	---	---	---	
PCLO	27445	broad.mit.edu	37	7	82531905	82531909	+	Intron	DEL	CAAAA	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82531905_82531909delCAAAA	uc003uhx.2	-						PCLO_uc003uhv.2_Intron	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						taaaaaaaTGcaaaacaaaacaaaa	0.102													13	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100555116	100555117	+	Intron	INS	-	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100555116_100555117insT	uc003uxk.1	+						uc003uxl.1_Intron					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		AAGAGAGGGGAttttttttttt	0.257													13	7	---	---	---	---	
UBE3C	9690	broad.mit.edu	37	7	156962829	156962829	+	Intron	DEL	C	-	-	rs66735407		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156962829delC	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		ttttttttttctttttAACCA	0.174													3	3	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101011386	101011387	+	Intron	INS	-	A	A	rs35746502		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101011386_101011387insA	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			gcccattccttaaaaaaaaaaa	0.015													6	4	---	---	---	---	
ZNF252	286101	broad.mit.edu	37	8	146202910	146202910	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146202910delT	uc011llo.1	-	3	1280	c.1064delA	c.(1063-1065)GAGfs	p.E355fs	ZNF252_uc003zew.3_Frame_Shift_Del_p.E334fs					SubName: Full=cDNA FLJ52642, weakly similar to Zinc finger protein 3;												0						TTTGCCACACTCCTTACAGTC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104121960	104121963	+	IGR	DEL	AAAC	-	-	rs113884218		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104121960_104121963delAAAC								LPPR1 (34544 upstream) : BAAT (737 downstream)																							aagactGTCTaaacaaacaaacaa	0.137													13	7	---	---	---	---	
MAN1B1	11253	broad.mit.edu	37	9	139996194	139996195	+	Intron	DEL	TG	-	-	rs4880203	by1000genomes	TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139996194_139996195delTG	uc004cld.2	+						MAN1B1_uc004clc.2_Frame_Shift_Del_p.C343fs|MAN1B1_uc011meo.1_Intron|MAN1B1_uc011mep.1_Intron|MAN1B1_uc010ncc.2_Intron|MAN1B1_uc004clf.1_5'Flank|MAN1B1_uc004clg.1_5'Flank	NM_016219	NP_057303	Q9UKM7	MA1B1_HUMAN	alpha 1,2-mannosidase						oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|endoplasmic reticulum quality control compartment|integral to membrane	alpha-mannosidase activity|calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(1)|central_nervous_system(1)	2	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		CAGCAGGTACtgtgtgtgtgtg	0.297													4	2	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7248006	7248011	+	Intron	DEL	AAAAAC	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7248006_7248011delAAAAAC	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						TTATACATTAaaaaacaaaaacaaaa	0.296													3	3	---	---	---	---	
MS4A13	503497	broad.mit.edu	37	11	60296728	60296729	+	Intron	INS	-	T	T	rs35057428		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60296728_60296729insT	uc001nps.2	+						MS4A13_uc009ync.2_Intron|MS4A13_uc009ynd.2_Intron	NM_001012417	NP_001012417	Q5J8X5	M4A13_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane					0						Attttccttccttttttttttt	0.327													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19985459	19985461	+	IGR	DEL	TGG	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19985459_19985461delTGG								LOC100101938 (66346 upstream) : TPTE2 (11560 downstream)																							atgtttctgttggtgatggatgg	0.192													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23424490	23424492	+	IGR	DEL	AAT	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23424490_23424492delAAT								None (None upstream) : SGCG (330568 downstream)																							CGCTGGCATAAATACAAAATTAC	0.409													30	17	---	---	---	---	
ATF7IP2	80063	broad.mit.edu	37	16	10532277	10532277	+	Intron	DEL	T	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10532277delT	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						aatttttgggttttttttttt	0.000													4	2	---	---	---	---	
DYNC1LI2	1783	broad.mit.edu	37	16	66757488	66757488	+	3'UTR	DEL	T	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66757488delT	uc002eqb.1	-	13					DYNC1LI2_uc010vis.1_3'UTR	NM_006141	NP_006132	O43237	DC1L2_HUMAN	dynein, cytoplasmic, light intermediate						transport	centrosome|cytoplasmic dynein complex|microtubule	ATP binding|motor activity			central_nervous_system(3)|skin(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		GCCAATGAAGTTTTTTTTTTT	0.393													4	3	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47655768	47655768	+	Intron	DEL	T	-	-	rs67095119		TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655768delT	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					GGGGGGGGGGTGACCCAACTG	0.527													3	3	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	7007343	7007343	+	Intron	DEL	C	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7007343delC	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	tgaatagacacttctccaaag	0.179													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	2056532	2056532	+	IGR	DEL	A	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2056532delA								PDYN (81829 upstream) : STK35 (25996 downstream)																							TCTCAAACGGAAAAAAAAAAA	0.209													4	2	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8731631	8731632	+	Intron	INS	-	GAGTGCA	GAGTGCA			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8731631_8731632insGAGTGCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						tgcccaggctggagtgcagagg	0.114													4	2	---	---	---	---	
CDC42EP1	11135	broad.mit.edu	37	22	37962842	37962842	+	Intron	DEL	C	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37962842delC	uc003asz.3	+							NM_152243	NP_689449	Q00587	BORG5_HUMAN	CDC42 effector protein 1						positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|endomembrane system|Golgi apparatus|plasma membrane	protein binding				0	Melanoma(58;0.0574)					GCCATCTTGGcccacttttca	0.328													28	16	---	---	---	---	
TRIOBP	11078	broad.mit.edu	37	22	38084734	38084737	+	Intron	DEL	GACC	-	-			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38084734_38084737delGACC	uc003atq.1	+						NOL12_uc011anm.1_Intron|NOL12_uc003ato.1_Intron|NOL12_uc003atp.2_Intron	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					TACAGCCAGTGACCTTGTGGATGC	0.583													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	83996003	83996004	+	IGR	INS	-	T	T			TCGA-B0-5698-01A-11D-1669-08	TCGA-B0-5698-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83996003_83996004insT								HDX (238545 upstream) : UBE2DNL (193153 downstream)																							aggccagtatgttttttttttt	0.000													4	2	---	---	---	---	
