Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PUM1	9698	broad.mit.edu	37	1	31440057	31440057	+	Silent	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31440057T>C	uc001bsi.1	-	12	1859	c.1746A>G	c.(1744-1746)GTA>GTG	p.V582V	PUM1_uc001bsf.1_Silent_p.V248V|PUM1_uc001bsg.1_Silent_p.V395V|PUM1_uc001bsh.1_Silent_p.V582V|PUM1_uc001bsj.1_Silent_p.V583V|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Silent_p.V618V|PUM1_uc010ogb.1_Silent_p.V523V	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	582	Ala-rich.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GGGCAGGAGCTACAAGTCGAA	0.527													5	73	---	---	---	---	PASS
C1orf122	127687	broad.mit.edu	37	1	38274767	38274767	+	3'UTR	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38274767T>C	uc001ccd.2	+	3					YRDC_uc001cca.1_5'Flank|C1orf122_uc001ccb.1_Silent_p.P147P|C1orf122_uc010oii.1_3'UTR	NM_198446	NP_940848	Q6ZSJ8	CA122_HUMAN	hypothetical protein LOC127687 isoform 1												0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0393)				CAGAATACCCTGACTTCTCTC	0.637													12	10	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	98164907	98164907	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98164907C>T	uc001drv.2	-	6	817	c.680G>A	c.(679-681)AGT>AAT	p.S227N	DPYD_uc010oub.1_RNA	NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	227					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	TAGGCATTACCTTAAACCACC	0.363													89	101	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145293274	145293274	+	5'Flank	SNP	T	G	G	rs4525095	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145293274T>G	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Splice_Site|NOTCH2NL_uc010oyh.1_Intron|NBPF10_uc001emq.1_5'UTR	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CAACAGTAAGTTAAGAATTTC	0.428													5	93	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004487	148004487	+	3'UTR	SNP	T	A	A	rs138320683	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004487T>A	uc001eqq.2	-	22					LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_3'UTR|NBPF14_uc010pac.1_3'UTR	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832							cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					TTCATTCAAATCTTCACGTGC	0.498													6	53	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152323999	152323999	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152323999C>G	uc001ezw.3	-	3	6336	c.6263G>C	c.(6262-6264)GGA>GCA	p.G2088A	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	2088							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGGACTGTCCATGACCAGA	0.522													239	239	---	---	---	---	PASS
CACYBP	27101	broad.mit.edu	37	1	174973977	174973977	+	Intron	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174973977T>C	uc001gkj.1	+						CACYBP_uc001gki.1_Intron|CACYBP_uc010pmw.1_Silent_p.T81T	NM_014412	NP_055227	Q9HB71	CYBP_HUMAN	calcyclin binding protein isoform 1							beta-catenin destruction complex	protein homodimerization activity				0						ATGGTATGACTTGCTTCCCTA	0.423													39	42	---	---	---	---	PASS
C1orf25	81627	broad.mit.edu	37	1	185089094	185089094	+	3'UTR	SNP	T	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185089094T>G	uc001grf.3	-	15					C1orf25_uc010pon.1_3'UTR	NM_030934	NP_112196	Q7Z2T5	TRM1L_HUMAN	N2,N2-dimethylguanosine tRNA							intracellular	RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding				0						CTACAGTTGGTATAGAGAACT	0.368													31	39	---	---	---	---	PASS
CFHR2	3080	broad.mit.edu	37	1	196927137	196927137	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196927137C>A	uc001gtq.1	+	4	624	c.547C>A	c.(547-549)CAA>AAA	p.Q183K	CFHR2_uc001gtr.1_Missense_Mutation_p.Q59K	NM_005666	NP_005657	P36980	FHR2_HUMAN	H factor (complement)-like 3 precursor	183	Sushi 3.					extracellular region				skin(2)|ovary(1)	3						GAACTTGTATCAACTTGAGGG	0.408													85	321	---	---	---	---	PASS
CD55	1604	broad.mit.edu	37	1	207495818	207495818	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207495818A>C	uc001hfq.3	+	2	486	c.192A>C	c.(190-192)AAA>AAC	p.K64N	CD55_uc001hfp.3_Missense_Mutation_p.K64N|CD55_uc001hfr.3_Missense_Mutation_p.K64N|CD55_uc010psf.1_RNA|CD55_uc009xcf.2_Missense_Mutation_p.K64N|CD55_uc009xce.2_Missense_Mutation_p.K64N	NM_000574	NP_000565	P08174	DAF_HUMAN	decay accelerating factor for complement isoform	64	Sushi 1.				complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)	TAACGTACAAATGTGAAGAAA	0.468													42	112	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15415713	15415713	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15415713C>T	uc002rcc.1	-	44	5645	c.5619G>A	c.(5617-5619)TGG>TGA	p.W1873*	NBAS_uc010exl.1_Nonsense_Mutation_p.W945*|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1873										ovary(2)|liver(1)|skin(1)	4						AGGCATGAAGCCACTCCGGTG	0.478													6	151	---	---	---	---	PASS
RGPD1	400966	broad.mit.edu	37	2	88056472	88056472	+	3'UTR	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88056472T>C	uc010fhc.1	-	23					PLGLB2_uc002ssl.2_3'UTR	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						TTTCCTTTCATCTTTGTGTTC	0.264													46	195	---	---	---	---	PASS
CFLAR	8837	broad.mit.edu	37	2	201997707	201997707	+	Intron	SNP	A	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201997707A>T	uc002uxb.3	+						CFLAR_uc002uwy.2_Intron|CFLAR_uc002uwz.2_Intron|CFLAR_uc002uxa.3_Intron|CFLAR_uc010zhk.1_Intron|CFLAR_uc002uxc.3_Intron|CFLAR_uc010zhl.1_Intron|CFLAR_uc010fsw.1_Intron|CFLAR_uc002uxd.3_Intron|CFLAR_uc002uxe.2_Intron|CFLAR_uc002uxf.2_Intron|CFLAR_uc010fsy.2_Intron|CFLAR_uc010fsx.2_Intron|CFLAR_uc010zhm.1_5'UTR|CFLAR_uc010fsz.2_5'Flank	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0						GAGTTGTCTTAGGACTGATGT	0.428													97	168	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191489	10191489	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191489G>C	uc003bvc.2	+	3	695	c.482G>C	c.(481-483)CGA>CCA	p.R161P	VHL_uc003bvd.2_Missense_Mutation_p.R120P	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	161	Interaction with Elongin BC complex.		R -> P (in pheochromocytoma and VHLD; type I).|R -> Q (in pheochromocytoma and VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.R161*(10)|p.R161P(3)|p.R161del(1)|p.R161fs*13(1)|p.R161fs*12(1)|p.E160fs*9(1)|p.C162fs*12(1)|p.?fs(1)|p.C162fs*9(1)|p.L158fs*6(1)|p.R161Q(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CTGAAAGAGCGATGCCTCCAG	0.502		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				53	27	---	---	---	---	PASS
SYNPR	132204	broad.mit.edu	37	3	63594923	63594923	+	Silent	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63594923T>C	uc003dlq.2	+	4	840	c.471T>C	c.(469-471)GCT>GCC	p.A157A	SYNPR_uc003dlp.2_Silent_p.A177A|SYNPR_uc011bfk.1_RNA|SYNPR_uc011bfl.1_RNA|SYNPR_uc010hnt.2_Silent_p.A166A|SYNPR_uc011bfm.1_RNA	NM_144642	NP_653243	Q8TBG9	SYNPR_HUMAN	synaptoporin isoform 2	157	MARVEL.|Vesicular (Potential).					cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		TAATGTCAGCTTGCAAACAGC	0.433													6	291	---	---	---	---	PASS
MITF	4286	broad.mit.edu	37	3	69987112	69987112	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69987112G>A	uc003dnz.2	+	3	610	c.494G>A	c.(493-495)GGC>GAC	p.G165D	MITF_uc011bgb.1_Missense_Mutation_p.G113D|MITF_uc003doa.2_Missense_Mutation_p.G164D|MITF_uc003dob.2_Missense_Mutation_p.G149D|MITF_uc003dod.2_Missense_Mutation_p.G140D|MITF_uc003doe.2_Missense_Mutation_p.G58D|MITF_uc003dof.2_Missense_Mutation_p.G58D	NM_198159	NP_937802	O75030	MITF_HUMAN	microphthalmia-associated transcription factor	165					melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			ovary(2)	2		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		AACCAGCCTGGCGATCATGTC	0.522			A		melanoma 		Waardenburg syndrome type 2|Tietz syndrome						19	10	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97851659	97851659	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97851659A>T	uc011bgt.1	+	1	118	c.118A>T	c.(118-120)ATG>TTG	p.M40L		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	40	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						CATCACCATCATGGGGAATCT	0.413													5	114	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97851661	97851661	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97851661G>T	uc011bgt.1	+	1	120	c.120G>T	c.(118-120)ATG>ATT	p.M40I		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	40	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						TCACCATCATGGGGAATCTTG	0.413													5	116	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121186462	121186462	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121186462C>T	uc003eee.3	-	24	7000	c.6871G>A	c.(6871-6873)GTG>ATG	p.V2291M	POLQ_uc003eed.2_Missense_Mutation_p.V1463M	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	2291					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		CTAGGATTCACGCTGAAACCC	0.428								DNA_polymerases_(catalytic_subunits)					4	154	---	---	---	---	PASS
HLTF	6596	broad.mit.edu	37	3	148759393	148759393	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148759393A>G	uc003ewq.1	-	20	2478	c.2260T>C	c.(2260-2262)TCA>CCA	p.S754P	HLTF_uc003ewr.1_Missense_Mutation_p.S754P|HLTF_uc003ews.1_Missense_Mutation_p.S753P|HLTF_uc010hve.1_Missense_Mutation_p.S753P	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	754					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TCTGAACCTGAGCTCAGAATT	0.363													6	264	---	---	---	---	PASS
SERPINI1	5274	broad.mit.edu	37	3	167540830	167540830	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167540830G>A	uc003ffa.3	+	7	1234	c.1036G>A	c.(1036-1038)GAA>AAA	p.E346K	SERPINI1_uc003ffb.3_Missense_Mutation_p.E346K	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	346					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						AGAGGTTAATGAAGAAGGCTC	0.373													35	208	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505855	195505855	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505855G>T	uc011bto.1	-	3	12672	c.12212C>A	c.(12211-12213)TCC>TAC	p.S4071Y	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAGTGTCGGT	0.597													8	73	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505872	195505872	+	Silent	SNP	A	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505872A>C	uc011bto.1	-	3	12655	c.12195T>G	c.(12193-12195)CTT>CTG	p.L4065L	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGTGACAGGAAGAGGGGTGG	0.602													6	57	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505874	195505874	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505874G>C	uc011bto.1	-	3	12653	c.12193C>G	c.(12193-12195)CTT>GTT	p.L4065V	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGTG	0.602													7	55	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41176625	41176625	+	Missense_Mutation	SNP	C	T	T	rs143839537		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41176625C>T	uc003jmk.2	-	8	1330	c.1120G>A	c.(1120-1122)GTG>ATG	p.V374M	C6_uc003jml.1_Missense_Mutation_p.V374M	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	374	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				AGGTCATACACGCCTCCCAGG	0.433													4	165	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70840940	70840940	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70840940G>T	uc003kbp.1	+	32	6901	c.6638G>T	c.(6637-6639)GGG>GTG	p.G2213V	BDP1_uc003kbo.2_Missense_Mutation_p.G2213V|BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2213					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TCTGAGACAGGGCCCTGCACA	0.468													18	266	---	---	---	---	PASS
DIAPH1	1729	broad.mit.edu	37	5	140907203	140907203	+	Silent	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140907203T>C	uc003llb.3	-	25	3351	c.3210A>G	c.(3208-3210)GAA>GAG	p.E1070E	DIAPH1_uc011dbd.1_5'Flank|DIAPH1_uc003llc.3_Silent_p.E1061E|DIAPH1_uc010jgc.1_Silent_p.E506E	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1	1070	Potential.|FH2.				regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACATCACGTTCCACATCAG	0.343													6	284	---	---	---	---	PASS
ABLIM3	22885	broad.mit.edu	37	5	148563015	148563015	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148563015T>C	uc003lpy.2	+	3	265	c.14T>C	c.(13-15)ATT>ACT	p.I5T	ABLIM3_uc003lpz.1_Missense_Mutation_p.I5T|ABLIM3_uc003lqa.1_5'UTR|ABLIM3_uc003lqb.2_Missense_Mutation_p.I5T|ABLIM3_uc003lqc.1_Missense_Mutation_p.I5T|ABLIM3_uc003lqd.1_Missense_Mutation_p.I5T|ABLIM3_uc003lqf.2_Missense_Mutation_p.I5T|ABLIM3_uc003lqe.1_Missense_Mutation_p.I5T	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	5					axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTTTACAGTTCCTTATCAG	0.468													5	225	---	---	---	---	PASS
TRIM41	90933	broad.mit.edu	37	5	180651556	180651556	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180651556G>C	uc003mne.1	+	1	1251	c.557G>C	c.(556-558)TGC>TCC	p.C186S	uc003mnb.1_Silent_p.G112G|TRIM41_uc003mnc.1_Missense_Mutation_p.C186S|TRIM41_uc003mnd.1_Missense_Mutation_p.C186S|TRIM41_uc003mnf.1_RNA	NM_033549	NP_291027	Q8WV44	TRI41_HUMAN	tripartite motif-containing 41 isoform 1	186						cytoplasm|nucleus	ligase activity|protein binding|zinc ion binding				0	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCCCTCAGTGCCGAAAGAGC	0.537													7	17	---	---	---	---	PASS
DLK2	65989	broad.mit.edu	37	6	43418521	43418521	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43418521C>A	uc003ova.2	-	6	1117	c.908G>T	c.(907-909)GGT>GTT	p.G303V	DLK2_uc003ovb.2_Missense_Mutation_p.G303V	NM_023932	NP_076421	Q6UY11	DLK2_HUMAN	EGF-like-domain, multiple 9 precursor	303	Extracellular (Potential).					integral to membrane	calcium ion binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GCTAGGCTCACCTAGCCCAGC	0.672													6	9	---	---	---	---	PASS
POLR1C	9533	broad.mit.edu	37	6	43487172	43487172	+	Silent	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43487172A>G	uc003ovn.2	+	3	300	c.243A>G	c.(241-243)CTA>CTG	p.L81L	YIPF3_uc003ovl.1_5'Flank|YIPF3_uc011dvk.1_5'Flank|YIPF3_uc010jyr.1_5'Flank|YIPF3_uc010jys.1_5'Flank|YIPF3_uc003ovm.1_5'Flank|YIPF3_uc010jyt.1_5'Flank|POLR1C_uc003ovo.1_Silent_p.L81L	NM_203290	NP_976035	O15160	RPAC1_HUMAN	RNA polymerase I subunit isoform 1	81					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity				0	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GAATTCTGCTAGCTGAGGTAT	0.483													6	108	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46658611	46658611	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46658611A>C	uc003oyj.2	+	1	2746	c.2746A>C	c.(2746-2748)AAA>CAA	p.K916Q	TDRD6_uc010jze.2_Missense_Mutation_p.K910Q	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	916					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			TGCATGGCAAAAAAATCTAGA	0.338													9	26	---	---	---	---	PASS
HACE1	57531	broad.mit.edu	37	6	105298826	105298826	+	Silent	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105298826A>G	uc003pqu.1	-	3	454	c.177T>C	c.(175-177)TAT>TAC	p.Y59Y	HACE1_uc010kcy.1_5'UTR|HACE1_uc010kcz.1_Silent_p.Y59Y	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3	59					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		GTCCGAATGCATAATTGACAT	0.318													38	82	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133072355	133072355	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133072355C>T	uc003qdt.2	-	5	1140	c.1129G>A	c.(1129-1131)GAA>AAA	p.E377K	VNN2_uc003qds.2_Missense_Mutation_p.E86K|VNN2_uc010kgb.2_Intron|VNN2_uc003qdv.2_Missense_Mutation_p.E324K	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	377					cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		TCATTCTCTTCTTTTTGTAAC	0.393													4	223	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134495196	134495196	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134495196T>C	uc003qen.3	-	3	264	c.175A>G	c.(175-177)AAG>GAG	p.K59E	SGK1_uc003qeo.3_Missense_Mutation_p.K154E|SGK1_uc011ect.1_Missense_Mutation_p.K49E|SGK1_uc011ecu.1_Missense_Mutation_p.K59E|SGK1_uc011ecv.1_Missense_Mutation_p.K73E|SGK1_uc011ecw.1_Missense_Mutation_p.K87E	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	59	Necessary for localization to the cytoplasm.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TGGGAGATCTTCAAGATGGAC	0.498													47	112	---	---	---	---	PASS
IYD	389434	broad.mit.edu	37	6	150715251	150715251	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150715251G>C	uc003qnu.1	+	4	687	c.547G>C	c.(547-549)GAG>CAG	p.E183Q	IYD_uc003qnv.1_Missense_Mutation_p.E183Q|IYD_uc003qnw.1_RNA|IYD_uc003qnx.1_Missense_Mutation_p.E183Q|IYD_uc010kik.1_Missense_Mutation_p.E101Q	NM_203395	NP_981932	Q6PHW0	IYD1_HUMAN	iodotyrosine dehalogenase 1 isoform 2	183	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	integral to membrane|plasma membrane				ovary(2)	2		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		CTGGATTAAAGAGTACTTGGA	0.343													26	68	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38398653	38398653	+	Intron	SNP	C	T	T	rs75695637	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38398653C>T	uc003tgp.1	+						uc003tgr.2_5'UTR					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		AAAACTCAGGCCCCACTCAAC	0.537													9	50	---	---	---	---	PASS
POLR2J4	84820	broad.mit.edu	37	7	44026251	44026251	+	Missense_Mutation	SNP	T	C	C	rs75823018		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44026251T>C	uc010kxw.2	-	6	665	c.544A>G	c.(544-546)AAA>GAA	p.K182E	POLR2J4_uc003tjc.2_RNA|POLR2J4_uc003tjd.2_Intron					SubName: Full=cDNA FLJ58900, weakly similar to Uroplakin-3B;												0						ACGGGTCCTTTGTCATTCATC	0.602													4	46	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51096089	51096089	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51096089C>G	uc003tpr.3	-	10	2889	c.2704G>C	c.(2704-2706)GTG>CTG	p.V902L	COBL_uc003tps.2_Missense_Mutation_p.V959L|COBL_uc011kcl.1_Missense_Mutation_p.V902L|COBL_uc003tpp.3_Missense_Mutation_p.V688L|COBL_uc003tpq.3_Missense_Mutation_p.V843L|COBL_uc003tpo.3_Missense_Mutation_p.V444L	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	902										skin(3)|ovary(2)	5	Glioma(55;0.08)					GCAGCCAGCACTGGCGCCTTG	0.582													14	31	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128484128	128484128	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128484128T>G	uc003vnz.3	+	20	3209	c.3000T>G	c.(2998-3000)GAT>GAG	p.D1000E	FLNC_uc003voa.3_Missense_Mutation_p.D1000E	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1000	Filamin 8.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GCCAACTGGATGTGCGGATGA	0.652													7	6	---	---	---	---	PASS
ASH2L	9070	broad.mit.edu	37	8	37974168	37974168	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37974168G>T	uc003xkt.3	+	8	836	c.778G>T	c.(778-780)GAC>TAC	p.D260Y	ASH2L_uc011lbk.1_Missense_Mutation_p.D121Y|ASH2L_uc003xku.3_Missense_Mutation_p.D166Y|ASH2L_uc010lwa.2_Missense_Mutation_p.D166Y	NM_004674	NP_004665	Q9UBL3	ASH2L_HUMAN	ash2-like isoform a	260					hemopoiesis|histone H3-K4 methylation|positive regulation of cell proliferation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription from RNA polymerase II promoter	Set1C/COMPASS complex	metal ion binding|protein binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				ATTTTTGCAGGACCTTAGTAA	0.358													59	176	---	---	---	---	PASS
LYPLA1	10434	broad.mit.edu	37	8	54978369	54978369	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54978369C>T	uc003xry.2	-	3	300	c.106G>A	c.(106-108)GGA>AGA	p.G36R	LYPLA1_uc011ldx.1_Missense_Mutation_p.G31R|LYPLA1_uc003xrz.2_Missense_Mutation_p.G31R	NM_006330	NP_006321	O75608	LYPA1_HUMAN	lysophospholipase 1	36					fatty acid metabolic process|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytosol	lysophospholipase activity|palmitoyl-(protein) hydrolase activity			central_nervous_system(1)	1		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;8.48e-07)|Epithelial(17;9.29e-05)|all cancers(17;0.000689)			TCTGCCCATCCGTGCCTGGTG	0.383													106	109	---	---	---	---	PASS
STAU2	27067	broad.mit.edu	37	8	74527933	74527933	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74527933G>C	uc003xzm.2	-	8	891	c.655C>G	c.(655-657)CGA>GGA	p.R219G	STAU2_uc011lfg.1_Missense_Mutation_p.R47G|STAU2_uc003xzn.2_Missense_Mutation_p.R187G|STAU2_uc011lfh.1_Missense_Mutation_p.R115G|STAU2_uc003xzo.2_Missense_Mutation_p.R219G|STAU2_uc003xzp.2_Missense_Mutation_p.R187G|STAU2_uc011lfi.1_Missense_Mutation_p.R181G|STAU2_uc003xzq.2_5'UTR|STAU2_uc010lzk.2_Missense_Mutation_p.R187G|STAU2_uc010lzl.1_Missense_Mutation_p.R47G	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e	219	DRBM 3.				transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			GGCATATTTCGCTTCAGAGCA	0.358													40	204	---	---	---	---	PASS
STAU2	27067	broad.mit.edu	37	8	74527934	74527934	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74527934C>A	uc003xzm.2	-	8	890	c.654G>T	c.(652-654)AAG>AAT	p.K218N	STAU2_uc011lfg.1_Missense_Mutation_p.K46N|STAU2_uc003xzn.2_Missense_Mutation_p.K186N|STAU2_uc011lfh.1_Missense_Mutation_p.K114N|STAU2_uc003xzo.2_Missense_Mutation_p.K218N|STAU2_uc003xzp.2_Missense_Mutation_p.K186N|STAU2_uc011lfi.1_Missense_Mutation_p.K180N|STAU2_uc003xzq.2_5'UTR|STAU2_uc010lzk.2_Missense_Mutation_p.K186N|STAU2_uc010lzl.1_Missense_Mutation_p.K46N	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e	218	DRBM 3.				transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			GCATATTTCGCTTCAGAGCAA	0.353													44	208	---	---	---	---	PASS
TLN1	7094	broad.mit.edu	37	9	35724673	35724673	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35724673T>C	uc003zxt.2	-	5	761	c.407A>G	c.(406-408)GAG>GGG	p.E136G	TLN1_uc003zxu.3_Missense_Mutation_p.E136G	NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	136	FERM.				axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTCCTTTTTCTCTTCCATCAG	0.423													7	434	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84531866	84531866	+	3'UTR	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84531866T>C	uc011lst.1	+	4					uc004ame.2_5'Flank	NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						AGGCACGGTCTCTTATGCCAT	0.453													6	219	---	---	---	---	PASS
CHST15	51363	broad.mit.edu	37	10	125771989	125771989	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125771989A>G	uc001lhl.2	-	6	1868	c.1355T>C	c.(1354-1356)CTC>CCC	p.L452P	CHST15_uc001lhm.2_Missense_Mutation_p.L452P|CHST15_uc001lhn.2_Missense_Mutation_p.L452P	NM_015892	NP_056976	Q7LFX5	CHSTF_HUMAN	B cell RAG associated protein	452	Lumenal (Potential).				hexose biosynthetic process	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity			ovary(1)	1						CCCAACCTGGAGCCTCACCTA	0.498													4	79	---	---	---	---	PASS
IFITM2	10581	broad.mit.edu	37	11	308415	308415	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:308415A>C	uc001lox.3	+	1	309	c.223A>C	c.(223-225)ATA>CTA	p.I75L		NM_006435	NP_006426	Q01629	IFM2_HUMAN	interferon induced transmembrane protein 2	75	Helical; (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCTGGGCTTCATAGCATTCGC	0.627													10	13	---	---	---	---	PASS
IFITM3	10410	broad.mit.edu	37	11	320588	320588	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:320588T>G	uc001lpa.2	-	1	327	c.226A>C	c.(226-228)ATA>CTA	p.I76L	uc001loz.2_Intron	NM_021034	NP_066362	Q01628	IFM3_HUMAN	interferon-induced transmembrane protein 3	76	Interaction with SPP1.|Helical; (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane				central_nervous_system(7)	7		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCGAATGCTATGAAGCCCAGG	0.627													5	34	---	---	---	---	PASS
TMX2	51075	broad.mit.edu	37	11	57505101	57505101	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57505101T>C	uc001nlc.1	+	2	260	c.211T>C	c.(211-213)TTT>CTT	p.F71L	CTNND1_uc001nlf.1_5'UTR|TMX2_uc001nld.1_5'UTR|TMX2_uc001nle.1_Missense_Mutation_p.F71L	NM_015959	NP_057043	Q9Y320	TMX2_HUMAN	thioredoxin domain containing 14 isoform 1	71	Extracellular (Potential).				cell redox homeostasis	integral to membrane					0						GATCCTGATGTTTCTCAGTGC	0.418													8	384	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92086153	92086153	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92086153A>G	uc001pdj.3	+	1	892	c.875A>G	c.(874-876)GAT>GGT	p.D292G		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	292	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GACTTAGATGATGGAGCGAAT	0.433										TCGA Ovarian(4;0.039)			5	269	---	---	---	---	PASS
PTPRQ	374462	broad.mit.edu	37	12	80890073	80890073	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80890073G>A	uc001sze.2	+	11	2035	c.2035G>A	c.(2035-2037)GCA>ACA	p.A679T		NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						TGATGTTACCGCAGATGAAAT	0.343													14	42	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105582196	105582196	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105582196G>A	uc001tlf.1	-	17	1707	c.1489C>T	c.(1489-1491)CGG>TGG	p.R497W	APPL2_uc010swt.1_Missense_Mutation_p.R454W|APPL2_uc001tlg.1_Missense_Mutation_p.R251W|APPL2_uc010swu.1_Missense_Mutation_p.R503W|APPL2_uc009zuq.2_Missense_Mutation_p.R454W	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	497	PID.				cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						CCCAAAAACCGAACTATAAAC	0.423													79	83	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23914058	23914058	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23914058C>G	uc001uon.2	-	10	4546	c.3957G>C	c.(3955-3957)AAG>AAC	p.K1319N	SACS_uc001uoo.2_Missense_Mutation_p.K1172N|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1319					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AACCACAGACCTTAAATAGTT	0.383													61	75	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23914059	23914059	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23914059T>G	uc001uon.2	-	10	4545	c.3956A>C	c.(3955-3957)AAG>ACG	p.K1319T	SACS_uc001uoo.2_Missense_Mutation_p.K1172T|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1319					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ACCACAGACCTTAAATAGTTG	0.388													62	77	---	---	---	---	PASS
FAM124A	220108	broad.mit.edu	37	13	51826047	51826047	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51826047A>T	uc001vfg.1	+	3	675	c.544A>T	c.(544-546)AAC>TAC	p.N182Y	FAM124A_uc001vfe.2_Missense_Mutation_p.N182Y|FAM124A_uc001vff.1_Missense_Mutation_p.N218Y	NM_145019	NP_659456	Q86V42	F124A_HUMAN	hypothetical protein LOC220108	182										central_nervous_system(1)	1		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		TCGCTACGACAACTATGCTGA	0.577													3	9	---	---	---	---	PASS
PELI2	57161	broad.mit.edu	37	14	56645110	56645110	+	Silent	SNP	C	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56645110C>A	uc001xch.2	+	2	421	c.135C>A	c.(133-135)CTC>CTA	p.L45L		NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN	pellino 2	45					innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding			ovary(1)	1						GATTTGCCCTCTACAAGCGGC	0.498													6	115	---	---	---	---	PASS
GOLGA5	9950	broad.mit.edu	37	14	93305910	93305910	+	3'UTR	SNP	T	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93305910T>G	uc001yaz.1	+	13					GOLGA5_uc001yba.1_3'UTR	NM_005113	NP_005104	Q8TBA6	GOGA5_HUMAN	Golgi autoantigen, golgin subfamily a, 5						Golgi organization	cis-Golgi network|integral to membrane	ATP binding|protein homodimerization activity|protein tyrosine kinase activity|Rab GTPase binding			ovary(2)|lung(1)	3		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		CTACAAGCTTTTAACTTTTTA	0.318			T	RET	papillary thyroid								23	25	---	---	---	---	PASS
AKT1	207	broad.mit.edu	37	14	105246482	105246482	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105246482C>T	uc001ypk.2	-	3	672	c.118G>A	c.(118-120)GAG>AAG	p.E40K	INF2_uc010tyi.1_Intron|AKT1_uc001ypl.2_Missense_Mutation_p.E40K|AKT1_uc010axa.2_Missense_Mutation_p.E40K|AKT1_uc001ypm.2_Missense_Mutation_p.E40K|AKT1_uc001ypn.2_Missense_Mutation_p.E40K|AKT1_uc010tyk.1_5'Flank	NM_005163	NP_005154	P31749	AKT1_HUMAN	AKT1 kinase	40	PH.				activation of pro-apoptotic gene products|activation-induced cell death of T cells|endocrine pancreas development|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen biosynthetic process|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|mRNA metabolic process|negative regulation of fatty acid beta-oxidation|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|nitric oxide biosynthetic process|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of blood vessel endothelial cell migration|positive regulation of cell growth|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of establishment of protein localization in plasma membrane|positive regulation of fat cell differentiation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|positive regulation of nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein autophosphorylation|protein import into nucleus, translocation|regulation of neuron projection development|regulation of translation|response to fluid shear stress|response to heat|response to UV-A|T cell costimulation	cytosol|nucleoplasm|plasma membrane	enzyme binding|identical protein binding|nitric-oxide synthase regulator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein serine/threonine kinase activity			breast(86)|urinary_tract(12)|thyroid(10)|lung(7)|endometrium(5)|large_intestine(4)|skin(4)|prostate(3)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|NS(1)	134		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	TGCGGCCGCTCCTTGTAGCCA	0.582		1	Mis		breast|colorectal|ovarian|NSCLC								8	18	---	---	---	---	PASS
GOLGA6D	653643	broad.mit.edu	37	15	75586110	75586110	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75586110C>T	uc010uma.1	+	15	1669	c.1634C>T	c.(1633-1635)ACG>ATG	p.T545M	uc010umd.1_5'Flank	NM_001145224	NP_001138696	P0CG33	GOG6D_HUMAN	golgi autoantigen, golgin subfamily a, 6D	545	Potential.										0						GCGGACGGGACGGAGCAGGTG	0.622													12	41	---	---	---	---	PASS
CLCN7	1186	broad.mit.edu	37	16	1510843	1510843	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1510843C>A	uc002clv.2	-	5	568	c.458G>T	c.(457-459)GGC>GTC	p.G153V	CLCN7_uc002clw.2_Missense_Mutation_p.G129V	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	153	Helical; (By similarity).					integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				GTACTTGAGGCCAGCCAGGTT	0.642													9	10	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53189973	53189973	+	5'UTR	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53189973A>G	uc002ehb.2	+	1					CHD9_uc002egy.2_5'UTR|CHD9_uc002egz.1_5'UTR|CHD9_uc002eha.1_5'UTR|CHD9_uc002ehc.2_5'UTR	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TTTGGAGTGAACAGCCCGGAT	0.358													6	247	---	---	---	---	PASS
TNFAIP1	7126	broad.mit.edu	37	17	26667402	26667402	+	Silent	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26667402C>T	uc002hax.1	+	3	292	c.273C>T	c.(271-273)ACC>ACT	p.T91T	TNFAIP1_uc002hay.2_Silent_p.T91T|TNFAIP1_uc010waf.1_5'UTR	NM_021137	NP_066960	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1	91	BTB.				apoptosis|cell migration|DNA replication|embryo development|immune response|negative regulation of Rho protein signal transduction|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|endosome|nucleus|voltage-gated potassium channel complex	GTP-Rho binding|voltage-gated potassium channel activity				0	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GAGATGACACCATCACCCTCC	0.507													30	116	---	---	---	---	PASS
GGNBP2	79893	broad.mit.edu	37	17	34901611	34901611	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34901611A>G	uc002hnb.2	+	2	287	c.38A>G	c.(37-39)GAG>GGG	p.E13G	GGNBP2_uc002hna.2_Missense_Mutation_p.E13G	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403	13					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GACGGGGAGGAGGAGTTCCCC	0.323													5	5	---	---	---	---	PASS
MEOX1	4222	broad.mit.edu	37	17	41738797	41738797	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41738797G>T	uc002idz.2	-	1	135	c.106C>A	c.(106-108)CCC>ACC	p.P36T	MEOX1_uc002iea.2_Missense_Mutation_p.P36T|MEOX1_uc002ieb.2_Intron	NM_004527	NP_004518	P50221	MEOX1_HUMAN	mesenchyme homeobox 1 isoform 1	36						nucleus	sequence-specific DNA binding				0		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		GGGTAGTGGGGTAGCCCTGAG	0.672													4	15	---	---	---	---	PASS
C17orf64	124773	broad.mit.edu	37	17	58503586	58503586	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58503586C>T	uc002iyq.2	+	3	307	c.218C>T	c.(217-219)CCC>CTC	p.P73L		NM_181707	NP_859058	Q86WR6	CQ064_HUMAN	hypothetical protein LOC124773	73										breast(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			AGGGACCTTCCCCAGAAGAAG	0.522													4	72	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62892204	62892204	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62892204T>A	uc002jey.2	-	3	1703	c.1172A>T	c.(1171-1173)GAA>GTA	p.E391V	LRRC37A3_uc010wqg.1_Intron|LRRC37A3_uc010wqf.1_Intron	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	391	Extracellular (Potential).					integral to membrane					0						AACTGTGACTTCATGATGTTC	0.537													4	5	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9070657	9070657	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9070657C>T	uc002mkp.2	-	3	16993	c.16789G>A	c.(16789-16791)GTG>ATG	p.V5597M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5599	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCCTGAGACACGGTTGAATGA	0.532													73	83	---	---	---	---	PASS
ELOF1	84337	broad.mit.edu	37	19	11664531	11664531	+	3'UTR	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11664531G>A	uc002mse.1	-	4					ELOF1_uc002msd.1_3'UTR	NM_032377	NP_115753	P60002	ELOF1_HUMAN	elongation factor 1 homolog (ELF1, S.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding				0						CAGTACGCGGGGCTGCTCAGG	0.567													8	10	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43411873	43411873	+	Silent	SNP	C	T	T	rs138530848	byFrequency	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43411873C>T	uc002ovj.1	-	4	892	c.840G>A	c.(838-840)CCG>CCA	p.P280P	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Silent_p.P287P|PSG6_uc002ovi.2_Silent_p.P281P|PSG6_uc010xwk.1_Silent_p.P120P|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_Silent_p.P70P|PSG6_uc002ovf.1_Intron|PSG6_uc002ovg.1_Silent_p.P280P	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	280	Ig-like C2-type 2.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				TCGGACTGACCGGGAGGCTCT	0.483													5	234	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54756788	54756788	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54756788G>A	uc002qex.2	-	9	1528	c.1417C>T	c.(1417-1419)CTC>TTC	p.L473F	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.L465F|LILRB5_uc002qey.2_Missense_Mutation_p.L474F|LILRB5_uc002qez.2_Missense_Mutation_p.L374F|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	473	Helical; (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		aagaggaggaggaACAGCAGC	0.532													10	51	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37534706	37534706	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37534706A>G	uc002xje.2	+	7	980	c.791A>G	c.(790-792)GAG>GGG	p.E264G	PPP1R16B_uc010ggc.2_Intron	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	264	ANK 4.				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				GATGGCTGGGAGCCCCTGCAT	0.612													6	48	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60888399	60888399	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60888399C>G	uc002ycq.2	-	64	8843	c.8776G>C	c.(8776-8778)GAC>CAC	p.D2926H		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2926	Laminin G-like 1.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAAGGCCTGTCCACAGCCGTG	0.652													6	2	---	---	---	---	PASS
KRTAP20-2	337976	broad.mit.edu	37	21	32007632	32007632	+	Missense_Mutation	SNP	T	G	G	rs8132721		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32007632T>G	uc011adg.1	+	1	50	c.50T>G	c.(49-51)GTC>GGC	p.V17G		NM_181616	NP_853647	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	17						intermediate filament				central_nervous_system(1)	1						GGCTATGGAGTCCTGGGCGGT	0.537													12	144	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47801608	47801608	+	Splice_Site	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47801608G>A	uc002zji.3	+	16	3273	c.3166_splice	c.e16-1	p.G1056_splice	PCNT_uc002zjj.2_Splice_Site_p.G938_splice	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					GATGTGTACAGGGTGAATTTG	0.413													7	211	---	---	---	---	PASS
SUSD2	56241	broad.mit.edu	37	22	24580140	24580140	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24580140A>C	uc002zzn.1	+	4	520	c.476A>C	c.(475-477)GAG>GCG	p.E159A		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	159	Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						GAGAAGAGCGAGTTGGTGAAC	0.617													13	20	---	---	---	---	PASS
FANCB	2187	broad.mit.edu	37	X	14882777	14882777	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14882777C>A	uc004cwg.1	-	3	1124	c.856G>T	c.(856-858)GCA>TCA	p.A286S	FANCB_uc004cwh.1_Missense_Mutation_p.A286S	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN	Fanconi anemia complementation group B	286					DNA repair	nucleoplasm				lung(1)	1	Hepatocellular(33;0.183)					AGTTGAACTGCACAAGGATCT	0.393								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				65	104	---	---	---	---	PASS
TAB3	257397	broad.mit.edu	37	X	30849594	30849594	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30849594G>A	uc004dcj.2	-	11	2752	c.2089C>T	c.(2089-2091)CAC>TAC	p.H697Y	TAB3_uc004dck.2_Missense_Mutation_p.H697Y|TAB3_uc010ngl.2_Missense_Mutation_p.H669Y	NM_152787	NP_690000	Q8N5C8	TAB3_HUMAN	mitogen-activated protein kinase kinase kinase 7	697	RanBP2-type.				activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein binding|zinc ion binding			ovary(1)	1						AGTGCTGGGTGGTTAAGAAAG	0.502													99	115	---	---	---	---	PASS
CXorf38	159013	broad.mit.edu	37	X	40495806	40495806	+	Silent	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40495806T>C	uc004dew.2	-	5	785	c.780A>G	c.(778-780)GAA>GAG	p.E260E	CXorf38_uc011mko.1_Silent_p.E175E|CXorf38_uc004dev.1_Silent_p.E141E|CXorf38_uc010nhd.2_RNA	NM_144970	NP_659407	Q8TB03	CX038_HUMAN	hypothetical protein LOC159013	260										ovary(1)	1						ACACCTCTTGTTCTTCTGCTT	0.383													7	356	---	---	---	---	PASS
NHSL2	340527	broad.mit.edu	37	X	71360504	71360504	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71360504A>G	uc011mqa.1	+	6	3106	c.3106A>G	c.(3106-3108)ATC>GTC	p.I1036V	NHSL2_uc004eak.1_Missense_Mutation_p.I670V|NHSL2_uc010nli.2_Missense_Mutation_p.I805V	NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2	1036											0	Renal(35;0.156)					TCTCAGCCCCATCATCACCCT	0.557													11	16	---	---	---	---	PASS
NAP1L3	4675	broad.mit.edu	37	X	92927545	92927545	+	Silent	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92927545T>C	uc004efq.2	-	1	1064	c.759A>G	c.(757-759)AAA>AAG	p.K253K	FAM133A_uc004efr.1_5'Flank	NM_004538	NP_004529	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	253	Glu-rich.				nucleosome assembly	chromatin assembly complex				ovary(1)|skin(1)	2						GGGGGACTTCTTTAGGATCTT	0.428													83	290	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135441581	135441581	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135441581G>A	uc004ezu.1	+	11	7402	c.7111G>A	c.(7111-7113)GTA>ATA	p.V2371I	GPR112_uc010nsb.1_Missense_Mutation_p.V2166I|GPR112_uc010nsc.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2371	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					GACGTTATTAGTAAACTGTGA	0.338													58	190	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138729056	138729056	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138729056C>T	uc011mwn.1	-	3	293	c.287G>A	c.(286-288)CGG>CAG	p.R96Q	MCF2_uc004faw.2_Missense_Mutation_p.R11Q|MCF2_uc011mwo.1_Missense_Mutation_p.R11Q			P10911	MCF2_HUMAN	SubName: Full=MCF.2 cell line derived transforming sequence;	Error:Variant_position_missing_in_P10911_after_alignment					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					GTCCTTTCCCCGGCCACCTAC	0.338													8	147	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	10594	10594	+	RNA	SNP	T	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:10594T>C	uc004cov.3	+	1		c.17T>C			uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		ATCGCTGTTCATTATAGCTAC	0.448													4	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	11692	11692	+	RNA	SNP	C	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:11692C>T	uc004cov.3	+	1		c.1115C>T			uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		AGCTTCACCGGCGCAGTCATT	0.478													54	7	---	---	---	---	PASS
LIN28A	79727	broad.mit.edu	37	1	26737960	26737960	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26737960C>T	uc001bmj.2	+	2	229	c.115C>T	c.(115-117)CAC>TAC	p.H39Y	LIN28A_uc001bmi.1_RNA	NM_024674	NP_078950	Q9H9Z2	LN28A_HUMAN	lin-28 homolog	39	CSD.				miRNA catabolic process|pre-miRNA processing|regulation of transcription, DNA-dependent|RNA 3'-end processing|stem cell maintenance	cytoplasmic mRNA processing body|nucleolus|stress granule	DNA binding|zinc ion binding			central_nervous_system(1)	1						TCAGCTGCTGCACGGTGCGGG	0.721													23	13	---	---	---	---	PASS
C1orf122	127687	broad.mit.edu	37	1	38274767	38274767	+	3'UTR	SNP	T	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38274767T>C	uc001ccd.2	+	3					YRDC_uc001cca.1_5'Flank|C1orf122_uc001ccb.1_Silent_p.P147P|C1orf122_uc010oii.1_3'UTR	NM_198446	NP_940848	Q6ZSJ8	CA122_HUMAN	hypothetical protein LOC127687 isoform 1												0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0393)				CAGAATACCCTGACTTCTCTC	0.637													61	70	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	98164907	98164907	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98164907C>T	uc001drv.2	-	6	817	c.680G>A	c.(679-681)AGT>AAT	p.S227N	DPYD_uc010oub.1_RNA	NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	227					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	TAGGCATTACCTTAAACCACC	0.363													44	74	---	---	---	---	PASS
HIST2H3D	653604	broad.mit.edu	37	1	149785229	149785229	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149785229C>T	uc010pbl.1	-	1	8	c.8G>A	c.(7-9)CGT>CAT	p.R3H	HIST2H2BF_uc010pbj.1_5'Flank|HIST2H2BF_uc010pbk.1_5'Flank|HIST2H2BF_uc001esr.2_5'Flank	NM_001123375	NP_001116847	Q71DI3	H32_HUMAN	histone cluster 2, H3d	3					blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding|protein binding				0						CTGCTTAGTACGGGCCATGCT	0.572													10	35	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152323999	152323999	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152323999C>G	uc001ezw.3	-	3	6336	c.6263G>C	c.(6262-6264)GGA>GCA	p.G2088A	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	2088							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGGACTGTCCATGACCAGA	0.522													314	326	---	---	---	---	PASS
CACYBP	27101	broad.mit.edu	37	1	174973977	174973977	+	Intron	SNP	T	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174973977T>C	uc001gkj.1	+						CACYBP_uc001gki.1_Intron|CACYBP_uc010pmw.1_Silent_p.T81T	NM_014412	NP_055227	Q9HB71	CYBP_HUMAN	calcyclin binding protein isoform 1							beta-catenin destruction complex	protein homodimerization activity				0						ATGGTATGACTTGCTTCCCTA	0.423													45	41	---	---	---	---	PASS
C1orf25	81627	broad.mit.edu	37	1	185089094	185089094	+	3'UTR	SNP	T	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185089094T>G	uc001grf.3	-	15					C1orf25_uc010pon.1_3'UTR	NM_030934	NP_112196	Q7Z2T5	TRM1L_HUMAN	N2,N2-dimethylguanosine tRNA							intracellular	RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding				0						CTACAGTTGGTATAGAGAACT	0.368													149	114	---	---	---	---	PASS
CFHR2	3080	broad.mit.edu	37	1	196927137	196927137	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196927137C>A	uc001gtq.1	+	4	624	c.547C>A	c.(547-549)CAA>AAA	p.Q183K	CFHR2_uc001gtr.1_Missense_Mutation_p.Q59K	NM_005666	NP_005657	P36980	FHR2_HUMAN	H factor (complement)-like 3 precursor	183	Sushi 3.					extracellular region				skin(2)|ovary(1)	3						GAACTTGTATCAACTTGAGGG	0.408													62	170	---	---	---	---	PASS
CD55	1604	broad.mit.edu	37	1	207495818	207495818	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207495818A>C	uc001hfq.3	+	2	486	c.192A>C	c.(190-192)AAA>AAC	p.K64N	CD55_uc001hfp.3_Missense_Mutation_p.K64N|CD55_uc001hfr.3_Missense_Mutation_p.K64N|CD55_uc010psf.1_RNA|CD55_uc009xcf.2_Missense_Mutation_p.K64N|CD55_uc009xce.2_Missense_Mutation_p.K64N	NM_000574	NP_000565	P08174	DAF_HUMAN	decay accelerating factor for complement isoform	64	Sushi 1.				complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)	TAACGTACAAATGTGAAGAAA	0.468													41	114	---	---	---	---	PASS
KCNF1	3754	broad.mit.edu	37	2	11053935	11053935	+	Silent	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11053935G>A	uc002rax.2	+	1	1873	c.1383G>A	c.(1381-1383)GCG>GCA	p.A461A		NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F,	461	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		GGAAGGAGGCGCCGAGCTGCA	0.662													16	17	---	---	---	---	PASS
RGPD1	400966	broad.mit.edu	37	2	88056472	88056472	+	3'UTR	SNP	T	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88056472T>C	uc010fhc.1	-	23					PLGLB2_uc002ssl.2_3'UTR	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						TTTCCTTTCATCTTTGTGTTC	0.264													8	18	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96521777	96521777	+	Missense_Mutation	SNP	T	C	C	rs77768218		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96521777T>C	uc002suz.1	-	31	2790	c.1313A>G	c.(1312-1314)CAT>CGT	p.H438R						SubName: Full=Putative uncharacterized protein ENSP00000312008; Flags: Fragment;																		AAGGTCTTCATGCTTTCTTTT	0.383													3	38	---	---	---	---	PASS
ASTL	431705	broad.mit.edu	37	2	96789912	96789912	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96789912G>T	uc010yui.1	-	9	973	c.973C>A	c.(973-975)CCC>ACC	p.P325T		NM_001002036	NP_001002036	Q6HA08	ASTL_HUMAN	astacin-like metalloendopeptidase precursor	325					proteolysis		metalloendopeptidase activity|zinc ion binding				0						GAACCACTGGGGTCGGGGCTC	0.672													26	43	---	---	---	---	PASS
TGFBRAP1	9392	broad.mit.edu	37	2	105886106	105886106	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105886106C>A	uc002tcq.2	-	11	2113	c.2029G>T	c.(2029-2031)GGC>TGC	p.G677C	TGFBRAP1_uc010fjc.2_Missense_Mutation_p.G446C|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.G677C	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	677					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						TCATGCTCGCCCAGCTTCCCG	0.647													12	8	---	---	---	---	PASS
CFLAR	8837	broad.mit.edu	37	2	201997707	201997707	+	Intron	SNP	A	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201997707A>T	uc002uxb.3	+						CFLAR_uc002uwy.2_Intron|CFLAR_uc002uwz.2_Intron|CFLAR_uc002uxa.3_Intron|CFLAR_uc010zhk.1_Intron|CFLAR_uc002uxc.3_Intron|CFLAR_uc010zhl.1_Intron|CFLAR_uc010fsw.1_Intron|CFLAR_uc002uxd.3_Intron|CFLAR_uc002uxe.2_Intron|CFLAR_uc002uxf.2_Intron|CFLAR_uc010fsy.2_Intron|CFLAR_uc010fsx.2_Intron|CFLAR_uc010zhm.1_5'UTR|CFLAR_uc010fsz.2_5'Flank	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0						GAGTTGTCTTAGGACTGATGT	0.428													17	36	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191489	10191489	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191489G>C	uc003bvc.2	+	3	695	c.482G>C	c.(481-483)CGA>CCA	p.R161P	VHL_uc003bvd.2_Missense_Mutation_p.R120P	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	161	Interaction with Elongin BC complex.		R -> P (in pheochromocytoma and VHLD; type I).|R -> Q (in pheochromocytoma and VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.R161*(10)|p.R161P(3)|p.R161del(1)|p.R161fs*13(1)|p.R161fs*12(1)|p.E160fs*9(1)|p.C162fs*12(1)|p.?fs(1)|p.C162fs*9(1)|p.L158fs*6(1)|p.R161Q(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CTGAAAGAGCGATGCCTCCAG	0.502		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				22	15	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65425588	65425588	+	Silent	SNP	C	T	T	rs139785185		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65425588C>T	uc003dmn.2	-	9	1762	c.1236G>A	c.(1234-1236)CAG>CAA	p.Q412Q	MAGI1_uc003dmm.2_Silent_p.Q412Q|MAGI1_uc003dmo.2_Silent_p.Q412Q|MAGI1_uc003dmp.2_Silent_p.Q412Q|MAGI1_uc010hny.2_Silent_p.Q297Q	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	412	Poly-Gln.				cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgctgctgctgttgctgct	0.343											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	1	---	---	---	---	PASS
MITF	4286	broad.mit.edu	37	3	69987112	69987112	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69987112G>A	uc003dnz.2	+	3	610	c.494G>A	c.(493-495)GGC>GAC	p.G165D	MITF_uc011bgb.1_Missense_Mutation_p.G113D|MITF_uc003doa.2_Missense_Mutation_p.G164D|MITF_uc003dob.2_Missense_Mutation_p.G149D|MITF_uc003dod.2_Missense_Mutation_p.G140D|MITF_uc003doe.2_Missense_Mutation_p.G58D|MITF_uc003dof.2_Missense_Mutation_p.G58D	NM_198159	NP_937802	O75030	MITF_HUMAN	microphthalmia-associated transcription factor	165					melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			ovary(2)	2		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		AACCAGCCTGGCGATCATGTC	0.522			A		melanoma 		Waardenburg syndrome type 2|Tietz syndrome						48	23	---	---	---	---	PASS
FAM55C	91775	broad.mit.edu	37	3	101520532	101520532	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101520532G>T	uc003dvn.2	+	5	1184	c.547G>T	c.(547-549)GTA>TTA	p.V183L	FAM55C_uc010hpn.2_Missense_Mutation_p.V183L	NM_145037	NP_659474	Q969Y0	FA55C_HUMAN	hypothetical protein LOC91775 precursor	183						extracellular region				ovary(1)|pancreas(1)|skin(1)	3						CAAAGTTAAAGTATCCGTATC	0.493													5	49	---	---	---	---	PASS
SERPINI1	5274	broad.mit.edu	37	3	167540830	167540830	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167540830G>A	uc003ffa.3	+	7	1234	c.1036G>A	c.(1036-1038)GAA>AAA	p.E346K	SERPINI1_uc003ffb.3_Missense_Mutation_p.E346K	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	346					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						AGAGGTTAATGAAGAAGGCTC	0.373													43	153	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1572397	1572397	+	Intron	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1572397C>T	uc011cmd.1	-						SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0						TTGTCGATTACGGGTCTATAT	0.433													9	114	---	---	---	---	PASS
TRIM41	90933	broad.mit.edu	37	5	180651556	180651556	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180651556G>C	uc003mne.1	+	1	1251	c.557G>C	c.(556-558)TGC>TCC	p.C186S	uc003mnb.1_Silent_p.G112G|TRIM41_uc003mnc.1_Missense_Mutation_p.C186S|TRIM41_uc003mnd.1_Missense_Mutation_p.C186S|TRIM41_uc003mnf.1_RNA	NM_033549	NP_291027	Q8WV44	TRI41_HUMAN	tripartite motif-containing 41 isoform 1	186						cytoplasm|nucleus	ligase activity|protein binding|zinc ion binding				0	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCCCTCAGTGCCGAAAGAGC	0.537													18	32	---	---	---	---	PASS
DLK2	65989	broad.mit.edu	37	6	43418521	43418521	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43418521C>A	uc003ova.2	-	6	1117	c.908G>T	c.(907-909)GGT>GTT	p.G303V	DLK2_uc003ovb.2_Missense_Mutation_p.G303V	NM_023932	NP_076421	Q6UY11	DLK2_HUMAN	EGF-like-domain, multiple 9 precursor	303	Extracellular (Potential).					integral to membrane	calcium ion binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GCTAGGCTCACCTAGCCCAGC	0.672													24	32	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46658611	46658611	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46658611A>C	uc003oyj.2	+	1	2746	c.2746A>C	c.(2746-2748)AAA>CAA	p.K916Q	TDRD6_uc010jze.2_Missense_Mutation_p.K910Q	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	916					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			TGCATGGCAAAAAAATCTAGA	0.338													47	104	---	---	---	---	PASS
HACE1	57531	broad.mit.edu	37	6	105298826	105298826	+	Silent	SNP	A	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105298826A>G	uc003pqu.1	-	3	454	c.177T>C	c.(175-177)TAT>TAC	p.Y59Y	HACE1_uc010kcy.1_5'UTR|HACE1_uc010kcz.1_Silent_p.Y59Y	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3	59					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		GTCCGAATGCATAATTGACAT	0.318													94	179	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129691082	129691082	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129691082G>A	uc003qbn.2	+	34	5011	c.4906G>A	c.(4906-4908)GCA>ACA	p.A1636T	LAMA2_uc003qbo.2_Missense_Mutation_p.A1636T	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1636	Domain II and I.|Potential.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TATTCAGCTGGCAGAGGGCAA	0.453													4	66	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134495196	134495196	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134495196T>C	uc003qen.3	-	3	264	c.175A>G	c.(175-177)AAG>GAG	p.K59E	SGK1_uc003qeo.3_Missense_Mutation_p.K154E|SGK1_uc011ect.1_Missense_Mutation_p.K49E|SGK1_uc011ecu.1_Missense_Mutation_p.K59E|SGK1_uc011ecv.1_Missense_Mutation_p.K73E|SGK1_uc011ecw.1_Missense_Mutation_p.K87E	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	59	Necessary for localization to the cytoplasm.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TGGGAGATCTTCAAGATGGAC	0.498													35	85	---	---	---	---	PASS
IYD	389434	broad.mit.edu	37	6	150715251	150715251	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150715251G>C	uc003qnu.1	+	4	687	c.547G>C	c.(547-549)GAG>CAG	p.E183Q	IYD_uc003qnv.1_Missense_Mutation_p.E183Q|IYD_uc003qnw.1_RNA|IYD_uc003qnx.1_Missense_Mutation_p.E183Q|IYD_uc010kik.1_Missense_Mutation_p.E101Q	NM_203395	NP_981932	Q6PHW0	IYD1_HUMAN	iodotyrosine dehalogenase 1 isoform 2	183	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	integral to membrane|plasma membrane				ovary(2)	2		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		CTGGATTAAAGAGTACTTGGA	0.343													25	85	---	---	---	---	PASS
DPY19L2P1	554236	broad.mit.edu	37	7	35189821	35189821	+	5'UTR	SNP	A	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35189821A>G	uc003teq.1	-	7					DPY19L2P1_uc003tep.1_5'Flank|DPY19L2P1_uc010kwz.1_RNA					RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						GCTTTCTAGAAAACAAACCTC	0.308													3	40	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51096089	51096089	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51096089C>G	uc003tpr.3	-	10	2889	c.2704G>C	c.(2704-2706)GTG>CTG	p.V902L	COBL_uc003tps.2_Missense_Mutation_p.V959L|COBL_uc011kcl.1_Missense_Mutation_p.V902L|COBL_uc003tpp.3_Missense_Mutation_p.V688L|COBL_uc003tpq.3_Missense_Mutation_p.V843L|COBL_uc003tpo.3_Missense_Mutation_p.V444L	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	902										skin(3)|ovary(2)	5	Glioma(55;0.08)					GCAGCCAGCACTGGCGCCTTG	0.582													40	50	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128484128	128484128	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128484128T>G	uc003vnz.3	+	20	3209	c.3000T>G	c.(2998-3000)GAT>GAG	p.D1000E	FLNC_uc003voa.3_Missense_Mutation_p.D1000E	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1000	Filamin 8.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GCCAACTGGATGTGCGGATGA	0.652													22	24	---	---	---	---	PASS
TRY6	154754	broad.mit.edu	37	7	142481271	142481271	+	Silent	SNP	A	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142481271A>C	uc011ksq.1	+	3	428	c.345A>C	c.(343-345)ACA>ACC	p.T115T	uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_Intron|TRY6_uc011ksr.1_RNA	NR_001296				SubName: Full=Protease, serine, 3; Flags: Fragment;												0						AGCTCTCCACACCTGCCGTCA	0.537													4	26	---	---	---	---	PASS
MTUS1	57509	broad.mit.edu	37	8	17612078	17612078	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17612078C>T	uc003wxv.2	-	2	1713	c.1239G>A	c.(1237-1239)TGG>TGA	p.W413*	MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Nonsense_Mutation_p.W413*|MTUS1_uc010lsz.2_Nonsense_Mutation_p.W413*	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	413						Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		CATTTGCATCCCAAGTCAGTC	0.438													7	142	---	---	---	---	PASS
ASH2L	9070	broad.mit.edu	37	8	37974168	37974168	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37974168G>T	uc003xkt.3	+	8	836	c.778G>T	c.(778-780)GAC>TAC	p.D260Y	ASH2L_uc011lbk.1_Missense_Mutation_p.D121Y|ASH2L_uc003xku.3_Missense_Mutation_p.D166Y|ASH2L_uc010lwa.2_Missense_Mutation_p.D166Y	NM_004674	NP_004665	Q9UBL3	ASH2L_HUMAN	ash2-like isoform a	260					hemopoiesis|histone H3-K4 methylation|positive regulation of cell proliferation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription from RNA polymerase II promoter	Set1C/COMPASS complex	metal ion binding|protein binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				ATTTTTGCAGGACCTTAGTAA	0.358													35	85	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38034599	38034599	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38034599G>A	uc003xky.1	+	1	494	c.212G>A	c.(211-213)GGC>GAC	p.G71D	LSM1_uc003xkw.2_5'Flank|LSM1_uc003xkx.2_5'Flank|BAG4_uc003xkz.1_Missense_Mutation_p.G71D	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4	71					anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				GGAGGCGATGGCTACTATCCC	0.701													6	14	---	---	---	---	PASS
LYPLA1	10434	broad.mit.edu	37	8	54978369	54978369	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54978369C>T	uc003xry.2	-	3	300	c.106G>A	c.(106-108)GGA>AGA	p.G36R	LYPLA1_uc011ldx.1_Missense_Mutation_p.G31R|LYPLA1_uc003xrz.2_Missense_Mutation_p.G31R	NM_006330	NP_006321	O75608	LYPA1_HUMAN	lysophospholipase 1	36					fatty acid metabolic process|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytosol	lysophospholipase activity|palmitoyl-(protein) hydrolase activity			central_nervous_system(1)	1		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;8.48e-07)|Epithelial(17;9.29e-05)|all cancers(17;0.000689)			TCTGCCCATCCGTGCCTGGTG	0.383													39	34	---	---	---	---	PASS
STAU2	27067	broad.mit.edu	37	8	74527933	74527933	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74527933G>C	uc003xzm.2	-	8	891	c.655C>G	c.(655-657)CGA>GGA	p.R219G	STAU2_uc011lfg.1_Missense_Mutation_p.R47G|STAU2_uc003xzn.2_Missense_Mutation_p.R187G|STAU2_uc011lfh.1_Missense_Mutation_p.R115G|STAU2_uc003xzo.2_Missense_Mutation_p.R219G|STAU2_uc003xzp.2_Missense_Mutation_p.R187G|STAU2_uc011lfi.1_Missense_Mutation_p.R181G|STAU2_uc003xzq.2_5'UTR|STAU2_uc010lzk.2_Missense_Mutation_p.R187G|STAU2_uc010lzl.1_Missense_Mutation_p.R47G	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e	219	DRBM 3.				transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			GGCATATTTCGCTTCAGAGCA	0.358													43	148	---	---	---	---	PASS
STAU2	27067	broad.mit.edu	37	8	74527934	74527934	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74527934C>A	uc003xzm.2	-	8	890	c.654G>T	c.(652-654)AAG>AAT	p.K218N	STAU2_uc011lfg.1_Missense_Mutation_p.K46N|STAU2_uc003xzn.2_Missense_Mutation_p.K186N|STAU2_uc011lfh.1_Missense_Mutation_p.K114N|STAU2_uc003xzo.2_Missense_Mutation_p.K218N|STAU2_uc003xzp.2_Missense_Mutation_p.K186N|STAU2_uc011lfi.1_Missense_Mutation_p.K180N|STAU2_uc003xzq.2_5'UTR|STAU2_uc010lzk.2_Missense_Mutation_p.K186N|STAU2_uc010lzl.1_Missense_Mutation_p.K46N	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e	218	DRBM 3.				transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			GCATATTTCGCTTCAGAGCAA	0.353													43	151	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385545	33385545	+	Intron	SNP	A	T	T	rs114344786	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385545A>T	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CTGGGGGCTCAGCAGGACCCT	0.607													4	16	---	---	---	---	PASS
BSPRY	54836	broad.mit.edu	37	9	116130543	116130543	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116130543G>T	uc004bhg.3	+	5	610	c.562G>T	c.(562-564)GAA>TAA	p.E188*	BSPRY_uc010muw.2_Intron	NM_017688	NP_060158	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	188					calcium ion transport	cytoplasm|membrane	zinc ion binding			breast(1)	1						TATAAGGACCGAAGAAGCAGA	0.458													4	124	---	---	---	---	PASS
ARID5B	84159	broad.mit.edu	37	10	63851145	63851145	+	Silent	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63851145G>A	uc001jlt.1	+	10	1949	c.1923G>A	c.(1921-1923)GCG>GCA	p.A641A		NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	641					liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)					TCCACAATGCGCTCAAGCAGA	0.517													3	42	---	---	---	---	PASS
ADK	132	broad.mit.edu	37	10	75936548	75936548	+	Intron	SNP	A	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75936548A>G	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_5'UTR|ADK_uc010qlc.1_5'UTR	NM_006721	NP_006712	P55263	ADK_HUMAN	adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)	GCCGGGAAGCAGTTGCTGTGG	0.701													3	4	---	---	---	---	PASS
IFITM2	10581	broad.mit.edu	37	11	308415	308415	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:308415A>C	uc001lox.3	+	1	309	c.223A>C	c.(223-225)ATA>CTA	p.I75L		NM_006435	NP_006426	Q01629	IFM2_HUMAN	interferon induced transmembrane protein 2	75	Helical; (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCTGGGCTTCATAGCATTCGC	0.627													28	85	---	---	---	---	PASS
IFITM3	10410	broad.mit.edu	37	11	320588	320588	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:320588T>G	uc001lpa.2	-	1	327	c.226A>C	c.(226-228)ATA>CTA	p.I76L	uc001loz.2_Intron	NM_021034	NP_066362	Q01628	IFM3_HUMAN	interferon-induced transmembrane protein 3	76	Interaction with SPP1.|Helical; (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane				central_nervous_system(7)	7		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCGAATGCTATGAAGCCCAGG	0.627													10	166	---	---	---	---	PASS
ART1	417	broad.mit.edu	37	11	3681532	3681532	+	Silent	SNP	C	T	T	rs139469651		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3681532C>T	uc001lye.1	+	3	884	c.783C>T	c.(781-783)CCC>CCT	p.P261P	ART1_uc009yeb.1_Silent_p.P261P	NM_004314	NP_004305	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1 precursor	261					protein ADP-ribosylation	anchored to membrane|integral to plasma membrane|sarcoplasmic reticulum membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity				0		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)	Becaplermin(DB00102)	CCCAGGGCCCCGCCCGCATCT	0.602													21	86	---	---	---	---	PASS
SSH3	54961	broad.mit.edu	37	11	67079361	67079361	+	3'UTR	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67079361C>T	uc001okj.2	+	14					SSH3_uc001okk.2_RNA|SSH3_uc001okl.2_3'UTR	NM_017857	NP_060327	Q8TE77	SSH3_HUMAN	slingshot homolog 3						regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton|nucleus	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			AGGCCTGAGCCCTCACACATG	0.577													14	21	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9578354	9578354	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9578354A>C	uc010sgs.1	-	16	1783	c.1588T>G	c.(1588-1590)TTT>GTT	p.F530V		NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						AATTGCTGAAACCCAGCCAGT	0.597													8	20	---	---	---	---	PASS
CLEC1B	51266	broad.mit.edu	37	12	10150903	10150903	+	Silent	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10150903C>T	uc001qwu.2	-	2	341	c.141G>A	c.(139-141)GGG>GGA	p.G47G	CLEC1B_uc009zhd.2_Intron	NM_016509	NP_057593	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B isoform	47	Helical; Signal-anchor for type II membrane protein; (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity				0						GAGCCACCAGCCCGACAACCA	0.502													4	130	---	---	---	---	PASS
FGD4	121512	broad.mit.edu	37	12	32735256	32735256	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32735256C>A	uc001rkz.2	+	4	932	c.455C>A	c.(454-456)TCT>TAT	p.S152Y	FGD4_uc001rlc.2_Missense_Mutation_p.S237Y|FGD4_uc001rky.2_Translation_Start_Site|FGD4_uc001rla.2_Translation_Start_Site|FGD4_uc010ske.1_Missense_Mutation_p.S264Y|FGD4_uc001rlb.1_RNA|FGD4_uc001rkx.3_Missense_Mutation_p.S152Y	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	152					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GGAAATGCTTCTGACAGTAGC	0.498													4	108	---	---	---	---	PASS
KRT75	9119	broad.mit.edu	37	12	52827829	52827829	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52827829C>A	uc001saj.2	-	1	282	c.260G>T	c.(259-261)AGG>ATG	p.R87M		NM_004693	NP_004684	O95678	K2C75_HUMAN	keratin 75	87	Gly-rich.|Head.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.192)		GTTGCTGGCCCTGCCACCAAA	0.632													3	41	---	---	---	---	PASS
CPM	1368	broad.mit.edu	37	12	69264001	69264001	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69264001C>A	uc001sup.2	-	5	671	c.610G>T	c.(610-612)GTT>TTT	p.V204F	CPM_uc001sur.2_Missense_Mutation_p.V204F|CPM_uc001suq.2_Missense_Mutation_p.V204F	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor	204					anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTACCTTGAACACCATTATCA	0.532													4	87	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105582196	105582196	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105582196G>A	uc001tlf.1	-	17	1707	c.1489C>T	c.(1489-1491)CGG>TGG	p.R497W	APPL2_uc010swt.1_Missense_Mutation_p.R454W|APPL2_uc001tlg.1_Missense_Mutation_p.R251W|APPL2_uc010swu.1_Missense_Mutation_p.R503W|APPL2_uc009zuq.2_Missense_Mutation_p.R454W	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	497	PID.				cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						CCCAAAAACCGAACTATAAAC	0.423													37	39	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23914058	23914058	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23914058C>G	uc001uon.2	-	10	4546	c.3957G>C	c.(3955-3957)AAG>AAC	p.K1319N	SACS_uc001uoo.2_Missense_Mutation_p.K1172N|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1319					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AACCACAGACCTTAAATAGTT	0.383													52	58	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23914059	23914059	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23914059T>G	uc001uon.2	-	10	4545	c.3956A>C	c.(3955-3957)AAG>ACG	p.K1319T	SACS_uc001uoo.2_Missense_Mutation_p.K1172T|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1319					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ACCACAGACCTTAAATAGTTG	0.388													50	57	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39263959	39263959	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39263959C>A	uc001uwv.2	+	1	2787	c.2478C>A	c.(2476-2478)GAC>GAA	p.D826E		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	826	CSPG 5.|Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ATCCCGTGGACAACCAGCCAC	0.547													3	64	---	---	---	---	PASS
FAM124A	220108	broad.mit.edu	37	13	51826047	51826047	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51826047A>T	uc001vfg.1	+	3	675	c.544A>T	c.(544-546)AAC>TAC	p.N182Y	FAM124A_uc001vfe.2_Missense_Mutation_p.N182Y|FAM124A_uc001vff.1_Missense_Mutation_p.N218Y	NM_145019	NP_659456	Q86V42	F124A_HUMAN	hypothetical protein LOC220108	182										central_nervous_system(1)	1		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		TCGCTACGACAACTATGCTGA	0.577													8	18	---	---	---	---	PASS
AKT1	207	broad.mit.edu	37	14	105246482	105246482	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105246482C>T	uc001ypk.2	-	3	672	c.118G>A	c.(118-120)GAG>AAG	p.E40K	INF2_uc010tyi.1_Intron|AKT1_uc001ypl.2_Missense_Mutation_p.E40K|AKT1_uc010axa.2_Missense_Mutation_p.E40K|AKT1_uc001ypm.2_Missense_Mutation_p.E40K|AKT1_uc001ypn.2_Missense_Mutation_p.E40K|AKT1_uc010tyk.1_5'Flank	NM_005163	NP_005154	P31749	AKT1_HUMAN	AKT1 kinase	40	PH.				activation of pro-apoptotic gene products|activation-induced cell death of T cells|endocrine pancreas development|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen biosynthetic process|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|mRNA metabolic process|negative regulation of fatty acid beta-oxidation|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|nitric oxide biosynthetic process|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of blood vessel endothelial cell migration|positive regulation of cell growth|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of establishment of protein localization in plasma membrane|positive regulation of fat cell differentiation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|positive regulation of nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein autophosphorylation|protein import into nucleus, translocation|regulation of neuron projection development|regulation of translation|response to fluid shear stress|response to heat|response to UV-A|T cell costimulation	cytosol|nucleoplasm|plasma membrane	enzyme binding|identical protein binding|nitric-oxide synthase regulator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein serine/threonine kinase activity			breast(86)|urinary_tract(12)|thyroid(10)|lung(7)|endometrium(5)|large_intestine(4)|skin(4)|prostate(3)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|NS(1)	134		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	TGCGGCCGCTCCTTGTAGCCA	0.582		1	Mis		breast|colorectal|ovarian|NSCLC								10	18	---	---	---	---	PASS
CILP	8483	broad.mit.edu	37	15	65499358	65499358	+	Silent	SNP	G	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65499358G>T	uc002aon.2	-	4	367	c.186C>A	c.(184-186)ATC>ATA	p.I62I		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	62					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						CTGGGTAGTCGATGTTGAACC	0.597													5	16	---	---	---	---	PASS
CLCN7	1186	broad.mit.edu	37	16	1510843	1510843	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1510843C>A	uc002clv.2	-	5	568	c.458G>T	c.(457-459)GGC>GTC	p.G153V	CLCN7_uc002clw.2_Missense_Mutation_p.G129V	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	153	Helical; (By similarity).					integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				GTACTTGAGGCCAGCCAGGTT	0.642													31	38	---	---	---	---	PASS
MLST8	64223	broad.mit.edu	37	16	2256665	2256665	+	Intron	SNP	G	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2256665G>C	uc002coz.2	+						MLST8_uc002coy.2_Intron|MLST8_uc002cpa.2_Intron|MLST8_uc002cpb.2_Intron|MLST8_uc010uvx.1_Intron|MLST8_uc002cpc.2_Intron|MLST8_uc002cpd.2_Intron|MLST8_uc002cpe.2_Intron|MLST8_uc010uvy.1_Missense_Mutation_p.G117R|MLST8_uc002cpg.2_Intron|MLST8_uc002cph.2_Intron|MLST8_uc002cpf.2_Intron	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0						CCTCAGGTGCGGTGGGGAGGG	0.517													59	47	---	---	---	---	PASS
TNFAIP1	7126	broad.mit.edu	37	17	26667402	26667402	+	Silent	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26667402C>T	uc002hax.1	+	3	292	c.273C>T	c.(271-273)ACC>ACT	p.T91T	TNFAIP1_uc002hay.2_Silent_p.T91T|TNFAIP1_uc010waf.1_5'UTR	NM_021137	NP_066960	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1	91	BTB.				apoptosis|cell migration|DNA replication|embryo development|immune response|negative regulation of Rho protein signal transduction|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|endosome|nucleus|voltage-gated potassium channel complex	GTP-Rho binding|voltage-gated potassium channel activity				0	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GAGATGACACCATCACCCTCC	0.507													47	160	---	---	---	---	PASS
MEOX1	4222	broad.mit.edu	37	17	41738797	41738797	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41738797G>T	uc002idz.2	-	1	135	c.106C>A	c.(106-108)CCC>ACC	p.P36T	MEOX1_uc002iea.2_Missense_Mutation_p.P36T|MEOX1_uc002ieb.2_Intron	NM_004527	NP_004518	P50221	MEOX1_HUMAN	mesenchyme homeobox 1 isoform 1	36						nucleus	sequence-specific DNA binding				0		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		GGGTAGTGGGGTAGCCCTGAG	0.672													7	11	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62892204	62892204	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62892204T>A	uc002jey.2	-	3	1703	c.1172A>T	c.(1171-1173)GAA>GTA	p.E391V	LRRC37A3_uc010wqg.1_Intron|LRRC37A3_uc010wqf.1_Intron	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	391	Extracellular (Potential).					integral to membrane					0						AACTGTGACTTCATGATGTTC	0.537													64	138	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9070657	9070657	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9070657C>T	uc002mkp.2	-	3	16993	c.16789G>A	c.(16789-16791)GTG>ATG	p.V5597M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5599	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCCTGAGACACGGTTGAATGA	0.532													70	57	---	---	---	---	PASS
ELOF1	84337	broad.mit.edu	37	19	11664531	11664531	+	3'UTR	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11664531G>A	uc002mse.1	-	4					ELOF1_uc002msd.1_3'UTR	NM_032377	NP_115753	P60002	ELOF1_HUMAN	elongation factor 1 homolog (ELF1, S.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding				0						CAGTACGCGGGGCTGCTCAGG	0.567													22	15	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54756788	54756788	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54756788G>A	uc002qex.2	-	9	1528	c.1417C>T	c.(1417-1419)CTC>TTC	p.L473F	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.L465F|LILRB5_uc002qey.2_Missense_Mutation_p.L474F|LILRB5_uc002qez.2_Missense_Mutation_p.L374F|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	473	Helical; (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		aagaggaggaggaACAGCAGC	0.532													5	89	---	---	---	---	PASS
KRTAP20-2	337976	broad.mit.edu	37	21	32007632	32007632	+	Missense_Mutation	SNP	T	G	G	rs8132721		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32007632T>G	uc011adg.1	+	1	50	c.50T>G	c.(49-51)GTC>GGC	p.V17G		NM_181616	NP_853647	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	17						intermediate filament				central_nervous_system(1)	1						GGCTATGGAGTCCTGGGCGGT	0.537													7	59	---	---	---	---	PASS
SUSD2	56241	broad.mit.edu	37	22	24580140	24580140	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24580140A>C	uc002zzn.1	+	4	520	c.476A>C	c.(475-477)GAG>GCG	p.E159A		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	159	Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						GAGAAGAGCGAGTTGGTGAAC	0.617													23	27	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37480371	37480371	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37480371G>T	uc003aqs.1	-	10	1301	c.1187C>A	c.(1186-1188)CCG>CAG	p.P396Q	TMPRSS6_uc003aqt.1_Missense_Mutation_p.P387Q|TMPRSS6_uc003aqu.2_Missense_Mutation_p.P387Q	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	396	CUB 2.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						CTGGGTGCACGGCAAATCATA	0.428													3	21	---	---	---	---	PASS
FANCB	2187	broad.mit.edu	37	X	14882777	14882777	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14882777C>A	uc004cwg.1	-	3	1124	c.856G>T	c.(856-858)GCA>TCA	p.A286S	FANCB_uc004cwh.1_Missense_Mutation_p.A286S	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN	Fanconi anemia complementation group B	286					DNA repair	nucleoplasm				lung(1)	1	Hepatocellular(33;0.183)					AGTTGAACTGCACAAGGATCT	0.393								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				84	90	---	---	---	---	PASS
RBBP7	5931	broad.mit.edu	37	X	16870947	16870947	+	Silent	SNP	C	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16870947C>T	uc004cxt.2	-	7	1168	c.810G>A	c.(808-810)GCG>GCA	p.A270A	RBBP7_uc004cxs.1_Silent_p.A314A|RBBP7_uc004cxu.2_Silent_p.A261A|RBBP7_uc010nez.2_3'UTR	NM_002893	NP_002884	Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	270					cell proliferation|cellular heat acclimation|CenH3-containing nucleosome assembly at centromere|DNA replication|multicellular organismal development|negative regulation of cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex|NuRD complex	protein binding			upper_aerodigestive_tract(1)|ovary(1)	2	Hepatocellular(33;0.0997)					CGGCAGTGTGCGCATCCACCA	0.502													5	176	---	---	---	---	PASS
TAB3	257397	broad.mit.edu	37	X	30849594	30849594	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30849594G>A	uc004dcj.2	-	11	2752	c.2089C>T	c.(2089-2091)CAC>TAC	p.H697Y	TAB3_uc004dck.2_Missense_Mutation_p.H697Y|TAB3_uc010ngl.2_Missense_Mutation_p.H669Y	NM_152787	NP_690000	Q8N5C8	TAB3_HUMAN	mitogen-activated protein kinase kinase kinase 7	697	RanBP2-type.				activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein binding|zinc ion binding			ovary(1)	1						AGTGCTGGGTGGTTAAGAAAG	0.502													19	26	---	---	---	---	PASS
NHSL2	340527	broad.mit.edu	37	X	71360504	71360504	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71360504A>G	uc011mqa.1	+	6	3106	c.3106A>G	c.(3106-3108)ATC>GTC	p.I1036V	NHSL2_uc004eak.1_Missense_Mutation_p.I670V|NHSL2_uc010nli.2_Missense_Mutation_p.I805V	NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2	1036											0	Renal(35;0.156)					TCTCAGCCCCATCATCACCCT	0.557													21	20	---	---	---	---	PASS
NAP1L3	4675	broad.mit.edu	37	X	92927545	92927545	+	Silent	SNP	T	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92927545T>C	uc004efq.2	-	1	1064	c.759A>G	c.(757-759)AAA>AAG	p.K253K	FAM133A_uc004efr.1_5'Flank	NM_004538	NP_004529	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	253	Glu-rich.				nucleosome assembly	chromatin assembly complex				ovary(1)|skin(1)	2						GGGGGACTTCTTTAGGATCTT	0.428													91	218	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135441581	135441581	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135441581G>A	uc004ezu.1	+	11	7402	c.7111G>A	c.(7111-7113)GTA>ATA	p.V2371I	GPR112_uc010nsb.1_Missense_Mutation_p.V2166I|GPR112_uc010nsc.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2371	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					GACGTTATTAGTAAACTGTGA	0.338													53	136	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7751808	7751809	+	Intron	DEL	GA	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7751808_7751809delGA	uc001aoi.2	+						CAMTA1_uc010nzv.1_Intron|CAMTA1_uc001aok.3_Intron	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		ACAagagagcgagagagagaga	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18787198	18787204	+	IGR	DEL	AATGAAT	-	-	rs111267148		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18787198_18787204delAATGAAT								IGSF21 (82222 upstream) : KLHDC7A (20220 downstream)																							tgaatgaatgaatgaatgtctatctct	0.087													5	4	---	---	---	---	
PTAFR	5724	broad.mit.edu	37	1	28477695	28477695	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28477695delT	uc001bpl.2	-						PTAFR_uc001bpm.3_Intron|PTAFR_uc009vte.2_Intron	NM_000952	NP_000943	P25105	PTAFR_HUMAN	platelet-activating factor receptor						chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		atgttgaatcttttttttttt	0.109													4	2	---	---	---	---	
KIAA0467	23334	broad.mit.edu	37	1	43897632	43897632	+	Intron	DEL	G	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43897632delG	uc001cjk.1	+							NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTGGGCCCCAGGCACAGGACT	0.567													8	4	---	---	---	---	
NASP	4678	broad.mit.edu	37	1	46081689	46081690	+	Intron	DEL	AG	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46081689_46081690delAG	uc001coi.1	+						NASP_uc001coh.1_Intron|NASP_uc001coj.1_Intron|NASP_uc010olr.1_Intron|NASP_uc001col.1_Intron	NM_002482	NP_002473	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein isoform 2						blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					TCCATCTCCAAGAACTCATTTG	0.376													4	2	---	---	---	---	
USP24	23358	broad.mit.edu	37	1	55614284	55614284	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55614284delA	uc001cyg.3	-							NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24						ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						ATTTAGAAATAAACAGCAGAT	0.299													50	53	---	---	---	---	
CTH	1491	broad.mit.edu	37	1	70877012	70877014	+	5'UTR	DEL	CTT	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70877012_70877014delCTT	uc001dfd.2	+	1					CTH_uc009wbl.1_RNA|CTH_uc001dfe.2_5'UTR|CTH_uc010oqq.1_5'UTR	NM_001902	NP_001893	P32929	CGL_HUMAN	cystathionase isoform 1						cysteine biosynthetic process|hydrogen sulfide biosynthetic process|protein homotetramerization|protein-pyridoxal-5-phosphate linkage via peptidyl-N6-pyridoxal phosphate-L-lysine	cytoplasm|nucleus	cystathionine gamma-lyase activity|L-cysteine desulfhydrase activity|pyridoxal phosphate binding			lung(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	TCGCCTGATCCTTCTGTCTCTCC	0.542													9	4	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114267762	114267762	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114267762delA	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc010own.1_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAATCTACTAAAAAAAAAAA	0.348													4	2	---	---	---	---	
DNM3	26052	broad.mit.edu	37	1	171914791	171914792	+	Intron	DEL	TT	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171914791_171914792delTT	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						GGTTTTTTCCTTTTTTTTGGTT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178602696	178602697	+	IGR	INS	-	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178602696_178602697insT								C1orf220 (84672 upstream) : RALGPS2 (91603 downstream)																							TTAATTTCTGattttttttttt	0.327													4	2	---	---	---	---	
TOR1AIP2	163590	broad.mit.edu	37	1	179821497	179821497	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179821497delT	uc001gnk.2	-						TOR1AIP2_uc001gnl.2_Intron	NM_145034	NP_659471	Q8NFQ8	TOIP2_HUMAN	torsin A interacting protein 2							endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1						TCTACCATCATTTTTTAAAGA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	22493638	22493638	+	IGR	DEL	T	-	-	rs77003565		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22493638delT								None (None upstream) : None (None downstream)																							tttcatgaagtttcatgaagc	0.000													4	2	---	---	---	---	
EMILIN1	11117	broad.mit.edu	37	2	27304812	27304812	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27304812delT	uc002rii.3	+						EMILIN1_uc010eyq.1_Intron|EMILIN1_uc002rik.3_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor						cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGGAGTTTCTTTTTTTTTCT	0.403													4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495217	187495218	+	Intron	INS	-	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495217_187495218insT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgggttgtgatataaattat	0.084													4	6	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495222	187495224	+	Intron	DEL	AAA	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495222_187495224delAAA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgtgatataaattataatctt	0.089													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	212105810	212105810	+	IGR	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212105810delA								CPS1 (561981 upstream) : ERBB4 (134632 downstream)																							actgcgtctcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
COL4A4	1286	broad.mit.edu	37	2	227885103	227885103	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227885103delA	uc010zlt.1	-							NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ACGGGCCGTTAAAAAAAGTTG	0.403													4	2	---	---	---	---	
XYLB	9942	broad.mit.edu	37	3	38404189	38404190	+	Intron	INS	-	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38404189_38404190insC	uc003cic.2	+						XYLB_uc011ayp.1_Intron|XYLB_uc003cid.1_Intron	NM_005108	NP_005099	O75191	XYLB_HUMAN	xylulokinase						D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		TTTGAGGATTGGTGGTTTATGA	0.168													7	4	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47125280	47125289	+	Frame_Shift_Del	DEL	TCTTGGCTCC	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47125280_47125289delTCTTGGCTCC	uc003cqs.2	-	12	6034_6043	c.5981_5990delGGAGCCAAGA	c.(5980-5991)AGGAGCCAAGAAfs	p.R1994fs	SETD2_uc003cqv.2_Frame_Shift_Del_p.R2061fs|SETD2_uc003cqt.1_RNA	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1994_1997					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATCTGGCTGTTCTTGGCTCCTTTCACTCTC	0.433			N|F|S|Mis		clear cell renal carcinoma								184	145	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52643396	52643396	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52643396delA	uc003des.2	-	16	2512	c.2500delT	c.(2500-2502)TACfs	p.Y834fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.Y834fs|PBRM1_uc003der.2_Frame_Shift_Del_p.Y802fs|PBRM1_uc003det.2_Frame_Shift_Del_p.Y849fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.Y849fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.Y834fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.Y834fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.Y834fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.Y834fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.Y747fs|PBRM1_uc003dfa.1_Frame_Shift_Del_p.Y180fs|PBRM1_uc003dfc.2_Frame_Shift_Del_p.Y201fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	834	Bromo 6.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGCCGACGGTAGCGATTATTT	0.373			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								67	145	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	74588740	74588740	+	IGR	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74588740delA								CNTN3 (18397 upstream) : FAM86D (881965 downstream)																							TTCTGGGATGAAAAAAAAAAT	0.418													5	3	---	---	---	---	
SLC25A36	55186	broad.mit.edu	37	3	140689553	140689553	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140689553delA	uc003etr.2	+						SLC25A36_uc003ets.2_Intron|SLC25A36_uc003etq.2_Intron|SLC25A36_uc011bmz.1_Intron	NM_001104647	NP_001098117	Q96CQ1	S2536_HUMAN	solute carrier family 25, member 36 isoform a						response to estradiol stimulus|transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						TTTTGCTTTTAAAAGAATCTG	0.303													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149768515	149768517	+	IGR	DEL	GGC	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149768515_149768517delGGC								PFN2 (79774 upstream) : TSC22D2 (358271 downstream)																							TCCTCAAGATGGCGGCGGCGGCG	0.611													5	3	---	---	---	---	
SERPINI1	5274	broad.mit.edu	37	3	167510155	167510156	+	Intron	DEL	AT	-	-	rs34567506		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167510155_167510156delAT	uc003ffa.3	+						SERPINI1_uc003ffb.3_Intron	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor						central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						atatacacacatatatatatat	0.213													2	4	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	169194458	169194458	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169194458delT	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						GCAAGTAATCTTTTTTTTCTC	0.438													4	2	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	192318041	192318042	+	Intron	INS	-	T	T	rs150182120	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192318041_192318042insT	uc003fsy.2	-							NM_004113	NP_004104	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		tggtctatgtgtctgtttttat	0.000													4	2	---	---	---	---	
MUC20	200958	broad.mit.edu	37	3	195448129	195448130	+	Intron	INS	-	GTGA	GTGA	rs55707324		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195448129_195448130insGTGA	uc010hzo.2	+						MUC20_uc010hzp.2_5'Flank	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CAAATGACAGTGTGAGTGTAAG	0.480													8	5	---	---	---	---	
FYTTD1	84248	broad.mit.edu	37	3	197504101	197504101	+	Intron	DEL	G	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197504101delG	uc003fyi.2	+						FYTTD1_uc011bui.1_Intron|FYTTD1_uc011buj.1_Intron|FYTTD1_uc011buk.1_Intron	NM_032288	NP_115664	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1 isoform 1						mRNA export from nucleus	nuclear speck	mRNA binding|protein binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		TGTTTTTTATGTTTTAAAAAT	0.234													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	7124907	7124907	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7124907delT								FLJ36777 (19804 upstream) : SORCS2 (69467 downstream)																							tccttttttctttttttttga	0.249													5	3	---	---	---	---	
ABLIM2	84448	broad.mit.edu	37	4	8062948	8062949	+	Intron	INS	-	A	A	rs150322251	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8062948_8062949insA	uc003gko.2	-						ABLIM2_uc003gkl.2_Intron|ABLIM2_uc003gkj.3_Intron|ABLIM2_uc003gkm.3_Intron|ABLIM2_uc003gkp.2_Intron|ABLIM2_uc003gkq.2_Intron|ABLIM2_uc003gkr.2_Intron|ABLIM2_uc003gks.3_Intron|ABLIM2_uc011bwl.1_Intron	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2						axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						AGCCCAGACCCGGGGGTGCCCC	0.693													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25056418	25056419	+	IGR	INS	-	AG	AG	rs147732376	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25056418_25056419insAG								LGI2 (24004 upstream) : SEPSECS (65209 downstream)																							ctgaggtggccagagagagaga	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49506430	49506430	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49506430delT								CWH43 (442337 upstream) : None (None downstream)																							TTCTTCTCTATTTTTTTGTAC	0.279													5	3	---	---	---	---	
NPNT	255743	broad.mit.edu	37	4	106888079	106888080	+	Intron	INS	-	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106888079_106888080insC	uc003hya.2	+						NPNT_uc011cfc.1_Intron|NPNT_uc011cfd.1_Intron|NPNT_uc011cfe.1_Intron|NPNT_uc010ilt.1_Intron|NPNT_uc011cff.1_Intron|NPNT_uc010ilu.1_Intron	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor						cell differentiation	membrane	calcium ion binding			skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		ATTCCACTGGAAATATTCATAG	0.371													4	2	---	---	---	---	
ENPP6	133121	broad.mit.edu	37	4	185018264	185018265	+	Intron	INS	-	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185018264_185018265insG	uc003iwc.2	-							NM_153343	NP_699174	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		ggagaccggctgggtttgctcT	0.252													4	2	---	---	---	---	
GOLPH3	64083	broad.mit.edu	37	5	32135385	32135386	+	Intron	DEL	AC	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32135385_32135386delAC	uc003jhp.1	-							NM_022130	NP_071413	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3						cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding			ovary(1)	1						ggggtttgttaccaccacagct	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	49439825	49439825	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49439825delT								None (None upstream) : EMB (252208 downstream)																							accatgggcatcaaagcgttc	0.000													5	3	---	---	---	---	
COL4A3BP	10087	broad.mit.edu	37	5	74675414	74675414	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74675414delT	uc011csu.1	-						COL4A3BP_uc003kds.2_Intron|COL4A3BP_uc003kdt.2_Intron|COL4A3BP_uc003kdu.2_Intron	NM_005713	NP_005704	Q9Y5P4	C43BP_HUMAN	alpha 3 type IV collagen binding protein isoform						ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity			skin(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		AATTAGCATCttttttttttc	0.139													9	5	---	---	---	---	
TMEM167A	153339	broad.mit.edu	37	5	82357937	82357939	+	Intron	DEL	AAA	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82357937_82357939delAAA	uc003khx.3	-							NM_174909	NP_777569	Q8TBQ9	KISHA_HUMAN	transmembrane protein 167A precursor							Golgi membrane|integral to membrane					0						CAATGTACAGAAACTGCTATGAA	0.340													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	115106723	115106723	+	IGR	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115106723delA								TMED7-TICAM2 (144853 upstream) : CDO1 (33709 downstream)																							TTTCATTCTCAAAAAAAAAAA	0.353													11	5	---	---	---	---	
ETF1	2107	broad.mit.edu	37	5	137846859	137846862	+	Frame_Shift_Del	DEL	GTGT	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137846859_137846862delGTGT	uc003ldc.3	-	8	1055_1058	c.890_893delACAC	c.(889-894)GACACGfs	p.D297fs	ETF1_uc011cyv.1_Frame_Shift_Del_p.D283fs|ETF1_uc010jex.2_RNA|ETF1_uc003ldd.3_Frame_Shift_Del_p.D264fs	NM_004730	NP_004721	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	297_298					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTACTTGCCCGTGTCCTGGCTGAT	0.377													144	66	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153371253	153371253	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153371253delT								GRIA1 (177825 upstream) : FAM114A2 (18 downstream)																							TGCTTTGCTATTTTTTTTTTT	0.289													4	2	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26459148	26459148	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26459148delA	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						gcaaattttcaaaaaaaatta	0.055													4	2	---	---	---	---	
TNXB	7148	broad.mit.edu	37	6	32064926	32064927	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32064926_32064927delCA	uc003nzl.2	-	3	905_906	c.703_704delTG	c.(703-705)TGCfs	p.C235fs		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	235	EGF-like 3.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						GCCTGCCCGGCACACACACACG	0.698													4	2	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117650252	117650252	+	Intron	DEL	C	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117650252delC	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CAAACAATTTCCATAAAGTGT	0.333			T	GOPC|ROS1	glioblastoma|NSCLC								4	2	---	---	---	---	
KIAA1244	57221	broad.mit.edu	37	6	138606890	138606891	+	Intron	INS	-	G	G			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138606890_138606891insG	uc003qhu.2	+							NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine						regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GAAGAATAAATACTCCAAAGTG	0.248													4	3	---	---	---	---	
C6orf70	55780	broad.mit.edu	37	6	170179576	170179576	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170179576delT	uc003qxg.1	+						C6orf70_uc011ehb.1_Intron|C6orf70_uc003qxh.1_Intron|C6orf70_uc010kky.1_Intron|C6orf70_uc003qxi.1_Intron	NM_018341	NP_060811	Q5T6L9	CF070_HUMAN	hypothetical protein LOC55780							integral to membrane				ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)		CAAAACCAtgttttttttgtt	0.269													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	170736015	170736015	+	IGR	DEL	G	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170736015delG								FAM120B (21779 upstream) : PSMB1 (44092 downstream)																							ctccctttatggtctttccca	0.000													4	2	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21584345	21584346	+	Intron	INS	-	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21584345_21584346insT	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TAGTTATAAGATTTTTTTTTTG	0.307									Kartagener_syndrome				4	2	---	---	---	---	
TBXAS1	6916	broad.mit.edu	37	7	139598812	139598812	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139598812delT	uc011kqv.1	+						TBXAS1_uc003vvh.2_Intron|TBXAS1_uc010lne.2_Intron|TBXAS1_uc011kqu.1_Intron|TBXAS1_uc003vvi.2_Intron|TBXAS1_uc003vvj.2_Intron|TBXAS1_uc011kqw.1_Intron|TBXAS1_uc011kqx.1_Intron	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					CTCCCTCTCCTTTTTTTTTTT	0.313													4	2	---	---	---	---	
MSRA	4482	broad.mit.edu	37	8	9969603	9969604	+	Intron	INS	-	T	T	rs148502523	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9969603_9969604insT	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	TCTTTGTTCTCTAATTTTGTAG	0.282													5	4	---	---	---	---	
WRN	7486	broad.mit.edu	37	8	30998669	30998669	+	Intron	DEL	T	-	-	rs76871007		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30998669delT	uc003xio.3	+						WRN_uc010lvk.2_Intron	NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein						base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		AAGCTAAGTGTTCCAAACACA	0.328			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52168584	52168584	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52168584delT								SNTG1 (463157 upstream) : PXDNL (63560 downstream)																							ATATTGGGGGTTTTGATGGAG	0.443													4	2	---	---	---	---	
CSPP1	79848	broad.mit.edu	37	8	68103043	68103043	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68103043delT	uc003xxi.2	+						ARFGEF1_uc003xxl.1_Intron|CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron|CSPP1_uc010lyw.2_Intron	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GAATGAGAGGTCTGGGTTCTG	0.328													19	9	---	---	---	---	
PAG1	55824	broad.mit.edu	37	8	81892425	81892425	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81892425delA	uc003ybz.2	-							NM_018440	NP_060910	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid						epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			ATTTTTCCTGACCCTGCTTTC	0.493													4	3	---	---	---	---	
DPYS	1807	broad.mit.edu	37	8	105478241	105478241	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105478241delA	uc003yly.3	-							NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase						protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TCATTTCTGGAATACTTTCTC	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	117336399	117336399	+	IGR	DEL	C	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117336399delC								TRPS1 (655171 upstream) : EIF3H (320657 downstream)																							gaatacaattccaggagaggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92978754	92978754	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92978754delT								LOC100129066 (644080 upstream) : DIRAS2 (393360 downstream)																							TTTTGTTGTCTTTTTTTTTTC	0.428													3	3	---	---	---	---	
COL15A1	1306	broad.mit.edu	37	9	101829513	101829515	+	Intron	DEL	CAG	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101829513_101829515delCAG	uc004azb.1	+							NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				ccctgaacctcagttttctTTAT	0.138													4	5	---	---	---	---	
CEP110	11064	broad.mit.edu	37	9	123888359	123888360	+	Intron	INS	-	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123888359_123888360insT	uc004bkx.1	+						CEP110_uc004bky.1_Intron|CEP110_uc004bkz.1_Intron|CEP110_uc004bla.1_Intron	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa						cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						AACAGTTGGGCTTTTTTTTTTC	0.302													5	3	---	---	---	---	
TSC1	7248	broad.mit.edu	37	9	135782947	135782948	+	Intron	INS	-	C	C	rs147566970	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135782947_135782948insC	uc004cca.2	-						TSC1_uc004ccb.3_Intron|TSC1_uc011mcq.1_Intron|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_Intron	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1						activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		cacaatctcggctcactgcaac	0.059			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50342290	50342290	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50342290delA	uc001jhi.1	+						FAM170B_uc001jhj.2_5'Flank					Homo sapiens cDNA FLJ35736 fis, clone TESTI2003545.																		AGACACACATAAAAACACAAA	0.308													4	2	---	---	---	---	
C10orf76	79591	broad.mit.edu	37	10	103789677	103789677	+	Intron	DEL	G	-	-	rs10786660	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103789677delG	uc009xwy.1	-						C10orf76_uc001kui.2_Intron	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		CGGtttttttgtttgtttgtt	0.179													4	2	---	---	---	---	
CASC2	255082	broad.mit.edu	37	10	119816920	119816922	+	Intron	DEL	TCC	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119816920_119816922delTCC	uc001ldm.3	+						CASC2_uc009xzc.2_Intron|CASC2_uc009xza.2_Intron|CASC2_uc009xzb.2_Intron	NR_026939				Homo sapiens mRNA for IGM1 protein.												0						CTGTTCTGCTTCCTCCTCGTAAT	0.507													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125283576	125283578	+	IGR	DEL	TCA	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125283576_125283578delTCA								BUB3 (358690 upstream) : GPR26 (142293 downstream)																							cagccctttgtcatcatcatcat	0.064													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128824379	128824379	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128824379delA	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GAGCATTCAGAAAAAAAAATT	0.229													4	2	---	---	---	---	
MPPED2	744	broad.mit.edu	37	11	30436120	30436120	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30436120delT	uc001msr.2	-						MPPED2_uc001msq.3_Intron|MPPED2_uc009yji.2_Intron	NM_001584	NP_001575	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2						nervous system development		hydrolase activity|metal ion binding			skin(1)	1						TTAATTAACATTTTTTTTTCT	0.313													4	2	---	---	---	---	
EIF3M	10480	broad.mit.edu	37	11	32610886	32610888	+	Intron	DEL	CTA	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32610886_32610888delCTA	uc001mtu.2	+						EIF3M_uc010ref.1_Intron	NM_006360	NP_006351	Q7L2H7	EIF3M_HUMAN	eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)					ccacgcccggctaatgttgtatt	0.000													9	5	---	---	---	---	
PTPRJ	5795	broad.mit.edu	37	11	48146358	48146358	+	Intron	DEL	G	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48146358delG	uc001ngp.3	+						PTPRJ_uc001ngo.3_Intron	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						GCCTTTTTATGGGGCTGCCTC	0.498													4	2	---	---	---	---	
BTBD18	643376	broad.mit.edu	37	11	57518777	57518777	+	5'UTR	DEL	G	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57518777delG	uc009ymm.2	-	1					CTNND1_uc001nlf.1_Intron|CTNND1_uc001nlh.1_5'Flank|BTBD18_uc010rjy.1_Intron	NM_001145101	NP_001138573	B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18												0						TGAAATGGCAGGGGAATTTTG	0.338													12	12	---	---	---	---	
EEF1G	1937	broad.mit.edu	37	11	62339884	62339884	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62339884delT	uc001ntm.1	-						EEF1G_uc010rlw.1_Intron|EEF1G_uc001ntn.1_Intron	NM_001404	NP_001395	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1						response to virus	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						tagctctgtattttttttcac	0.244													4	2	---	---	---	---	
TMEM223	79064	broad.mit.edu	37	11	62558503	62558503	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62558503delT	uc001nve.2	-							NM_001080501	NP_001073970	A0PJW6	TM223_HUMAN	transmembrane protein 223							integral to membrane					0						TACTGAGCGCttttttttttg	0.264													5	3	---	---	---	---	
SIK2	23235	broad.mit.edu	37	11	111593990	111593990	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111593990delA	uc001plt.2	+							NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN	SNF1-like kinase 2						intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3						GGAGTCAGAGAAAATGCATTC	0.453													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131254473	131254473	+	Intron	DEL	A	-	-	rs10580571		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131254473delA	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						agagagagagagtgagtgaga	0.159													4	3	---	---	---	---	
LOC100288778	100288778	broad.mit.edu	37	12	88237	88237	+	Intron	DEL	C	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88237delC	uc010scy.1	+						LOC100288778_uc010scz.1_Intron|LOC100288778_uc010sdb.1_Intron|LOC100288778_uc010sdc.1_Intron|LOC100288778_uc010sdd.1_Intron|LOC100288778_uc010sde.1_Intron|LOC100288778_uc010sdf.1_5'UTR|LOC100288778_uc010sdg.1_Intron|LOC100288778_uc010sdh.1_5'Flank					SubName: Full=Actin nucleation promoting factor; Flags: Fragment;												0						TCTTGCCTGACCCCCATGTCG	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57150085	57150085	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57150085delT								C14orf101 (33855 upstream) : OTX2 (117342 downstream)																							caatataaactttTTTTTTTA	0.179													6	5	---	---	---	---	
B2M	567	broad.mit.edu	37	15	45007701	45007701	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45007701delT	uc001zuc.2	+	2	208	c.148delT	c.(148-150)TTTfs	p.F50fs	B2M_uc010uek.1_Frame_Shift_Del_p.F50fs|B2M_uc010bdx.1_Frame_Shift_Del_p.F50fs	NM_004048	NP_004039	P61769	B2MG_HUMAN	beta-2-microglobulin precursor	50	Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of defense response to virus by virus|viral reproduction	early endosome membrane|Golgi membrane|MHC class I protein complex	protein binding			ovary(2)|skin(1)	3		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TGTGTCTGGGTTTCATCCATC	0.413													199	93	---	---	---	---	
AXIN1	8312	broad.mit.edu	37	16	354490	354490	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:354490delA	uc002cgp.1	-						AXIN1_uc002cgq.1_Intron	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a						activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GTCACAGGCTAAACATTTCTT	0.418													4	2	---	---	---	---	
C16orf62	57020	broad.mit.edu	37	16	19584758	19584758	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19584758delA	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc010vas.1_Intron|C16orf62_uc002dgm.1_Intron	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020							integral to membrane				ovary(1)	1						CAGGTTTCCCAAAAAAAAATG	0.378													4	2	---	---	---	---	
FTO	79068	broad.mit.edu	37	16	53849425	53849425	+	Intron	DEL	C	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53849425delC	uc002ehr.2	+						FTO_uc010vha.1_Intron	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CTCATGCCCTCCCCAGTGCCA	0.458													4	2	---	---	---	---	
RANBP10	57610	broad.mit.edu	37	16	67836762	67836763	+	Intron	INS	-	A	A			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67836762_67836763insA	uc002eud.2	-						RANBP10_uc010ceo.2_Intron|RANBP10_uc010vju.1_Intron|RANBP10_uc010vjv.1_Intron|RANBP10_uc010vjx.1_Intron|RANBP10_uc010vjy.1_Intron	NM_020850	NP_065901	Q6VN20	RBP10_HUMAN	RAN binding protein 10											ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		CCTCATCTCTCAAAAAATACAA	0.376													4	2	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7623838	7623838	+	Intron	DEL	G	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7623838delG	uc002giu.1	+						DNAH2_uc002git.2_Intron|DNAH2_uc010vuk.1_Intron	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTTTCCTGTGGGTGAGCCGG	0.498													4	2	---	---	---	---	
RICH2	9912	broad.mit.edu	37	17	12780659	12780659	+	Intron	DEL	C	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12780659delC	uc002gnr.3	+						RICH2_uc010vvk.1_Intron|RICH2_uc010vvl.1_Intron|RICH2_uc002gns.3_Intron|RICH2_uc010vvm.1_Intron|RICH2_uc010vvn.1_Intron	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						TGATCACATGCCCTTGGAAAA	0.378													6	5	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15519362	15519363	+	Intron	DEL	AG	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15519362_15519363delAG	uc002gor.1	-						CDRT1_uc002gov.3_Intron			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TTATACAAGCAGAGAGAGAGAG	0.431													4	2	---	---	---	---	
FBXW10	10517	broad.mit.edu	37	17	18652860	18652860	+	Intron	DEL	A	-	-	rs140182637		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18652860delA	uc002guk.2	+						FBXW10_uc002guj.2_Intron|FBXW10_uc002gul.2_Intron|FBXW10_uc010cqh.1_Intron	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10											ovary(1)	1						actccgtctcaaaaaaaaaaa	0.184													4	2	---	---	---	---	
BRCA1	672	broad.mit.edu	37	17	41228262	41228262	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41228262delT	uc002icq.2	-						BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Intron|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Intron|BRCA1_uc002ict.2_Intron|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTCCATTATATTTTTTTCTGA	0.348			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			4	2	---	---	---	---	
BRCA1	672	broad.mit.edu	37	17	41321890	41321890	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41321890delT	uc010whp.1	-						uc010czc.2_Intron|NBR1_uc010czd.2_5'Flank|NBR1_uc010diz.2_5'Flank|NBR1_uc010whu.1_5'Flank|NBR1_uc010whv.1_5'Flank|NBR1_uc010whw.1_5'Flank	NM_007298	NP_009229	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 4						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CGCAGTCACGTTTTTTTCCCC	0.567			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	58511030	58511030	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58511030delT								C17orf64 (2244 upstream) : APPBP2 (9490 downstream)																							ttTCTTTTTCTTTTTTTTTCA	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72013779	72013779	+	IGR	DEL	G	-	-	rs35516123		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72013779delG								C17orf54 (189103 upstream) : RPL38 (186016 downstream)																							AGCAGGGGTTGGGCTGGATGA	0.557													2	4	---	---	---	---	
CABLES1	91768	broad.mit.edu	37	18	20839629	20839630	+	3'UTR	INS	-	GT	GT	rs113433428		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20839629_20839630insGT	uc002kuc.2	+	10					C18orf45_uc010xaq.1_Intron|CABLES1_uc002kub.2_3'UTR|CABLES1_uc002kud.2_3'UTR	NM_001100619	NP_001094089	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1 isoform 2						blood coagulation|cell cycle|cell division|regulation of cell cycle|regulation of cell division	cytosol|nucleus	cyclin-dependent protein kinase regulator activity|protein binding			breast(1)	1	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGGCAAAGGAAGTGGAGGAGGG	0.530													1	5	---	---	---	---	
ZNF57	126295	broad.mit.edu	37	19	2901115	2901124	+	Intron	DEL	GCCGAAGTCT	-	-	rs11279103		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2901115_2901124delGCCGAAGTCT	uc002lwr.2	+							NM_173480	NP_775751	Q68EA5	ZNF57_HUMAN	zinc finger protein 57						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCAGAGTCCGCCGAAGTCTGCGGCCGGGA	0.714													5	4	---	---	---	---	
ZNF430	80264	broad.mit.edu	37	19	21205912	21205912	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21205912delA	uc002npj.2	+						ZNF430_uc002npk.2_Intron	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						CCCAAAAGACAAAAAGAAAAA	0.388													4	2	---	---	---	---	
RPSAP58	388524	broad.mit.edu	37	19	23990451	23990452	+	Intron	DEL	AG	-	-	rs140725153		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23990451_23990452delAG	uc002nrn.2	+							NM_002295	NP_002286			ribosomal protein SA												0						CTCTTTTCTCAGAGTTAGAGAA	0.322													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54275959	54275959	+	IGR	DEL	C	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54275959delC								MIR519A2 (10275 upstream) : MIR371 (14970 downstream)																							ACAATATATACCCCAAGGATA	0.423													80	56	---	---	---	---	
KIR2DL3	3804	broad.mit.edu	37	19	55271765	55271766	+	Intron	DEL	GA	-	-	rs112795662		TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55271765_55271766delGA	uc010erw.1	+						KIR2DS4_uc010yfj.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two						immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		GGTGGAGGGTgagagagagaga	0.446													3	3	---	---	---	---	
C20orf194	25943	broad.mit.edu	37	20	3363429	3363430	+	Intron	INS	-	T	T	rs141628867	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3363429_3363430insT	uc002wii.2	-						C20orf194_uc010gay.1_Intron	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						CAAAGTCCCTCTCTCATGGTCA	0.337													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6625388	6625389	+	IGR	INS	-	T	T	rs143614849	by1000genomes	TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6625388_6625389insT								FERMT1 (521197 upstream) : BMP2 (123356 downstream)																							CTGAGGGCACGTTTTTTGTTTT	0.287													1	5	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25436620	25436620	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25436620delT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc002wuw.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						taatcccagctacttgggagg	0.000													4	3	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25436622	25436623	+	Intron	INS	-	T	T			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25436622_25436623insT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc002wuw.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						atcccagctacttgggaggctg	0.000													3	3	---	---	---	---	
EDEM2	55741	broad.mit.edu	37	20	33760256	33760257	+	Intron	INS	-	TGG	TGG			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33760256_33760257insTGG	uc010zuv.1	-						PROCR_uc010zuw.1_Intron|PROCR_uc002xbt.2_Intron	NM_018217	NP_060687	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GCTAGGGGAAACAGGATGACTG	0.530													4	2	---	---	---	---	
MCM3AP	8888	broad.mit.edu	37	21	47705388	47705388	+	5'Flank	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47705388delA	uc002zir.1	-						C21orf57_uc002zit.1_5'Flank|C21orf57_uc002ziu.1_5'Flank|C21orf57_uc002ziv.2_5'Flank|C21orf57_uc002ziw.2_5'Flank|C21orf57_uc002zix.2_5'Flank|C21orf57_uc010gqh.2_5'Flank|C21orf57_uc002ziy.2_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3						DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					CTGTCATACTAAAAGGATAAC	0.363													4	2	---	---	---	---	
DMC1	11144	broad.mit.edu	37	22	38917965	38917965	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38917965delT	uc003avz.1	-						DMC1_uc011anv.1_Intron	NM_007068	NP_008999	Q14565	DMC1_HUMAN	DMC1 dosage suppressor of mck1 homolog						reciprocal meiotic recombination	condensed nuclear chromosome	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding			ovary(1)	1	Melanoma(58;0.0286)					TTTGTTTGACttttttttttt	0.174								Homologous_recombination					4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	174297	174297	+	IGR	DEL	A	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:174297delA								None (None upstream) : PLCXD1 (18695 downstream)																							actccatctcaaaaaaaaaaa	0.259													4	3	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2149856	2149857	+	Intron	INS	-	C	C			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2149856_2149857insC	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				ctctctcccttcctcttccttt	0.000													4	3	---	---	---	---	
KDM6A	7403	broad.mit.edu	37	X	44937420	44937421	+	Intron	INS	-	AT	AT			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44937420_44937421insAT	uc004dge.3	+						KDM6A_uc010nhk.2_Intron|KDM6A_uc011mkz.1_Intron|KDM6A_uc011mla.1_Intron|KDM6A_uc011mlb.1_Intron|KDM6A_uc011mlc.1_Intron|KDM6A_uc011mld.1_Intron	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide						histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						TTCATTTCTCCTACATATTTTT	0.193			D|N|F|S		renal|oesophageal SCC|MM								4	4	---	---	---	---	
RNF128	79589	broad.mit.edu	37	X	106033192	106033192	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106033192delT	uc004eml.2	+						RNF128_uc004emk.2_Intron	NM_194463	NP_919445	Q8TEB7	RN128_HUMAN	ring finger protein 128 isoform 1							endomembrane system|integral to membrane|perinuclear region of cytoplasm	zinc ion binding			ovary(1)|central_nervous_system(1)	2						ACTGAAAATATTTTTTTTTGG	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13524407	13524407	+	IGR	DEL	T	-	-			TCGA-B8-4620-01A-02D-1386-10	TCGA-B8-4620-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13524407delT								None (None upstream) : None (None downstream)																							TGGAATGAGCTTTCTATGGAG	0.313													7	4	---	---	---	---	
MTOR	2475	broad.mit.edu	37	1	11315903	11315904	+	Intron	INS	-	A	A	rs35904498		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11315903_11315904insA	uc001asd.2	-							NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						gactccatcacaaaaaaaaaaa	0.198													2	4	---	---	---	---	
KIAA0467	23334	broad.mit.edu	37	1	43897632	43897632	+	Intron	DEL	G	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43897632delG	uc001cjk.1	+							NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTGGGCCCCAGGCACAGGACT	0.567													28	13	---	---	---	---	
CTH	1491	broad.mit.edu	37	1	70877012	70877014	+	5'UTR	DEL	CTT	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70877012_70877014delCTT	uc001dfd.2	+	1					CTH_uc009wbl.1_RNA|CTH_uc001dfe.2_5'UTR|CTH_uc010oqq.1_5'UTR	NM_001902	NP_001893	P32929	CGL_HUMAN	cystathionase isoform 1						cysteine biosynthetic process|hydrogen sulfide biosynthetic process|protein homotetramerization|protein-pyridoxal-5-phosphate linkage via peptidyl-N6-pyridoxal phosphate-L-lysine	cytoplasm|nucleus	cystathionine gamma-lyase activity|L-cysteine desulfhydrase activity|pyridoxal phosphate binding			lung(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	TCGCCTGATCCTTCTGTCTCTCC	0.542													42	44	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114301137	114301137	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114301137delT	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc010own.1_Intron|PHTF1_uc001edp.2_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTGTACATCTTTTTTTTTTT	0.388													7	5	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153790790	153790790	+	Intron	DEL	C	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790790delC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCAAGGttttctttttttttt	0.189													3	3	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153800931	153800932	+	Intron	INS	-	AC	AC	rs144104082	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800931_153800932insAC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTCTcacacatacacacacaca	0.233													6	5	---	---	---	---	
FAM5B	57795	broad.mit.edu	37	1	177250856	177250857	+	3'UTR	DEL	AC	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250856_177250857delAC	uc001glf.2	+	8					FAM5B_uc001glg.2_3'UTR	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						GCGcacgcatacacacacacac	0.441													4	2	---	---	---	---	
ACBD6	84320	broad.mit.edu	37	1	180471041	180471041	+	Intron	DEL	A	-	-	rs5779061		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180471041delA	uc001gog.2	-							NM_032360	NP_115736	Q9BR61	ACBD6_HUMAN	acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1						GCAGATGGTCAAAAAAAAAAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11060846	11060847	+	IGR	INS	-	TG	TG	rs149638295	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11060846_11060847insTG								KCNF1 (6496 upstream) : C2orf50 (212332 downstream)																							gtgcgtgtgcctgtgtgtgtgt	0.386													4	2	---	---	---	---	
EPAS1	2034	broad.mit.edu	37	2	46611722	46611723	+	Frame_Shift_Del	DEL	GT	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46611722_46611723delGT	uc002ruv.2	+	16	3024_3025	c.2536_2537delGT	c.(2536-2538)GTGfs	p.V846fs	EPAS1_uc002ruw.2_Frame_Shift_Del_p.V312fs	NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	846	CTAD.				angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TGACTGTGAGGTGAACGTGCCC	0.609													129	72	---	---	---	---	
SFTPB	6439	broad.mit.edu	37	2	85894569	85894569	+	Intron	DEL	C	-	-	rs3024797		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85894569delC	uc002sqh.2	-						SFTPB_uc002sqi.2_Intron|SFTPB_uc002sqj.2_Intron	NM_198843	NP_942140	P07988	PSPB_HUMAN	surfactant, pulmonary-associated protein B						organ morphogenesis|respiratory gaseous exchange|sphingolipid metabolic process	extracellular space|lysosome				ovary(1)|central_nervous_system(1)	2						cctatcctatcccttcccctc	0.015													2	5	---	---	---	---	
RGPD4	285190	broad.mit.edu	37	2	108479623	108479623	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108479623delT	uc010ywk.1	+						RGPD4_uc002tdu.2_Intron|RGPD4_uc010ywl.1_Intron	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4						intracellular transport		binding			skin(2)	2						CATTTTGGTCttttttttttt	0.234													11	5	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47125280	47125289	+	Frame_Shift_Del	DEL	TCTTGGCTCC	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47125280_47125289delTCTTGGCTCC	uc003cqs.2	-	12	6034_6043	c.5981_5990delGGAGCCAAGA	c.(5980-5991)AGGAGCCAAGAAfs	p.R1994fs	SETD2_uc003cqv.2_Frame_Shift_Del_p.R2061fs|SETD2_uc003cqt.1_RNA	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1994_1997					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATCTGGCTGTTCTTGGCTCCTTTCACTCTC	0.433			N|F|S|Mis		clear cell renal carcinoma								95	117	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52643396	52643396	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52643396delA	uc003des.2	-	16	2512	c.2500delT	c.(2500-2502)TACfs	p.Y834fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.Y834fs|PBRM1_uc003der.2_Frame_Shift_Del_p.Y802fs|PBRM1_uc003det.2_Frame_Shift_Del_p.Y849fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.Y849fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.Y834fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.Y834fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.Y834fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.Y834fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.Y747fs|PBRM1_uc003dfa.1_Frame_Shift_Del_p.Y180fs|PBRM1_uc003dfc.2_Frame_Shift_Del_p.Y201fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	834	Bromo 6.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGCCGACGGTAGCGATTATTT	0.373			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								37	72	---	---	---	---	
NAA50	80218	broad.mit.edu	37	3	113459588	113459588	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113459588delT	uc003ean.1	-						NAA50_uc010hqm.1_5'Flank|NAA50_uc011bij.1_Intron	NM_025146	NP_079422	Q9GZZ1	NAA50_HUMAN	N-acetyltransferase 13						N-terminal protein amino acid acetylation	cytoplasm	N-acetyltransferase activity|protein binding				0						ACATTTTTTCTTTTTTTTTTT	0.239													4	2	---	---	---	---	
DZIP1L	199221	broad.mit.edu	37	3	137811006	137811007	+	Intron	INS	-	TAAC	TAAC	rs140644204	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137811006_137811007insTAAC	uc003erq.2	-						DZIP1L_uc003err.1_Intron	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like							intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						catgaggaggttaactcattca	0.089													3	5	---	---	---	---	
COPB2	9276	broad.mit.edu	37	3	139086136	139086136	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139086136delT	uc003etf.3	-						COPB2_uc011bmv.1_Intron|COPB2_uc010hui.2_Intron	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						TTCCTTGGAAttttttttttt	0.149													4	2	---	---	---	---	
C4orf50	389197	broad.mit.edu	37	4	5981742	5981742	+	Intron	DEL	G	-	-	rs60012784	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5981742delG	uc003git.1	-							NM_207405	NP_997288	Q6ZRC1	CD050_HUMAN	hypothetical protein LOC389197											pancreas(2)|breast(1)	3						GTTTTTTGTTGTTTTTTTTTT	0.373													6	3	---	---	---	---	
ABLIM2	84448	broad.mit.edu	37	4	8009586	8009587	+	Intron	INS	-	C	C			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8009586_8009587insC	uc003gko.2	-						ABLIM2_uc003gkk.2_Intron|ABLIM2_uc003gkl.2_Intron|ABLIM2_uc003gkj.3_Intron|ABLIM2_uc003gkm.3_Intron|ABLIM2_uc003gkp.2_Intron|ABLIM2_uc003gkq.2_Intron|ABLIM2_uc003gkr.2_Intron|ABLIM2_uc003gks.3_3'UTR|MIR95_hsa-mir-95|MI0000097_5'Flank	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2						axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						GCACACTGGCTCGGGGACAGTT	0.535													4	4	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39827205	39827205	+	Intron	DEL	T	-	-	rs72009420		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39827205delT	uc003guv.3	-						PDS5A_uc010ifo.2_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						ATCTAAAATCttttttttttt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	70257546	70257547	+	IGR	DEL	TT	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70257546_70257547delTT								UGT2B28 (96779 upstream) : UGT2B4 (88337 downstream)																							GTAAGGAGACTTTGAAAATAGA	0.257													3	3	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	93806086	93806087	+	Intron	INS	-	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93806086_93806087insA	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TTGGTCTCCCCAAAAAAAAAAA	0.342													5	3	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5235001	5235002	+	Intron	INS	-	G	G	rs145857413	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5235001_5235002insG	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						aaaaaaaaaaagaaTCCACTTT	0.134													4	4	---	---	---	---	
ETF1	2107	broad.mit.edu	37	5	137846859	137846862	+	Frame_Shift_Del	DEL	GTGT	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137846859_137846862delGTGT	uc003ldc.3	-	8	1055_1058	c.890_893delACAC	c.(889-894)GACACGfs	p.D297fs	ETF1_uc011cyv.1_Frame_Shift_Del_p.D283fs|ETF1_uc010jex.2_RNA|ETF1_uc003ldd.3_Frame_Shift_Del_p.D264fs	NM_004730	NP_004721	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	297_298					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTACTTGCCCGTGTCCTGGCTGAT	0.377													165	77	---	---	---	---	
GABRP	2568	broad.mit.edu	37	5	170235946	170235947	+	Intron	INS	-	T	T	rs150989217	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170235946_170235947insT	uc003mau.2	+						GABRP_uc011dev.1_Intron	NM_014211	NP_055026	O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi							cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			breast(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ttttgttgttgttttttttttg	0.173													4	2	---	---	---	---	
NUP153	9972	broad.mit.edu	37	6	17669073	17669074	+	Intron	INS	-	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17669073_17669074insA	uc003ncd.1	-						NUP153_uc011dje.1_Intron|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			gactgagactcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
PREP	5550	broad.mit.edu	37	6	105777031	105777031	+	Intron	DEL	T	-	-	rs11345908		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105777031delT	uc003prc.2	-							NM_002726	NP_002717	P48147	PPCE_HUMAN	prolyl endopeptidase						proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	CACTTTTACAttttttttttt	0.169													4	2	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6840334	6840334	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6840334delT	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		TATAAAGTCATTTTTTTTTTT	0.204													7	4	---	---	---	---	
IL6	3569	broad.mit.edu	37	7	22769440	22769443	+	Intron	DEL	TTTG	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22769440_22769443delTTTG	uc011jyn.1	+						uc010kun.1_5'Flank|IL6_uc011jyo.1_3'UTR|IL6_uc011jyp.1_3'UTR|IL6_uc003svj.3_Intron|IL6_uc011jyq.1_3'UTR	NM_000600	NP_000591	P05231	IL6_HUMAN	interleukin 6 precursor						acute-phase response|cellular response to hydrogen peroxide|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|defense response to virus|endocrine pancreas development|glucagon secretion|hepatic immune response|interleukin-6-mediated signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of chemokine biosynthetic process|negative regulation of collagen biosynthetic process|negative regulation of fat cell differentiation|negative regulation of lipid storage|neuron projection development|neutrophil apoptosis|platelet activation|positive regulation of acute inflammatory response|positive regulation of anti-apoptosis|positive regulation of B cell activation|positive regulation of chemokine production|positive regulation of immunoglobulin secretion|positive regulation of interleukin-6 production|positive regulation of osteoblast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of smooth muscle cell proliferation|positive regulation of T cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of translation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of vascular endothelial growth factor production|response to glucocorticoid stimulus|response to peptidoglycan	extracellular space|interleukin-6 receptor complex	cytokine activity|growth factor activity|interleukin-6 receptor binding				0					Arsenic trioxide(DB01169)|Bicalutamide(DB01128)|Ginseng(DB01404)|Simvastatin(DB00641)	TAAATCTTTTTTTGTTTGTTTGGT	0.333													4	5	---	---	---	---	
SPDYE1	285955	broad.mit.edu	37	7	44043625	44043625	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44043625delT	uc003tjf.2	+						POLR2J4_uc003tjc.2_Intron|POLR2J4_uc003tjd.2_Intron|POLR2J4_uc010kxw.2_Intron|POLR2J4_uc003tje.3_Intron	NM_175064	NP_778234	Q8NFV5	SPDE1_HUMAN	Williams Beuren syndrome chromosome region 19											ovary(1)	1						TCCTACAGtcttttttttttt	0.289													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142448200	142448207	+	Intron	DEL	GGTGGAAA	-	-	rs112413030	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142448200_142448207delGGTGGAAA	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc011ksl.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		GTTAACACTGGGTGGAAAGGTGGAAAGA	0.457													4	2	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144380279	144380279	+	Intron	DEL	T	-	-	rs137896700		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144380279delT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	tttctgcatcttttttttttt	0.129													4	2	---	---	---	---	
SLC25A32	81034	broad.mit.edu	37	8	104413535	104413536	+	Intron	INS	-	C	C	rs146562515	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104413535_104413536insC	uc003yll.2	-						SLC25A32_uc011lhr.1_Intron	NM_030780	NP_110407	Q9H2D1	MFTC_HUMAN	solute carrier family 25, member 32						folic acid metabolic process|mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding|folic acid transporter activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	aacctattagttagaaagtctt	0.059													2	6	---	---	---	---	
PLAA	9373	broad.mit.edu	37	9	26908166	26908167	+	Intron	DEL	TT	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26908166_26908167delTT	uc003zqd.2	-						PLAA_uc003zqe.2_Intron	NM_001031689	NP_001026859	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein						phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		GAGCtttgtctttttttttttt	0.168													4	2	---	---	---	---	
PRPF4	9128	broad.mit.edu	37	9	116052508	116052508	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116052508delA	uc004bgx.2	+						PRPF4_uc004bgy.2_Intron	NM_004697	NP_004688	O43172	PRP4_HUMAN	PRP4 pre-mRNA processing factor 4 homolog							Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding			ovary(2)|pancreas(1)	3						tcaaaagaagaaaaaaaaaaa	0.189													5	3	---	---	---	---	
OLFML2A	169611	broad.mit.edu	37	9	127549029	127549032	+	Intron	DEL	ACAC	-	-	rs149733353		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127549029_127549032delACAC	uc004bov.2	+						OLFML2A_uc010mwr.1_Intron	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor												0						AGAGACGTAGacacacacacacac	0.157													4	2	---	---	---	---	
C9orf114	51490	broad.mit.edu	37	9	131590774	131590775	+	Intron	INS	-	A	A	rs35247950		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131590774_131590775insA	uc004bwd.2	-						C9orf114_uc004bwe.2_Intron|C9orf114_uc010mym.2_Intron	NM_016390	NP_057474	Q5T280	CI114_HUMAN	hypothetical protein LOC51490												0						gactccatctcaaaaaaaaaaa	0.153													6	3	---	---	---	---	
ADAMTS13	11093	broad.mit.edu	37	9	136291396	136291396	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136291396delG	uc004cdv.3	+	6	1061	c.617delG	c.(616-618)TGGfs	p.W206fs	ADAMTS13_uc004cdp.3_5'UTR|ADAMTS13_uc004cdt.1_Frame_Shift_Del_p.W206fs|ADAMTS13_uc004cdu.1_Frame_Shift_Del_p.W206fs|ADAMTS13_uc004cdw.3_Frame_Shift_Del_p.W206fs|ADAMTS13_uc004cdx.3_Frame_Shift_Del_p.W206fs|ADAMTS13_uc004cdy.1_5'Flank|ADAMTS13_uc004cdq.1_Frame_Shift_Del_p.W206fs|ADAMTS13_uc004cds.1_Frame_Shift_Del_p.G36fs|ADAMTS13_uc004cdr.1_RNA	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	206	Peptidase M12B.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		TCCCCAACCTGGAGCTGCCTC	0.607													37	18	---	---	---	---	
WDR85	92715	broad.mit.edu	37	9	140459472	140459472	+	Intron	DEL	G	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140459472delG	uc004cnk.1	-						WDR85_uc004cnj.1_5'Flank|WDR85_uc004cnl.1_Intron|WDR85_uc004cnm.1_5'UTR|WDR85_uc004cnn.1_Intron|WDR85_uc010ncl.1_Intron	NM_138778	NP_620133	Q9BTV6	WDR85_HUMAN	WD repeat domain 85						peptidyl-diphthamide biosynthetic process from peptidyl-histidine						0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.00029)|Epithelial(140;0.000509)		GGGAACGGGAGGGCTGGTGAC	0.622													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135454782	135454784	+	IGR	DEL	AAG	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135454782_135454784delAAG								FRG2B (14483 upstream) : LOC653544 (35495 downstream)																							AAGTGTAGACAAGAGGGTCATCT	0.438													4	6	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	16180412	16180413	+	Intron	DEL	GT	-	-	rs10549567		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16180412_16180413delGT	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						gaagttacaggtgtgtgtgtgt	0.025													2	5	---	---	---	---	
OR8H2	390151	broad.mit.edu	37	11	55872323	55872324	+	5'Flank	INS	-	T	T	rs113669153		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872323_55872324insT	uc010riy.1	+							NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					Gtttttttttgtttgttttttg	0.109										HNSCC(53;0.14)			4	2	---	---	---	---	
SLC3A2	6520	broad.mit.edu	37	11	62655423	62655423	+	Intron	DEL	C	-	-	rs34176851		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62655423delC	uc001nwd.2	+						SLC3A2_uc001nwb.2_Intron|SLC3A2_uc001nwc.2_Intron|SLC3A2_uc001nwe.2_Intron|SLC3A2_uc001nwf.2_Intron|SLC3A2_uc001nwg.2_Intron	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c						blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						taacactacacccagctaatt	0.000													6	3	---	---	---	---	
TMPRSS13	84000	broad.mit.edu	37	11	117772788	117772789	+	3'UTR	DEL	CA	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117772788_117772789delCA	uc001prs.1	-	13					TMPRSS13_uc009yzr.1_3'UTR	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		cacacatatgcacacacacaca	0.416													5	4	---	---	---	---	
PPFIA2	8499	broad.mit.edu	37	12	81655693	81655693	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81655693delT	uc001szo.1	-						PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_Intron|PPFIA2_uc010suh.1_Intron|PPFIA2_uc010suf.1_Intron|PPFIA2_uc009zsh.2_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2											ovary(3)|lung(2)|pancreas(1)	6						TTTTTTTGTCTTTTTTTTTTT	0.403													5	3	---	---	---	---	
TSC22D1	8848	broad.mit.edu	37	13	45090339	45090339	+	Intron	DEL	A	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45090339delA	uc001uzn.3	-						TSC22D1_uc001uzo.1_Intron	NM_183422	NP_904358	Q15714	T22D1_HUMAN	TSC22 domain family, member 1 isoform 1						transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		CTATGCTACTAAAAAAAAAGT	0.388													4	2	---	---	---	---	
THSD1P1	374500	broad.mit.edu	37	13	52803642	52803642	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52803642delT	uc001vgm.1	-						uc001vgn.2_Intron					Homo sapiens cDNA FLJ14630 fis, clone NT2RP2000459.												0						CAGTTTTCCCTTTTTTTTTTT	0.328													3	3	---	---	---	---	
CDH24	64403	broad.mit.edu	37	14	23521190	23521190	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23521190delC	uc001wil.2	-	9	1726	c.1466delG	c.(1465-1467)GGAfs	p.G489fs	CDH24_uc001wik.3_5'Flank|CDH24_uc010akf.2_Intron	NM_022478	NP_071923	Q86UP0	CAD24_HUMAN	cadherin-like 24 isoform 1	489	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|cell-cell adhesion|homophilic cell adhesion	cell-cell junction|cell-cell junction|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|delta-catenin binding			central_nervous_system(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		TTGGGGGATTCCCACAGCGCT	0.627													4	2	---	---	---	---	
EML5	161436	broad.mit.edu	37	14	89124421	89124423	+	Intron	DEL	ACC	-	-	rs143248735		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89124421_89124423delACC	uc001xxg.2	-						EML5_uc001xxf.2_Intron|EML5_uc001xxh.1_Intron	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3						TAAAAACAGTACCACTACAATTA	0.266													7	10	---	---	---	---	
SPTBN5	51332	broad.mit.edu	37	15	42171798	42171799	+	Intron	INS	-	G	G	rs141761744	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42171798_42171799insG	uc001zos.2	-							NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5						actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCAGACTGGCTGTCCCTTGCCC	0.644													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102299886	102299887	+	5'Flank	INS	-	G	G			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102299886_102299887insG	uc002bzh.1	-						uc002bzk.2_5'Flank|uc002bzn.2_5'Flank|uc010uso.1_5'Flank|uc002bzs.2_5'Flank|uc010usv.1_5'Flank|uc002cal.2_5'Flank|uc002cam.2_5'Flank|uc010usx.1_5'Flank|uc002cao.2_5'Flank|uc002cap.2_5'Flank|uc002caq.2_5'Flank|uc010usz.1_5'Flank|uc010uta.1_5'Flank|uc002cas.2_5'Flank|uc002cat.1_5'Flank|uc002cau.2_5'Flank|uc010utb.1_5'Flank|uc002cav.2_5'Flank|uc002caw.2_5'Flank|uc002cax.2_5'Flank|uc010utc.1_5'Flank|uc002cay.2_5'Flank|uc002cbb.2_5'Flank|uc002cbc.1_5'Flank|uc002cbd.2_5'Flank|uc002cbe.2_5'Flank|uc002cbg.2_5'Flank|uc002cbh.2_5'Flank|uc002cbi.2_5'Flank|uc002cbk.2_5'Flank|uc002cbl.2_5'Flank|uc010utd.1_5'Flank					DQ575740																		AACCTGTACTCGCGTCGGAACC	0.589													3	3	---	---	---	---	
SRL	6345	broad.mit.edu	37	16	4254404	4254407	+	Intron	DEL	AGAT	-	-	rs111601443	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4254404_4254407delAGAT	uc002cvz.3	-						SRL_uc002cvy.3_Intron	NM_001098814	NP_001092284	Q86TD4	SRCA_HUMAN	sarcalumenin							sarcoplasmic reticulum lumen	GTP binding|GTPase activity			ovary(3)|skin(2)	5						CCAGCCTCCAAGATAGATACAGCC	0.667													4	2	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700254	14700255	+	Intron	DEL	GA	-	-	rs113976422		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700254_14700255delGA	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						gaccctgagggaaaaaaaaaaa	0.139													8	5	---	---	---	---	
LPCAT2	54947	broad.mit.edu	37	16	55571300	55571300	+	Intron	DEL	C	-	-	rs111668979		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55571300delC	uc002eie.3	+						LPCAT2_uc002eic.2_Intron	NM_017839	NP_060309	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2						cellular membrane organization|platelet activating factor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|Golgi stack|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding				0						aagaccctgtccccaaaaaaa	0.144													5	4	---	---	---	---	
MMP15	4324	broad.mit.edu	37	16	58072113	58072114	+	Intron	DEL	AC	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58072113_58072114delAC	uc002ena.2	+							NM_002428	NP_002419	P51511	MMP15_HUMAN	matrix metalloproteinase 15 preproprotein						protein modification process|proteolysis	extracellular matrix|integral to plasma membrane	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|protein binding|zinc ion binding			central_nervous_system(2)|breast(1)	3						CAGTGCCAGAACAGGCAGGTGT	0.634													34	17	---	---	---	---	
ZDHHC1	29800	broad.mit.edu	37	16	67439929	67439931	+	Intron	DEL	GGT	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67439929_67439931delGGT	uc010vjm.1	-							NM_013304	NP_037436	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1							integral to membrane	DNA binding|zinc ion binding				0		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		GGAGAGGTCAGGTGGAGGCTGGA	0.586													2	4	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81155068	81155069	+	Intron	INS	-	A	A			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81155068_81155069insA	uc002fgh.1	-						PKD1L2_uc002fgf.1_Intron|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gactccatctcaaaaaaaaaaa	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	3895191	3895191	+	IGR	DEL	C	-	-	rs145456066		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3895191delC								ATP2A3 (27455 upstream) : ZZEF1 (12549 downstream)																							ttccttccttcccttcccttc	0.075													4	2	---	---	---	---	
MRM1	79922	broad.mit.edu	37	17	34963890	34963890	+	Intron	DEL	A	-	-	rs35964238		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34963890delA	uc002hne.2	+						MRM1_uc002hnf.2_Intron	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog						RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		acctcatctcaaaaaaaaaaa	0.000													5	4	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	63747018	63747018	+	Intron	DEL	A	-	-	rs75469128		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63747018delA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			CTTAAAAAGCAAAAAAAAAAA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13709283	13709291	+	IGR	DEL	AAGGAAGGA	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13709283_13709291delAAGGAAGGA								CACNA1A (92009 upstream) : CCDC130 (133283 downstream)																							aaaaggaaggaaggaaggaaaggaaggaa	0.000											OREG0025297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
HIF3A	64344	broad.mit.edu	37	19	46811257	46811260	+	Intron	DEL	AGAT	-	-	rs59642371	by1000genomes	TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46811257_46811260delAGAT	uc002peh.2	+						HIF3A_uc002pef.1_Intron|HIF3A_uc002peg.3_Intron|HIF3A_uc010xxx.1_Intron|HIF3A_uc002pei.3_Intron|HIF3A_uc002pej.1_Intron|HIF3A_uc002pek.2_Intron|HIF3A_uc010xxy.1_Intron|HIF3A_uc002pel.2_Intron|HIF3A_uc010xxz.1_Intron	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		acagacagacagatagatagatag	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54275959	54275959	+	IGR	DEL	C	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54275959delC								MIR519A2 (10275 upstream) : MIR371 (14970 downstream)																							ACAATATATACCCCAAGGATA	0.423													14	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	59524822	59524825	+	IGR	DEL	GGAA	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59524822_59524825delGGAA								MIR646 (641197 upstream) : CDH4 (302734 downstream)																							atggatggagggaaggaaggaagg	0.000													4	2	---	---	---	---	
MEI1	150365	broad.mit.edu	37	22	42128780	42128781	+	Intron	INS	-	T	T	rs11463943		TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42128780_42128781insT	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						ggattgaaaaattttttttttt	0.000													4	3	---	---	---	---	
SEPT6	23157	broad.mit.edu	37	X	118759508	118759508	+	Intron	DEL	T	-	-			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118759508delT	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						ACTGATACTCttttttttttt	0.244													4	2	---	---	---	---	
ZNF275	10838	broad.mit.edu	37	X	152612156	152612157	+	Intron	INS	-	T	T			TCGA-B8-4620-01A-01D-1553-08	TCGA-B8-4620-11A-01D-1553-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152612156_152612157insT	uc004fhg.1	+						ZNF275_uc011mym.1_Intron|ZNF275_uc011myn.1_Intron			A6NFS0	A6NFS0_HUMAN	SubName: Full=cDNA FLJ16723 fis, clone UTERU3004418, highly similar to Zinc finger protein 275; SubName: Full=Putative uncharacterized protein ZNF275;							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTTCTGGTGGCTTCCGGGCCCA	0.574													4	2	---	---	---	---	
