Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RLF	6018	broad.mit.edu	37	1	40701710	40701710	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40701710C>T	uc001cfc.3	+	8	1367	c.1336C>T	c.(1336-1338)CCG>TCG	p.P446S	RLF_uc001cfd.3_Missense_Mutation_p.P137S	NM_012421	NP_036553	Q13129	RLF_HUMAN	rearranged L-myc fusion	446					chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			ovary(2)|pancreas(1)	3	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			AGAAAATGCACCGGTTCCAAA	0.368													14	242	---	---	---	---	PASS
LGR6	59352	broad.mit.edu	37	1	202287589	202287589	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202287589T>G	uc001gxu.2	+	18	2158	c.2158T>G	c.(2158-2160)TAC>GAC	p.Y720D	LGR6_uc001gxv.2_Missense_Mutation_p.Y668D|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Missense_Mutation_p.Y581D	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	720	Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						CTGCCTGCCCTACGCGCCACC	0.672													6	26	---	---	---	---	PASS
C1orf124	83932	broad.mit.edu	37	1	231488560	231488560	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231488560G>A	uc001hur.2	+	5	1371	c.923G>A	c.(922-924)GGT>GAT	p.G308D	C1orf124_uc001hus.2_3'UTR|C1orf124_uc001hut.2_3'UTR	NM_032018	NP_114407	Q9H040	CA124_HUMAN	hypothetical protein LOC83932 isoform a	308					DNA repair	nuclear speck	DNA binding|metal ion binding				0	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				GAACAGAATGGTTCAAGTAAA	0.348													7	114	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188321	10188321	+	Splice_Site	SNP	G	T	T	rs5030814		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188321G>T	uc003bvc.2	+	2	676	c.463_splice	c.e2+1	p.V155_splice	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1						anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(9)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		ACACTGCCAGGTACTGACGTT	0.403		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				26	131	---	---	---	---	PASS
C3orf62	375341	broad.mit.edu	37	3	49314185	49314185	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49314185A>G	uc003cwn.2	-	1	324	c.121T>C	c.(121-123)TGC>CGC	p.C41R	C3orf62_uc003cwm.2_5'Flank	NM_198562	NP_940964	Q6ZUJ4	CC062_HUMAN	hypothetical protein LOC375341	41											0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGGCCTGTGCACTCCTGGGAA	0.557													12	43	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155199797	155199797	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155199797G>A	uc011bok.1	-	23	4319	c.4042C>T	c.(4042-4044)CCC>TCC	p.P1348S	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.P1310S	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1348					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CAGAGAGTGGGATCAGCTATT	0.473													6	91	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19483487	19483487	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19483487G>C	uc003jgc.2	-	11	2182	c.1805C>G	c.(1804-1806)GCA>GGA	p.A602G	CDH18_uc003jgd.2_Missense_Mutation_p.A602G|CDH18_uc011cnm.1_Missense_Mutation_p.Q566E	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	602	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GAAGGCTTCTGCATGGCAGGT	0.522													4	26	---	---	---	---	PASS
SAR1B	51128	broad.mit.edu	37	5	133948437	133948437	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133948437T>A	uc003kzq.2	-	5	435	c.188A>T	c.(187-189)GAA>GTA	p.E63V	SAR1B_uc003kzr.2_Missense_Mutation_p.E63V	NM_001033503	NP_001028675	Q9Y6B6	SAR1B_HUMAN	SAR1a gene homolog 2	63					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi cisterna membrane	GTP binding|GTPase activity|metal ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATGGTCAGTTCTTCGGAAGC	0.214													56	210	---	---	---	---	PASS
PCDHGB3	56102	broad.mit.edu	37	5	140751808	140751808	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140751808T>A	uc003ljw.1	+	1	1847	c.1847T>A	c.(1846-1848)CTG>CAG	p.L616Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Missense_Mutation_p.L616Q|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	616	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCCCGGGCTGTTCAGCCTG	0.687													22	60	---	---	---	---	PASS
ITK	3702	broad.mit.edu	37	5	156641308	156641308	+	Silent	SNP	C	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156641308C>T	uc003lwo.1	+	4	514	c.432C>T	c.(430-432)GCC>GCT	p.A144A		NM_005546	NP_005537	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	144	Btk-type.				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CAGGCTGTGCCCAATATGATC	0.408			T	SYK	peripheral T-cell lymphoma								10	121	---	---	---	---	PASS
SLC34A1	6569	broad.mit.edu	37	5	176825284	176825284	+	Silent	SNP	C	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176825284C>A	uc003mgk.3	+	13	2018	c.1917C>A	c.(1915-1917)CTC>CTA	p.L639L		NM_003052	NP_003043	Q06495	NPT2A_HUMAN	solute carrier family 34 (sodium phosphate),	639	Cytoplasmic (Potential).				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCACCCGCCTCTAGGCTGTGG	0.662													20	59	---	---	---	---	PASS
RIPK1	8737	broad.mit.edu	37	6	3113551	3113551	+	Nonsense_Mutation	SNP	T	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3113551T>A	uc010jni.2	+	11	2226	c.1994T>A	c.(1993-1995)TTG>TAG	p.L665*	RIPK1_uc003muv.3_Nonsense_Mutation_p.L502*|RIPK1_uc003muw.3_Nonsense_Mutation_p.L600*|RIPK1_uc011dhs.1_Nonsense_Mutation_p.L619*|RIPK1_uc003mux.2_Nonsense_Mutation_p.L665*	NM_003804	NP_003795	Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine	665	Death.				activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				CTGAGCAGCTTGATTTACGTC	0.562													9	23	---	---	---	---	PASS
RSPO2	340419	broad.mit.edu	37	8	109094887	109094887	+	5'UTR	SNP	G	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109094887G>C	uc003yms.2	-	2					RSPO2_uc003ymq.2_5'Flank|RSPO2_uc003ymr.2_5'UTR	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			GGGCGGGGGAGAGACGCCTCT	0.622													2	16	---	---	---	---	PASS
TRHR	7201	broad.mit.edu	37	8	110131518	110131518	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110131518A>C	uc003ymz.3	+	2	1047	c.1031A>C	c.(1030-1032)AAA>ACA	p.K344T		NM_003301	NP_003292	P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	344	Cytoplasmic (Potential).					integral to plasma membrane	thyrotropin-releasing hormone receptor activity			skin(2)|lung(1)	3			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CCAACAGAGAAACCTGCTAAC	0.473													28	166	---	---	---	---	PASS
C9orf117	286207	broad.mit.edu	37	9	130475074	130475074	+	Silent	SNP	C	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130475074C>A	uc004brn.1	+	7	1264	c.1224C>A	c.(1222-1224)CTC>CTA	p.L408L	PTRH1_uc004brm.2_Intron|C9orf117_uc010mxl.1_RNA	NM_001012502	NP_001012520	Q5JU67	CI117_HUMAN	hypothetical protein LOC286207	408											0						TGGTCATGCTCAGCTCCACTG	0.592													3	27	---	---	---	---	PASS
LRRC8A	56262	broad.mit.edu	37	9	131678652	131678652	+	3'UTR	SNP	C	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131678652C>T	uc004bwl.3	+	4					LRRC8A_uc010myp.2_3'UTR|LRRC8A_uc010myq.2_3'UTR	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member						pre-B cell differentiation	integral to membrane					0						CAGGCCTGAGCGAGGCCGGCC	0.672													6	19	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108040715	108040715	+	Silent	SNP	C	G	G			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108040715C>G	uc001pjz.3	-	14	2943	c.2841G>C	c.(2839-2841)GGG>GGC	p.G947G	NPAT_uc010rvv.1_Silent_p.G3G	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	947					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		CTGGGATCATCCCTACCATTC	0.388													24	151	---	---	---	---	PASS
SLC37A4	2542	broad.mit.edu	37	11	118897701	118897701	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118897701T>C	uc010rys.1	-	7	1487	c.730A>G	c.(730-732)ACT>GCT	p.T244A	SLC37A4_uc009zam.2_RNA|SLC37A4_uc009zan.2_RNA|SLC37A4_uc010ryr.1_Missense_Mutation_p.T244A|SLC37A4_uc010ryt.1_Missense_Mutation_p.T171A|SLC37A4_uc001pus.2_Missense_Mutation_p.T244A	NM_001164277	NP_001157749	O43826	G6PT1_HUMAN	solute carrier family 37 (glucose-6-phosphate	244					glucose homeostasis|glucose metabolic process	endoplasmic reticulum membrane|integral to endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphate transmembrane transporter activity|glucose-6-phosphate transmembrane transporter activity			large_intestine(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		CCCCAGTCAGTACAGCAGGTC	0.547									Glycogen_Storage_Disease_type_Ib				7	22	---	---	---	---	PASS
SLC38A1	81539	broad.mit.edu	37	12	46623010	46623010	+	Silent	SNP	T	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46623010T>C	uc001rpa.2	-	5	498	c.240A>G	c.(238-240)CTA>CTG	p.L80L	SLC38A1_uc001rpb.2_Silent_p.L80L|SLC38A1_uc001rpc.2_Silent_p.L80L|SLC38A1_uc001rpd.2_Silent_p.L80L|SLC38A1_uc001rpe.2_Silent_p.L80L|SLC38A1_uc010slh.1_Silent_p.L53L|SLC38A1_uc009zkj.1_Silent_p.L80L	NM_030674	NP_109599	Q9H2H9	S38A1_HUMAN	amino acid transporter system A1	80	Helical; (Potential).				cellular nitrogen compound metabolic process|neurotransmitter uptake	integral to membrane|plasma membrane	sodium:amino acid symporter activity			ovary(2)|skin(2)|central_nervous_system(1)	5	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			TGGCGTTGCTTAGGTTAAAAA	0.433													10	29	---	---	---	---	PASS
KRT84	3890	broad.mit.edu	37	12	52774232	52774232	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52774232C>G	uc001sah.1	-	7	1387	c.1339G>C	c.(1339-1341)GAG>CAG	p.E447Q		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	447	Rod.|Coil 2.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCTGGTACTCGCACAGCTGC	0.632											OREG0021848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	41	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56495609	56495609	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56495609C>T	uc001sjh.2	+	28	3992	c.3799C>T	c.(3799-3801)CGA>TGA	p.R1267*	ERBB3_uc009zoj.2_RNA|ERBB3_uc010sqb.1_Nonsense_Mutation_p.R624*|ERBB3_uc010sqc.1_Nonsense_Mutation_p.R1208*|ERBB3_uc009zok.2_Nonsense_Mutation_p.R532*|ERBB3_uc001sjk.2_Nonsense_Mutation_p.R508*|ERBB3_uc001sjl.2_Nonsense_Mutation_p.R387*|PA2G4_uc001sjm.2_5'Flank|PA2G4_uc009zol.2_5'Flank|PA2G4_uc009zom.2_5'Flank	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	1267	Cytoplasmic (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GAATCGGCAACGAGATGGAGG	0.552													19	101	---	---	---	---	PASS
ZNF286B	729288	broad.mit.edu	37	17	18575065	18575065	+	Intron	SNP	C	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18575065C>A	uc010vyd.1	-						FOXO3B_uc010vye.1_RNA	NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTGATGTTATCCAGCAGGTCG	0.592													4	31	---	---	---	---	PASS
LRRC37B	114659	broad.mit.edu	37	17	30348328	30348328	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30348328C>T	uc002hgu.2	+	1	174	c.163C>T	c.(163-165)CTC>TTC	p.L55F	LRRC37B_uc010wbx.1_Intron|LRRC37B_uc010csu.2_Missense_Mutation_p.L55F	NM_052888	NP_443120	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B precursor	55	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				CTCCTCCCATCTCCCATGGGA	0.642													23	127	---	---	---	---	PASS
DUSP14	11072	broad.mit.edu	37	17	35872566	35872566	+	Silent	SNP	T	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35872566T>C	uc002hnx.2	+	3	486	c.192T>C	c.(190-192)CCT>CCC	p.P64P	DUSP14_uc002hny.2_Silent_p.P51P|DUSP14_uc002hnz.2_Silent_p.P51P	NM_007026	NP_008957	O95147	DUS14_HUMAN	dual specificity phosphatase 14	64							MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Breast(25;0.00637)|Ovarian(249;0.15)				TTGAGATCCCTAATTTCAACT	0.532													25	69	---	---	---	---	PASS
KRTAP1-5	83895	broad.mit.edu	37	17	39183145	39183145	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39183145A>G	uc002hvu.2	-	1	310	c.263T>C	c.(262-264)ATC>ACC	p.I88T		NM_031957	NP_114163	Q9BYS1	KRA15_HUMAN	keratin associated protein 1.5	88	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament					0		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			GCAGGAGCTGATCTGGCAGCA	0.632													3	21	---	---	---	---	PASS
ZC3H4	23211	broad.mit.edu	37	19	47588443	47588443	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47588443C>A	uc002pga.3	-	8	1015	c.977G>T	c.(976-978)CGA>CTA	p.R326L	ZC3H4_uc002pgb.1_RNA	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	326	Gly-rich.						nucleic acid binding|zinc ion binding			skin(4)|ovary(2)	6		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GCCACGGCCTCGACTTAGCCC	0.647													4	36	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	11014952	11014952	+	RNA	SNP	A	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11014952A>T	uc002yis.1	-	7		c.1494T>A						P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CACATTGTCTACATTGCAGAA	0.333													4	79	---	---	---	---	PASS
DDTL	100037417	broad.mit.edu	37	22	24313682	24313682	+	3'UTR	SNP	G	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24313682G>C	uc002zyy.3	+	3					DDT_uc011ajf.1_Intron|DDT_uc002zyz.3_3'UTR|DDT_uc002zza.3_3'UTR	NM_001084393	NP_001077862	A6NHG4	DDTL_HUMAN	D-dopachrome tautomerase-like							cytoplasm	lyase activity				0						ACTCTGCCAAGAGATCTCTCT	0.473													17	54	---	---	---	---	PASS
IL2RB	3560	broad.mit.edu	37	22	37524097	37524097	+	3'UTR	SNP	A	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37524097A>C	uc003aqv.1	-	10						NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor						interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GGCTCGGCGCAGAGCAGGCAG	0.607													2	1	---	---	---	---	PASS
SLC9A6	10479	broad.mit.edu	37	X	135080323	135080323	+	Silent	SNP	T	C	C			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135080323T>C	uc004ezj.2	+	3	562	c.486T>C	c.(484-486)TAT>TAC	p.Y162Y	SLC9A6_uc004ezk.2_Silent_p.Y194Y|SLC9A6_uc011mvx.1_Silent_p.Y142Y	NM_006359	NP_006350	Q92581	SL9A6_HUMAN	solute carrier family 9 (sodium/hydrogen	162	Helical; (Potential).				regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TCATATTTTATGCAGGTTATA	0.313													32	66	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	147743723	147743723	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147743723T>A	uc004fcp.2	+	3	954	c.475T>A	c.(475-477)TGG>AGG	p.W159R	AFF2_uc004fco.2_Missense_Mutation_p.W155R|AFF2_uc004fcq.2_Missense_Mutation_p.W155R|AFF2_uc004fcr.2_Missense_Mutation_p.W155R|AFF2_uc011mxb.1_Missense_Mutation_p.W159R|AFF2_uc004fcs.2_Missense_Mutation_p.W155R	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	159					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					AAAACCTGAGTGGTCACGTGA	0.468													6	136	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16933655	16933662	+	Intron	DEL	GGAGGGAA	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16933655_16933662delGGAGGGAA	uc009vos.1	-						NBPF1_uc001aza.3_Intron|NBPF1_uc001azb.1_RNA|NBPF1_uc001azc.1_RNA	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		aggaaagaagggagggaaggagggaagg	0.101													4	2	---	---	---	---	
GBP1	2633	broad.mit.edu	37	1	89518866	89518866	+	3'UTR	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89518866delT	uc001dmx.2	-	11						NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,						interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		ATTTACAGTCTTTTTTTTTTT	0.318													5	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145706564	145706565	+	Intron	INS	-	AA	AA			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145706564_145706565insAA	uc001emp.3	+						CD160_uc001eol.1_Intron|CD160_uc001eom.1_Intron|CD160_uc010oyz.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		gagactccctcaaaaaaaaaaa	0.228													9	5	---	---	---	---	
RGL1	23179	broad.mit.edu	37	1	183879221	183879224	+	Intron	DEL	TTCC	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183879221_183879224delTTCC	uc001gqo.2	+						RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron|RGL1_uc010poi.1_Intron	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						tctttcttctttccttccttcctt	0.000													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237955697	237955698	+	Intron	DEL	GC	-	-	rs146588202	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237955697_237955698delGC	uc001hyl.1	+						RYR2_uc010pyb.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			gtgtgtgtgtgcgtgtgtgtgt	0.109													9	5	---	---	---	---	
NCOA1	8648	broad.mit.edu	37	2	24888855	24888857	+	Intron	DEL	TTA	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24888855_24888857delTTA	uc002rfk.2	+						NCOA1_uc010eye.2_Intron|NCOA1_uc002rfi.2_Intron|NCOA1_uc002rfj.2_Intron|NCOA1_uc002rfl.2_Intron	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1										PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGATTTTACTttattattattat	0.148			T	PAX3	alveolar rhadomyosarcoma								9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	225572728	225572729	+	IGR	INS	-	CTTC	CTTC	rs146400721	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225572728_225572729insCTTC								CUL3 (122618 upstream) : DOCK10 (57078 downstream)																							ttccttcctttcttccttcctt	0.000													4	3	---	---	---	---	
CTNNB1	1499	broad.mit.edu	37	3	41279325	41279325	+	Intron	DEL	A	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41279325delA	uc010hia.1	+						CTNNB1_uc003ckp.2_Intron|CTNNB1_uc003ckq.2_Intron|CTNNB1_uc003ckr.2_Intron|CTNNB1_uc011azf.1_Intron|CTNNB1_uc011azg.1_Intron	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin						adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	GTGCAAAGAGAAAAAAAAATG	0.214		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188295533	188295540	+	Intron	DEL	GTTCCTTC	-	-	rs67188827		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295533_188295540delGTTCCTTC	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		tccttcctttgttccttcgttccttcgt	0.053			T	HMGA2|MLL|C12orf9	lipoma|leukemia								8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189283104	189283105	+	IGR	INS	-	CTCC	CTCC	rs148958439	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189283104_189283105insCTCC								TPRG1 (241834 upstream) : TP63 (66111 downstream)																							ttcttctttctctccctccctc	0.010													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7726610	7726611	+	Intron	INS	-	TGA	TGA			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7726610_7726611insTGA	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ggtgatggtggtggtgttggtg	0.000													5	3	---	---	---	---	
HMGCS1	3157	broad.mit.edu	37	5	43297956	43297956	+	Intron	DEL	G	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43297956delG	uc003jnr.3	-						HMGCS1_uc003jnp.3_5'Flank|HMGCS1_uc003jnq.3_Intron	NM_001098272	NP_001091742	Q01581	HMCS1_HUMAN	hydroxymethylglutaryl-CoA synthase 1						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0						aaaaaaaaaagaaaaaaaaac	0.020													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475785	90475786	+	IGR	INS	-	A	A	rs140241795	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475785_90475786insA								GPR98 (15753 upstream) : ARRDC3 (188755 downstream)																							aggaaggaaggaggaaggaagg	0.030													8	5	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130800137	130800138	+	Intron	INS	-	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130800137_130800138insT	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvq.2_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TAAATATATCCTTTTTTTTTTT	0.203													4	2	---	---	---	---	
FAM153C	653316	broad.mit.edu	37	5	177462772	177462775	+	Intron	DEL	GAGA	-	-	rs71585669		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177462772_177462775delGAGA	uc011dge.1	+						FAM153C_uc003mig.1_Intron	NM_001079527	NP_001072995			hypothetical protein LOC653316												0	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			gggagtaggggagagagagagaga	0.010													4	2	---	---	---	---	
RIPK1	8737	broad.mit.edu	37	6	3110842	3110842	+	Intron	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3110842delT	uc010jni.2	+						RIPK1_uc003muv.3_Intron|RIPK1_uc003muw.3_Intron|RIPK1_uc011dhs.1_Intron|RIPK1_uc003mux.2_Intron	NM_003804	NP_003795	Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine						activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				gtgttatttcttttttttttt	0.085													4	2	---	---	---	---	
RING1	6015	broad.mit.edu	37	6	33180123	33180123	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33180123delA	uc003odk.2	+	7	1362	c.1168delA	c.(1168-1170)AAGfs	p.K390fs	RING1_uc003odl.2_Frame_Shift_Del_p.K361fs	NM_002931	NP_002922	Q06587	RING1_HUMAN	ring finger protein 1	390	Necessary for interaction with CBX2 (By similarity).				histone H2A monoubiquitination|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear speck|PcG protein complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						GAAATTCTGGAAGGTGTCCCG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	53062408	53062411	+	IGR	DEL	GAAG	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53062408_53062411delGAAG								GCM1 (48784 upstream) : ELOVL5 (69785 downstream)																							GAGAGAAAGAgaaggaaggaagga	0.074													4	3	---	---	---	---	
SNAP91	9892	broad.mit.edu	37	6	84366385	84366386	+	Intron	INS	-	AAG	AAG	rs145969366	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84366385_84366386insAAG	uc011dze.1	-						SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron|SNAP91_uc011dzf.1_Intron	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		tattgcCCACCAAGTGAGACAA	0.238													7	6	---	---	---	---	
RMND1	55005	broad.mit.edu	37	6	151748510	151748511	+	Intron	INS	-	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151748510_151748511insA	uc003qoi.2	-						RMND1_uc011eeq.1_Intron	NM_017909	NP_060379	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog												0		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		gactccgtctcaaaaaaaaaaa	0.134													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	12546630	12546630	+	IGR	DEL	A	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12546630delA								VWDE (102778 upstream) : SCIN (49557 downstream)																							ATTAAGGGCCAAAAAAAAGCT	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25417776	25417791	+	IGR	DEL	TCCTTCCTCCCTTCCC	-	-	rs144541468	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25417776_25417791delTCCTTCCTCCCTTCCC								NPVF (149671 upstream) : MIR148A (571748 downstream)																							cttccttccttccttcctcccttccctccttccttc	0.000													5	3	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	33066270	33066270	+	Intron	DEL	T	-	-	rs34317509		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33066270delT	uc011kai.1	+						NT5C3_uc003tdi.2_Intron|NT5C3_uc003tdj.2_Intron|NT5C3_uc003tdk.2_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						tgcccggccAttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	101977570	101977571	+	IGR	INS	-	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101977570_101977571insT								SH2B2 (15393 upstream) : SPDYE6 (8622 downstream)																							GCATGGGTCCAttttttttttt	0.139													3	3	---	---	---	---	
BLK	640	broad.mit.edu	37	8	11361905	11361906	+	Intron	INS	-	A	A	rs71539728		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11361905_11361906insA	uc003wty.2	+						BLK_uc003wtz.2_Intron|BLK_uc003wtx.2_Intron	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase						intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		gaaaagaaaagaaaagaaaaga	0.183													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131199667	131199667	+	Intron	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131199667delT	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CGTTACACCAttttttttttt	0.159													3	3	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	91978182	91978183	+	Intron	INS	-	C	C	rs139774075	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91978182_91978183insC	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aql.2_Intron|SEMA4D_uc004aqm.2_Intron	NM_001142287	NP_001135759	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						ACGTGGGATTTCCCCCCCCAGT	0.554													5	3	---	---	---	---	
PKN3	29941	broad.mit.edu	37	9	131478876	131478876	+	Intron	DEL	C	-	-	rs10819432	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131478876delC	uc004bvw.2	+						PKN3_uc010myh.2_Intron|PKN3_uc011mbk.1_Intron	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta						signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						gactgtgtctcaaaaaaaaaa	0.229													6	3	---	---	---	---	
REXO4	57109	broad.mit.edu	37	9	136272788	136272788	+	Intron	DEL	T	-	-	rs35694504		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136272788delT	uc004cdm.2	-						REXO4_uc011mde.1_Intron|REXO4_uc011mdf.1_Intron|REXO4_uc004cdn.2_Intron|REXO4_uc004cdo.2_Intron	NM_020385	NP_065118	Q9GZR2	REXO4_HUMAN	XPMC2 prevents mitotic catastrophe 2 homolog							nucleolus	exonuclease activity|nucleic acid binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		cgctctaccattttttttttt	0.189											OREG0019587	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
CARD9	64170	broad.mit.edu	37	9	139259410	139259411	+	Intron	INS	-	AGG	AGG	rs146336925	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139259410_139259411insAGG	uc004chg.3	-						DNLZ_uc004chf.1_5'Flank|DNLZ_uc011mdv.1_5'Flank|CARD9_uc011mdw.1_Intron	NM_052813	NP_434700	Q9H257	CARD9_HUMAN	caspase recruitment domain protein 9 isoform 1						positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JNK cascade|positive regulation of stress-activated MAPK cascade|regulation of apoptosis	cytoplasm	CARD domain binding|protein homodimerization activity			pancreas(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		GTGCCCAAGAAAGGGGGATCCA	0.624													2	4	---	---	---	---	
C10orf137	26098	broad.mit.edu	37	10	127437816	127437817	+	Intron	INS	-	A	A			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127437816_127437817insA	uc001liq.1	+						C10orf137_uc001lio.1_Intron|C10orf137_uc001lip.1_Intron|C10orf137_uc001lis.1_Intron|C10orf137_uc001lit.1_5'Flank	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				gaccctgtctcaaaaaaaaaaa	0.129													4	3	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31255772	31255773	+	Intron	INS	-	G	G	rs149786035	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31255772_31255773insG	uc001rjt.1	+						DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc009zjn.1_Intron|DDX11_uc009zjo.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					ACAGTCGGAGAGGCTGAGGGAA	0.604										Multiple Myeloma(12;0.14)			4	5	---	---	---	---	
METTL7A	25840	broad.mit.edu	37	12	51324058	51324058	+	3'UTR	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51324058delT	uc001rxb.2	+	2					METTL7A_uc010smv.1_3'UTR	NM_014033	NP_054752	Q9H8H3	MET7A_HUMAN	methyltransferase like 7A precursor							endoplasmic reticulum|lipid particle|membrane	methyltransferase activity				0						TTGTTGTTGGttttttttttt	0.179													2	4	---	---	---	---	
SPIC	121599	broad.mit.edu	37	12	101873596	101873597	+	Intron	INS	-	T	T	rs35835395		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101873596_101873597insT	uc001tid.2	+						SPIC_uc009zua.2_Intron|SPIC_uc010svp.1_Intron	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						ttttttctttcttttttttttt	0.178													7	4	---	---	---	---	
RPH3A	22895	broad.mit.edu	37	12	113307382	113307382	+	Intron	DEL	A	-	-	rs113867631		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113307382delA	uc010syl.1	+						RPH3A_uc001ttz.2_Intron|RPH3A_uc001tty.2_Intron|RPH3A_uc009zwe.1_Intron|RPH3A_uc010sym.1_Intron|RPH3A_uc001tua.2_5'UTR	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1						intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		TTGTGCATGCAAAAAAAAATG	0.338													4	2	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	25074314	25074314	+	Intron	DEL	A	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25074314delA	uc001upl.2	-						PARP4_uc010tdc.1_Intron	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AGACTCAAATAAAAAATCACT	0.229													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31591123	31591126	+	IGR	DEL	TTCT	-	-	rs66956577		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31591123_31591126delTTCT								C13orf26 (41972 upstream) : HSPH1 (119639 downstream)																							ccttccttccttctttccttcctt	0.142													4	2	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347465	92347472	+	Intron	DEL	ACACACAC	-	-	rs140834248	by1000genomes	TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347465_92347472delACACACAC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTTCTATTCTacacacacacacacacac	0.207													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85795448	85795448	+	IGR	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85795448delT								PDE8A (113078 upstream) : AKAP13 (128423 downstream)																							CCAGAGCTGGTTGAGGCAAGT	0.607													4	2	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													4	2	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700253	14700254	+	Intron	INS	-	A	A	rs113976422		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700253_14700254insA	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						agaccctgagggaaaaaaaaaa	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29372347	29372348	+	Intron	INS	-	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29372347_29372348insT	uc010vct.1	-						RUNDC2C_uc010bys.1_Intron|RUNDC2C_uc002dsj.1_Intron|RUNDC2C_uc010vdo.1_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		ATGGGAGGttgttttttttttt	0.257													4	2	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20280158	20280159	+	Intron	INS	-	GC	GC	rs139801618		TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20280158_20280159insGC	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						AGCTGCGGGGAGCGCGGCCGTT	0.634													5	3	---	---	---	---	
NF1	4763	broad.mit.edu	37	17	29575850	29575850	+	Intron	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29575850delT	uc002hgg.2	+						NF1_uc002hgh.2_Intron|NF1_uc010csn.1_Intron|NF1_uc002hgi.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CAAAGTTGTCTTTTTTTTTTT	0.174			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			4	2	---	---	---	---	
CDH2	1000	broad.mit.edu	37	18	25585623	25585623	+	Intron	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25585623delT	uc002kwg.2	-						CDH2_uc010xbn.1_Intron	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein						adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						ATAAGAAGGATTTTTTTTTTG	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13304574	13304577	+	IGR	DEL	TTCC	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13304574_13304577delTTCC								IER2 (38858 upstream) : CACNA1A (12679 downstream)																							CAGTTTTGGTttccttccttcctt	0.083													4	2	---	---	---	---	
NLRP2	55655	broad.mit.edu	37	19	55505987	55505987	+	Intron	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55505987delT	uc002qij.2	+						NLRP2_uc010yfp.1_Intron|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Intron|NLRP2_uc010esp.2_Intron	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TAAGtttttgttttttttttt	0.169													4	3	---	---	---	---	
DYRK1A	1859	broad.mit.edu	37	21	38836698	38836699	+	Intron	INS	-	T	T			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38836698_38836699insT	uc002ywk.2	+						DYRK1A_uc002ywg.1_Intron|DYRK1A_uc010gno.1_Intron|DYRK1A_uc002ywh.1_Intron|DYRK1A_uc002ywi.2_Intron|DYRK1A_uc002ywj.2_Intron|DYRK1A_uc002ywl.2_Intron|DYRK1A_uc002ywm.2_Intron	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation						nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4						TTTTTCCCAAGTTTAGCAAAGT	0.351													10	6	---	---	---	---	
ATP7A	538	broad.mit.edu	37	X	77299156	77299156	+	Intron	DEL	T	-	-			TCGA-B8-5165-01A-01D-1421-08	TCGA-B8-5165-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77299156delT	uc004ecx.3	+							NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide						ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						TCCCTCCAACttttttttttt	0.129													4	3	---	---	---	---	
