Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
GBP1	2633	broad.mit.edu	37	1	89523764	89523764	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89523764A>G	uc001dmx.2	-	6	1005	c.785T>C	c.(784-786)TTT>TCT	p.F262S		NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,	262					interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		TTGTTGCACAAATTCGGGGTC	0.468													7	243	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103444415	103444415	+	Splice_Site	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103444415C>A	uc001dul.2	-	34	3027	c.2709_splice	c.e34+1	p.K903_splice	COL11A1_uc001duk.2_Splice_Site_p.K99_splice|COL11A1_uc001dum.2_Splice_Site_p.K915_splice|COL11A1_uc001dun.2_Splice_Site_p.K864_splice|COL11A1_uc009weh.2_Splice_Site_p.K787_splice	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACAGGTGATACCTTTGGCCCA	0.413													14	163	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142813127	142813127	+	Intron	SNP	A	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142813127A>T	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron|uc001ejc.2_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		TCCTTCCTTGAAGGTAATTAA	0.333													4	101	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142813129	142813129	+	Intron	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142813129G>A	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron|uc001ejc.2_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		CTTCCTTGAAGGTAATTAATT	0.338													5	108	---	---	---	---	PASS
RNF115	27246	broad.mit.edu	37	1	145686976	145686976	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145686976A>G	uc001eoj.2	+	8	872	c.668A>G	c.(667-669)GAT>GGT	p.D223G	NBPF10_uc001emp.3_Intron|RNF115_uc001eok.2_Missense_Mutation_p.D190G|RNF115_uc009wiy.2_Missense_Mutation_p.D142G	NM_014455	NP_055270	Q9Y4L5	RN115_HUMAN	Rabring 7	223					protein autoubiquitination	cytosol	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1						TCTTCAACAGATATGGGTTTA	0.388													6	352	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158655094	158655094	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158655094T>G	uc001fst.1	-	2	267	c.68A>C	c.(67-69)GAG>GCG	p.E23A		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	23	Spectrin 1.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTCCTGGATCTCTTCTGCTGT	0.378													42	241	---	---	---	---	PASS
CD247	919	broad.mit.edu	37	1	167404535	167404535	+	Intron	SNP	T	C	C	rs56387336	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167404535T>C	uc001gei.3	-						CD247_uc001gej.3_Intron|CD247_uc001gek.2_Missense_Mutation_p.Q146R	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)			gcccttcctctggagccctcc	0.179													8	158	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171510546	171510546	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171510546G>A	uc010pmg.1	+	16	4201	c.3935G>A	c.(3934-3936)CGA>CAA	p.R1312Q	BAT2L2_uc010pmh.1_Missense_Mutation_p.R289Q	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	1312							protein C-terminus binding				0						AATCATGTTCGAATAGATAAT	0.413													23	124	---	---	---	---	PASS
CFHR1	3078	broad.mit.edu	37	1	196795970	196795970	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196795970T>C	uc001gtn.2	+	3	379	c.265T>C	c.(265-267)TTT>CTT	p.F89L	CFHR1_uc001gtm.2_Intron	NM_002113	NP_002104	Q03591	FHR1_HUMAN	complement factor H-related 1 precursor	89	Sushi 2.				complement activation	extracellular space					0						ACTGTGTTTCTTTCCTTTTGT	0.318													7	548	---	---	---	---	PASS
GNPAT	8443	broad.mit.edu	37	1	231410988	231410988	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231410988A>G	uc001hup.3	+	13	1971	c.1765A>G	c.(1765-1767)AGT>GGT	p.S589G	GNPAT_uc009xfp.2_Missense_Mutation_p.S528G	NM_014236	NP_055051	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	589					ether lipid biosynthetic process|fatty acid metabolic process|organ morphogenesis	peroxisomal matrix|peroxisomal membrane	glycerone-phosphate O-acyltransferase activity			ovary(3)|breast(1)	4	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				GTACCTTTTGAGTGAAGAAGA	0.413													7	404	---	---	---	---	PASS
KIF26B	55083	broad.mit.edu	37	1	245850309	245850309	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245850309A>T	uc001ibf.1	+	12	4464	c.4024A>T	c.(4024-4026)ATC>TTC	p.I1342F	KIF26B_uc001ibg.1_Missense_Mutation_p.I960F|KIF26B_uc001ibh.1_Missense_Mutation_p.I584F	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1342					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CAACTTGCTCATCCTGTCTGA	0.552													7	81	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21229795	21229795	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21229795A>G	uc002red.2	-	26	10073	c.9945T>C	c.(9943-9945)CTT>CTC	p.L3315L		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3315					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTGGAAGAGAAAGCTTGAGAT	0.408													5	120	---	---	---	---	PASS
THUMPD2	80745	broad.mit.edu	37	2	39995606	39995606	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39995606T>C	uc002rru.2	-	4	745	c.708A>G	c.(706-708)AAA>AAG	p.K236K	THUMPD2_uc002rrv.2_RNA|THUMPD2_uc010ynt.1_Silent_p.K127K|THUMPD2_uc010ynu.1_Missense_Mutation_p.T301A	NM_025264	NP_079540	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2	236	THUMP.						methyltransferase activity			skin(1)	1		all_hematologic(82;0.248)				ATCCAAAGTGTTTCATAATAG	0.294													8	557	---	---	---	---	PASS
FLJ40330	645784	broad.mit.edu	37	2	89102234	89102234	+	Intron	SNP	C	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89102234C>G	uc010fhg.2	+						FLJ40330_uc010fhh.2_RNA|FLJ40330_uc010fhi.1_Intron	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						CATCAGGTAGCTGTGAGACAG	0.313													8	147	---	---	---	---	PASS
IL18RAP	8807	broad.mit.edu	37	2	103040773	103040773	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103040773T>C	uc002tbx.2	+	5	962	c.478T>C	c.(478-480)TCA>CCA	p.S160P	IL18RAP_uc010fiz.2_Missense_Mutation_p.S18P	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	160	Ig-like C2-type 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						gtattccgcatcacataagca	0.333													6	438	---	---	---	---	PASS
IWS1	55677	broad.mit.edu	37	2	128262502	128262502	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128262502T>C	uc002ton.2	-	3	1280	c.977A>G	c.(976-978)AAG>AGG	p.K326R	IWS1_uc010yzl.1_RNA|uc002too.1_5'Flank|IWS1_uc010fma.2_RNA	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	326	Glu-rich.				transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TGACTCTGGCTTCTGTTTGTG	0.512													7	340	---	---	---	---	PASS
TUBA3D	113457	broad.mit.edu	37	2	132240203	132240203	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132240203A>G	uc002tsu.3	+	5	1242	c.1135A>G	c.(1135-1137)AGC>GGC	p.S379G		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	379					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)		GTGCATGCTGAGCAACACCAC	0.627													4	89	---	---	---	---	PASS
MIR663B	100302269	broad.mit.edu	37	2	133015485	133015485	+	5'Flank	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133015485C>A	hsa-mir-663b|MI0006336	-						NCRNA00164_uc002ttj.3_RNA																	0						AACCCACACACAACCTGTCGG	0.697													5	56	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141055473	141055473	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141055473C>A	uc002tvj.1	-	84	13843	c.12871G>T	c.(12871-12873)GAT>TAT	p.D4291Y		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4291	Extracellular (Potential).|EGF-like 12.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGACAAAAATCCTCACAGACT	0.463										TSP Lung(27;0.18)			7	94	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152582052	152582052	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152582052T>C	uc010fnx.2	-	6	508	c.317A>G	c.(316-318)GAG>GGG	p.E106G		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	106	Nebulin 1.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTTTGTTTTCTCAAACTTCTC	0.388													8	680	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165947237	165947237	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165947237T>C	uc002ucx.2	-	28	5918	c.5426A>G	c.(5425-5427)GAG>GGG	p.E1809G	SCN3A_uc010zcy.1_Missense_Mutation_p.E292G|SCN3A_uc002ucy.2_Missense_Mutation_p.E1760G|SCN3A_uc002ucz.2_Missense_Mutation_p.E1760G	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1809						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	TTTAGAGAACTCTATAAACTG	0.468													6	352	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166785603	166785603	+	Intron	SNP	C	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166785603C>G	uc002udk.2	-						TTC21B_uc002udl.2_Missense_Mutation_p.L476F	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B							cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						CATAAAACATCAAGTAAACGC	0.318													9	60	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167056246	167056246	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167056246A>C	uc010fpl.2	-	27	5211	c.4870T>G	c.(4870-4872)TTT>GTT	p.F1624V	uc002udp.2_RNA	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1635	IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	ATCAAAGCAAAGAGCAGCGTG	0.507													12	318	---	---	---	---	PASS
MYO3B	140469	broad.mit.edu	37	2	171260862	171260862	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171260862T>C	uc002ufy.2	+	20	2526	c.2383T>C	c.(2383-2385)TTG>CTG	p.L795L	MYO3B_uc002ufv.2_Silent_p.L782L|MYO3B_uc010fqb.1_Silent_p.L782L|MYO3B_uc002ufz.2_Silent_p.L795L|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	795	Myosin head-like.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						GCTTGCACTTTTGGATGAGGA	0.478													5	119	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179473535	179473535	+	Silent	SNP	G	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179473535G>T	uc010zfg.1	-	223	44723	c.44499C>A	c.(44497-44499)ATC>ATA	p.I14833I	uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.I8528I|TTN_uc010zfi.1_Silent_p.I8461I|TTN_uc010zfj.1_Silent_p.I8336I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15760							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTAGTTTATGATTTCACTGC	0.388													28	373	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604819	179604819	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604819C>T	uc010zfh.1	-	46	12852	c.12628G>A	c.(12628-12630)GAA>AAA	p.E4210K	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.E4143K|TTN_uc010zfj.1_Missense_Mutation_p.E4018K|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	4137							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCAAGCTTTCCTTAGAAAGA	0.498													14	114	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179634658	179634658	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179634658T>C	uc010zfg.1	-	37	8874	c.8650A>G	c.(8650-8652)ATT>GTT	p.I2884V	TTN_uc010zfh.1_Missense_Mutation_p.I2838V|TTN_uc010zfi.1_Missense_Mutation_p.I2838V|TTN_uc010zfj.1_Missense_Mutation_p.I2838V|TTN_uc002unb.2_Missense_Mutation_p.I2884V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2884							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTTTGTAATATGTAATGCT	0.363													8	126	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202591238	202591238	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202591238A>G	uc002uyo.2	-	19	3573	c.3217T>C	c.(3217-3219)TCT>CCT	p.S1073P	ALS2_uc002uyp.3_Missense_Mutation_p.S1073P|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	1073	MORN 2.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						AACATGCCAGAATACATCTTT	0.333													5	248	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204000576	204000576	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204000576A>G	uc002uzt.3	+	27	4236	c.3903A>G	c.(3901-3903)GAA>GAG	p.E1301E	NBEAL1_uc002uzs.3_Silent_p.E11E	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	1301							binding			ovary(1)|skin(1)	2						TGTCAACTGAAGATACCAAGA	0.343													6	198	---	---	---	---	PASS
PPP1R7	5510	broad.mit.edu	37	2	242099797	242099797	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242099797A>G	uc002wat.1	+	6	500	c.485A>G	c.(484-486)AAG>AGG	p.K162R	PPP1R7_uc010fzm.1_Missense_Mutation_p.K146R|PPP1R7_uc002war.2_Missense_Mutation_p.K156R|PPP1R7_uc002was.2_Missense_Mutation_p.K162R|PPP1R7_uc002wau.1_Missense_Mutation_p.K119R|PPP1R7_uc002wav.1_Missense_Mutation_p.K88R	NM_002712	NP_002703	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	162	LRR 4.					cytoplasm|nucleus	protein binding|protein phosphatase type 1 regulator activity			ovary(3)	3		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		GGGGTTGACAAGTTGACACGA	0.348													14	195	---	---	---	---	PASS
LHFPL4	375323	broad.mit.edu	37	3	9594204	9594204	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9594204G>A	uc003bry.2	-	2	446	c.160C>T	c.(160-162)CCC>TCC	p.P54S		NM_198560	NP_940962	Q7Z7J7	LHPL4_HUMAN	lipoma HMGIC fusion partner-like 4	54						integral to membrane				ovary(2)|skin(1)	3	Medulloblastoma(99;0.227)					CCAGGCTTGGGGGTGCTCACG	0.652													3	38	---	---	---	---	PASS
HACL1	26061	broad.mit.edu	37	3	15609989	15609989	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15609989A>G	uc003caf.2	-	13	1360	c.1200T>C	c.(1198-1200)AAT>AAC	p.N400N	HACL1_uc011avr.1_RNA|HACL1_uc011avs.1_Silent_p.N373N|HACL1_uc011avt.1_Silent_p.N340N|HACL1_uc003cag.2_Silent_p.N44N|HACL1_uc011avu.1_Silent_p.N318N|HACL1_uc010hep.2_Silent_p.N159N	NM_012260	NP_036392	Q9UJ83	HACL1_HUMAN	2-hydroxyphytanoyl-CoA lyase	400					fatty acid alpha-oxidation	peroxisomal matrix	carbon-carbon lyase activity|identical protein binding|magnesium ion binding|thiamine pyrophosphate binding				0						TGTCCATAGTATTTGCTCCTT	0.373													27	368	---	---	---	---	PASS
ZNF621	285268	broad.mit.edu	37	3	40574134	40574134	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40574134T>A	uc003ckm.2	+	5	1089	c.873T>A	c.(871-873)TAT>TAA	p.Y291*	ZNF621_uc003ckn.2_Nonsense_Mutation_p.Y291*|ZNF621_uc003cko.2_Nonsense_Mutation_p.Y256*|ZNF621_uc011aze.1_Nonsense_Mutation_p.Y283*	NM_001098414	NP_001091884	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	291	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		AGAAACCTTATCAATGTAAGG	0.428													18	171	---	---	---	---	PASS
ZNF167	55888	broad.mit.edu	37	3	44612378	44612378	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44612378T>C	uc010hin.2	+	6	2164	c.1776T>C	c.(1774-1776)TCT>TCC	p.S592S	ZNF167_uc003cni.2_Intron|ZNF167_uc010hio.2_Intron|ZNF167_uc003cnj.2_Silent_p.S592S|ZNF167_uc003cnk.2_Intron	NM_018651	NP_061121	Q9P0L1	ZN167_HUMAN	zinc finger protein 167 isoform 1	592	C2H2-type 8.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(197;0.0486)|Kidney(197;0.0609)		ATCAGAACTCTCAACTCATTG	0.428													4	88	---	---	---	---	PASS
OR5H15	403274	broad.mit.edu	37	3	97888392	97888392	+	Silent	SNP	T	C	C	rs143876513		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97888392T>C	uc011bgu.1	+	1	849	c.849T>C	c.(847-849)CCT>CCC	p.P283P		NM_001005515	NP_001005515	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TCATCATTCCTTTGTTAAATC	0.363													6	402	---	---	---	---	PASS
OSBPL11	114885	broad.mit.edu	37	3	125286405	125286405	+	Nonsense_Mutation	SNP	A	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125286405A>C	uc003eic.2	-	6	1438	c.701T>G	c.(700-702)TTA>TGA	p.L234*		NM_022776	NP_073613	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	234					lipid transport		lipid binding			ovary(3)|breast(1)|kidney(1)	5						TCGTCTAATTAAGTCTCTTTG	0.403													41	270	---	---	---	---	PASS
DZIP1L	199221	broad.mit.edu	37	3	137813771	137813771	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137813771G>T	uc003erq.2	-	4	1004	c.641C>A	c.(640-642)GCC>GAC	p.A214D	DZIP1L_uc003err.1_Missense_Mutation_p.A214D	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like	214	Potential.					intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						CTTTAGCTTGGCCCGTAGCTC	0.552													108	407	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180334622	180334622	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180334622T>C	uc010hxe.2	-	17	2513	c.2398A>G	c.(2398-2400)ACC>GCC	p.T800A	CCDC39_uc003fkn.2_RNA|TTC14_uc003fkm.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	800	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ACCTGTTTGGTCACTCTTTCT	0.308													8	832	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195511525	195511525	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195511525T>C	uc011bto.1	-	2	7386	c.6926A>G	c.(6925-6927)GAC>GGC	p.D2309G	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	195					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGCGTCGGTGACATG	0.582													9	32	---	---	---	---	PASS
PIGG	54872	broad.mit.edu	37	4	502672	502672	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:502672T>C	uc003gak.3	+	5	950	c.814T>C	c.(814-816)TCT>CCT	p.S272P	PIGG_uc003gaj.3_Missense_Mutation_p.S272P|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_Missense_Mutation_p.S139P|PIGG_uc003gal.3_Missense_Mutation_p.S183P|PIGG_uc003gai.2_RNA|PIGG_uc011buw.1_Missense_Mutation_p.S150P|PIGG_uc003gam.2_Missense_Mutation_p.S183P|PIGG_uc003gan.2_Missense_Mutation_p.S183P	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	272	Lumenal (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			central_nervous_system(2)|ovary(1)|skin(1)	4						CCATGGCATGTCTGAAACAGG	0.468													6	383	---	---	---	---	PASS
PDS5A	23244	broad.mit.edu	37	4	39978099	39978099	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39978099G>A	uc003guv.3	-	2	639	c.99C>T	c.(97-99)ACC>ACT	p.T33T	PDS5A_uc010ifo.2_5'UTR|PDS5A_uc003guw.3_Silent_p.T33T	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	33					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						TGATCTTGTCGGTGATCTCTT	0.557											OREG0016159	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	157	---	---	---	---	PASS
LOC344967	344967	broad.mit.edu	37	4	40045118	40045118	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40045118C>T	uc011byr.1	-	3	1032	c.538G>A	c.(538-540)GCC>ACC	p.A180T		NR_027277				RecName: Full=Cytosolic acyl coenzyme A thioester hydrolase-like;          EC=3.1.2.2; AltName: Full=Acyl-CoA thioesterase 7-like;												0						AAGATCCCGGCGACCTCGTCC	0.552													5	44	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69681734	69681734	+	5'UTR	SNP	A	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69681734A>C	uc003hee.2	+	1					UGT2B10_uc011cam.1_5'UTR	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1						lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						CACATTGCACAAGGATGGCTC	0.373													6	295	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69885813	69885813	+	Splice_Site	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69885813C>T	uc011cao.1	-	2	290	c.154_splice	c.e2+1	p.I52_splice	UGT2B10_uc011can.1_Splice_Site_p.I52_splice			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;						lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						AATGTTGCATCGTGATATTCT	0.318													4	258	---	---	---	---	PASS
C4orf40	401137	broad.mit.edu	37	4	71019995	71019995	+	Intron	SNP	C	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71019995C>G	uc003hfa.3	+						C4orf40_uc003hfb.3_5'UTR	NM_214711	NP_999876	Q6MZM9	CD040_HUMAN	hypothetical protein LOC401137 precursor							extracellular region					0						tgtATTCTTTCGTTTCTCTCT	0.114													15	107	---	---	---	---	PASS
NDST3	9348	broad.mit.edu	37	4	118975713	118975713	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118975713T>C	uc003ibx.2	+	2	1051	c.648T>C	c.(646-648)CCT>CCC	p.P216P	NDST3_uc011cgf.1_Silent_p.P216P|NDST3_uc003ibw.2_Silent_p.P216P	NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	216	Lumenal (Potential).|Heparan sulfate N-deacetylase 3.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						GTTCTTTACCTGGAACTGACT	0.368													6	376	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37167164	37167164	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37167164T>C	uc011cpa.1	-	35	7616	c.7385A>G	c.(7384-7386)AAG>AGG	p.K2462R	C5orf42_uc011coy.1_Missense_Mutation_p.K962R|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.K1537R	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	2462										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TTTACTGTCCTTTCCTTGTCT	0.323													9	795	---	---	---	---	PASS
RICTOR	253260	broad.mit.edu	37	5	38954951	38954951	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38954951A>G	uc003jlp.2	-	27	2646	c.2622T>C	c.(2620-2622)CCT>CCC	p.P874P	RICTOR_uc003jlo.2_Silent_p.P874P|RICTOR_uc010ivf.2_Silent_p.P589P	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	874					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					GGTAGACGTGAGGACGCTGTA	0.299													6	442	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41032861	41032861	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41032861G>A	uc003jmj.3	-	24	2914	c.2424C>T	c.(2422-2424)ATC>ATT	p.I808I	HEATR7B2_uc003jmi.3_Silent_p.I363I	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	808	HEAT 9.						binding			ovary(6)|central_nervous_system(2)	8						ACCTAATGGCGATTAAGGCTT	0.388													6	313	---	---	---	---	PASS
ITGA2	3673	broad.mit.edu	37	5	52356771	52356771	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52356771C>A	uc003joy.2	+	12	1496	c.1353C>A	c.(1351-1353)CAC>CAA	p.H451Q	ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.H375Q|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor	451	Extracellular (Potential).|FG-GAP 4.				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				AAAGCACTCACTTTGTTGCTG	0.428													4	224	---	---	---	---	PASS
POU5F2	134187	broad.mit.edu	37	5	93076649	93076649	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93076649T>C	uc003kkl.1	-	1	661	c.621A>G	c.(619-621)CAA>CAG	p.Q207Q	FAM172A_uc010jbd.2_Intron|FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron	NM_153216	NP_694948	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	207						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		TCCCAGACTGTTGCAGGATCA	0.532													4	221	---	---	---	---	PASS
C5orf30	90355	broad.mit.edu	37	5	102612173	102612173	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102612173G>C	uc003kog.1	+	3	822	c.553G>C	c.(553-555)GTG>CTG	p.V185L	C5orf30_uc003koh.1_Missense_Mutation_p.V185L	NM_033211	NP_149988	Q96GV9	CE030_HUMAN	hypothetical protein LOC90355	185											0		all_cancers(142;2.22e-05)|all_epithelial(76;9.54e-08)|Prostate(80;0.0174)|Colorectal(57;0.0551)|Ovarian(225;0.11)|Lung NSC(167;0.136)|all_lung(232;0.18)		Epithelial(69;2.84e-14)|COAD - Colon adenocarcinoma(37;0.00762)		TGATACAGAAGTGCTACAGTA	0.448													11	130	---	---	---	---	PASS
MEGF10	84466	broad.mit.edu	37	5	126778707	126778707	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126778707T>A	uc003kuh.3	+	20	2742	c.2380T>A	c.(2380-2382)TAT>AAT	p.Y794N	MEGF10_uc003kui.3_Missense_Mutation_p.Y794N	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor	794	Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TTCAGGAACATATGGCTATGG	0.517													7	102	---	---	---	---	PASS
MEGF10	84466	broad.mit.edu	37	5	126778709	126778709	+	Nonsense_Mutation	SNP	T	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126778709T>G	uc003kuh.3	+	20	2744	c.2382T>G	c.(2380-2382)TAT>TAG	p.Y794*	MEGF10_uc003kui.3_Nonsense_Mutation_p.Y794*	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor	794	Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		CAGGAACATATGGCTATGGCT	0.517													9	105	---	---	---	---	PASS
ECSCR	641700	broad.mit.edu	37	5	138784369	138784369	+	3'UTR	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138784369A>G	uc011cze.1	-	7					ECSCR_uc011czd.1_Intron	NM_001077693	NP_001071161	Q19T08	ECSCR_HUMAN	endothelial cell-specific chemotaxis regulator						angiogenesis|cell differentiation|chemotaxis	integral to membrane|plasma membrane					0						AGAAGCAGGCAGTATTTCCAC	0.493													5	33	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139876772	139876772	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139876772T>C	uc003lfs.1	+	15	3037	c.2913T>C	c.(2911-2913)CAT>CAC	p.H971H	ANKHD1_uc003lfq.1_Silent_p.H990H|ANKHD1_uc003lfr.2_Silent_p.H971H|ANKHD1_uc003lft.1_Intron|ANKHD1_uc003lfu.1_Silent_p.H451H|ANKHD1_uc003lfv.1_Intron	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	971						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTACTGGACATGATCAGGGGC	0.448													6	57	---	---	---	---	PASS
PCDHA5	56143	broad.mit.edu	37	5	140202962	140202962	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140202962G>A	uc003lhl.2	+	1	1602	c.1602G>A	c.(1600-1602)GTG>GTA	p.V534V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Silent_p.V534V|PCDHA5_uc003lhj.1_Silent_p.V534V	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	534	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTTCCAGGTGAGCGCGCGCG	0.687													3	31	---	---	---	---	PASS
SCGB3A2	117156	broad.mit.edu	37	5	147261132	147261132	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147261132T>C	uc003lot.1	+	2	272	c.179T>C	c.(178-180)GTT>GCT	p.V60A		NM_054023	NP_473364	Q96PL1	SG3A2_HUMAN	secretoglobin, family 3A, member 2 precursor	60						extracellular region	binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCATTTCTGTTGAGCACCTT	0.488													23	488	---	---	---	---	PASS
PWWP2A	114825	broad.mit.edu	37	5	159520481	159520481	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159520481A>G	uc011ded.1	-	2	1233	c.1176T>C	c.(1174-1176)GCT>GCC	p.A392A	PWWP2A_uc003lxv.3_Silent_p.A392A|PWWP2A_uc011dec.1_Silent_p.A392A	NM_001130864	NP_001124336	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A isoform b	392											0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCTGCTGTGAGCAATATTTG	0.368													6	354	---	---	---	---	PASS
TCF19	6941	broad.mit.edu	37	6	31127384	31127384	+	Silent	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31127384C>T	uc003nss.2	+	2	662	c.138C>T	c.(136-138)CCC>CCT	p.P46P	CCHCR1_uc011dne.1_5'Flank|CCHCR1_uc003nsq.3_5'Flank|CCHCR1_uc003nsp.3_5'Flank|CCHCR1_uc003nsr.3_5'Flank|CCHCR1_uc010jsk.1_5'Flank|TCF19_uc003nst.2_Silent_p.P46P	NM_001077511	NP_001070979	Q9Y242	TCF19_HUMAN	transcription factor 19	46	FHA.				cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCCTGCGGCCCCAGCAGGAGC	0.682													4	21	---	---	---	---	PASS
GPR116	221395	broad.mit.edu	37	6	46826424	46826424	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46826424A>G	uc003oyo.3	-	17	3505	c.3216T>C	c.(3214-3216)GCT>GCC	p.A1072A	GPR116_uc011dwj.1_Silent_p.A627A|GPR116_uc011dwk.1_Silent_p.A501A|GPR116_uc003oyp.3_Silent_p.A930A|GPR116_uc003oyq.3_Silent_p.A1072A|GPR116_uc010jzi.1_Silent_p.A744A	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	1072	Helical; Name=2; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			CCTGGATGGCAGCGACCACAA	0.522													4	90	---	---	---	---	PASS
FILIP1	27145	broad.mit.edu	37	6	76022977	76022977	+	Silent	SNP	A	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76022977A>T	uc003pia.2	-	5	2944	c.2571T>A	c.(2569-2571)CCT>CCA	p.P857P	FILIP1_uc003phy.1_Silent_p.P857P|FILIP1_uc003phz.2_Silent_p.P758P|FILIP1_uc010kbe.2_Silent_p.P860P|FILIP1_uc003pib.1_Silent_p.P609P	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	857										skin(3)|ovary(1)	4						TTGCTGCTGGAGGATACCTGT	0.463													28	195	---	---	---	---	PASS
PNRC1	10957	broad.mit.edu	37	6	89790527	89790527	+	5'UTR	SNP	A	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89790527A>T	uc003pmv.2	+	1					PNRC1_uc003pmu.2_5'UTR|PNRC1_uc003pmx.2_5'Flank	NM_006813	NP_006804	Q12796	PNRC1_HUMAN	proline-rich nuclear receptor coactivator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding				0		all_cancers(76;3.64e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.102)		CTCTCCTAGCAGCATCCATCG	0.567										Multiple Myeloma(7;0.094)			3	17	---	---	---	---	PASS
SLC16A10	117247	broad.mit.edu	37	6	111540047	111540047	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111540047T>C	uc003pus.2	+	5	1292	c.1117T>C	c.(1117-1119)TCC>CCC	p.S373P	SLC16A10_uc003put.2_Missense_Mutation_p.S59P	NM_018593	NP_061063	Q8TF71	MOT10_HUMAN	solute carrier family 16, member 10	373	Cytoplasmic (Potential).				aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)		TGGTCTGATGTCCATGATGAT	0.483													9	507	---	---	---	---	PASS
FABP7	2173	broad.mit.edu	37	6	123105017	123105017	+	3'UTR	SNP	C	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123105017C>G	uc003pzf.2	+	4					FABP7_uc003pze.1_3'UTR	NM_001446	NP_001437	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain						negative regulation of cell proliferation	cytoplasm	lipid binding|transporter activity				0				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|gamma-Homolinolenic acid(DB00154)|Icosapent(DB00159)	AGAAGGTTATCCTTGGTGTGG	0.363													12	176	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136597187	136597187	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136597187T>C	uc003qgx.1	-	5	1729	c.1476A>G	c.(1474-1476)AAA>AAG	p.K492K	BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Silent_p.K490K|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Silent_p.K490K	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	492					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ACTGAGTTTCTTTCTTTACTG	0.378													8	800	---	---	---	---	PASS
PPIL4	85313	broad.mit.edu	37	6	149855820	149855820	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149855820T>C	uc003qmo.1	-	6	585	c.555A>G	c.(553-555)CAA>CAG	p.Q185Q	PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Silent_p.Q185Q	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4	185					protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		TTACATCTAATTGTTCCCTTG	0.303													34	412	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152443659	152443659	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152443659T>A	uc010kiw.2	-	146	26908	c.26306A>T	c.(26305-26307)GAG>GTG	p.E8769V	SYNE1_uc010kiv.2_Missense_Mutation_p.E3293V|SYNE1_uc003qos.3_Missense_Mutation_p.E3293V|SYNE1_uc003qot.3_Missense_Mutation_p.E8721V|SYNE1_uc003qou.3_Missense_Mutation_p.E8769V|SYNE1_uc003qop.3_Missense_Mutation_p.E954V|SYNE1_uc011eez.1_3'UTR|SYNE1_uc003qoq.3_3'UTR|SYNE1_uc003qor.3_3'UTR	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8769	Perinuclear space (Potential).|KASH.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTAGTCTTCCTCTGACATTGG	0.572										HNSCC(10;0.0054)			15	120	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152706875	152706875	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152706875T>C	uc010kiw.2	-	55	9188	c.8586A>G	c.(8584-8586)GAA>GAG	p.E2862E	SYNE1_uc003qot.3_Silent_p.E2869E|SYNE1_uc003qou.3_Silent_p.E2862E|SYNE1_uc010kjb.1_Silent_p.E2845E	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2862	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACCGGTGAAGTTCTTCCTTTG	0.398										HNSCC(10;0.0054)			6	428	---	---	---	---	PASS
PNLDC1	154197	broad.mit.edu	37	6	160225062	160225062	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160225062T>C	uc003qsx.1	+	5	452	c.281T>C	c.(280-282)TTC>TCC	p.F94S	PNLDC1_uc003qsy.1_Missense_Mutation_p.F105S	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	94	Cytoplasmic (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GACTCAGAATTCTCCTTCCAG	0.383													6	480	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1538900	1538900	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1538900A>G	uc003skn.2	-	7	1042	c.941T>C	c.(940-942)CTC>CCC	p.L314P	INTS1_uc003skq.2_Missense_Mutation_p.L314P	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	314					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCTGGGCATGAGCTGGCCCTC	0.577													3	22	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6180597	6180597	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6180597T>C	uc011jwo.1	+	7	900	c.777T>C	c.(775-777)GAT>GAC	p.D259D	USP42_uc011jwn.1_Silent_p.D104D|USP42_uc010kth.1_Silent_p.D192D|USP42_uc011jwp.1_Silent_p.D259D|USP42_uc011jwq.1_Silent_p.D66D|USP42_uc011jwr.1_Silent_p.D104D	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	259					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CATATCTTGATATAACATTGG	0.244													5	454	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14378224	14378224	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14378224G>A	uc003ssz.2	-	22	2228	c.2041C>T	c.(2041-2043)CGA>TGA	p.R681*	DGKB_uc011jxt.1_Nonsense_Mutation_p.R662*|DGKB_uc003sta.2_Nonsense_Mutation_p.R681*|DGKB_uc011jxu.1_Nonsense_Mutation_p.R680*	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	681					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	CGATGGCTTCGTCTTTTCTTA	0.398													59	370	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32957949	32957949	+	Intron	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32957949G>A	uc011kai.1	+						RP9P_uc003tdc.2_RNA|RP9P_uc003tdd.2_RNA|RP9P_uc011kaj.1_RNA	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						GTTGTTTATTGTCTCGTATGA	0.333													6	188	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47925541	47925541	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47925541G>A	uc003tny.1	-	18	2948	c.2948C>T	c.(2947-2949)GCA>GTA	p.A983V		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	983	Extracellular (Potential).|REJ.				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						TGTGGTCGTTGCATCAGGATC	0.587													4	104	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48550784	48550784	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48550784G>A	uc003toq.2	+	51	13654	c.13629G>A	c.(13627-13629)CTG>CTA	p.L4543L	ABCA13_uc010kys.1_Silent_p.L1618L|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Silent_p.L273L	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	4543	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CCCTCCTGCTGTCACTTTTCG	0.483													10	232	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	83023615	83023615	+	Missense_Mutation	SNP	G	A	A	rs111300014		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83023615G>A	uc003uhy.1	-	13	1964	c.1498C>T	c.(1498-1500)CGG>TGG	p.R500W		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	500	Sema.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				GAACTTACCCGCTTTGAAGAA	0.244													12	201	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91660882	91660882	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91660882A>G	uc003ulg.2	+	16	4527	c.4302A>G	c.(4300-4302)AAA>AAG	p.K1434K	AKAP9_uc003ule.2_Silent_p.K1446K|AKAP9_uc003ulf.2_Silent_p.K1434K|AKAP9_uc003uli.2_Silent_p.K1059K	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	1446	Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGCTTGAAAAACAATACCAAG	0.294			T	BRAF	papillary thyroid								6	453	---	---	---	---	PASS
C7orf61	402573	broad.mit.edu	37	7	100061715	100061715	+	5'UTR	SNP	T	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100061715T>G	uc003uuz.1	-	1						NM_001004323	NP_001004323	Q8IZ16	CG061_HUMAN	hypothetical protein LOC402573												0						GGGTGGCGGGTGGGGGATGGG	0.542													5	11	---	---	---	---	PASS
C7orf51	222950	broad.mit.edu	37	7	100088627	100088627	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100088627G>A	uc003uvd.1	+	6	2336	c.2177G>A	c.(2176-2178)CGC>CAC	p.R726H	C7orf51_uc003uve.1_Missense_Mutation_p.R509H	NM_173564	NP_775835	Q6ZVC0	CG051_HUMAN	hypothetical protein FLJ37538	726										skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGAGGCTACCGCCTGGGGCGC	0.677													4	38	---	---	---	---	PASS
MLL5	55904	broad.mit.edu	37	7	104714126	104714126	+	Splice_Site	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104714126T>C	uc003vcm.2	+	7	1090	c.556_splice	c.e7+2	p.D186_splice	MLL5_uc010lja.1_Splice_Site_p.D40_splice|MLL5_uc010ljb.1_Splice_Site_p.D186_splice|MLL5_uc003vcl.2_Splice_Site_p.D186_splice|MLL5_uc010ljc.2_Splice_Site_p.D186_splice|MLL5_uc003vco.1_5'Flank	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						ATATGTCAGGTAGGTAAAAAG	0.299													5	303	---	---	---	---	PASS
ASZ1	136991	broad.mit.edu	37	7	117025841	117025841	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117025841A>G	uc003vjb.2	-	5	526	c.463T>C	c.(463-465)TAT>CAT	p.Y155H	ASZ1_uc011kno.1_Missense_Mutation_p.Y155H|ASZ1_uc011knp.1_Intron	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper	155	ANK 4.				cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CGAGCAGCATACATGATTGGG	0.413													20	148	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122303575	122303575	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122303575A>C	uc010lkp.2	-	3	665	c.502T>G	c.(502-504)TGT>GGT	p.C168G	CADPS2_uc010lkq.2_Missense_Mutation_p.C168G	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	168					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TTAGCAGAACACCCTCCACTC	0.348													10	95	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124387074	124387074	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124387074A>G	uc003vli.2	-	2	1998	c.1347T>C	c.(1345-1347)TGT>TGC	p.C449C		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	449	Helical; Name=5; (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						AACAAAAGTAACAGCCAAAAT	0.478													5	266	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	144703233	144703233	+	IGR	SNP	A	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144703233A>T								TPK1 (170087 upstream) : None (None downstream)																							ACTGAAGGCTACTGCCATGCA	0.547													7	65	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3087644	3087644	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3087644A>G	uc011kwk.1	-	27	4656	c.4266T>C	c.(4264-4266)TAT>TAC	p.Y1422Y	CSMD1_uc011kwj.1_Silent_p.Y814Y|CSMD1_uc003wqe.2_Silent_p.Y578Y	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1422	Extracellular (Potential).|Sushi 8.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTTGGAGCTGATAGCCAGGGT	0.522													4	141	---	---	---	---	PASS
CNOT7	29883	broad.mit.edu	37	8	17088157	17088157	+	3'UTR	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17088157A>G	uc003wxf.1	-	7					CNOT7_uc003wxg.1_3'UTR	NM_013354	NP_037486	Q9UIV1	CNOT7_HUMAN	CCR4-NOT transcription complex, subunit 7						carbohydrate metabolic process|nuclear-transcribed mRNA poly(A) tail shortening	CCR4-NOT complex|cytoplasmic mRNA processing body|cytosol	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(1)	1				Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)		TGTTCGAGGGATTCAACCAGA	0.393													4	70	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41791800	41791800	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41791800T>C	uc010lxb.2	-	18	4482	c.3938A>G	c.(3937-3939)GAC>GGC	p.D1313G	MYST3_uc010lxc.2_Missense_Mutation_p.D1313G|MYST3_uc003xon.3_Missense_Mutation_p.D1313G	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1313					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			AGCGTCGTGGTCGTCATTCTG	0.358													24	193	---	---	---	---	PASS
VDAC3	7419	broad.mit.edu	37	8	42259393	42259393	+	Silent	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42259393C>T	uc011lct.1	+	7	554	c.411C>T	c.(409-411)ACC>ACT	p.T137T	VDAC3_uc010lxk.2_3'UTR|VDAC3_uc003xpc.2_Silent_p.T138T	NM_005662	NP_005653	Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3 isoform b	137	Beta stranded; (By similarity).				adenine transport	mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity			upper_aerodigestive_tract(1)	1	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	CTGGACCAACCATCTATGGCT	0.433													4	284	---	---	---	---	PASS
ATP6V0D2	245972	broad.mit.edu	37	8	87163693	87163693	+	Splice_Site	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87163693A>G	uc003ydp.1	+	7	886	c.817_splice	c.e7-2	p.V273_splice		NM_152565	NP_689778	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex	hydrogen ion transmembrane transporter activity|protein binding				0						TTTGTTTTTAAGGTATACAAA	0.294													6	369	---	---	---	---	PASS
MLLT3	4300	broad.mit.edu	37	9	20414343	20414343	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414343A>G	uc003zoe.2	-	5	760	c.501T>C	c.(499-501)AGT>AGC	p.S167S	MLLT3_uc011lne.1_Silent_p.S135S|MLLT3_uc011lnf.1_Silent_p.S164S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Missense_Mutation_p.V129A	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	167	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.139			T	MLL	ALL								7	134	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413585	68413585	+	RNA	SNP	G	T	T	rs145928615		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413585G>T	uc004aex.2	+	1		c.140G>T								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		ATCTAGGAAAGGTTGTGCCTT	0.597													10	50	---	---	---	---	PASS
GAPVD1	26130	broad.mit.edu	37	9	128064585	128064585	+	Missense_Mutation	SNP	T	C	C	rs139801640		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128064585T>C	uc010mwx.2	+	5	835	c.509T>C	c.(508-510)CTT>CCT	p.L170P	GAPVD1_uc004bpo.2_Missense_Mutation_p.L170P|GAPVD1_uc011lzs.1_Missense_Mutation_p.L170P|GAPVD1_uc004bpp.2_Missense_Mutation_p.L170P|GAPVD1_uc004bpq.2_Missense_Mutation_p.L170P|GAPVD1_uc004bpr.2_Missense_Mutation_p.L170P|GAPVD1_uc004bps.2_Missense_Mutation_p.L170P|GAPVD1_uc010mwy.1_Missense_Mutation_p.L29P	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	170	Ras-GAP.				endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CCTAGGCGACTTTTGAGGAGA	0.398													18	253	---	---	---	---	PASS
NACC2	138151	broad.mit.edu	37	9	138908218	138908218	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138908218C>T	uc004cgw.2	-	3	1100	c.944G>A	c.(943-945)CGC>CAC	p.R315H	NACC2_uc010nbh.2_5'UTR	NM_144653	NP_653254	Q96BF6	NACC2_HUMAN	BTB (POZ) domain containing 14A	315					negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization	nuclear body					0						CACGAGGTCGCGGCGGATGAG	0.657													4	51	---	---	---	---	PASS
PITRM1	10531	broad.mit.edu	37	10	3190208	3190208	+	Intron	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3190208C>A	uc010qah.1	-						PITRM1_uc001igr.1_Missense_Mutation_p.M680I|PITRM1_uc001igs.1_5'Flank|PITRM1_uc001igt.1_Missense_Mutation_p.M680I|PITRM1_uc009xhv.1_Missense_Mutation_p.M246I|PITRM1_uc001igu.1_Intron|PITRM1_uc010qai.1_Missense_Mutation_p.M651I|uc001igv.1_RNA			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;						proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						ATAGCTGCATCATGTCTGGCA	0.413													31	432	---	---	---	---	PASS
KIN	22944	broad.mit.edu	37	10	7811268	7811268	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7811268C>T	uc001ijt.2	-	8	757	c.709G>A	c.(709-711)GCA>ACA	p.A237T	KIN_uc010qaz.1_RNA|KIN_uc009xip.2_Missense_Mutation_p.A237T|KIN_uc010qba.1_Missense_Mutation_p.A131T	NM_012311	NP_036443	O60870	KIN17_HUMAN	HsKin17 protein	237					DNA recombination|DNA repair|DNA replication|interspecies interaction between organisms|mRNA processing	cytoplasm|nuclear matrix	double-stranded DNA binding|RNA binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TTCACTGATGCTGAACTTCCT	0.418													5	187	---	---	---	---	PASS
C10orf140	387640	broad.mit.edu	37	10	21804245	21804245	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21804245A>G	uc009xkd.2	-	4	4760	c.2507T>C	c.(2506-2508)GTA>GCA	p.V836A	uc001iqp.1_Intron	NM_207371	NP_997254	Q1XH10	DLN1_HUMAN	hypothetical protein LOC387640	755						nucleus	nucleotide binding			ovary(1)	1						TGCTGATGCTACATTGCTGGC	0.438													5	387	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43297609	43297609	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43297609T>C	uc001jaj.2	+	13	2630	c.2272T>C	c.(2272-2274)TTC>CTC	p.F758L		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	758					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						CAGAGATTGCTTCGTGACTGG	0.433													5	270	---	---	---	---	PASS
CBARA1	10367	broad.mit.edu	37	10	74322768	74322768	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74322768T>C	uc001jtb.1	-	3	348	c.215A>G	c.(214-216)GAT>GGT	p.D72G		NM_006077	NP_006068	Q9BPX6	MICU1_HUMAN	calcium binding atopy-related autoantigen 1	72					calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1						CTTCCCTTTATCACCGATGTC	0.408													7	756	---	---	---	---	PASS
EXOC6	54536	broad.mit.edu	37	10	94693932	94693932	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94693932T>C	uc001kig.2	+	10	1070	c.1004T>C	c.(1003-1005)TTC>TCC	p.F335S	EXOC6_uc010qnr.1_Missense_Mutation_p.F351S|EXOC6_uc001kie.2_Missense_Mutation_p.F330S|EXOC6_uc009xub.2_Missense_Mutation_p.F335S|EXOC6_uc009xuc.2_Intron|EXOC6_uc001kih.2_RNA	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a	335					protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				AGAAGATATTTCACTCAAATT	0.244													5	190	---	---	---	---	PASS
BLNK	29760	broad.mit.edu	37	10	97967645	97967645	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97967645T>C	uc001kls.3	-	10	935	c.757A>G	c.(757-759)ACG>GCG	p.T253A	BLNK_uc001kme.3_Missense_Mutation_p.T148A|BLNK_uc001klt.3_Missense_Mutation_p.T144A|BLNK_uc009xvc.2_RNA|BLNK_uc001klu.3_Missense_Mutation_p.T171A|BLNK_uc001klv.3_Missense_Mutation_p.T148A|BLNK_uc001klw.3_RNA|BLNK_uc001klx.3_Missense_Mutation_p.T230A|BLNK_uc001kly.3_Missense_Mutation_p.T253A|BLNK_uc001klz.3_RNA|BLNK_uc001kma.3_Missense_Mutation_p.T230A|BLNK_uc001kmb.3_Missense_Mutation_p.T49A|BLNK_uc001kmc.3_RNA|BLNK_uc001kmd.3_Missense_Mutation_p.T171A|BLNK_uc009xvd.2_RNA	NM_013314	NP_037446	Q8WV28	BLNK_HUMAN	B-cell linker isoform 1	253	Pro-rich.				B cell differentiation|humoral immune response|inflammatory response|intracellular signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(2)	2		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		AGTGGTGTCGTTGGTTTTTTC	0.313													6	421	---	---	---	---	PASS
RAB11FIP2	22841	broad.mit.edu	37	10	119805726	119805726	+	5'UTR	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119805726C>T	uc001ldj.1	-	1					RAB11FIP2_uc009xyz.1_5'UTR|CASC2_uc001ldm.3_5'Flank|CASC2_uc009xzc.2_5'Flank|CASC2_uc001ldk.2_5'Flank|CASC2_uc009xza.2_5'Flank|CASC2_uc009xzb.2_5'Flank	NM_014904	NP_055719	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2						protein transport	plasma membrane|recycling endosome membrane	protein homodimerization activity				0		Colorectal(252;0.235)		all cancers(201;0.0238)		GTGCCCCTCCCGGAGGGAGAG	0.562													3	93	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1253899	1253899	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1253899G>A	uc009ycr.1	+	33	4067	c.3941G>A	c.(3940-3942)TGT>TAT	p.C1314Y	MUC5B_uc009yct.1_Missense_Mutation_p.C655Y|MUC5B_uc001ltb.2_Missense_Mutation_p.C658Y|MUC5B_uc001lta.2_Missense_Mutation_p.C323Y	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	655					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCTGCAACTGTGAGCGGAGC	0.682													3	51	---	---	---	---	PASS
KRTAP5-4	387267	broad.mit.edu	37	11	1643255	1643255	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1643255G>A	uc009ycy.1	-	1	114	c.27C>T	c.(25-27)GGC>GGT	p.G9G		NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	23						keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagagccacagcccccacagc	0.254													5	39	---	---	---	---	PASS
OR51E1	143503	broad.mit.edu	37	11	4674457	4674457	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4674457A>G	uc001lzi.3	+	2	845	c.701A>G	c.(700-702)GAA>GGA	p.E234G		NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(3)|pancreas(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGACACGTGAAGCCCAGGCC	0.473													6	342	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26465333	26465333	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26465333A>G	uc001mqt.3	+	3	408	c.263A>G	c.(262-264)AAC>AGC	p.N88S	ANO3_uc010rdr.1_Missense_Mutation_p.N72S	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	88	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GAGAATAAAAACGACTCTGTG	0.343													59	607	---	---	---	---	PASS
RAG2	5897	broad.mit.edu	37	11	36614945	36614945	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36614945G>A	uc001mwv.3	-	2	962	c.774C>T	c.(772-774)GTC>GTT	p.V258V	C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	NM_000536	NP_000527	P55895	RAG2_HUMAN	recombination activating gene 2	258					chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding			skin(3)|ovary(1)|pancreas(1)	5	all_lung(20;0.226)	all_hematologic(20;0.00756)				TTGCACTGGAGACAGAGATTC	0.433									Familial_Hemophagocytic_Lymphohistiocytosis				13	130	---	---	---	---	PASS
HSD17B12	51144	broad.mit.edu	37	11	43852717	43852717	+	Intron	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43852717T>C	uc001mxq.3	+						uc001mxr.1_RNA	NM_016142	NP_057226	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12						long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0						CAGTAGAGCATGAGTCATCGG	0.463													6	50	---	---	---	---	PASS
OR5AP2	338675	broad.mit.edu	37	11	56409234	56409234	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56409234A>G	uc001njb.1	-	1	682	c.682T>C	c.(682-684)TTC>CTC	p.F228L		NM_001002925	NP_001002925	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP,	228	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						ACGGCAATGAAGATACACAGG	0.443													18	182	---	---	---	---	PASS
WDR74	54663	broad.mit.edu	37	11	62606659	62606659	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62606659C>T	uc001nvm.1	-	4	388	c.220G>A	c.(220-222)GAT>AAT	p.D74N	WDR74_uc001nvk.1_Missense_Mutation_p.D17N|WDR74_uc001nvl.1_Missense_Mutation_p.D74N|WDR74_uc001nvn.1_Missense_Mutation_p.D126N|WDR74_uc009yoi.1_Missense_Mutation_p.D74N|WDR74_uc010rmk.1_Missense_Mutation_p.D74N	NM_018093	NP_060563	Q6RFH5	WDR74_HUMAN	WD repeat domain 74	74	WD 1.					nucleolus				ovary(1)	1						AATATGCCATCCTCGGTGCTG	0.647													7	23	---	---	---	---	PASS
C11orf82	220042	broad.mit.edu	37	11	82644299	82644299	+	Missense_Mutation	SNP	A	G	G	rs142322539		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82644299A>G	uc001ozt.2	+	6	2163	c.1919A>G	c.(1918-1920)AAT>AGT	p.N640S	C11orf82_uc010rsr.1_Missense_Mutation_p.N339S|C11orf82_uc010rss.1_Missense_Mutation_p.N339S|C11orf82_uc009yvd.2_Intron	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	640					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2						ACTCTTTGCAATAGTCCAAAT	0.328													5	212	---	---	---	---	PASS
SNX19	399979	broad.mit.edu	37	11	130775869	130775869	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130775869C>G	uc001qgk.3	-	7	2970	c.2422G>C	c.(2422-2424)GAC>CAC	p.D808H	SNX19_uc009zcw.2_Missense_Mutation_p.D45H|SNX19_uc010sce.1_Missense_Mutation_p.D188H|SNX19_uc010scf.1_Missense_Mutation_p.D251H|SNX19_uc010scg.1_Missense_Mutation_p.D45H|SNX19_uc001qgl.3_Missense_Mutation_p.D791H|SNX19_uc009zcx.1_RNA	NM_014758	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	808					cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|lung(2)	4	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TTGCTGGGGTCTTGGGCTGGC	0.562													17	239	---	---	---	---	PASS
TSPAN9	10867	broad.mit.edu	37	12	3310390	3310390	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3310390T>C	uc001qlp.2	+	3	178	c.31T>C	c.(31-33)TAC>CAC	p.Y11H		NM_006675	NP_006666	O75954	TSN9_HUMAN	tetraspanin 9	11	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			CTGCTTGAAGTACATGATGTT	0.483													6	453	---	---	---	---	PASS
ATN1	1822	broad.mit.edu	37	12	7045683	7045683	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7045683T>C	uc001qrw.1	+	5	1490	c.1253T>C	c.(1252-1254)CTC>CCC	p.L418P	ATN1_uc001qrx.1_Missense_Mutation_p.L418P|ATN1_uc001qry.1_Missense_Mutation_p.L417P	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1	418					cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						CCAACAAGCCTCTCTGTCTCC	0.483													5	347	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11506356	11506356	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11506356G>A	uc001qzw.1	-	4	718	c.681C>T	c.(679-681)GGC>GGT	p.G227G	PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	288	12.|15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in clone CP-4).|Missing (in clone CP-5).			extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGGGCTGGTTGCCTCCTTGTG	0.607													6	45	---	---	---	---	PASS
C12orf60	144608	broad.mit.edu	37	12	14976216	14976216	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14976216A>G	uc001rcj.3	+	2	551	c.347A>G	c.(346-348)AAA>AGA	p.K116R		NM_175874	NP_787070	Q5U649	CL060_HUMAN	hypothetical protein LOC144608	116										ovary(1)|central_nervous_system(1)	2						GAAGTATTCAAAAGTGCCCAT	0.438													22	274	---	---	---	---	PASS
ERP27	121506	broad.mit.edu	37	12	15091412	15091412	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15091412G>T	uc001rco.2	-	1	52	c.31C>A	c.(31-33)CTC>ATC	p.L11I		NM_152321	NP_689534	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27 kDa precursor	11						endoplasmic reticulum lumen				breast(1)	1						AGAAATAAGAGGAACATGAAC	0.453													48	151	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26551807	26551807	+	Splice_Site	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26551807A>G	uc001rhg.2	-	54	8113	c.7696_splice	c.e54+1	p.G2566_splice	ITPR2_uc009zjg.1_Splice_Site_p.G717_splice	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CCGAACACTTACCACAGATGA	0.338													5	485	---	---	---	---	PASS
DENND5B	160518	broad.mit.edu	37	12	31632930	31632930	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31632930T>C	uc001rki.1	-	3	683	c.497A>G	c.(496-498)GAT>GGT	p.D166G	DENND5B_uc001rkh.1_Missense_Mutation_p.D201G|DENND5B_uc009zjq.1_Missense_Mutation_p.D85G|DENND5B_uc001rkj.2_Missense_Mutation_p.D188G|DENND5B_uc001rkk.1_Missense_Mutation_p.D88G	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	166						integral to membrane				ovary(1)|central_nervous_system(1)	2						GGAAGTTGTATCTCCTTCATC	0.423													6	308	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32955457	32955457	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32955457T>C	uc001rlj.3	-	11	2294	c.2179A>G	c.(2179-2181)AAG>GAG	p.K727E	PKP2_uc001rlk.3_Missense_Mutation_p.K683E|PKP2_uc010skj.1_Missense_Mutation_p.K680E	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	727	ARM 6.				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CCACTTTCCTTCTGGACAACT	0.453													4	108	---	---	---	---	PASS
DIP2B	57609	broad.mit.edu	37	12	51054071	51054071	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51054071T>C	uc001rwv.2	+	4	552	c.396T>C	c.(394-396)GTT>GTC	p.V132V	DIP2B_uc001rwu.2_Silent_p.V132V|DIP2B_uc009zls.1_Silent_p.V14V	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	132						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						CCACATTTGTTCAGTCTCCTG	0.443													5	229	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62931472	62931472	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62931472T>C	uc001sre.2	+	16	2495	c.2104T>C	c.(2104-2106)TTG>CTG	p.L702L	MON2_uc009zqj.2_Silent_p.L702L|MON2_uc010ssl.1_Silent_p.L630L|MON2_uc010ssm.1_Silent_p.L679L|MON2_uc010ssn.1_Silent_p.L702L|MON2_uc001srf.2_Silent_p.L465L	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	702					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		GCAACTTGTCTTGGCAACTCT	0.358													5	227	---	---	---	---	PASS
TSPAN8	7103	broad.mit.edu	37	12	71531795	71531795	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71531795A>G	uc009zrt.1	-	5	544	c.382T>C	c.(382-384)TTG>CTG	p.L128L	TSPAN8_uc001swk.1_Silent_p.L128L|TSPAN8_uc001swj.1_Silent_p.L128L	NM_004616	NP_004607	P19075	TSN8_HUMAN	transmembrane 4 superfamily member 3	128	Extracellular (Potential).				protein glycosylation	integral to membrane|lysosome	signal transducer activity			skin(2)|lung(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)			GTGGCGCTCAAAAGCTTTGTG	0.338													15	753	---	---	---	---	PASS
TMTC3	160418	broad.mit.edu	37	12	88589406	88589406	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88589406C>T	uc001tau.2	+	14	2945	c.2725C>T	c.(2725-2727)CGT>TGT	p.R909C		NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	910						integral to membrane	binding			skin(1)	1						AGAGATTGAACGTATTTTAAA	0.323													28	191	---	---	---	---	PASS
KITLG	4254	broad.mit.edu	37	12	88939540	88939540	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88939540C>T	uc001tav.2	-	2	301	c.118G>A	c.(118-120)GTC>ATC	p.V40I	KITLG_uc001taw.2_Missense_Mutation_p.V40I	NM_000899	NP_000890	P21583	SCF_HUMAN	KIT ligand isoform b precursor	40	Extracellular (Potential).				cell adhesion|cell proliferation|hemopoiesis|male gonad development|positive regulation of DNA replication|signal transduction	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	growth factor activity|identical protein binding|stem cell factor receptor binding			ovary(1)	1						AATTTAGTGACGTCTTTTACA	0.373									Testicular_Cancer_Familial_Clustering_of				4	257	---	---	---	---	PASS
ATP2B1	490	broad.mit.edu	37	12	90003819	90003819	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90003819A>G	uc001tbh.2	-	14	2518	c.2337T>C	c.(2335-2337)GGT>GGC	p.G779G	ATP2B1_uc001tbg.2_Silent_p.G779G|ATP2B1_uc001tbf.2_Silent_p.G449G	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b	779	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						TGTCAATTATACCTTAAATAC	0.363													6	265	---	---	---	---	PASS
AMDHD1	144193	broad.mit.edu	37	12	96346551	96346551	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96346551G>C	uc001tel.1	+	2	300	c.194G>C	c.(193-195)GGA>GCA	p.G65A	AMDHD1_uc009zth.1_5'UTR	NM_152435	NP_689648	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	65					histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding			central_nervous_system(1)	1						CAGTTTTCTGGAGAAACTTTT	0.323													30	441	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102053492	102053492	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102053492C>T	uc001tii.2	+	17	1837	c.1735C>T	c.(1735-1737)CCT>TCT	p.P579S	MYBPC1_uc001tig.2_Missense_Mutation_p.P604S|MYBPC1_uc010svq.1_Missense_Mutation_p.P566S|MYBPC1_uc001tih.2_Missense_Mutation_p.P604S|MYBPC1_uc001tij.2_Missense_Mutation_p.P579S|MYBPC1_uc010svr.1_Missense_Mutation_p.P579S|MYBPC1_uc010svs.1_Missense_Mutation_p.P579S|MYBPC1_uc010svt.1_Missense_Mutation_p.P567S|MYBPC1_uc010svu.1_Missense_Mutation_p.P560S|MYBPC1_uc001tik.2_Missense_Mutation_p.P553S	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	579	Ig-like C2-type 5.				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						AGAATCTTACCCTGATAGCAG	0.428													21	252	---	---	---	---	PASS
USP30	84749	broad.mit.edu	37	12	109519170	109519170	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109519170T>C	uc010sxi.1	+	8	856	c.752T>C	c.(751-753)CTT>CCT	p.L251P	USP30_uc001tnu.3_Missense_Mutation_p.L220P|USP30_uc001tnw.3_5'Flank	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	251	Cytoplasmic (Potential).				ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						TTTGATAGCCTTTCACTAAGT	0.363													8	703	---	---	---	---	PASS
RSRC2	65117	broad.mit.edu	37	12	122999662	122999662	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122999662A>C	uc001ucr.2	-	6	861	c.715T>G	c.(715-717)TTA>GTA	p.L239V	RSRC2_uc001uco.2_Missense_Mutation_p.L7V|RSRC2_uc001ucp.2_Missense_Mutation_p.L180V|RSRC2_uc001ucq.2_Missense_Mutation_p.L7V|RSRC2_uc001ucs.2_Missense_Mutation_p.L7V|RSRC2_uc001uct.2_Missense_Mutation_p.L191V|RSRC2_uc001ucu.2_Missense_Mutation_p.L239V	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a	239	Potential.									ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		CTTCTAGCTAAAGCTTCCTGT	0.393													35	566	---	---	---	---	PASS
HIP1R	9026	broad.mit.edu	37	12	123343650	123343650	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123343650A>G	uc001udj.1	+	22	2260	c.2201A>G	c.(2200-2202)GAG>GGG	p.E734G	HIP1R_uc001udk.1_5'UTR	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	734					receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		CGGGCTCTGGAGCTCATGGGG	0.682													3	20	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124887093	124887093	+	Silent	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124887093C>T	uc010tba.1	-	14	1614	c.1497G>A	c.(1495-1497)CAG>CAA	p.Q499Q	NCOR2_uc010tay.1_Silent_p.Q499Q|NCOR2_uc010taz.1_Silent_p.Q499Q|NCOR2_uc010tbb.1_Silent_p.Q499Q|NCOR2_uc010tbc.1_Silent_p.Q498Q|NCOR2_uc001ugj.1_Silent_p.Q499Q	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	499	Poly-Gln.				cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.328													4	98	---	---	---	---	PASS
C13orf34	79866	broad.mit.edu	37	13	73320181	73320181	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73320181A>G	uc001viv.1	+	9	957	c.838A>G	c.(838-840)ATT>GTT	p.I280V	C13orf34_uc010thq.1_Missense_Mutation_p.I55V|C13orf34_uc010aen.1_Missense_Mutation_p.I355V|C13orf34_uc010thr.1_Missense_Mutation_p.I210V|C13orf34_uc001viw.1_Missense_Mutation_p.I229V	NM_024808	NP_079084	Q6PGQ7	BORA_HUMAN	aurora borealis	280					cell division|mitosis|regulation of mitosis|regulation of mitotic spindle organization|regulation of protein localization		protein kinase binding				0		Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.000227)		TTTCTCACCAATTGAATTTCA	0.373													8	232	---	---	---	---	PASS
PCK2	5106	broad.mit.edu	37	14	24568786	24568786	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24568786C>A	uc001wlt.2	+	6	1004	c.872C>A	c.(871-873)CCT>CAT	p.P291H	NRL_uc001wlq.2_Intron|PCK2_uc001wlr.1_Missense_Mutation_p.P303H|PCK2_uc001wls.2_Missense_Mutation_p.P291H|PCK2_uc010tnw.1_Missense_Mutation_p.P157H|PCK2_uc010ald.2_Missense_Mutation_p.P143H|PCK2_uc010ale.2_Silent_p.P94P|PCK2_uc010tnx.1_Missense_Mutation_p.P157H|PCK2_uc001wlu.3_Missense_Mutation_p.P157H	NM_004563	NP_004554	Q16822	PCKGM_HUMAN	mitochondrial phosphoenolpyruvate carboxykinase	291					gluconeogenesis	mitochondrial matrix	GTP binding|metal ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0184)		ATCACCAGCCCTGCAGGGAAG	0.587													9	125	---	---	---	---	PASS
IPO4	79711	broad.mit.edu	37	14	24655980	24655980	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24655980G>A	uc001wmv.1	-	9	905	c.774C>T	c.(772-774)GCC>GCT	p.A258A	IPO4_uc001wmt.1_5'Flank|IPO4_uc001wmu.2_5'UTR|IPO4_uc001wmx.1_Silent_p.A122A|IPO4_uc001wmy.1_Silent_p.A122A|IPO4_uc010tnz.1_RNA|IPO4_uc001wmw.1_RNA|IPO4_uc001wmz.1_Silent_p.A258A	NM_024658	NP_078934	Q8TEX9	IPO4_HUMAN	importin 4	258					intracellular protein transport	cytoplasm|nucleus	protein binding|protein transporter activity			kidney(1)	1				GBM - Glioblastoma multiforme(265;0.0087)		CATTGCCCAGGGCCACATTTC	0.512													4	134	---	---	---	---	PASS
PPP2R3C	55012	broad.mit.edu	37	14	35554890	35554890	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35554890A>G	uc001wss.2	-	13	1622	c.1268T>C	c.(1267-1269)ATT>ACT	p.I423T	PPP2R3C_uc001wst.2_Missense_Mutation_p.I307T|PPP2R3C_uc010tpr.1_Missense_Mutation_p.I307T|PPP2R3C_uc001wsu.2_RNA	NM_017917	NP_060387	Q969Q6	P2R3C_HUMAN	serine/threonine-protein phosphatase 2A	423						centrosome|nucleus	calcium ion binding			ovary(1)	1	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		ATCGATTAGAATGGTGGTTAC	0.393													6	336	---	---	---	---	PASS
MIA2	117153	broad.mit.edu	37	14	39703435	39703435	+	Splice_Site	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39703435T>C	uc001wux.2	+	1	309	c.115_splice	c.e1+2	p.A39_splice	MIA2_uc010amy.1_Splice_Site	NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2							extracellular region				ovary(1)|breast(1)	2	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		AATGTGAAGGTAAGTTTGCTT	0.403													5	297	---	---	---	---	PASS
SDCCAG1	9147	broad.mit.edu	37	14	50251984	50251984	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50251984A>G	uc001wxc.2	-	30	3051	c.2983T>C	c.(2983-2985)TTT>CTT	p.F995L	SDCCAG1_uc010anj.1_Missense_Mutation_p.F995L|SDCCAG1_uc001wwz.2_Missense_Mutation_p.F195L|SDCCAG1_uc001wxa.2_Missense_Mutation_p.F275L|SDCCAG1_uc010tqi.1_Missense_Mutation_p.F974L|SDCCAG1_uc001wxe.2_Missense_Mutation_p.F953L	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1	995						cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		GGAATGGCAAACAGTAGTACA	0.383													5	310	---	---	---	---	PASS
ESR2	2100	broad.mit.edu	37	14	64746834	64746834	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64746834C>T	uc001xha.1	-	3	868	c.400G>A	c.(400-402)GCC>ACC	p.A134T	ESR2_uc001xgu.2_Missense_Mutation_p.A134T|ESR2_uc001xgv.2_Missense_Mutation_p.A134T|ESR2_uc001xgw.2_RNA|ESR2_uc001xgx.2_Missense_Mutation_p.A134T|ESR2_uc001xgy.1_Missense_Mutation_p.A134T|ESR2_uc001xgz.1_Missense_Mutation_p.A134T|ESR2_uc010aqb.1_Intron|ESR2_uc010aqc.1_Missense_Mutation_p.A134T	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1	134	Modulating.				cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	ACAGGGCTGGCGCAACGGTTC	0.493													12	116	---	---	---	---	PASS
GPHN	10243	broad.mit.edu	37	14	67389564	67389564	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67389564A>G	uc001xiy.2	+	7	1759	c.638A>G	c.(637-639)GAG>GGG	p.E213G	GPHN_uc001xiw.2_Missense_Mutation_p.E195G|GPHN_uc001xix.2_Missense_Mutation_p.E213G|GPHN_uc010tss.1_Missense_Mutation_p.E226G|GPHN_uc010tst.1_Missense_Mutation_p.E182G|GPHN_uc010tsu.1_Missense_Mutation_p.E103G	NM_001024218	NP_001019389	Q9NQX3	GEPH_HUMAN	gephyrin isoform 2	213	Interaction with GABARAP (By similarity).				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		GTTCAATGTGAGGAAGAGGAA	0.478			T	MLL	AL								26	206	---	---	---	---	PASS
HSP90AA1	3320	broad.mit.edu	37	14	102551043	102551043	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102551043T>C	uc001yku.3	-	5	1146	c.956A>G	c.(955-957)GAC>GGC	p.D319G	HSP90AA1_uc001ykv.3_Missense_Mutation_p.D441G|HSP90AA1_uc001ykw.1_Missense_Mutation_p.D140G|HSP90AA1_uc001ykx.1_Missense_Mutation_p.D308G	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	319					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)	ATCTTCCCAGTCATTGGTCAA	0.428													7	347	---	---	---	---	PASS
JAG2	3714	broad.mit.edu	37	14	105617708	105617708	+	Silent	SNP	C	T	T	rs147768578		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105617708C>T	uc001yqg.2	-	9	1583	c.1179G>A	c.(1177-1179)CCG>CCA	p.P393P	JAG2_uc001yqf.2_Translation_Start_Site|JAG2_uc001yqh.2_Silent_p.P393P	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	393	EGF-like 5; calcium-binding (Potential).|Extracellular (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CGGCCGCACACGGGTTCGAAG	0.657													5	18	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106790945	106790945	+	RNA	SNP	G	C	C	rs148991419	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106790945G>C	uc010tyt.1	-	386		c.14673C>G								Parts of antibodies, mostly variable regions.												0						CTGATTTCCCGCCAGCGTTCC	0.597													5	98	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107183575	107183575	+	RNA	SNP	G	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107183575G>T	uc010tyt.1	-	29		c.1982C>A								Parts of antibodies, mostly variable regions.												0						GCCCCTTCCCGGGAGCCTGGC	0.552													9	95	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107183594	107183594	+	RNA	SNP	C	T	T	rs116154875	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107183594C>T	uc010tyt.1	-	29		c.1963G>A								Parts of antibodies, mostly variable regions.												0						GCGGACCCAGCTCATGTAGTA	0.582													11	79	---	---	---	---	PASS
GOLGA8C	729786	broad.mit.edu	37	15	20776168	20776168	+	Missense_Mutation	SNP	C	T	T	rs142656913		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20776168C>T	uc010tzc.1	+	13	1679	c.664C>T	c.(664-666)CCT>TCT	p.P222S		NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E									p.P218S(1)		skin(1)	1						CATGGCTCTCCCTGGGGAAGG	0.597													4	113	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	42042275	42042275	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42042275A>G	uc010ucy.1	+	17	6651	c.6470A>G	c.(6469-6471)GAG>GGG	p.E2157G	MGA_uc010ucz.1_Missense_Mutation_p.E1948G|MGA_uc010uda.1_Missense_Mutation_p.E773G|MGA_uc001zoi.2_Missense_Mutation_p.E371G	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	2118	Basic motif.					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		CTACAGCCAGAGGCCAAAGAG	0.423													5	177	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54307142	54307142	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54307142A>G	uc002ack.2	+	1	2042	c.2042A>G	c.(2041-2043)AAC>AGC	p.N681S		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	681					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TATGAAACAAACAGTCTTTTT	0.403													6	161	---	---	---	---	PASS
RNF111	54778	broad.mit.edu	37	15	59359171	59359171	+	Silent	SNP	T	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59359171T>A	uc002afv.2	+	6	1854	c.1575T>A	c.(1573-1575)GCT>GCA	p.A525A	RNF111_uc002afs.2_Silent_p.A525A|RNF111_uc002aft.2_Silent_p.A525A|RNF111_uc002afu.2_Silent_p.A525A|RNF111_uc002afw.2_Silent_p.A525A|RNF111_uc002afx.2_Silent_p.A52A	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111	525					multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		CCCACCCAGCTGTCCCAGTTT	0.488													4	164	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63901323	63901323	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63901323G>A	uc002amp.2	-	78	14691	c.14543C>T	c.(14542-14544)TCG>TTG	p.S4848L	HERC1_uc002amo.2_RNA	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	4848	HECT.				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CACGTTTCTCGAGAGCATGTA	0.582													7	113	---	---	---	---	PASS
MEGF11	84465	broad.mit.edu	37	15	66198458	66198458	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66198458C>T	uc002apm.2	-	21	2873	c.2732G>A	c.(2731-2733)CGT>CAT	p.R911H	MEGF11_uc002apl.2_Missense_Mutation_p.R836H|MEGF11_uc002apn.1_Missense_Mutation_p.R911H	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor	911						basolateral plasma membrane|integral to membrane				pancreas(1)	1						TGTGTTCTGACGTCTATCCAT	0.388													4	369	---	---	---	---	PASS
BNC1	646	broad.mit.edu	37	15	83935707	83935707	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83935707C>T	uc002bjt.1	-	3	404	c.316G>A	c.(316-318)GTT>ATT	p.V106I	BNC1_uc010uos.1_Missense_Mutation_p.V94I	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	106					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TTTAGGCGAACGGGGATGGCC	0.502													5	111	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85399832	85399832	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85399832G>A	uc002ble.2	+	6	2636	c.2469G>A	c.(2467-2469)AGG>AGA	p.R823R		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	823					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGGATGGAAGGACCAGGGGAG	0.522													7	202	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102516350	102516350	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102516350G>A	uc002cdi.2	+	11	2096	c.676G>A	c.(676-678)GGA>AGA	p.G226R	WASH3P_uc002cdl.2_Missense_Mutation_p.G226R|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G226R|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						CTCTGGGAAAGGACCTGGGGC	0.622													3	17	---	---	---	---	PASS
ZNF200	7752	broad.mit.edu	37	16	3274074	3274074	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3274074A>T	uc002cuj.2	-	5	1638	c.1006T>A	c.(1006-1008)TTT>ATT	p.F336I	ZNF200_uc002cum.3_Missense_Mutation_p.F335I|ZNF200_uc010bti.2_Missense_Mutation_p.F335I|ZNF200_uc002cuk.2_Missense_Mutation_p.F336I|ZNF200_uc002cui.2_Missense_Mutation_p.F335I|ZNF200_uc002cul.3_Missense_Mutation_p.F335I	NM_003454	NP_003445	P98182	ZN200_HUMAN	zinc finger protein 200 isoform 1	336	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						GGACACTTAAATATCTTCTCC	0.418													46	167	---	---	---	---	PASS
RRN3P3	100131998	broad.mit.edu	37	16	22444123	22444123	+	RNA	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22444123G>A	uc002dkp.2	-	4		c.1060C>T			RRN3P3_uc010vbu.1_RNA	NR_027460				Homo sapiens cDNA FLJ31180 fis, clone KIDNE2000266.												0						ATCACTATCCGCTCAAAATTC	0.333													4	51	---	---	---	---	PASS
PRKCB	5579	broad.mit.edu	37	16	24231171	24231171	+	Intron	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24231171C>T	uc002dmd.2	+						PRKCB_uc002dme.2_3'UTR	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	CAGCACAGGGCTCTTTCTGAC	0.438													12	62	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49672052	49672052	+	Silent	SNP	A	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49672052A>T	uc002efs.2	-	5	1309	c.1011T>A	c.(1009-1011)GGT>GGA	p.G337G	ZNF423_uc010vgn.1_Silent_p.G220G	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	337	C2H2-type 8.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GGCAGTAGACACCTTCCACTG	0.617													13	56	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53341745	53341745	+	Silent	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53341745C>T	uc002ehb.2	+	32	7097	c.6933C>T	c.(6931-6933)AGC>AGT	p.S2311S	CHD9_uc002egy.2_Silent_p.S2311S|CHD9_uc002ehc.2_Silent_p.S2312S|CHD9_uc002ehf.2_Silent_p.S1425S|CHD9_uc010cbw.2_Silent_p.S377S|CHD9_uc002ehg.1_Silent_p.S318S	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2311					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				CAGAATACAGCGATCCCAGTG	0.473													3	137	---	---	---	---	PASS
FAM65A	79567	broad.mit.edu	37	16	67576412	67576412	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67576412C>T	uc010vjp.1	+	13	1879	c.1783C>T	c.(1783-1785)CAC>TAC	p.H595Y	FAM65A_uc010cei.1_Missense_Mutation_p.H417Y|FAM65A_uc002eth.2_Missense_Mutation_p.H575Y|FAM65A_uc010cej.2_Missense_Mutation_p.H578Y|FAM65A_uc002eti.1_Missense_Mutation_p.H538Y|FAM65A_uc010vjq.1_Missense_Mutation_p.H589Y|FAM65A_uc002etj.1_Missense_Mutation_p.H574Y|FAM65A_uc002etk.2_Missense_Mutation_p.H574Y	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	579	Pro-rich.					cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		AGGCTCCACCCACAAGCCCAT	0.557													6	864	---	---	---	---	PASS
RLTPR	146206	broad.mit.edu	37	16	67685104	67685104	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67685104G>T	uc002etn.2	+	23	2319	c.2199G>T	c.(2197-2199)TTG>TTT	p.L733F	RLTPR_uc010cel.1_Missense_Mutation_p.L726F|RLTPR_uc010vjr.1_Missense_Mutation_p.L697F|RLTPR_uc010vjs.1_5'Flank	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	733										breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TGAATGAATTGTGTCAGTCGG	0.612													8	96	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74444645	74444645	+	Intron	SNP	C	T	T	rs144170380	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74444645C>T	uc002fct.2	-						CLEC18B_uc002fcu.2_Intron|CLEC18B_uc010vmu.1_3'UTR	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region	sugar binding				0						CCTGGGCCCTCCCCGGGAAAG	0.682													8	307	---	---	---	---	PASS
BCAR1	9564	broad.mit.edu	37	16	75270822	75270822	+	Silent	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75270822G>A	uc002fdv.2	-	4	993	c.870C>T	c.(868-870)CCC>CCT	p.P290P	BCAR1_uc002fdt.2_5'Flank|BCAR1_uc002fdu.2_Silent_p.P80P|BCAR1_uc010cgu.2_Silent_p.P261P|BCAR1_uc010vna.1_Silent_p.P288P|BCAR1_uc010vnb.1_Silent_p.P336P|BCAR1_uc002fdw.2_Silent_p.P290P|BCAR1_uc010vnc.1_Silent_p.P142P|BCAR1_uc010vnd.1_Silent_p.P308P|BCAR1_uc002fdx.2_Silent_p.P308P	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	290	Substrate for kinases (By similarity).				actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		CCACACTGGGGGGCACGTCAT	0.622													3	68	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90168774	90168774	+	RNA	SNP	A	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90168774A>C	uc002fqr.2	+	1		c.73A>C								Homo sapiens cDNA FLJ35239 fis, clone PROST2002212.																		GAGGATCCAGATTTCCCTGTG	0.328													6	226	---	---	---	---	PASS
YWHAE	7531	broad.mit.edu	37	17	1268251	1268251	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1268251T>C	uc002fsj.2	-	2	318	c.166A>G	c.(166-168)AGA>GGA	p.R56G	YWHAE_uc002fsk.2_Missense_Mutation_p.R34G|YWHAE_uc010vqh.1_RNA|YWHAE_uc010vqi.1_RNA	NM_006761	NP_006752	P62258	1433E_HUMAN	tyrosine 3/tryptophan 5 -monooxygenase	56					apoptosis|G2/M transition of mitotic cell cycle|induction of apoptosis by extracellular signals|interspecies interaction between organisms|intracellular signal transduction|nerve growth factor receptor signaling pathway	cytosol|melanosome	histone deacetylase binding|phosphoserine binding			lung(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		GAGGCTCTTCTAGCTCCAATC	0.418													5	478	---	---	---	---	PASS
TEKT3	64518	broad.mit.edu	37	17	15207259	15207259	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15207259G>C	uc002gon.2	-	9	1654	c.1467C>G	c.(1465-1467)TTC>TTG	p.F489L		NM_031898	NP_114104	Q9BXF9	TEKT3_HUMAN	tektin 3	489					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		GTCCCTAGCAGAAGCCGACCA	0.512													17	118	---	---	---	---	PASS
CCT6B	10693	broad.mit.edu	37	17	33269837	33269837	+	Missense_Mutation	SNP	C	T	T	rs151193695	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33269837C>T	uc002hig.2	-	6	797	c.703G>A	c.(703-705)GTT>ATT	p.V235I	CCT6B_uc010ctg.2_Intron|CCT6B_uc010wcc.1_Missense_Mutation_p.V190I	NM_006584	NP_006575	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B	235					chaperone-mediated protein complex assembly|protein folding|spermatogenesis	cytoplasm	ATP binding|protein transporter activity|unfolded protein binding			pancreas(1)	1		Ovarian(249;0.17)				TCCAGTGAAACGTTGCAAATA	0.328													9	361	---	---	---	---	PASS
KRT26	353288	broad.mit.edu	37	17	38926611	38926611	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38926611C>T	uc002hvf.2	-	3	621	c.575G>A	c.(574-576)GGT>GAT	p.G192D		NM_181539	NP_853517	Q7Z3Y9	K1C26_HUMAN	keratin 26	192	Rod.|Coil 1B.					intermediate filament	structural molecule activity				0		Breast(137;0.00526)				TCTGCGAAGACCACTGGTGTC	0.483													8	180	---	---	---	---	PASS
HIGD1B	51751	broad.mit.edu	37	17	42925468	42925468	+	5'UTR	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42925468A>G	uc002ihm.2	+	1						NM_016438	NP_057522	Q9P298	HIG1B_HUMAN	HIG1 hypoxia inducible domain family, member 1B							integral to membrane					0		Prostate(33;0.109)				GCCTCTCTCTAGGACGGGGCT	0.537													10	54	---	---	---	---	PASS
PRAC	84366	broad.mit.edu	37	17	46799733	46799733	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46799733C>T	uc002iny.2	-	1	150	c.22G>A	c.(22-24)GAT>AAT	p.D8N	C17orf93_uc002inz.1_5'Flank	NM_032391	NP_115767	Q96KF2	PRAC_HUMAN	prostate cancer susceptibility candidate	8						nucleus					0						GGTCCTTGATCTGAGAAATGG	0.517													10	191	---	---	---	---	PASS
CDK3	1018	broad.mit.edu	37	17	73999460	73999460	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73999460A>G	uc010dgt.2	+	7	849	c.773A>G	c.(772-774)GAG>GGG	p.E258G	CDK3_uc002jqg.3_Missense_Mutation_p.E286G	NM_001258	NP_001249	Q00526	CDK3_HUMAN	cyclin-dependent kinase 3	258	Protein kinase.				cell division|cell proliferation|mitosis		ATP binding|cyclin-dependent protein kinase activity			central_nervous_system(1)	1						CTGGAGCCAGAGGGCAGGGAC	0.582													4	43	---	---	---	---	PASS
SFRS2	6427	broad.mit.edu	37	17	74732441	74732441	+	Silent	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74732441T>C	uc002jsv.2	-	2	638	c.468A>G	c.(466-468)CGA>CGG	p.R156R	SFRS2_uc002jsw.1_RNA|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Silent_p.R156R|SFRS2_uc010wtg.1_Silent_p.R144R|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	NM_003016	NP_003007	Q01130	SRSF2_HUMAN	splicing factor, arginine/serine-rich 2	156	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity				0						TCGACCGAGATCGAGAACGAG	0.652													7	56	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	109344	109344	+	RNA	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:109344T>C	uc002kke.2	+	1		c.280T>C								Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		aggctttgcctacaggggaca	0.000													4	29	---	---	---	---	PASS
ANKRD30B	374860	broad.mit.edu	37	18	14760580	14760580	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14760580A>G	uc010dlo.2	+	6	963	c.783A>G	c.(781-783)ATA>ATG	p.I261M	ANKRD30B_uc010xak.1_RNA	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	261										ovary(1)|skin(1)	2						TGGAACATATACGAAAATTAC	0.284													5	277	---	---	---	---	PASS
AES	166	broad.mit.edu	37	19	3056393	3056393	+	Intron	SNP	T	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3056393T>G	uc002lwy.1	-						AES_uc002lwx.1_Silent_p.P91P|AES_uc002lwz.1_Intron|AES_uc002lxa.1_Intron|AES_uc002lxb.1_Intron|AES_uc002lxc.2_Intron	NM_001130	NP_001121	Q08117	AES_HUMAN	amino-terminal enhancer of split isoform b						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of response to cytokine stimulus|negative regulation of transcription from RNA polymerase II promoter|organ morphogenesis|response to interleukin-1|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gagatgggggtggggaaggat	0.144													6	51	---	---	---	---	PASS
ATCAY	85300	broad.mit.edu	37	19	3905489	3905489	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3905489C>T	uc002lyy.3	+	4	624	c.194C>T	c.(193-195)GCC>GTC	p.A65V	ATCAY_uc010xhz.1_Missense_Mutation_p.A71V	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin	65					transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		ACGCTGGTGGCCCCAGAGATC	0.488													16	133	---	---	---	---	PASS
EMR4P	326342	broad.mit.edu	37	19	6974657	6974657	+	5'UTR	SNP	G	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6974657G>T	uc010xjk.1	-	8					EMR4P_uc010dve.1_Intron	NR_024075				RecName: Full=Putative EGF-like module-containing mucin-like hormone receptor-like 4; AltName: Full=G-protein coupled receptor 127; AltName: Full=G-protein coupled receptor PGR16; Flags: Precursor;												0						CCAAGAGATTGATAAGTGATA	0.408													5	150	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9072939	9072939	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9072939C>T	uc002mkp.2	-	3	14711	c.14507G>A	c.(14506-14508)GGG>GAG	p.G4836E		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4838	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACCGGTGGTCCCCACATTGGT	0.458													28	343	---	---	---	---	PASS
EMR3	84658	broad.mit.edu	37	19	14730267	14730267	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14730267C>T	uc002mzi.3	-	16	2085	c.1937G>A	c.(1936-1938)GGA>GAA	p.G646E	EMR3_uc010dzp.2_Missense_Mutation_p.G594E|EMR3_uc010xnv.1_Missense_Mutation_p.G520E	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor	646	Cytoplasmic (Potential).				neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						CTTCACTTGTCCTGGAAAAAC	0.328													5	369	---	---	---	---	PASS
USHBP1	83878	broad.mit.edu	37	19	17373404	17373404	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17373404G>A	uc002nfs.1	-	4	712	c.599C>T	c.(598-600)TCC>TTC	p.S200F	USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Missense_Mutation_p.S136F|USHBP1_uc010eam.1_Missense_Mutation_p.S128F	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	200	Potential.						PDZ domain binding			ovary(1)	1						GGCCTCCAGGGAGGCCTGCGT	0.667													5	13	---	---	---	---	PASS
ZNF253	56242	broad.mit.edu	37	19	19976780	19976780	+	5'UTR	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19976780A>G	uc002noj.2	+	1					ZNF253_uc002nok.2_5'UTR|ZNF253_uc002nol.2_RNA	NM_021047	NP_066385	O75346	ZN253_HUMAN	zinc finger protein 253						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCACAGCTAAACCCCGGGACC	0.597													10	74	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22574754	22574754	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22574754T>G	uc002nqt.2	-	4	1405	c.1283A>C	c.(1282-1284)CAT>CCT	p.H428P		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	428	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CTCTCCAGTATGAATTCTCTT	0.378													10	41	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41601670	41601670	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41601670C>T	uc002opt.2	+	9	1318	c.1309C>T	c.(1309-1311)CGG>TGG	p.R437W		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	437					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	CTCAGGAAAGCGGTACTGTTT	0.572													5	181	---	---	---	---	PASS
CIC	23152	broad.mit.edu	37	19	42793535	42793535	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42793535A>T	uc002otf.1	+	8	1377	c.1337A>T	c.(1336-1338)GAG>GTG	p.E446V		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	446					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				ATCTGTGAGGAGGAAGGGGAT	0.612			T	DUX4	soft tissue sarcoma								20	136	---	---	---	---	PASS
PSG5	5673	broad.mit.edu	37	19	43679580	43679580	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43679580A>G	uc002ovu.2	-	4	882	c.751T>C	c.(751-753)TAC>CAC	p.Y251H	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Missense_Mutation_p.Y126H|PSG5_uc002ovx.2_Missense_Mutation_p.Y251H|PSG5_uc002ovv.2_Missense_Mutation_p.Y344H|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	251	Ig-like C2-type 2.				female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				CCTGAACGGTAATAGGTGAAT	0.488													50	277	---	---	---	---	PASS
SRRM5	100170229	broad.mit.edu	37	19	44116657	44116657	+	Silent	SNP	A	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44116657A>C	uc002oxb.2	+	3	737	c.384A>C	c.(382-384)GGA>GGC	p.G128G	ZNF428_uc002oxa.2_Intron|SRRM5_uc010xwr.1_Silent_p.G128G	NM_001145641	NP_001139113	B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	128	Ser-rich.										0						GCAGAAGGGGAAGCCGCAGCT	0.642													13	60	---	---	---	---	PASS
SCAF1	58506	broad.mit.edu	37	19	50154204	50154204	+	Silent	SNP	A	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50154204A>C	uc002poq.2	+	7	682	c.558A>C	c.(556-558)CCA>CCC	p.P186P		NM_021228	NP_067051	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	186	Pro-rich.				mRNA processing|RNA splicing	nucleus	RNA binding				0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		Gccctgccccaccccctgccc	0.373													4	28	---	---	---	---	PASS
SIGLEC6	946	broad.mit.edu	37	19	52033233	52033233	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52033233A>G	uc002pwy.2	-	5	919	c.757T>C	c.(757-759)TTC>CTC	p.F253L	SIGLEC6_uc002pwz.2_Missense_Mutation_p.F237L|SIGLEC6_uc002pxa.2_Missense_Mutation_p.F253L|SIGLEC6_uc010ydb.1_Missense_Mutation_p.F190L|SIGLEC6_uc010ydc.1_Missense_Mutation_p.F253L|SIGLEC6_uc010eoz.1_Missense_Mutation_p.F231L|SIGLEC6_uc010epb.1_Missense_Mutation_p.F206L|SIGLEC6_uc010epa.1_Missense_Mutation_p.F242L	NM_001245	NP_001236	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6 isoform 1	253	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus				ovary(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		AGGATTTTGAAGGCTTTGGGG	0.592													7	613	---	---	---	---	PASS
ZNF415	55786	broad.mit.edu	37	19	53625746	53625746	+	Intron	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53625746A>G	uc002qax.2	-						ZNF415_uc002qat.2_Intron|ZNF415_uc002qaw.2_Intron|ZNF415_uc010yds.1_Intron|ZNF415_uc010ydt.1_5'UTR|ZNF415_uc002qau.2_Intron|ZNF415_uc002qav.2_Intron|ZNF415_uc002qba.2_Intron|ZNF415_uc002qay.2_Intron|ZNF415_uc002qaz.2_Intron	NR_028343		Q09FC8	ZN415_HUMAN	RecName: Full=Zinc finger protein 415;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.0191)		TCAGGGTGAGACGGAATCTCA	0.557													5	79	---	---	---	---	PASS
DDRGK1	65992	broad.mit.edu	37	20	3183874	3183874	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3183874C>T	uc002wic.2	-	2	302	c.280G>A	c.(280-282)GAA>AAA	p.E94K	DDRGK1_uc010gaw.2_RNA|DDRGK1_uc010gax.1_Missense_Mutation_p.E94K	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1 precursor	94						endoplasmic reticulum	protein binding				0						ATGACAGCTTCCTCCTCGTTC	0.672													3	64	---	---	---	---	PASS
C20orf194	25943	broad.mit.edu	37	20	3356950	3356950	+	Splice_Site	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3356950C>T	uc002wii.2	-	4	335	c.284_splice	c.e4-1	p.D95_splice	C20orf194_uc002wik.2_5'Flank|C20orf194_uc010gay.1_Splice_Site	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						ATAATTACATCTGTAAGAAAA	0.328													4	284	---	---	---	---	PASS
NFS1	9054	broad.mit.edu	37	20	34285610	34285610	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34285610C>T	uc002xdw.1	-	3	384	c.320G>A	c.(319-321)CGT>CAT	p.R107H	NFS1_uc002xdt.1_Missense_Mutation_p.R47H|NFS1_uc002xdu.1_Missense_Mutation_p.R47H|NFS1_uc002xdv.1_RNA|NFS1_uc010zvk.1_5'UTR|NFS1_uc010zvl.1_Missense_Mutation_p.R107H|NFS1_uc002xdx.2_Missense_Mutation_p.R107H|ROMO1_uc002xdy.2_5'Flank|ROMO1_uc010gfm.2_5'Flank	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor	107					cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	ACTAACCTGACGAGCACGTTC	0.522													15	135	---	---	---	---	PASS
B4GALT5	9334	broad.mit.edu	37	20	48252773	48252773	+	3'UTR	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48252773T>C	uc002xuu.3	-	9						NM_004776	NP_004767	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			GTGTAGACCCTCCCCCCTCCA	0.493													5	188	---	---	---	---	PASS
AURKA	6790	broad.mit.edu	37	20	54945046	54945046	+	3'UTR	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54945046A>G	uc002xxd.1	-	11					AURKA_uc002xxe.1_3'UTR|AURKA_uc002xxf.1_3'UTR|AURKA_uc002xxg.1_3'UTR|AURKA_uc002xxh.1_3'UTR|AURKA_uc002xxi.1_3'UTR|AURKA_uc002xxj.1_3'UTR|AURKA_uc002xxk.1_3'UTR|AURKA_uc010zzd.1_RNA	NM_198433	NP_940835	O14965	AURKA_HUMAN	serine/threonine protein kinase 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|phosphatidylinositol-mediated signaling|regulation of protein stability|spindle organization	cytosol|nucleus|perinuclear region of cytoplasm|spindle microtubule|spindle pole centrosome	ATP binding|protein kinase binding|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(1)|large_intestine(1)|skin(1)	8			Colorectal(105;0.202)			ATTGATGTGGAGCTTTCTGAA	0.428													21	84	---	---	---	---	PASS
CSTF1	1477	broad.mit.edu	37	20	54974398	54974398	+	Silent	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54974398C>T	uc002xxl.1	+	5	1221	c.1021C>T	c.(1021-1023)CTG>TTG	p.L341L	CSTF1_uc002xxm.1_Silent_p.L341L|CSTF1_uc002xxn.1_Silent_p.L341L|CSTF1_uc002xxo.1_Silent_p.L284L	NM_001033521	NP_001028693	Q05048	CSTF1_HUMAN	cleavage stimulation factor subunit 1	341	WD 5.				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding			central_nervous_system(1)	1			Colorectal(105;0.202)			GGGACGAACACTGGTCAGATA	0.264													4	201	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11038748	11038748	+	3'UTR	SNP	C	T	T	rs75164355	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11038748C>T	uc002yit.1	-	6					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CGAGGTCTACCAGGAGAAAAT	0.378													7	316	---	---	---	---	PASS
HSPA13	6782	broad.mit.edu	37	21	15755498	15755498	+	5'UTR	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15755498C>A	uc002yjt.2	-	1					HSPA13_uc011abx.1_5'UTR	NM_006948	NP_008879	P48723	HSP13_HUMAN	heat shock protein 70kDa family member 13							endoplasmic reticulum|microsome	ATP binding			kidney(1)	1						ACCGCCCCCACTCCTCCCGGC	0.602													7	60	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47686137	47686137	+	Intron	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47686137C>A	uc002zir.1	-						MCM3AP_uc002ziq.1_5'UTR	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3						DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					GACAGCTTCGCCCTCAGTGCC	0.602													3	29	---	---	---	---	PASS
CYTSA	23384	broad.mit.edu	37	22	24718627	24718627	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24718627C>T	uc002zzw.2	+	5	1986	c.1679C>T	c.(1678-1680)GCC>GTC	p.A560V	CYTSA_uc002zzv.3_Missense_Mutation_p.A560V|CYTSA_uc011ajq.1_Missense_Mutation_p.A560V	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A	560	Potential.				cell cycle|cell division						0						GCCTTGGCAGCCACGTTAGAG	0.478													4	147	---	---	---	---	PASS
PMM1	5372	broad.mit.edu	37	22	41973272	41973272	+	3'UTR	SNP	G	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41973272G>T	uc003bal.2	-	8						NM_002676	NP_002667	Q92871	PMM1_HUMAN	phosphomannomutase 1						dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	metal ion binding|phosphomannomutase activity			ovary(1)	1						CCTCTCTTTAGGCCTAGGCCA	0.602											OREG0026591	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	22	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46712158	46712158	+	Silent	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46712158C>A	uc011aqy.1	+	7	1493	c.1281C>A	c.(1279-1281)GGC>GGA	p.G427G	GTSE1_uc011aqz.1_Silent_p.G274G|GTSE1_uc003bhl.1_Silent_p.G52G|GTSE1_uc003bhm.1_Silent_p.G52G	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	408					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CGGAAGGTGGCGGCCAGTGGC	0.567													9	37	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46807533	46807533	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46807533A>G	uc003bhw.1	-	6	4735	c.4735T>C	c.(4735-4737)TGC>CGC	p.C1579R	CELSR1_uc011arc.1_5'Flank	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1579	Extracellular (Potential).|Laminin G-like 1.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGGGCAGCGCAGCTGTAGTTC	0.627													10	54	---	---	---	---	PASS
PCYT1B	9468	broad.mit.edu	37	X	24593333	24593333	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24593333T>C	uc004dbi.2	-	7	1044	c.811A>G	c.(811-813)AGC>GGC	p.S271G	PCYT1B_uc004dbk.3_Missense_Mutation_p.S271G|PCYT1B_uc004dbj.2_Missense_Mutation_p.S253G	NM_004845	NP_004836	Q9Y5K3	PCY1B_HUMAN	choline phosphate cytidylyltransferase 1 beta	271						endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)	AGATCATGGCTCTTTTCTTCC	0.403													7	630	---	---	---	---	PASS
CENPI	2491	broad.mit.edu	37	X	100364566	100364566	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100364566T>C	uc004egx.2	+	4	739	c.469T>C	c.(469-471)TCT>CCT	p.S157P	CENPI_uc011mrg.1_Missense_Mutation_p.S157P|CENPI_uc004egy.2_Missense_Mutation_p.S157P	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	157					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1						TGGCAAGTGTTCTGGTAGCAC	0.423													6	281	---	---	---	---	PASS
TAF7L	54457	broad.mit.edu	37	X	100524077	100524077	+	3'UTR	SNP	G	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100524077G>T	uc004ehb.2	-	13					TAF7L_uc004eha.2_3'UTR	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						AAATATAACTGATTCAACATA	0.403													4	91	---	---	---	---	PASS
TAF7L	54457	broad.mit.edu	37	X	100532702	100532702	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100532702C>A	uc004ehb.2	-	9	853	c.841G>T	c.(841-843)GAA>TAA	p.E281*	TAF7L_uc004eha.2_Nonsense_Mutation_p.E195*|TAF7L_uc004ehc.1_Nonsense_Mutation_p.E195*	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	281					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						GCAATGACTTCCCAACCTGAA	0.453													63	163	---	---	---	---	PASS
ZMAT1	84460	broad.mit.edu	37	X	101153192	101153192	+	Translation_Start_Site	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101153192C>T	uc004ein.2	-	3	420	c.-960G>A	c.(-962--958)GGGTG>GGATG		ZMAT1_uc011mrl.1_Missense_Mutation_p.G77D|ZMAT1_uc011mrm.1_Translation_Start_Site	NM_032441	NP_115817	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin type 1 isoform 3							nucleus	zinc ion binding			ovary(1)	1						ATGTTTTTCACCCTGAAAAAA	0.299													8	195	---	---	---	---	PASS
ARMCX5	64860	broad.mit.edu	37	X	101858224	101858224	+	Silent	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101858224A>G	uc004ejg.2	+	6	2036	c.1155A>G	c.(1153-1155)GAA>GAG	p.E385E	ARMCX5_uc004ejh.2_Silent_p.E385E	NM_022838	NP_073749	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	385							binding			ovary(1)	1						CTTCCGAAGAACCAAAATCAG	0.423													4	72	---	---	---	---	PASS
GPR101	83550	broad.mit.edu	37	X	136112680	136112680	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136112680C>T	uc011mwh.1	-	1	1154	c.1154G>A	c.(1153-1155)AGC>AAC	p.S385N		NM_054021	NP_473362	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	385	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					AGGAGGGTTGCTGTTGCTGTT	0.512													36	101	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140953292	140953292	+	Silent	SNP	C	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140953292C>T	uc011mwp.1	+	2	159	c.159C>T	c.(157-159)GCC>GCT	p.A53A		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	53										skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ACTATTCTGCCTTTCATCTTG	0.512													29	204	---	---	---	---	PASS
IL9R	3581	broad.mit.edu	37	X	155239824	155239824	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155239824A>G	uc004fnv.1	+	9	1495	c.1316A>G	c.(1315-1317)AAC>AGC	p.N439S	IL9R_uc004fnu.1_3'UTR	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor	439	Poly-Asn.|Cytoplasmic (Potential).				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					agcagcagcaacaacaacaAC	0.517													6	21	---	---	---	---	PASS
IL9R	3581	broad.mit.edu	37	X	155239827	155239827	+	Missense_Mutation	SNP	A	G	G	rs150178903	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155239827A>G	uc004fnv.1	+	9	1498	c.1319A>G	c.(1318-1320)AAC>AGC	p.N440S	IL9R_uc004fnu.1_3'UTR	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor	440	Poly-Asn.|Cytoplasmic (Potential).				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					agcagcaacaacaacaACTAC	0.517													5	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	1748	1748	+	5'Flank	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:1748G>A	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		AATAAAGTATAGGCGATAGAA	0.408													209	162	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3928	3928	+	RNA	SNP	G	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3928G>A	uc004cos.3	+	2		c.2221G>A			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		AGTCCGAACTAGTCTCAGGCT	0.483													137	204	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	11992	11992	+	RNA	SNP	T	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:11992T>C	uc004cov.3	+	1		c.1415T>C			uc004cow.1_5'Flank|uc004cox.3_5'Flank|uc004coy.2_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		CTCTACATATTTACCACAACA	0.438													6	455	---	---	---	---	PASS
AGRN	375790	broad.mit.edu	37	1	985444	985444	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:985444delG	uc001ack.1	+							NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor						axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TCTCGGGGCAGGGGGGGGGGG	0.657													4	4	---	---	---	---	
CPSF3L	54973	broad.mit.edu	37	1	1255404	1255404	+	Intron	DEL	G	-	-	rs146327112		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1255404delG	uc001aee.1	-						CPSF3L_uc009vjy.1_5'Flank|CPSF3L_uc001aef.1_Intron|CPSF3L_uc009vjz.1_Intron|CPSF3L_uc010nyj.1_Intron|CPSF3L_uc001aeg.1_Intron|CPSF3L_uc001aeh.1_Intron|CPSF3L_uc001aei.1_Intron|CPSF3L_uc001aej.1_Intron|CPSF3L_uc001aek.1_Intron|CPSF3L_uc001aem.1_Intron|CPSF3L_uc001ael.1_Intron|CPSF3L_uc001aen.1_3'UTR	NM_017871	NP_060341	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor							Golgi apparatus|nucleus	hydrolase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		CCTGGCTGCTGGGGAGGACAG	0.652													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4122571	4122572	+	IGR	INS	-	CC	CC	rs138121280	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4122571_4122572insCC								LOC100133612 (288694 upstream) : LOC284661 (349539 downstream)																							tctgtttctctctgtctctgtc	0.238													2	5	---	---	---	---	
AJAP1	55966	broad.mit.edu	37	1	4776771	4776773	+	Intron	DEL	GAT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4776771_4776773delGAT	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943	Q9UKB5	AJAP1_HUMAN	adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		gtgatagagagatgatgatgatg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9094329	9094329	+	IGR	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9094329delG								SLC2A7 (7925 upstream) : SLC2A5 (2678 downstream)																							AAACCTGGCAGGGACGCCCGA	0.348													4	2	---	---	---	---	
APITD1	378708	broad.mit.edu	37	1	10490760	10490768	+	Intron	DEL	TGGCTTAAC	-	-	rs35995075		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10490760_10490768delTGGCTTAAC	uc001are.2	+						APITD1_uc001arf.2_Intron|APITD1_uc001arg.2_Intron|APITD1_uc001arh.2_5'Flank	NM_199294	NP_954988	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1 isoform						DNA repair|mitotic prometaphase|transcription initiation, DNA-dependent	chromosome, centromeric region|cytosol|Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		GCGCATGCGTTGGCTTAACTGCCGCGGGT	0.603													10	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14295314	14295315	+	IGR	DEL	TG	-	-	rs145043677		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14295314_14295315delTG								PRDM2 (143742 upstream) : KAZ (629898 downstream)																							ctctacattctgtctctccagt	0.000													3	3	---	---	---	---	
CASP9	842	broad.mit.edu	37	1	15850387	15850390	+	Intron	DEL	CTGA	-	-	rs4645986		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15850387_15850390delCTGA	uc001awn.2	-						DNAJC16_uc001awr.1_5'Flank|DNAJC16_uc001aws.2_5'Flank|DNAJC16_uc001awt.2_5'Flank|CASP9_uc001awm.1_Intron|CASP9_uc001awo.2_Intron|CASP9_uc001awp.2_Intron|CASP9_uc009voi.2_Intron|CASP9_uc010obm.1_Intron|CASP9_uc001awq.2_Intron	NM_001229	NP_001220	P55211	CASP9_HUMAN	caspase 9 isoform alpha preproprotein						activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding			central_nervous_system(1)|kidney(1)	2		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		ACAGTGTACGCTGACTGAGTATGG	0.338													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16551712	16551713	+	IGR	DEL	TG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16551712_16551713delTG								ARHGEF19 (12608 upstream) : C1orf89 (6470 downstream)																							CCTGGAGGGCTGAACTGGGCAT	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16860989	16860990	+	Intron	DEL	CT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16860989_16860990delCT	uc009voq.1	-						uc001ayv.1_5'Flank					Homo sapiens cDNA FLJ43749 fis, clone TESTI2034749.																		CCGCTCTCCCCTGAGCTTACAG	0.663													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17463313	17463314	+	IGR	DEL	TC	-	-	rs78700419	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17463313_17463314delTC								PADI2 (17365 upstream) : PADI1 (68307 downstream)																							ttgcatttagtctttttttttt	0.243													4	2	---	---	---	---	
RCC2	55920	broad.mit.edu	37	1	17747996	17747996	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17747996delA	uc001bal.2	-						RCC2_uc001bam.2_Intron	NM_001136204	NP_001129676	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2						cell division|mitotic prometaphase	chromosome, centromeric region|cytosol|microtubule|nucleolus|spindle					0		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		tctcccctccaaaaaaaaaag	0.169													4	2	---	---	---	---	
ZCCHC17	51538	broad.mit.edu	37	1	31799116	31799117	+	Intron	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31799116_31799117insT	uc001bsp.1	+						ZCCHC17_uc001bsq.1_Intron|ZCCHC17_uc010ogf.1_Intron|ZCCHC17_uc009vtu.1_Intron|ZCCHC17_uc001bsr.1_Intron|ZCCHC17_uc009vtv.1_Intron	NM_016505	NP_057589	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17							nucleolus	RNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		ACTTCTGGAAATTTTTTTTAAG	0.243													4	2	---	---	---	---	
SFPQ	6421	broad.mit.edu	37	1	35649755	35649755	+	3'UTR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35649755delA	uc001bys.2	-	10					SFPQ_uc001byr.2_Intron	NM_005066	NP_005057	P23246	SFPQ_HUMAN	splicing factor proline/glutamine rich						alternative nuclear mRNA splicing, via spliceosome|DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|nucleotide binding|protein binding|protein binding|RNA binding		SFPQ/TFE3(6)	kidney(4)|soft_tissue(2)|ovary(1)|skin(1)	8		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				GAAGCACAGTAAAAAAAAAAA	0.289			T	TFE3	papillary renal cell								5	4	---	---	---	---	
PTPRF	5792	broad.mit.edu	37	1	44025845	44025846	+	Intron	INS	-	TG	TG	rs142071261	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44025845_44025846insTG	uc001cjr.2	+						PTPRF_uc001cjq.3_Intron|PTPRF_uc001cjs.2_Intron|PTPRF_uc001cjt.3_Intron	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATGCAGCAGGCTGTGGTGTGTA	0.490													3	4	---	---	---	---	
ST3GAL3	6487	broad.mit.edu	37	1	44379220	44379220	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44379220delT	uc001ckc.2	+						ST3GAL3_uc010okj.1_Intron|ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270	Q11203	SIAT6_HUMAN	sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				GAGTTACAGCTTTTTTTTTTA	0.348													6	3	---	---	---	---	
TESK2	10420	broad.mit.edu	37	1	45826272	45826273	+	Intron	INS	-	A	A	rs140908852	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45826272_45826273insA	uc001cns.1	-						TESK2_uc009vxr.1_Intron|TESK2_uc010olo.1_Intron|TESK2_uc009vxs.1_Intron	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2						actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					ACTTGGCTAATAGATTCTGGCT	0.465													2	4	---	---	---	---	
OSBPL9	114883	broad.mit.edu	37	1	52246633	52246633	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52246633delA	uc001cst.2	+						OSBPL9_uc001css.2_Intron|OSBPL9_uc001csx.2_Intron|OSBPL9_uc009vza.2_Intron|OSBPL9_uc001csu.2_Intron|OSBPL9_uc001csv.2_Intron|OSBPL9_uc001csw.2_Intron|OSBPL9_uc001csy.2_Intron|OSBPL9_uc001csz.2_Intron|OSBPL9_uc001cta.2_Intron|OSBPL9_uc001ctb.2_Intron	NM_024586	NP_078862	Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9 isoform e						lipid transport		lipid binding			central_nervous_system(1)	1						tgttgaaattaaaaaaAAAAG	0.139													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57755921	57755922	+	Intron	DEL	AA	-	-	rs111603358		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57755921_57755922delAA	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						TCAGTTCAGGAAAAAAAAAAAA	0.297													5	3	---	---	---	---	
LRRC40	55631	broad.mit.edu	37	1	70619105	70619105	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70619105delA	uc001der.1	-							NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40											ovary(1)	1						ATTAGCAAAGAAAAAAAAAAG	0.194													4	2	---	---	---	---	
ST6GALNAC5	81849	broad.mit.edu	37	1	77334292	77334293	+	In_Frame_Ins	INS	-	CAGCAA	CAGCAA	rs62637703	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77334292_77334293insCAGCAA	uc001dhi.2	+	2	301_302	c.126_127insCAGCAA	c.(124-129)insCAGCAA	p.48_49insQQ	ST6GALNAC5_uc010ori.1_In_Frame_Ins_p.48_49insQQ|ST6GALNAC5_uc009wbw.2_RNA	NM_030965	NP_112227	Q9BVH7	SIA7E_HUMAN	sialyltransferase 7E	48_49	Poly-Gln.|Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			pancreas(1)|skin(1)	2						agcagcagcagcagcagcaaca	0.594													15	12	---	---	---	---	
ABCA4	24	broad.mit.edu	37	1	94588081	94588082	+	5'Flank	INS	-	TGA	TGA	rs144949414	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94588081_94588082insTGA	uc001dqh.2	-						ABCA4_uc010otn.1_5'Flank	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GACTGAAAAATtgatgatgatg	0.366													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118744544	118744545	+	IGR	DEL	TT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118744544_118744545delTT								SPAG17 (16696 upstream) : TBX15 (681121 downstream)																							ATCGCCAGTGTTAAGACAGATT	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120217478	120217480	+	IGR	DEL	ACA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120217478_120217480delACA								ZNF697 (27088 upstream) : PHGDH (36939 downstream)																							TTGTTAAGATACAACAACAACAA	0.276													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120634925	120634926	+	IGR	DEL	AG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120634925_120634926delAG								NOTCH2 (22649 upstream) : FAM72B (204079 downstream)																							ctgtctcaaaaGAGAGAGAGAG	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143418339	143418340	+	IGR	DEL	CT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143418339_143418340delCT								None (None upstream) : LOC100286793 (229299 downstream)																							cctctttcccctctctgtcttg	0.000													4	2	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	153995008	153995008	+	Intron	DEL	T	-	-	rs78839111		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153995008delT	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CCAGGAAGGCTTTTTTTTTTT	0.363													8	4	---	---	---	---	
FLAD1	80308	broad.mit.edu	37	1	154964919	154964919	+	Intron	DEL	A	-	-	rs79704914		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154964919delA	uc001fgf.1	+						FLAD1_uc001fge.1_Intron|FLAD1_uc001fgg.1_Intron|FLAD1_uc001fgh.1_Intron|LENEP_uc001fgi.2_5'Flank	NM_025207	NP_079483	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase isoform						FAD biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|FMN adenylyltransferase activity			ovary(2)|skin(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			actccgtctcaaaaaaaaaaT	0.229													9	4	---	---	---	---	
CRABP2	1382	broad.mit.edu	37	1	156675460	156675461	+	5'Flank	INS	-	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156675460_156675461insC	uc001fpr.2	-							NM_001878	NP_001869	P29373	RABP2_HUMAN	cellular retinoic acid binding protein 2						epidermis development|regulation of transcription, DNA-dependent|signal transduction	cytoplasm|nucleus	retinal binding|retinol binding|transporter activity			upper_aerodigestive_tract(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)				Alitretinoin(DB00523)	CTCCCGCTCCGCCCCCCCCCAC	0.693													11	5	---	---	---	---	
CCDC19	25790	broad.mit.edu	37	1	159891275	159891276	+	Intron	INS	-	C	C	rs145000097	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159891275_159891276insC	uc001ful.2	-						TAGLN2_uc001fum.1_5'Flank|TAGLN2_uc001fun.1_Intron|TAGLN2_uc001fuo.1_Intron|TAGLN2_uc010piy.1_Intron	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1							mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			tcacccaaaaaccccagaagga	0.000													3	4	---	---	---	---	
PRRX1	5396	broad.mit.edu	37	1	170641267	170641267	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170641267delT	uc001ghf.2	+						PRRX1_uc001ghe.2_Intron	NM_022716	NP_073207	P54821	PRRX1_HUMAN	paired mesoderm homeobox 1 isoform pmx-1b							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCTAAAGCCATTTCCAATCTG	0.463													4	2	---	---	---	---	
FMO2	2327	broad.mit.edu	37	1	171178335	171178336	+	3'UTR	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171178335_171178336insA	uc001ghk.1	+	9					FMO2_uc010pmd.1_3'UTR	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2						drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ACCTCCTAAAGAAAAAAAAAAA	0.351													8	4	---	---	---	---	
ASTN1	460	broad.mit.edu	37	1	177104625	177104625	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177104625delC	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron|ASTN1_uc009wwx.1_Intron	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GAAACGACAGCCCCAGCTACA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181449419	181449419	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181449419delT								IER5 (389442 upstream) : CACNA1E (3297 downstream)																							ACTGCTGCCCTTAGGCCAAGT	0.458													4	2	---	---	---	---	
PRG4	10216	broad.mit.edu	37	1	186279815	186279815	+	Intron	DEL	G	-	-	rs71970621		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186279815delG	uc001gru.3	+						PRG4_uc001grt.3_Intron|PRG4_uc009wyl.2_Intron|PRG4_uc009wym.2_Intron|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A						cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ttttttttttgtagagacagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200510121	200510121	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200510121delA								ZNF281 (130955 upstream) : KIF14 (10504 downstream)																							cgtctctactaaaaaaaaata	0.000													4	2	---	---	---	---	
IL20	50604	broad.mit.edu	37	1	207041516	207041517	+	Intron	DEL	CA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207041516_207041517delCA	uc001her.2	+						IL20_uc010pry.1_Intron|IL20_uc009xby.2_Intron	NM_018724	NP_061194	Q9NYY1	IL20_HUMAN	interleukin 20 precursor						positive regulation of keratinocyte differentiation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of inflammatory response	extracellular space	cytokine activity|interleukin-20 receptor binding				0	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)		caggcacgtgcacacacacaca	0.173													5	3	---	---	---	---	
KCNH1	3756	broad.mit.edu	37	1	210948428	210948428	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210948428delA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TTGATGGGGGAAAAAAAAGCC	0.448													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230549355	230549355	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230549355delA								PGBD5 (35988 upstream) : COG2 (228847 downstream)																							TTAAATCATTAAAAAAATATA	0.393													4	2	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234053923	234053923	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234053923delT	uc001hvy.1	+							NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			TGACTCCTAATGGTCAGCAGG	0.493													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245765421	245765422	+	Intron	DEL	TG	-	-	rs10536684		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245765421_245765422delTG	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron|KIF26B_uc001ibg.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CACTAATAACTGTGGATTTTTG	0.421													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	1773594	1773594	+	IGR	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1773594delC								PXDN (25303 upstream) : MYT1L (19293 downstream)																							ACGTGGGACTCCTGACCCTCC	0.512											OREG0014396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2675338	2675338	+	IGR	DEL	A	-	-	rs66652008		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2675338delA								MYT1L (340293 upstream) : TSSC1 (517403 downstream)																							actctgtctcaaaaaaaaaaa	0.050													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	14650566	14650566	+	IGR	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14650566delC								None (None upstream) : FAM84A (122290 downstream)																							CTTTCATGCTCCCCAGGCCTC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16340270	16340270	+	IGR	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16340270delC								MYCN (253142 upstream) : FAM49A (393631 downstream)																							cctgatccttcagatctatgc	0.000													4	2	---	---	---	---	
DNAJC27	51277	broad.mit.edu	37	2	25180475	25180475	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25180475delA	uc002rft.1	-						DNAJC27_uc010ykn.1_Intron|DNAJC27_uc002rfu.1_Intron|DNAJC27_uc010eyg.1_Intron	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27						protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1						ATGGCACCAGAAAAAAAAAAA	0.383													11	5	---	---	---	---	
C2orf39	92749	broad.mit.edu	37	2	26654480	26654480	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26654480delT	uc002rhg.2	+						C2orf39_uc010eym.1_Intron	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTTCTTTTCTTTTTTTTTTC	0.328													5	3	---	---	---	---	
CEBPZ	10153	broad.mit.edu	37	2	37442339	37442340	+	Intron	DEL	GT	-	-	rs3841525		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37442339_37442340delGT	uc002rpz.2	-							NM_005760	NP_005751	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein zeta						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding			pancreas(1)	1		all_hematologic(82;0.21)				TGTCAGTGCCGTTACAGTGAAA	0.386													9	4	---	---	---	---	
C2orf34	79823	broad.mit.edu	37	2	44727078	44727079	+	Intron	DEL	TG	-	-	rs36055270		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44727078_44727079delTG	uc002rum.2	+							NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				TAAAAAGCTTTGTGTACTATGT	0.292													1	5	---	---	---	---	
FSHR	2492	broad.mit.edu	37	2	49367149	49367149	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49367149delG	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	GGATATATCTGGGGGCAACTG	0.383									Gonadal_Dysgenesis_46_XX				4	2	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54714970	54714970	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54714970delT	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			CTCCTGTGTCttttttttttt	0.154													4	5	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54758746	54758746	+	Intron	DEL	T	-	-	rs72383425		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54758746delT	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			TTGTTTTTTGTTTTTTTTTTT	0.224													3	3	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71845581	71845582	+	Intron	INS	-	G	G	rs150257500		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845581_71845582insG	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						gtggtagaggtggggttgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73371782	73371783	+	IGR	INS	-	CTTTT	CTTTT	rs140477794	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73371782_73371783insCTTTT								RAB11FIP5 (31636 upstream) : NOTO (57603 downstream)																							TCGATATTCTGcttttcttttc	0.228													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90417010	90417011	+	Intron	INS	-	CGAAA	CGAAA	rs149420300	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90417010_90417011insCGAAA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		ACATGTATCACTGaaatgaaat	0.223													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91762557	91762558	+	IGR	INS	-	C	C	rs147674439		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91762557_91762558insC								None (None upstream) : LOC654342 (42634 downstream)																							GGCCCAAGAGACCCCTCACCCA	0.584													10	5	---	---	---	---	
FHL2	2274	broad.mit.edu	37	2	106024260	106024262	+	Intron	DEL	CCA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106024260_106024262delCCA	uc002tdd.2	-						FHL2_uc002tdc.2_Intron	NM_201557	NP_963851	Q14192	FHL2_HUMAN	four and a half LIM domains 2						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription, DNA-dependent|response to hormone stimulus|transcription, DNA-dependent	actin cytoskeleton|focal adhesion|nucleus	androgen receptor binding|identical protein binding|transcription coactivator activity|zinc ion binding			ovary(1)	1						CCCCCCGCTGCCACCACCACCAC	0.532													4	2	---	---	---	---	
SLC5A7	60482	broad.mit.edu	37	2	108618129	108618129	+	Intron	DEL	A	-	-	rs75725199		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108618129delA	uc002tdv.2	+						SLC5A7_uc010ywm.1_Intron|SLC5A7_uc010fjj.2_Intron|SLC5A7_uc010ywn.1_Intron	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),						acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	actccgtctcaaaaaaaaaaa	0.109													3	3	---	---	---	---	
ACOXL	55289	broad.mit.edu	37	2	111604364	111604365	+	Intron	INS	-	G	G	rs151158957	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111604364_111604365insG	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						gtgtgtgtgttggggggggtgt	0.356													5	4	---	---	---	---	
FBLN7	129804	broad.mit.edu	37	2	112907960	112907960	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112907960delA	uc002tho.1	+						FBLN7_uc002thn.2_Intron|FBLN7_uc010fki.1_Intron|FBLN7_uc010fkj.1_Intron	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN	fibulin 7 isoform 1						cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2						GTACCAGAAGAAAAAAAAAAT	0.478													4	2	---	---	---	---	
RABL2A	11159	broad.mit.edu	37	2	114391996	114391996	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114391996delC	uc002tkn.3	+						RABL2A_uc010flb.2_Intron|RABL2A_uc002tkl.3_Intron|RABL2A_uc002tkm.3_Intron|RABL2A_uc002tks.3_Intron|RABL2A_uc002tkr.2_Intron|RABL2A_uc002tkp.3_Intron	NM_007082	NP_009013	Q9UBK7	RBL2A_HUMAN	RAB, member of RAS oncogene family-like 2A						small GTPase mediated signal transduction		GTP binding|GTPase activity			skin(1)	1						CACGCAGGGGCCAAGTCCCAG	0.632													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	123452236	123452237	+	IGR	DEL	CG	-	-	rs61147457	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123452236_123452237delCG								TSN (926810 upstream) : None (None downstream)																							TCGTCGTCGTCGtcttcttctt	0.233													4	2	---	---	---	---	
SAP130	79595	broad.mit.edu	37	2	128736329	128736329	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128736329delA	uc002tpp.2	-						SAP130_uc002tpn.2_Intron|SAP130_uc002tpo.2_Intron|SAP130_uc010fmd.2_Intron|SAP130_uc002tpq.1_Intron	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b						histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ctaacatctcaaaaagggtga	0.000													4	2	---	---	---	---	
LOC150776	150776	broad.mit.edu	37	2	132273427	132273431	+	5'Flank	DEL	GAGTC	-	-	rs147707520		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132273427_132273431delGAGTC	uc002tsz.3	+						LOC150776_uc010zaz.1_Intron|LOC150776_uc010fna.2_Intron|LOC150776_uc002tsy.3_Intron					Homo sapiens cDNA FLJ41352 fis, clone BRAWH2014645.												0						AGGGTGAGGGGAGTCCCTTTCTGTT	0.654													5	3	---	---	---	---	
ZEB2	9839	broad.mit.edu	37	2	145161925	145161925	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145161925delT	uc002tvu.2	-						ZEB2_uc002tvv.2_Intron|ZEB2_uc010zbm.1_Intron|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Intron	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b							cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		TTACTTCAGGTTTTTTTTTTT	0.473													4	2	---	---	---	---	
MBD5	55777	broad.mit.edu	37	2	149054327	149054327	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149054327delT	uc002twm.3	+							NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CATTGCCCAATttttttttta	0.289													4	4	---	---	---	---	
KIF5C	3800	broad.mit.edu	37	2	149630566	149630566	+	5'Flank	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149630566delT	uc010zbu.1	+							NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		atttttaaaatttttttttgg	0.209													5	4	---	---	---	---	
KIF5C	3800	broad.mit.edu	37	2	149850414	149850415	+	Intron	DEL	GT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149850414_149850415delGT	uc010zbu.1	+						KIF5C_uc002tws.1_Intron|KIF5C_uc002twt.2_Intron	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		AGCCAAGGTAGTGTGTGTGTGT	0.327													6	3	---	---	---	---	
GRB14	2888	broad.mit.edu	37	2	165381367	165381368	+	Intron	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165381367_165381368insT	uc002ucl.2	-						GRB14_uc010zcv.1_Intron|GRB14_uc002ucm.2_Intron	NM_004490	NP_004481	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14						blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity			ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7						GCCTGGGTGCATTTTTTTTTTA	0.277													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177073659	177073659	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177073659delA								HOXD1 (18024 upstream) : MTX2 (60464 downstream)																							ATTTTCTAGTAAAAATGCCCT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	181692199	181692199	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181692199delA								CWC22 (820359 upstream) : UBE2E3 (152913 downstream)																							ggaggtagggagagtcatcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	183775350	183775351	+	IGR	DEL	TG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183775350_183775351delTG								FRZB (43852 upstream) : NCKAP1 (14255 downstream)																							TCTGCACTTCTGTGTACGTCGA	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186298908	186298909	+	IGR	INS	-	TGA	TGA	rs143662927	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186298908_186298909insTGA								ZNF804A (494696 upstream) : None (None downstream)																							ctactttcacttgaacagcaag	0.000													0	6	---	---	---	---	
HECW2	57520	broad.mit.edu	37	2	197302520	197302521	+	Intron	DEL	AG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197302520_197302521delAG	uc002utm.1	-							NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						GAAAAATGAAAGAGAGAGAGAG	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	198374201	198374202	+	IGR	DEL	CC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198374201_198374202delCC								HSPE1 (6015 upstream) : MOBKL3 (6118 downstream)																							ttgtattcttcctttaaggtgt	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	199414472	199414472	+	IGR	DEL	T	-	-	rs115512036	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199414472delT								PLCL1 (399866 upstream) : SATB2 (719752 downstream)																							cgagctgcacttttttttcct	0.000													3	3	---	---	---	---	
CLK1	1195	broad.mit.edu	37	2	201718403	201718406	+	Intron	DEL	AAAA	-	-	rs67212607		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201718403_201718406delAAAA	uc002uwe.2	-						CLK1_uc002uwd.2_Intron|CLK1_uc010zhi.1_Intron|CLK1_uc002uwf.2_Intron|CLK1_uc002uwg.2_Intron|CLK1_uc010fsv.2_Intron	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1						cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						tctttacttgaaaaaaaaaaaaaa	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	206785006	206785007	+	IGR	INS	-	AAA	AAA	rs67779539	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206785006_206785007insAAA								NRP2 (122150 upstream) : INO80D (73439 downstream)																							aagaaagaaaggagaaagaaag	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	206785007	206785008	+	IGR	INS	-	A	A	rs2358800	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206785007_206785008insA								NRP2 (122151 upstream) : INO80D (73438 downstream)																							agaaagaaaggagaaagaaaga	0.178													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	222642939	222642940	+	IGR	INS	-	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222642939_222642940insC								EPHA4 (204017 upstream) : PAX3 (421667 downstream)																							TTCACACAGGGCCCCCAGGGAA	0.455													4	2	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225783167	225783168	+	Intron	DEL	TG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225783167_225783168delTG	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002vod.1_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ggtgtgtgtatgtgttatgtga	0.045													4	2	---	---	---	---	
FBXO36	130888	broad.mit.edu	37	2	230945848	230945848	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230945848delG	uc010fxi.1	+							NM_174899	NP_777559	Q8NEA4	FBX36_HUMAN	F-box protein 36											ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		CATTTTAAGTGGGGGAAAAAT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233363395	233363396	+	IGR	DEL	CA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233363395_233363396delCA								ECEL1 (10863 upstream) : CHRND (27526 downstream)																							ACAAAACCGTCACCACCATCAT	0.252													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236471206	236471208	+	Intron	DEL	TTC	-	-	rs36104539		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236471206_236471208delTTC	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						GCCCCATGCTTTCTGGTGGCCTG	0.532													2	5	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236711445	236711446	+	Intron	INS	-	GTG	GTG			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236711445_236711446insGTG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						tgatgatggttgtggtggtggt	0.000													3	3	---	---	---	---	
LRRFIP1	9208	broad.mit.edu	37	2	238681141	238681141	+	Intron	DEL	A	-	-	rs74592408		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238681141delA	uc002vxc.2	+						LRRFIP1_uc010znm.1_Intron|LRRFIP1_uc002vxg.2_Intron	NM_001137550	NP_001131022	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|cytoskeleton|nucleus	DNA binding|double-stranded RNA binding|protein binding			breast(3)	3		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TGATTGTATGAAAAAAAAAAA	0.398													5	4	---	---	---	---	
SLC6A11	6538	broad.mit.edu	37	3	10960518	10960518	+	Intron	DEL	T	-	-	rs34883736		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10960518delT	uc003bvz.2	+							NM_014229	NP_055044	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.229)		tgcagagggattttttttttt	0.000													3	3	---	---	---	---	
EFHB	151651	broad.mit.edu	37	3	19946899	19946899	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19946899delA	uc003cbl.3	-						EFHB_uc003cbm.2_Intron	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B						signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						ATAAAGATAGAAAAAAAAAAG	0.284													3	3	---	---	---	---	
LRRFIP2	9209	broad.mit.edu	37	3	37163411	37163411	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37163411delT	uc003cgp.2	-						LRRFIP2_uc011ayf.1_Intron|LRRFIP2_uc003cgr.2_Intron|LRRFIP2_uc003cgs.3_Intron|LRRFIP2_uc003cgt.3_Intron	NM_006309	NP_006300	Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting						Wnt receptor signaling pathway		LRR domain binding			ovary(1)	1						GTTTTCTTTCttttttttttt	0.100													6	3	---	---	---	---	
PTH1R	5745	broad.mit.edu	37	3	46945264	46945264	+	3'UTR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46945264delA	uc003cqm.2	+	16					PTH1R_uc003cqn.2_3'UTR	NM_000316	NP_000307	Q03431	PTH1R_HUMAN	parathyroid hormone receptor 1 precursor							cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association			breast(1)	1						GGaaaaaaagaaaaaaaaaag	0.493									Ollier_disease_/_Maffuci_syndrome				7	4	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57505802	57505803	+	Intron	INS	-	GGAGCCGCCCGTCG	GGAGCCGCCCGTCG	rs139314673	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57505802_57505803insGGAGCCGCCCGTCG	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						GGCGGCTCTGTGGCTACAGCGT	0.416													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	63605962	63605965	+	IGR	DEL	TTTC	-	-	rs35315999		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63605962_63605965delTTTC								SYNPR (3366 upstream) : SNTN (32379 downstream)																							tctttctctttttctttctttctt	0.000													4	3	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113181988	113181988	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113181988delA	uc003eag.3	-						CCDC52_uc003eaf.3_Intron|CCDC52_uc003eah.1_Intron	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						ttcctcagacaggcatggccc	0.000													4	2	---	---	---	---	
IGSF11	152404	broad.mit.edu	37	3	118803246	118803247	+	Intron	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118803246_118803247insA	uc003eby.2	-						IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Intron	NM_152538	NP_689751	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform a						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						agacctctgggatcctagctgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	119147240	119147242	+	IGR	DEL	TTC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119147240_119147242delTTC								ARHGAP31 (8918 upstream) : TMEM39A (2459 downstream)																							cactgattctttcttcttcttgg	0.000													4	2	---	---	---	---	
RAB43	339122	broad.mit.edu	37	3	128851192	128851192	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128851192delA	uc003elo.1	-						ISY1_uc010hsz.1_Intron|ISY1_uc003elp.1_Intron|ISY1_uc010hta.1_Intron	NM_020701	NP_065752	Q86YS6	RAB43_HUMAN	ISY1 splicing factor homolog						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						atttgaaaagaaaaaAAAATT	0.119													4	2	---	---	---	---	
AMOTL2	51421	broad.mit.edu	37	3	134072424	134072424	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134072424delA	uc010htx.1	-									Q9Y2J4	AMOL2_HUMAN	Homo sapiens mRNA for ribosomal protein L39 variant protein.											large_intestine(1)	1						tcttgtttggaaaaaAAAAAA	0.299													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	134476723	134476723	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134476723delA								KY (106245 upstream) : EPHB1 (37537 downstream)																							CCCTCCGTGGAGGGGAATTTG	0.532													4	2	---	---	---	---	
FAIM	55179	broad.mit.edu	37	3	138330123	138330123	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138330123delT	uc003esr.2	+						FAIM_uc003eso.1_Intron|FAIM_uc003esp.2_Intron|FAIM_uc003esq.2_Intron|FAIM_uc003ess.2_Intron	NM_001033032	NP_001028204	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule isoform c						apoptosis	cytoplasm					0						TCTTTTTTTGTTTTTtttttt	0.209													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148656800	148656800	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148656800delT								CPA3 (41930 upstream) : GYG1 (52575 downstream)																							GAGTAGAGGGTTTTTTTTTTC	0.378													4	2	---	---	---	---	
MED12L	116931	broad.mit.edu	37	3	151000137	151000137	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151000137delT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TATAATTTAgtttttttttgt	0.264													4	2	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	159467151	159467151	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159467151delA	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			aagagaatttaaaaaaaaaaa	0.164													4	4	---	---	---	---	
PDCD10	11235	broad.mit.edu	37	3	167413770	167413770	+	Intron	DEL	A	-	-	rs11332538		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167413770delA	uc003fex.2	-						PDCD10_uc003fez.2_Intron|PDCD10_uc003fey.2_Intron	NM_007217	NP_009148	Q9BUL8	PDC10_HUMAN	programmed cell death 10						angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2						ATGAAATCTTAAAAAAAAAAA	0.313									Familial_Cerebral_Cavernous_Angioma				8	5	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	170855774	170855774	+	Intron	DEL	C	-	-	rs73882609		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170855774delC	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			aaaaaaaaaacaaaaacaaaa	0.274													7	4	---	---	---	---	
MCF2L2	23101	broad.mit.edu	37	3	183028451	183028451	+	Intron	DEL	A	-	-	rs113655194		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183028451delA	uc003fli.1	-						MCF2L2_uc003flj.1_Intron|MCF2L2_uc003flp.1_Intron|MCF2L2_uc011bqs.1_Intron	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			accctgtttcaaaaaaaaaaG	0.189													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183796101	183796101	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183796101delT								HTR3C (17642 upstream) : HTR3E (18751 downstream)																							tttttttttctttttttttga	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187238396	187238397	+	IGR	INS	-	T	T	rs151034574	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187238396_187238397insT								RTP4 (149029 upstream) : SST (148299 downstream)																							TCAATTAGGACTTTTTTTTTTA	0.292													3	3	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195487365	195487365	+	Intron	DEL	G	-	-	rs11333752		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195487365delG	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		aTGGAGTGGAGGGGGCTGGGA	0.368													4	6	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	68700	68700	+	Intron	DEL	T	-	-	rs5855664		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68700delT	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		attaaattgcttttgactata	0.000													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	408074	408074	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:408074delT								ZNF141 (30315 upstream) : ABCA11P (11150 downstream)																							tgtattctcgttttttttttt	0.000													2	4	---	---	---	---	
CPLX1	10815	broad.mit.edu	37	4	815897	815900	+	Intron	DEL	CTCT	-	-	rs75136326		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:815897_815900delCTCT	uc003gbi.2	-						CPLX1_uc003gbj.2_Intron	NM_006651	NP_006642	O14810	CPLX1_HUMAN	complexin 1						glutamate secretion	cytosol					0				Colorectal(103;0.187)		ctgtctctccctctgtctctgtct	0.196													4	2	---	---	---	---	
TACC3	10460	broad.mit.edu	37	4	1741863	1741863	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1741863delA	uc003gdo.2	+						TACC3_uc003gdp.2_Intron|TACC3_uc010ica.2_Intron	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing							centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			TCCCTTCAACATGGGCCCGGC	0.672													8	4	---	---	---	---	
TACC3	10460	broad.mit.edu	37	4	1741865	1741865	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1741865delG	uc003gdo.2	+						TACC3_uc003gdp.2_Intron|TACC3_uc010ica.2_Intron	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing							centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CCTTCAACATGGGCCCGGCCG	0.672													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3575563	3575564	+	IGR	DEL	TC	-	-	rs144392241		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3575563_3575564delTC								LRPAP1 (41339 upstream) : ADRA2C (192511 downstream)																							CTGTGTTTATTCTgagactcct	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	5913984	5913987	+	IGR	DEL	GTGT	-	-	rs72159395		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5913984_5913987delGTGT								CRMP1 (19199 upstream) : C4orf50 (44858 downstream)																							cactCCACTCgtgtgtgtgtgtgt	0.093													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7419816	7419818	+	Intron	DEL	TCC	-	-	rs145638990	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7419816_7419818delTCC	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TGTCACTTCTTCCTCCTCCTCCT	0.409													4	2	---	---	---	---	
WDR1	9948	broad.mit.edu	37	4	10093810	10093810	+	Intron	DEL	T	-	-	rs35741661		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10093810delT	uc003gmf.2	-						WDR1_uc003gmg.2_Intron|WDR1_uc003gmh.1_RNA|WDR1_uc011bwu.1_Intron	NM_017491	NP_059830	O75083	WDR1_HUMAN	WD repeat-containing protein 1 isoform 1						platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding			ovary(2)|pancreas(1)	3				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		GGCTGACCCCTGGGTCCTTCT	0.592													5	3	---	---	---	---	
LDB2	9079	broad.mit.edu	37	4	16770172	16770172	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16770172delA	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0						GAAAGAAGACAAAAAAAAAAT	0.403													6	3	---	---	---	---	
LAP3	51056	broad.mit.edu	37	4	17600384	17600385	+	Intron	INS	-	T	T	rs138457020	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17600384_17600385insT	uc003gph.1	+							NM_015907	NP_056991	P28838	AMPL_HUMAN	leucine aminopeptidase 3						proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding				0						CCAAGCTGTACtttttttttga	0.178													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31364350	31364351	+	IGR	DEL	GA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31364350_31364351delGA								PCDH7 (215929 upstream) : None (None downstream)																							tctggagtttgagagaaaacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	37803112	37803112	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37803112delT								RELL1 (115113 upstream) : PGM2 (25170 downstream)																							TTTCAAAAGATTTTTTTTCAT	0.209													4	2	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39257268	39257268	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39257268delA	uc003gtv.2	+						WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						ATTTAGAGTTAAAAAAAAAAG	0.308													11	5	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39892245	39892245	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39892245delT	uc003guv.3	-						PDS5A_uc010ifo.2_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						ATATAGCAACttttttttttt	0.194													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	41843955	41843955	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41843955delA								PHOX2B (92968 upstream) : TMEM33 (93182 downstream)																							TTAACTATACAAAAAAAATAC	0.343													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49265988	49265988	+	IGR	DEL	A	-	-	rs113692996		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49265988delA								CWH43 (201895 upstream) : None (None downstream)																							ccatctctacaaaaaaaaata	0.000													7	8	---	---	---	---	
KIT	3815	broad.mit.edu	37	4	55551392	55551392	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55551392delT	uc010igr.2	+						KIT_uc010igs.2_Intron	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral						male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity			soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACTACCACCCTCTGTGTGCCA	0.547		1	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	76253265	76253265	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76253265delT								PARM1 (277942 upstream) : RCHY1 (151090 downstream)																							TCAAACCCAGTTTTTTTTTCT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	80509281	80509281	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80509281delA								GK2 (179909 upstream) : GDEP (239344 downstream)																							AATAAAAAATAAAAACCAGCC	0.398													4	2	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83785932	83785932	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83785932delT	uc003hnf.2	-						SEC31A_uc003hne.2_Intron|SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				ggttttttggttttttttttt	0.159													8	5	---	---	---	---	
ARHGAP24	83478	broad.mit.edu	37	4	86491517	86491517	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86491517delC	uc003hpk.2	+						ARHGAP24_uc003hpi.1_Intron|ARHGAP24_uc003hpj.2_Intron	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		ttctttctttctctttctttc	0.144													3	3	---	---	---	---	
C4orf37	285555	broad.mit.edu	37	4	99028722	99028723	+	Intron	INS	-	G	G	rs141394189	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99028722_99028723insG	uc003htt.1	-							NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		GACAAGGTTGAGAAGTAAAACA	0.421													3	3	---	---	---	---	
MANBA	4126	broad.mit.edu	37	4	103573123	103573126	+	Intron	DEL	TTAA	-	-	rs147202824		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103573123_103573126delTTAA	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		TTTAttatttttaattgacacaat	0.147													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	105918246	105918247	+	IGR	INS	-	TT	TT	rs145057012		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105918246_105918247insTT								CXXC4 (502188 upstream) : TET2 (149696 downstream)																							tttttttttccttttttttttt	0.183													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	120013474	120013474	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120013474delT								SYNPO2 (31081 upstream) : MYOZ2 (43465 downstream)																							TAGAACTGACTTTTTTTCCCT	0.269													4	2	---	---	---	---	
BBS7	55212	broad.mit.edu	37	4	122750140	122750141	+	Intron	INS	-	A	A	rs138187466	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122750140_122750141insA	uc003ied.2	-						BBS7_uc003iee.1_Intron	NM_176824	NP_789794	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7 protein isoform a						cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding			ovary(1)	1						AAACTTCATTTAAACAACTTTT	0.257									Bardet-Biedl_syndrome				2	5	---	---	---	---	
ELF2	1998	broad.mit.edu	37	4	140057574	140057574	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140057574delA	uc003ihp.1	-						ELF2_uc003ihq.2_Intron	NM_201999	NP_973728	Q15723	ELF2_HUMAN	E74-like factor 2 (ets domain transcription						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)					ACCAAGGAGCAAAAAAAAAAG	0.398													4	2	---	---	---	---	
TRIM2	23321	broad.mit.edu	37	4	154256423	154256424	+	3'UTR	INS	-	A	A	rs143305341	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154256423_154256424insA	uc003ing.2	+	12					TRIM2_uc003inh.2_3'UTR	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		AACAGACACTTAAAAAACTAGC	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154357075	154357075	+	IGR	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154357075delC								MND1 (20832 upstream) : KIAA0922 (30423 downstream)																							CGAACCTTTACCCCCACAATG	0.428													4	2	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	164487244	164487244	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164487244delC	uc003iqs.1	-						MARCH1_uc003iqr.1_Intron	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AATTTTGATACCCTGCTTCTA	0.353													4	2	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183268369	183268370	+	Intron	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183268369_183268370insA	uc003ivd.1	+						ODZ3_uc010irv.1_Intron	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		ATCATCTACAGAAAAAAAAAAT	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4299271	4299271	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4299271delA								IRX1 (697755 upstream) : LOC340094 (735201 downstream)																							cttaaagtataaaaaaaaaat	0.025													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	5802561	5802561	+	IGR	DEL	G	-	-	rs111419127		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5802561delG								KIAA0947 (312224 upstream) : FLJ33360 (507993 downstream)																							TGCTCTTGTTGTTTTTTTTCA	0.294													3	3	---	---	---	---	
MTRR	4552	broad.mit.edu	37	5	7878725	7878725	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7878725delG	uc003jed.2	+						MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ttcccacccAGGTATTACAAA	0.149													4	2	---	---	---	---	
FBXL7	23194	broad.mit.edu	37	5	15519056	15519056	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15519056delT	uc003jfn.1	+							NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						aaatgaaacgtttacttgtcc	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20477321	20477322	+	IGR	DEL	CA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20477321_20477322delCA								CDH18 (489014 upstream) : GUSBP1 (864620 downstream)																							tacacacacccacacacacacg	0.134													4	2	---	---	---	---	
SPEF2	79925	broad.mit.edu	37	5	35770092	35770093	+	Intron	DEL	TG	-	-	rs144459495		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35770092_35770093delTG	uc003jjo.2	+						SPEF2_uc003jjp.1_Intron	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCCTCCATAAtgtgtgtgtgtg	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42939768	42939768	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42939768delT								SEPP1 (113770 upstream) : C5orf39 (99415 downstream)																							cctggGCGGATTTTTTTTTTT	0.179													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	43802534	43802534	+	IGR	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43802534delG								NNT (96867 upstream) : FGF10 (502563 downstream)																							AGAATGCCTTGGGGTAGCATG	0.428													4	2	---	---	---	---	
DEPDC1B	55789	broad.mit.edu	37	5	59944885	59944885	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59944885delC	uc003jsh.2	-						DEPDC1B_uc011cqm.1_Intron|DEPDC1B_uc011cqn.1_Intron	NM_018369	NP_060839	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)	1		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				AATCCCTACTCCCATCCCACC	0.358													4	2	---	---	---	---	
FAM169A	26049	broad.mit.edu	37	5	74092246	74092247	+	Intron	DEL	TC	-	-	rs76402838		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74092246_74092247delTC	uc003kdm.2	-						FAM169A_uc010izm.2_Intron|FAM169A_uc003kdl.2_Intron	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049												0						tttttttttttccgagataaag	0.134													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	80216726	80216726	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80216726delA								MSH3 (44093 upstream) : RASGRF2 (39832 downstream)																							AAAGGTGTGGAAAAAAAAAAC	0.423													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	94705364	94705364	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94705364delA								MCTP1 (85085 upstream) : FAM81B (21684 downstream)																							GTTGGTCAGTAATATGGCATC	0.393													4	2	---	---	---	---	
RHOBTB3	22836	broad.mit.edu	37	5	95129189	95129189	+	3'UTR	DEL	A	-	-	rs76643686		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95129189delA	uc003klm.2	+	12						NM_014899	NP_055714	O94955	RHBT3_HUMAN	rho-related BTB domain containing 3						retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		TGCTTAGATTAAAAAAAAAAA	0.323													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102543798	102543798	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102543798delT								PPIP5K2 (4891 upstream) : C5orf30 (50644 downstream)																							tttctttttcttttttttttt	0.060													4	2	---	---	---	---	
MAN2A1	4124	broad.mit.edu	37	5	109175636	109175636	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109175636delT	uc003kou.1	+							NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		ATTTACATTCTTTTTTTTTTT	0.308													3	3	---	---	---	---	
APC	324	broad.mit.edu	37	5	112085654	112085654	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112085654delT	uc010jby.2	+						APC_uc011cvt.1_Intron|APC_uc003kpz.3_Intron|APC_uc003kpy.3_Intron|APC_uc010jbz.2_Intron	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli						canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity			large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCTTtttctcttttttttttt	0.124		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126462617	126462617	+	IGR	DEL	T	-	-	rs139139165		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126462617delT								FLJ44606 (53445 upstream) : MEGF10 (163839 downstream)																							GTTGTTGCTGTTTTGTTTCCG	0.512													4	2	---	---	---	---	
P4HA2	8974	broad.mit.edu	37	5	131536241	131536241	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131536241delT	uc003kwh.2	-						P4HA2_uc003kwg.2_Intron|P4HA2_uc003kwi.2_Intron|P4HA2_uc003kwk.2_Intron|P4HA2_uc003kwl.2_Intron|P4HA2_uc003kwj.2_Intron	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1							endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	TTCTCTCTCCTTTTTTTTGGG	0.264													4	2	---	---	---	---	
TXNDC15	79770	broad.mit.edu	37	5	134232342	134232344	+	Intron	DEL	TTT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134232342_134232344delTTT	uc003lac.1	+						TXNDC15_uc010jdy.1_Intron|TXNDC15_uc011cxv.1_Intron	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	disulfide isomerase precursor						cell redox homeostasis	integral to membrane				ovary(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			tttttttcccttttttttttttt	0.113													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135015277	135015277	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135015277delT								LOC340074 (25653 upstream) : LOC153328 (155088 downstream)																							aggaaggggattttttcctca	0.000													4	2	---	---	---	---	
CDC23	8697	broad.mit.edu	37	5	137524389	137524389	+	3'UTR	DEL	A	-	-	rs79925684		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137524389delA	uc003lcl.2	-	16						NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTTGGGGGCCAAAAAAAAAAA	0.423													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	137615451	137615451	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137615451delA								GFRA3 (5198 upstream) : CDC25C (5508 downstream)																							AAGCAATTGCAAAAAAAAAAT	0.164													4	3	---	---	---	---	
CANX	821	broad.mit.edu	37	5	179129212	179129212	+	Intron	DEL	T	-	-	rs79245317		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179129212delT	uc003mkk.2	+						CANX_uc011dgp.1_Intron|CANX_uc010jlb.1_Intron|CANX_uc003mkl.2_Intron|CANX_uc011dgq.1_Intron	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	actcagctaattttttttttt	0.000													3	3	---	---	---	---	
BPHL	670	broad.mit.edu	37	6	3149603	3149604	+	Intron	INS	-	A	A	rs149898237	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3149603_3149604insA	uc003mva.2	+						BPHL_uc003muz.2_Intron|BPHL_uc011dht.1_Intron|BPHL_uc003muy.2_Intron	NM_004332	NP_004323	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like precursor						cellular amino acid metabolic process|response to toxin	mitochondrion	hydrolase activity				0	Ovarian(93;0.0386)	all_hematologic(90;0.108)				AGCACCAACCCAGCAGCCCGAG	0.550													4	4	---	---	---	---	
KIF13A	63971	broad.mit.edu	37	6	17956965	17956965	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17956965delA	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron|KIF13A_uc003nck.2_Intron	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			gctgtgggtcaaaaaaaaatc	0.000													4	2	---	---	---	---	
ALDH5A1	7915	broad.mit.edu	37	6	24526383	24526384	+	Intron	DEL	TG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24526383_24526384delTG	uc003neg.2	+						ALDH5A1_uc003nef.2_Intron	NM_001080	NP_001071	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5A1 isoform 2 precursor						acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)	ACCCAGTCCTTGTGTGTGTGTG	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	30070538	30070539	+	IGR	INS	-	T	T	rs151240936	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30070538_30070539insT								RNF39 (26910 upstream) : TRIM31 (135 downstream)																							AGTATAAGAGGGTCAAGGCTCA	0.436													1	5	---	---	---	---	
ZFAND3	60685	broad.mit.edu	37	6	37825589	37825590	+	Intron	DEL	GT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37825589_37825590delGT	uc003onx.2	+							NM_021943	NP_068762	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1						ACCAGGTCCAGTGTGTGTGAGG	0.416													4	2	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44149600	44149601	+	Intron	INS	-	CACT	CACT			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149600_44149601insCACT	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			caaccacaccacacacacacat	0.064													4	2	---	---	---	---	
DST	667	broad.mit.edu	37	6	56331195	56331195	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56331195delA	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pcv.3_5'Flank|DST_uc003pcw.3_5'UTR|DST_uc003pcx.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAACAGTTTGAAAAAAAAAAG	0.318													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57516345	57516346	+	IGR	INS	-	T	T	rs151188373		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57516345_57516346insT								PRIM2 (2970 upstream) : GUSBL2 (729813 downstream)																							TGGAAGCTGCGTTTTGGATAGG	0.406													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57543410	57543411	+	IGR	INS	-	A	A	rs145400324		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57543410_57543411insA								PRIM2 (30035 upstream) : GUSBL2 (702748 downstream)																							taagaaggaataaaaaagcctt	0.035													3	3	---	---	---	---	
SNAP91	9892	broad.mit.edu	37	6	84301248	84301248	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84301248delT	uc011dze.1	-						SNAP91_uc011dzd.1_Intron|SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AAGGGAATTCTTTTTTTTTTC	0.274													7	4	---	---	---	---	
KIAA1919	91749	broad.mit.edu	37	6	111584143	111584143	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111584143delT	uc003puv.3	+							NM_153369	NP_699200	Q5TF39	NAGT1_HUMAN	sodium-dependent glucose transporter 1						carbohydrate transport|sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(3)	3		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		GCAAAGCTGCttttttttttt	0.254													5	3	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117739393	117739398	+	Intron	DEL	ACAATT	-	-	rs71554880		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117739393_117739398delACAATT	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ccaaagccacacaattacatagagac	0.136			T	GOPC|ROS1	glioblastoma|NSCLC								10	6	---	---	---	---	
FAM184A	79632	broad.mit.edu	37	6	119390462	119390463	+	Intron	DEL	AC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119390462_119390463delAC	uc003pyj.2	-						FAM184A_uc003pyk.3_Intron|FAM184A_uc003pyl.3_Intron|MIR548B_hsa-mir-548b|MI0003596_5'Flank	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1											ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						AGACCATTAAACACACACACAC	0.337													4	2	---	---	---	---	
PTPRK	5796	broad.mit.edu	37	6	128301982	128301985	+	Intron	DEL	TAAT	-	-	rs146791913		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128301982_128301985delTAAT	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TTTCTGAAAATAATTAAGATGAAA	0.221													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	142997954	142997954	+	IGR	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142997954delC								LOC153910 (38928 upstream) : HIVEP2 (74651 downstream)																							TGTTAAGAGACCACGTGGAGT	0.423													4	2	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151286429	151286429	+	Intron	DEL	T	-	-	rs1625684	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151286429delT	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		AAAAAAAAAATTTTTAAGTGT	0.199													8	4	---	---	---	---	
TIAM2	26230	broad.mit.edu	37	6	155264013	155264013	+	Intron	DEL	T	-	-	rs5881111		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155264013delT	uc003qqb.2	+							NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TCCACTGCAGTTTTTTTTTTA	0.358													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	158945114	158945114	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158945114delT								TULP4 (12260 upstream) : TMEM181 (12354 downstream)																							AAAAGGAGGATTTTTTTTTTC	0.468													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169137221	169137221	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169137221delT								SMOC2 (68550 upstream) : THBS2 (478655 downstream)																							agctttggcctggagtcagcc	0.000													4	2	---	---	---	---	
WIPI2	26100	broad.mit.edu	37	7	5269561	5269561	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5269561delT	uc003snv.2	+						WIPI2_uc003snw.2_Intron|WIPI2_uc003snx.2_Intron|WIPI2_uc003sny.2_Intron|WIPI2_uc010ksv.2_Intron|WIPI2_uc003soa.2_Intron|WIPI2_uc003sob.2_Intron	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2						autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		TTTCGTTTCCTTttttttttt	0.249													5	3	---	---	---	---	
C7orf28A	51622	broad.mit.edu	37	7	5959838	5959839	+	Intron	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5959838_5959839insA	uc003spf.2	+							NM_015622	NP_056437	P86791	CCZ1_HUMAN	hypothetical protein LOC51622							lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)		CTCAGCTCCCCCCGAATGGAAC	0.564													6	6	---	---	---	---	
NXPH1	30010	broad.mit.edu	37	7	8475126	8475126	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8475126delT	uc003srv.2	+						NXPH1_uc011jxh.1_Intron	NM_152745	NP_689958	P58417	NXPH1_HUMAN	neurexophilin 1 precursor							extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		CCTCCCTCCCTTTTTTTTTTG	0.572													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24571772	24571772	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24571772delT								NPY (240295 upstream) : MPP6 (41313 downstream)																							GCTGGTTCCATTTACCAGCTA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27389816	27389817	+	IGR	DEL	AG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27389816_27389817delAG								EVX1 (103624 upstream) : HIBADH (175246 downstream)																							gactacatgaagagagagagat	0.000													4	2	---	---	---	---	
LOC646762	646762	broad.mit.edu	37	7	29699825	29699826	+	Intron	DEL	TT	-	-	rs35015386		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29699825_29699826delTT	uc003tad.3	-							NR_024278				Homo sapiens cDNA: FLJ23070 fis, clone LNG05629.												0						ATTATTGACCTTTTTTTTTTCA	0.248													12	11	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34183281	34183282	+	Intron	DEL	TG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34183281_34183282delTG	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						CGGTTATAGCTGTGGCTTAGGT	0.366													4	2	---	---	---	---	
SEPT7	989	broad.mit.edu	37	7	35904634	35904634	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35904634delT	uc010kxc.2	+						SEPT7_uc011kat.1_Intron|SEPT7_uc011kau.1_Intron|SEPT7_uc011kav.1_Intron|SEPT7_uc003tey.2_Intron	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1						cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						TATTTTAGGATTTTTTTTTTT	0.274													14	7	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	37487242	37487242	+	Intron	DEL	C	-	-	rs78223078		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37487242delC	uc003tfk.1	-						ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						acccacaacaccccccccaca	0.199													4	2	---	---	---	---	
POU6F2	11281	broad.mit.edu	37	7	39439471	39439471	+	Intron	DEL	G	-	-	rs60216245		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39439471delG	uc003thb.1	+							NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						aaaaaaaaaagaaagaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	39506771	39506771	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39506771delT								POU6F2 (2381 upstream) : C7orf36 (99238 downstream)																							TGTGCAGTGatttttttatag	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41824401	41824401	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41824401delA								LOC285954 (5427 upstream) : GLI3 (176149 downstream)																							TAACAAAAAGAAAAAAAATAC	0.383													4	2	---	---	---	---	
YKT6	10652	broad.mit.edu	37	7	44247319	44247319	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44247319delT	uc003tkm.2	+						YKT6_uc011kbv.1_Intron	NM_006555	NP_006546	O15498	YKT6_HUMAN	YKT6 v-SNARE protein						ER to Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi|vesicle docking involved in exocytosis|vesicle targeting	cytoplasmic vesicle membrane|cytosol|endoplasmic reticulum|endosome|Golgi membrane|integral to plasma membrane|mitochondrion|SNARE complex	protein-cysteine S-palmitoleyltransferase activity|SNAP receptor activity				0						AGGCTGTGGGttttttttttt	0.239													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46875319	46875319	+	IGR	DEL	C	-	-	rs66481768		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46875319delC								IGFBP3 (914448 upstream) : TNS3 (439434 downstream)																							gctctgggagccacatctgaa	0.010													3	3	---	---	---	---	
SUMF2	25870	broad.mit.edu	37	7	56136563	56136563	+	Intron	DEL	T	-	-	rs76525353		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56136563delT	uc003trv.2	+						PSPH_uc003trj.2_Intron|SUMF2_uc003tro.2_Intron|SUMF2_uc011kcv.1_Intron|SUMF2_uc011kcw.1_Intron|SUMF2_uc011kcx.1_Intron|SUMF2_uc003trt.2_Intron|SUMF2_uc011kcy.1_Intron|SUMF2_uc011kcz.1_Intron|SUMF2_uc003tru.2_Intron|SUMF2_uc011kda.1_Intron|SUMF2_uc003trx.2_Intron	NM_001130069	NP_001123541	Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2 isoform e							endoplasmic reticulum lumen	metal ion binding			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			gcccggctaattttttttttt	0.000													5	3	---	---	---	---	
GUSB	2990	broad.mit.edu	37	7	65429637	65429637	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65429637delA	uc003tun.2	-						GUSB_uc011kdt.1_Intron	NM_000181	NP_000172	P08236	BGLR_HUMAN	glucuronidase, beta precursor						glycosaminoglycan catabolic process	lysosome	beta-glucuronidase activity|cation binding				0						AAGGAGGTTTAAAAAAAAAAA	0.388													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68563249	68563249	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68563249delA								None (None upstream) : AUTS2 (500656 downstream)																							TTTTTAAAAGAAAAAAAAAAA	0.274													2	4	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70693092	70693093	+	Intron	INS	-	GT	GT	rs141707777	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70693092_70693093insGT	uc003tvy.2	+							NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GGACTTGCTTGGTGTGTGTGTG	0.554													4	2	---	---	---	---	
ELN	2006	broad.mit.edu	37	7	73456758	73456758	+	Intron	DEL	A	-	-	rs72489767		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73456758delA	uc003tzw.2	+						RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Intron|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Intron|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Intron|ELN_uc011kff.1_Intron|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor						blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	accttgtgtcaaaaaaaaaaa	0.239			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						4	2	---	---	---	---	
BAIAP2L1	55971	broad.mit.edu	37	7	97955113	97955113	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97955113delC	uc003upj.2	-							NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			GCAAACCGCTCCCCAGCACAC	0.423													4	3	---	---	---	---	
NRCAM	4897	broad.mit.edu	37	7	107822060	107822060	+	Intron	DEL	T	-	-	rs142360369		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107822060delT	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						TGGAGAAAACTTTTTTTTTTT	0.338													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	122893687	122893688	+	IGR	DEL	TA	-	-	rs77419861		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122893687_122893688delTA								SLC13A1 (53662 upstream) : IQUB (198550 downstream)																							GCTGTTTAATTATGCTCAAGGA	0.351													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	127056636	127056637	+	IGR	DEL	AA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127056636_127056637delAA								ZNF800 (23869 upstream) : GCC1 (164046 downstream)																							tctacacaggaaaaaaaaaagg	0.000													4	2	---	---	---	---	
OPN1SW	611	broad.mit.edu	37	7	128418363	128418363	+	5'Flank	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128418363delA	uc003vnt.3	-							NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive						phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						gaataacaacaaaaaagtatt	0.000													4	2	---	---	---	---	
CPA2	1358	broad.mit.edu	37	7	129907612	129907613	+	Intron	DEL	TC	-	-	rs71829223		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129907612_129907613delTC	uc003vpq.2	+						CPA2_uc011kpc.1_Intron	NM_001869	NP_001860	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic) precursor						proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					tttctttctttctctttctttc	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	134084275	134084276	+	IGR	DEL	CT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134084275_134084276delCT								SLC35B4 (82448 upstream) : AKR1B1 (42831 downstream)																							ataccccaacctctctctccct	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	134372191	134372192	+	IGR	INS	-	T	T	rs146983175	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134372191_134372192insT								BPGM (7626 upstream) : CALD1 (91979 downstream)																							actgttctgccttgagttaagc	0.000													2	4	---	---	---	---	
HIPK2	28996	broad.mit.edu	37	7	139373612	139373612	+	Intron	DEL	A	-	-	rs149402030	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139373612delA	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					GAACATGATGAAAAAAAAGTC	0.338													4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	148025581	148025583	+	Intron	DEL	AGA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148025581_148025583delAGA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			gtctgtctgtagattccatctct	0.217										HNSCC(39;0.1)			4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	148025585	148025586	+	Intron	DEL	TC	-	-	rs72132549		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148025585_148025586delTC	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			gtctgtagattccatctctTGG	0.228										HNSCC(39;0.1)			4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	148025590	148025605	+	Intron	DEL	CTCTTGGTGTTCAATA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148025590_148025605delCTCTTGGTGTTCAATA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			tagattccatctctTGGTGTTCAATAGGCCTTGGGG	0.259										HNSCC(39;0.1)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	151010089	151010090	+	IGR	DEL	GT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151010089_151010090delGT								SMARCD3 (35858 upstream) : NUB1 (28768 downstream)																							GTGTGTGAGAGTGTGAGGGAGT	0.153													3	4	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152066106	152066107	+	Intron	DEL	AA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152066106_152066107delAA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GTGGAAGGTTAAAAAAAAAAAA	0.183			N		medulloblastoma								4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100990	152101006	+	Intron	DEL	GGAGACTCAGAAGGTTG	-	-	rs34514819		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100990_152101006delGGAGACTCAGAAGGTTG	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		taacgacactggagactcagaaggttgggaggctggg	0.000			N		medulloblastoma								8	4	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152101013	152101023	+	Intron	DEL	TGGGAGGAGGG	-	-	rs57859426		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152101013_152101023delTGGGAGGAGGG	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		gttgggaggctgggaggagggtgagtaacaa	0.000			N		medulloblastoma								6	4	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	153949299	153949300	+	Intron	DEL	GT	-	-	rs113885950		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153949299_153949300delGT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ACAATGTCACgtgtgtgtgtgt	0.327													6	3	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154463350	154463351	+	Intron	DEL	TG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154463350_154463351delTG	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			tgcatgcatatgtgtgtgtgtg	0.347													4	2	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155455903	155455904	+	Intron	INS	-	T	T	rs60126329		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155455903_155455904insT	uc010lqk.1	+						RBM33_uc003wme.2_Intron	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ttctttctttcttttttttttt	0.094													3	3	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155493869	155493870	+	Intron	INS	-	A	A	rs143521704	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155493869_155493870insA	uc010lqk.1	+						RBM33_uc003wme.2_3'UTR|RBM33_uc011kvv.1_Intron	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ttaagataattaaaaaaaattt	0.356													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	11130495	11130496	+	IGR	DEL	GT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11130495_11130496delGT								XKR6 (71620 upstream) : MTMR9 (11504 downstream)																							ttttttctccgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
CSGALNACT1	55790	broad.mit.edu	37	8	19577844	19577844	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19577844delA	uc011kyp.1	-							NM_018371	NP_060841	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)		CTCATGTATCAGGGAGAGATA	0.458													4	2	---	---	---	---	
DOCK5	80005	broad.mit.edu	37	8	25202771	25202771	+	Intron	DEL	T	-	-	rs71549900		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25202771delT	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xei.2_Intron|DOCK5_uc003xej.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGAAGGGTCATTTTTTTTTTT	0.408													2	6	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38099572	38099572	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38099572delA	uc003xlb.2	+						DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			actccatctcaaaaaaaaaaa	0.139													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57975050	57975051	+	IGR	INS	-	A	A	rs35021183		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57975050_57975051insA								IMPAD1 (68623 upstream) : C8orf71 (217051 downstream)																							ACAATCCCCTTAAAAAAAAAAA	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	59230840	59230840	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59230840delA								FAM110B (168563 upstream) : UBXN2B (92983 downstream)																							GGGTAGCCCTAAAAAAAATGG	0.557											OREG0018785	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CA8	767	broad.mit.edu	37	8	61158840	61158841	+	Intron	INS	-	G	G	rs142251665	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61158840_61158841insG	uc003xtz.1	-						CA8_uc003xua.1_Intron	NM_004056	NP_004047	P35219	CAH8_HUMAN	carbonic anhydrase VIII						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)				AATGCATTTCTGGGGGGGGTTG	0.173													4	4	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	68972298	68972298	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68972298delA	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						ttacatatgcaaaactccctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	99409388	99409389	+	IGR	DEL	AC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99409388_99409389delAC								NIPAL2 (102767 upstream) : KCNS2 (29861 downstream)																							TAGAAAGAAAACACACACACAC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	118344992	118344992	+	IGR	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118344992delG								SLC30A8 (156040 upstream) : MED30 (187973 downstream)																							AGAACCCACTGGGAATGGGTG	0.403													4	2	---	---	---	---	
COL14A1	7373	broad.mit.edu	37	8	121137857	121137857	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121137857delC	uc003yox.2	+							NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor						cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGAAGCTTTTCCCAGTGTTTG	0.438											OREG0018944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	129103098	129103098	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129103098delT	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0						CTCCTAAATATTTTTTTTTCT	0.373													4	2	---	---	---	---	
ADCY8	114	broad.mit.edu	37	8	131824523	131824524	+	Intron	INS	-	ATT	ATT	rs139287011	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131824523_131824524insATT	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GGAGCTTGACCATTAGGCTCTG	0.431										HNSCC(32;0.087)			4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143017726	143017726	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143017726delA								MIR1302-7 (150052 upstream) : NCRNA00051 (261991 downstream)																							cggcttgtgcAAAGCGCTGCA	0.284													4	2	---	---	---	---	
HEATR7A	727957	broad.mit.edu	37	8	145288285	145288286	+	Intron	INS	-	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145288285_145288286insC	uc003zbk.3	+						HEATR7A_uc011lla.1_Intron|HEATR7A_uc010mft.2_Intron	NM_032450	NP_115826	Q8NDA8	HTR7A_HUMAN	HEAT repeat containing 7A isoform 1								binding				0						CAGCTCCTGCACCCACCATCCA	0.386													4	4	---	---	---	---	
ADCK5	203054	broad.mit.edu	37	8	145597908	145597908	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145597908delT	uc003zch.2	+						ADCK5_uc003zcg.2_Intron	NM_174922	NP_777582	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5							integral to membrane	protein serine/threonine kinase activity			stomach(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			tttttccctctttttttttga	0.338													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	43401525	43401526	+	IGR	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43401525_43401526insA								LOC642929 (256041 upstream) : FAM75A6 (222978 downstream)																							cacaaataaataaaaaaaaatt	0.045													15	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66455348	66455349	+	Intron	INS	-	G	G	rs142146645		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66455348_66455349insG	uc010mng.1	-						uc004aec.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		GACAGAGGGATGAGAAATAGAA	0.144													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68490476	68490476	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68490476delA								FAM27B (696287 upstream) : MIR1299 (511763 downstream)																							TGAAAGGTTTAAAAATATAAT	0.209													7	5	---	---	---	---	
C9orf85	138241	broad.mit.edu	37	9	74581096	74581096	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74581096delT	uc004ain.2	+						C9orf85_uc004aio.2_Intron|C9orf85_uc010mou.2_Intron|C9orf85_uc010mov.2_Intron	NM_182505	NP_872311	Q96MD7	CI085_HUMAN	hypothetical protein LOC138241												0						tgcactttactttttttgtct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	81428642	81428642	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81428642delT								PSAT1 (483635 upstream) : TLE4 (758236 downstream)																							tctttctttcttttttttttt	0.333													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87660281	87660281	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87660281delT								NTRK2 (21776 upstream) : AGTPBP1 (501174 downstream)																							tttcttcttcttttttttttt	0.284													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90933076	90933077	+	IGR	INS	-	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90933076_90933077insC								CDK20 (343409 upstream) : SPIN1 (69763 downstream)																							GCTTCTGCTGTCCCCCAGCCCG	0.525													4	2	---	---	---	---	
SHC3	53358	broad.mit.edu	37	9	91710650	91710650	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91710650delC	uc004aqg.2	-							NM_016848	NP_058544	Q92529	SHC3_HUMAN	src homology 2 domain-containing transforming						central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4						CAGCCTGACACCCCCACCTCC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	97097144	97097144	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97097144delT	uc004auq.1	+											Homo sapiens cDNA FLJ37869 fis, clone BRSSN2017422.																		CAAGTTATAAttttttttttt	0.214													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	97108767	97108768	+	Intron	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97108767_97108768insT	uc004auq.1	+											Homo sapiens cDNA FLJ37869 fis, clone BRSSN2017422.																		TTTTTTACAAGTTTTTTTTTTT	0.213													6	4	---	---	---	---	
HIATL1	84641	broad.mit.edu	37	9	97218372	97218372	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97218372delA	uc004aur.2	+						HIATL1_uc011luh.1_Intron	NM_032558	NP_115947	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1						transmembrane transport	integral to membrane|plasma membrane	protein binding|transporter activity			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				CTTGTAGGTTAAAAAAAAAAT	0.363													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	98515890	98515891	+	IGR	INS	-	CT	CT	rs138193208	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98515890_98515891insCT								PTCH1 (236643 upstream) : C9orf130 (52481 downstream)																							agatggagaaacTGCCCTGACA	0.243													4	2	---	---	---	---	
KIAA1529	57653	broad.mit.edu	37	9	100137230	100137230	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100137230delG	uc011lut.1	+						KIAA1529_uc004axe.1_Intron|KIAA1529_uc004axg.1_Intron|KIAA1529_uc004axh.1_Intron|KIAA1529_uc011luw.1_Intron	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)				CTGGCTCAGTGGGGGACACAT	0.438													4	2	---	---	---	---	
GABBR2	9568	broad.mit.edu	37	9	101250915	101250916	+	Intron	INS	-	T	T	rs139429494	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101250915_101250916insT	uc004ays.2	-							NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TTCCCTAGCACTTTTTTTTTTA	0.391													4	3	---	---	---	---	
TEX10	54881	broad.mit.edu	37	9	103065721	103065721	+	Intron	DEL	C	-	-	rs35109045		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103065721delC	uc004bas.2	-						TEX10_uc011lvf.1_Intron|TEX10_uc011lvg.1_Intron	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1							integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		CACAGACACACCCCCCCCCCC	0.363													4	7	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	115024485	115024485	+	Intron	DEL	A	-	-	rs79434908		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115024485delA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						TACCTACAAGAAAAAAAAAAT	0.279													5	3	---	---	---	---	
SET	6418	broad.mit.edu	37	9	131445768	131445768	+	5'Flank	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131445768delA	uc004bvt.3	+							NM_001122821	NP_001116293	Q01105	SET_HUMAN	SET translocation (myeloid leukemia-associated)						DNA replication|mRNA metabolic process|negative regulation of histone acetylation|negative regulation of neuron apoptosis|negative regulation of transcription, DNA-dependent|nucleocytoplasmic transport|nucleosome assembly|nucleosome disassembly	cytosol|endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm|protein complex	histone binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity				0		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		AGGCCAAAGGAAAAAAAAAAG	0.517			T	NUP214	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133376666	133376667	+	IGR	DEL	GT	-	-	rs36233815		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133376666_133376667delGT								ASS1 (6 upstream) : LOC100272217 (76072 downstream)																							TTTCTAgtgagtgtgtgtgtgt	0.337													4	4	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137577353	137577359	+	Intron	DEL	TCACCAT	-	-	rs143525729	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137577353_137577359delTCACCAT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		catccatccatcaccatccatccatcc	0.000													4	2	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137715707	137715708	+	Intron	DEL	TG	-	-	rs72312348		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137715707_137715708delTG	uc004cfe.2	+						uc004cff.2_Intron	NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		tgtatgtgcatgtgtgtgtgca	0.000													2	6	---	---	---	---	
SNAPC4	6621	broad.mit.edu	37	9	139277995	139277997	+	In_Frame_Del	DEL	GCT	-	-	rs35266724		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139277995_139277997delGCT	uc004chh.2	-	15	1633_1635	c.1624_1626delAGC	c.(1624-1626)AGCdel	p.S542del		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	542					snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CGTCCTCCTCgctgctgctgctg	0.473													11	8	---	---	---	---	
EDF1	8721	broad.mit.edu	37	9	139760831	139760831	+	5'Flank	DEL	G	-	-	rs111812525		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139760831delG	uc004cjt.1	-						EDF1_uc004cju.1_5'Flank	NM_003792	NP_003783	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1						endothelial cell differentiation|multicellular organismal development|positive regulation of DNA binding|positive regulation of transcription, DNA-dependent|regulation of lipid metabolic process|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleolus|nucleus	calmodulin binding|protein binding|protein binding|sequence-specific DNA binding|transcription coactivator activity				0	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GGCTGCACGCGGGGGGCGGGC	0.746													3	3	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140615677	140615677	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140615677delC	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CTCACACTCACCCCTCCCAGA	0.303													14	7	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140693552	140693553	+	Intron	DEL	CA	-	-	rs67033110		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140693552_140693553delCA	uc011mfc.1	+							NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CGTCCCATCCCACACACAGAGC	0.658													4	2	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	559564	559565	+	Intron	INS	-	TGAAAG	TGAAAG	rs144529132	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:559564_559565insTGAAAG	uc001ifp.2	-							NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CACACCTTACCTGAAAGTCACT	0.515													2	6	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24385714	24385714	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24385714delC	uc001irs.2	+							NM_001098500	NP_001091970	Q5T5P2	SKT_HUMAN	sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						agatttgcttcccttattaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	27620447	27620448	+	IGR	INS	-	TT	TT	rs142562667	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27620447_27620448insTT								LOC387646 (79212 upstream) : PTCHD3 (66669 downstream)																							ACTCAGGCTTCTTTCCGCCAAG	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29073752	29073755	+	IGR	DEL	ACAA	-	-	rs72010007		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29073752_29073755delACAA								BAMBI (101884 upstream) : LYZL1 (504235 downstream)																							ATCTTTGGGGACAAACAGTCTCAT	0.525													3	4	---	---	---	---	
EPC1	80314	broad.mit.edu	37	10	32562484	32562484	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32562484delT	uc001iwg.1	-						EPC1_uc001iwi.3_Intron|EPC1_uc009xlt.2_Intron|EPC1_uc001iwh.1_Intron	NM_025209	NP_079485	Q9H2F5	EPC1_HUMAN	enhancer of polycomb 1						histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)				AACACCACTATTTTTTTTTTA	0.318													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45660605	45660605	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45660605delT	uc001jca.3	+						uc001jcb.1_Intron|uc009xmr.1_Intron					Homo sapiens cDNA FLJ25822 fis, clone TST07893.																		TGATTTAACGTTTTTTTTTTT	0.289													11	5	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47023194	47023194	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47023194delG	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						tgatgtgcatgtgtggtgtgt	0.000													4	3	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51488628	51488629	+	Intron	INS	-	A	A	rs149702583	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51488628_51488629insA	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|AGAP7_uc001jio.2_5'Flank	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		CTCTCTAGGAGAAAAATAAATC	0.342													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	58938625	58938626	+	IGR	INS	-	GAAA	GAAA	rs150844154	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58938625_58938626insGAAA								ZWINT (817591 upstream) : None (None downstream)																							AGAAATAAAGGGAaagaaagaa	0.183													4	4	---	---	---	---	
IPMK	253430	broad.mit.edu	37	10	59958752	59958752	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59958752delT	uc001jkb.2	-							NM_152230	NP_689416	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase							nucleus	ATP binding|inositol trisphosphate 6-kinase activity			ovary(1)	1						CAGCTGTTCATTTTTTTTTTA	0.299													8	5	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73377297	73377297	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73377297delA	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc009xql.2_3'UTR	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						AATAAGGCTGAAAAAAAAATc	0.254													4	2	---	---	---	---	
LRIT2	340745	broad.mit.edu	37	10	85983847	85983848	+	Intron	INS	-	TA	TA			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85983847_85983848insTA	uc001kcy.2	-						LRIT2_uc010qmc.1_Intron	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor							integral to membrane				ovary(2)	2						AAATATGTGTTTATATATGTGT	0.292													4	2	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88818656	88818656	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88818656delA	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	tcaaaaaaagaaaaaaaaaaT	0.129													4	2	---	---	---	---	
LOC728190	728190	broad.mit.edu	37	10	89020225	89020226	+	Intron	DEL	AA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89020225_89020226delAA	uc009xtc.2	-						LOC728190_uc009xtd.2_Intron|LOC728190_uc010qmq.1_Intron|LOC728190_uc001kem.3_Intron					Homo sapiens cDNA FLJ34397 fis, clone HCHON2001110.												0						gggatagggtaaagtttggatt	0.000													2	4	---	---	---	---	
COX15	1355	broad.mit.edu	37	10	101489180	101489192	+	Intron	DEL	GCACTCCAGCCTG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101489180_101489192delGCACTCCAGCCTG	uc001kqb.3	-						COX15_uc001kqc.3_Intron|COX15_uc010qpj.1_Intron|CUTC_uc010qpk.1_5'Flank|CUTC_uc001kqd.3_5'Flank|CUTC_uc001kqe.3_5'Flank	NM_078470	NP_510870	Q7KZN9	COX15_HUMAN	COX15 homolog isoform 1						heme a biosynthetic process|respiratory chain complex IV assembly|respiratory gaseous exchange	integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		tcacaccactgcactccagcctggccaacagag	0.117													8	6	---	---	---	---	
PDZD7	79955	broad.mit.edu	37	10	102777612	102777613	+	Intron	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102777612_102777613insA	uc001kso.1	-						PDZD7_uc001ksn.2_Intron	NM_024895	NP_079171	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7							cilium|nucleus	protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		aagaaagaaagaaagaaagaaa	0.005													6	5	---	---	---	---	
DUSP5	1847	broad.mit.edu	37	10	112271145	112271146	+	3'UTR	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112271145_112271146insT	uc001kzd.2	+	4						NM_004419	NP_004410	Q16690	DUS5_HUMAN	dual specificity phosphatase 5						endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		CGTGGTACTACTTTTTTTTTCT	0.406													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113525760	113525760	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113525760delA								ADRA2A (685100 upstream) : GPAM (383862 downstream)																							cctgtctcggaaaaaaaaaaa	0.095													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133775335	133775336	+	IGR	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133775335_133775336insT								PPP2R2D (5284 upstream) : BNIP3 (5851 downstream)																							GTCCTCCAGGGTTTTTTTTTTT	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135464251	135464252	+	IGR	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135464251_135464252insT								FRG2B (23952 upstream) : LOC653544 (26027 downstream)																							caggttcattcttttacatgtg	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15598179	15598179	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15598179delT								INSC (329427 upstream) : SOX6 (389817 downstream)																							AGCAAGACTCTTTTTTGCTAT	0.483													4	2	---	---	---	---	
KCNC1	3746	broad.mit.edu	37	11	17761221	17761222	+	Intron	DEL	TG	-	-	rs144535999		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17761221_17761222delTG	uc001mnk.3	+						KCNC1_uc009yhc.1_Intron	NM_004976	NP_004967	P48547	KCNC1_HUMAN	Shaw-related voltage-gated potassium channel							voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)	1						tgtgtgagtctgtgtgtgtgtg	0.411													4	5	---	---	---	---	
SLC5A12	159963	broad.mit.edu	37	11	26720240	26720240	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26720240delT	uc001mra.2	-						SLC5A12_uc001mrb.2_Intron|SLC5A12_uc001mrc.3_Intron	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose						sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						ACTTTTGCTATTTTTTTTTTG	0.284													27	12	---	---	---	---	
CD44	960	broad.mit.edu	37	11	35202286	35202286	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35202286delA	uc001mvu.2	+						CD44_uc001mvv.2_Intron|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor						cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	aaaatcacacaaaaaaaatct	0.000													4	2	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47787203	47787204	+	Intron	INS	-	AAAAT	AAAAT	rs113703557		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47787203_47787204insAAAAT	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						ctaaaaatacaaaaaataaaaa	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	60517663	60517663	+	IGR	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60517663delG								MS4A8B (34381 upstream) : MS4A15 (6677 downstream)																							agaggggaacggggtaggaat	0.000													4	2	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68838579	68838580	+	Intron	INS	-	TG	TG	rs66520477		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68838579_68838580insTG	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_5'Flank	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GGGATCCCCCACCAACAGCTTC	0.644													10	5	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68838582	68838582	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68838582delA	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_5'Flank	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ATCCCCCACCAACAGCTTCAC	0.642													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	74207868	74207869	+	5'UTR	INS	-	C	C	rs141107343	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74207868_74207869insC	uc001ove.2	+	2										SubName: Full=Similar to Cytochrome c, somatic;																		gggaaaaaagacccccccagct	0.000													3	4	---	---	---	---	
CAPN5	726	broad.mit.edu	37	11	76793266	76793266	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76793266delG	uc001oxx.2	+						CAPN5_uc009yup.2_Intron|CAPN5_uc009yuq.2_Intron|CAPN5_uc001oxy.2_Intron	NM_004055	NP_004046	O15484	CAN5_HUMAN	calpain 5						proteolysis|signal transduction	intracellular	calcium-dependent cysteine-type endopeptidase activity				0						cttcagcccagggtggagaat	0.124													4	2	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89915863	89915863	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89915863delA	uc001pdf.3	+						NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AAAATATAACAAACGATTTTC	0.388													4	2	---	---	---	---	
FAT3	120114	broad.mit.edu	37	11	92439145	92439150	+	Intron	DEL	GTGATG	-	-	rs113154343		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92439145_92439150delGTGATG	uc001pdj.3	+							NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ggtagtggcagtgatggtgatggtgg	0.044										TCGA Ovarian(4;0.039)			4	3	---	---	---	---	
MRE11A	4361	broad.mit.edu	37	11	94197092	94197094	+	Intron	DEL	ATA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94197092_94197094delATA	uc001peu.2	-						MRE11A_uc001pev.2_Intron|MRE11A_uc009ywj.2_Intron	NM_005591	NP_005582	P49959	MRE11_HUMAN	meiotic recombination 11 homolog A isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|double-strand break repair via nonhomologous end joining|negative regulation of DNA endoreduplication|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|sister chromatid cohesion|telomere maintenance via telomerase	Mre11 complex|nucleoplasm	3'-5' exonuclease activity|double-stranded DNA binding|manganese ion binding|protein C-terminus binding|single-stranded DNA specific endodeoxyribonuclease activity			breast(4)|lung(1)	5		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				aacttaaggtataataataataa	0.118								Homologous_recombination	Ataxia-Telangiectasia-Like_Disorder				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	102601840	102601842	+	IGR	DEL	CTC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102601840_102601842delCTC								MMP8 (6155 upstream) : MMP10 (39392 downstream)																							cacacacctgctcctcctcacac	0.108													2	4	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	103182398	103182400	+	Intron	DEL	ATT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103182398_103182400delATT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AATTTGAATAATTATTCTGTATT	0.236													4	3	---	---	---	---	
RNF214	257160	broad.mit.edu	37	11	117110905	117110906	+	Intron	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117110905_117110906insA	uc001pqt.2	+						RNF214_uc001pqu.2_Intron|RNF214_uc010rxf.1_Intron	NM_207343	NP_997226	Q8ND24	RN214_HUMAN	ring finger protein 214								zinc ion binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		accatgtctacaaaaaatacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	126904805	126904805	+	IGR	DEL	G	-	-	rs111297276		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126904805delG								KIRREL3 (31450 upstream) : None (None downstream)																							GAGAAATATCGGAAGAAACCA	0.438													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	128755721	128755722	+	IGR	INS	-	TGCC	TGCC			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128755721_128755722insTGCC								KCNJ1 (18453 upstream) : KCNJ5 (5591 downstream)																							TTCCCAGCTCTTGCCTCTTCTC	0.505													2	5	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	132449280	132449281	+	Intron	INS	-	TG	TG	rs147056078	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132449280_132449281insTG	uc001qgs.2	-						OPCML_uc001qgu.2_Intron|OPCML_uc010sck.1_Intron|OPCML_uc001qgt.2_Intron|OPCML_uc010scl.1_Intron	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TAGAATGAATAtgtgtgtgtgt	0.381													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	4157109	4157109	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4157109delT								PARP11 (174501 upstream) : CCND2 (225793 downstream)																							gttccttcagttttttttttt	0.010													1	5	---	---	---	---	
PLEKHG6	55200	broad.mit.edu	37	12	6428620	6428620	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6428620delA	uc001qnr.2	+						PLEKHG6_uc010sew.1_Intron|PLEKHG6_uc010sex.1_Intron	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G						regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|skin(1)	2						aagaagaaggaaaaaaaaaag	0.239													4	2	---	---	---	---	
FAM66C	440078	broad.mit.edu	37	12	8363702	8363703	+	Intron	INS	-	ATATTTTGTGTGCAT	ATATTTTGTGTGCAT	rs17801875	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8363702_8363703insATATTTTGTGTGCAT	uc001qug.3	+											Homo sapiens cDNA FLJ38982 fis, clone NT2RI2005239.												0						GGCATATTCACAGAGATGTACT	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32041925	32041926	+	IGR	INS	-	CAA	CAA	rs138762619	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32041925_32041926insCAA								H3F3C (96750 upstream) : C12orf35 (70427 downstream)																							tgaaacaaacgcaacaacaaca	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32101807	32101808	+	IGR	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32101807_32101808insA								H3F3C (156632 upstream) : C12orf35 (10545 downstream)																							TTGACAACTAGAAAAAAAAAAA	0.198													5	5	---	---	---	---	
CPNE8	144402	broad.mit.edu	37	12	39123759	39123761	+	Intron	DEL	TCT	-	-	rs141494186		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39123759_39123761delTCT	uc001rls.1	-							NM_153634	NP_705898	Q86YQ8	CPNE8_HUMAN	copine VIII											pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				AAAATGCTAATCTTCTTCTTTAT	0.369													6	4	---	---	---	---	
SPATS2	65244	broad.mit.edu	37	12	49889535	49889539	+	Intron	DEL	TTAAG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49889535_49889539delTTAAG	uc001rud.2	+						SPATS2_uc001rue.2_Intron|SPATS2_uc009zli.1_Intron|SPATS2_uc001ruf.2_Intron|SPATS2_uc001rug.2_Intron	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2							cytoplasm				breast(1)	1						GAAGGTGACTTTAAGTTGTTTTTTA	0.205													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77377701	77377701	+	IGR	DEL	A	-	-	rs34635216		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77377701delA								CSRP2 (104902 upstream) : E2F7 (37326 downstream)																							GCAAAAACTTAAGAAACAAAC	0.333													5	7	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79702312	79702313	+	Intron	INS	-	AAAG	AAAG	rs143472094	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79702312_79702313insAAAG	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						aaagaagaaataaagaaagaaa	0.000													5	3	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79702326	79702327	+	Intron	INS	-	AGAC	AGAC	rs140848209	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79702326_79702327insAGAC	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						gaaagaaagaaagaaaaaagaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80367599	80367599	+	IGR	DEL	T	-	-	rs74928556		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80367599delT								PPP1R12A (38364 upstream) : PTPRQ (470527 downstream)																							AAAAAGCAGCTTTTTTTTTGT	0.239													4	2	---	---	---	---	
BRAP	8315	broad.mit.edu	37	12	112082569	112082569	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112082569delT	uc001tsn.3	-						BRAP_uc010syh.1_Intron|BRAP_uc009zvv.2_Intron	NM_006768	NP_006759	Q7Z569	BRAP_HUMAN	BRCA1 associated protein						MAPKKK cascade|negative regulation of signal transduction|Ras protein signal transduction	cytoplasm|ubiquitin ligase complex	identical protein binding|nuclear localization sequence binding|nucleotide binding|ubiquitin-protein ligase activity|zinc ion binding			lung(1)	1						CACAAGTGTAtttttttttga	0.219													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114983411	114983412	+	IGR	INS	-	A	A	rs142844727	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114983411_114983412insA								TBX5 (137164 upstream) : TBX3 (124647 downstream)																							AGTGATTGTGGAAAAAACAGAA	0.396													1	6	---	---	---	---	
MED13L	23389	broad.mit.edu	37	12	116674977	116674977	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116674977delA	uc001tvw.2	-							NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		ACTATCATTTAAAAACAGTGG	0.423													4	2	---	---	---	---	
PITPNM2	57605	broad.mit.edu	37	12	123549297	123549297	+	Intron	DEL	A	-	-	rs34701888		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123549297delA	uc001uej.1	-						PITPNM2_uc001uek.1_Intron|PITPNM2_uc009zxu.1_Intron	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,						metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CTCACCCTGCAAAAAAAAGCT	0.478													3	3	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	124953452	124953453	+	Intron	INS	-	C	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124953452_124953453insC	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		catcctcatcaccccatcatcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131975458	131975458	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131975458delA								LOC116437 (277983 upstream) : SFRS8 (220177 downstream)																							CCTGGGAATGAATGAGATGAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20143154	20143154	+	IGR	DEL	C	-	-	rs35224455		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20143154delC								TPTE2 (7440 upstream) : MPHOSPH8 (64726 downstream)																							TGTTTACTTTCATCTTTTAAA	0.244													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	42576663	42576663	+	IGR	DEL	T	-	-	rs77642727		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42576663delT								KIAA0564 (41442 upstream) : DGKH (37509 downstream)																							tttttctgggttttttttttt	0.000													6	3	---	---	---	---	
CPB2	1361	broad.mit.edu	37	13	46632101	46632102	+	Intron	INS	-	A	A	rs75807983	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46632101_46632102insA	uc001vaw.2	-						uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Intron	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a						blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		GCCCACGTGCTGAATAAAGTGT	0.426													7	7	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	49034111	49034111	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49034111delC	uc001vcb.2	+							NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ttctctctttctttctttttt	0.020		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			6	6	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	49034115	49034115	+	Intron	DEL	C	-	-	rs56388055		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49034115delC	uc001vcb.2	+							NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ctctttctttcttttttttga	0.010		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			3	7	---	---	---	---	
DLEU1	10301	broad.mit.edu	37	13	50734970	50734970	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50734970delT	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0						GTATTCCTAGTTTTTTTTTTT	0.403													3	4	---	---	---	---	
UTP14C	9724	broad.mit.edu	37	13	52602231	52602231	+	Intron	DEL	A	-	-	rs142915895		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52602231delA	uc001vgb.2	+						UTP14C_uc001vga.2_Intron|UTP14C_uc001vgc.2_Intron	NM_021645	NP_067677	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,						cell differentiation|meiosis|multicellular organismal development|rRNA processing|spermatogenesis	nucleolus|small-subunit processome				ovary(3)|large_intestine(1)|breast(1)	5		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		cctatctcttaaaaaaaaaaa	0.109													7	6	---	---	---	---	
MYCBP2	23077	broad.mit.edu	37	13	77843765	77843765	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77843765delA	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		tgtctcaattaaaaaaaaaaa	0.075													4	3	---	---	---	---	
IPO5	3843	broad.mit.edu	37	13	98658181	98658181	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98658181delA	uc001vnf.1	+						IPO5_uc001vne.2_Intron|IPO5_uc010tik.1_Intron|IPO5_uc010til.1_Intron|IPO5_uc001vng.1_Intron	NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						TAGAAGAGAGAAAAAAAAAAT	0.343													4	2	---	---	---	---	
F7	2155	broad.mit.edu	37	13	113768647	113768647	+	Intron	DEL	T	-	-	rs113619210		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113768647delT	uc001vsv.2	+						F7_uc010agp.1_Intron|F7_uc001vsw.2_Intron|F7_uc010tjt.1_Intron	NM_000131	NP_000122	P08709	FA7_HUMAN	coagulation factor VII isoform a precursor						anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	GAGGGGTTTGTTTTTTTTTTA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21231280	21231281	+	IGR	DEL	TG	-	-	rs71654772		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21231280_21231281delTG								EDDM3A (14742 upstream) : EDDM3B (5305 downstream)																							CTtgcgtgtatgtgtgtgtgtg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34838703	34838704	+	IGR	INS	-	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34838703_34838704insG								EGLN3 (418416 upstream) : C14orf147 (63441 downstream)																							tggcttttgacgggggaagtgt	0.000													4	2	---	---	---	---	
ERO1L	30001	broad.mit.edu	37	14	53110031	53110033	+	3'UTR	DEL	TCC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53110031_53110033delTCC	uc001wzv.2	-	16					ERO1L_uc001wzw.2_RNA|ERO1L_uc010aof.2_RNA	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN	ERO1-like precursor						chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor				0	Breast(41;0.226)					AATTTGATAATCCTCCTTTTATT	0.222													8	4	---	---	---	---	
BMP4	652	broad.mit.edu	37	14	54424358	54424358	+	5'Flank	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54424358delT	uc001xao.3	-						BMP4_uc001xan.3_5'Flank	NM_001202	NP_001193	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein						activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0						ttgttgttgatttttttgttC	0.348													4	2	---	---	---	---	
GMFB	2764	broad.mit.edu	37	14	54956157	54956158	+	5'Flank	DEL	TC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54956157_54956158delTC	uc010tqz.1	-							NM_004124	NP_004115	P60983	GMFB_HUMAN	glia maturation factor, beta						nervous system development|protein phosphorylation	intracellular	actin binding|enzyme activator activity|growth factor activity|protein kinase inhibitor activity|signal transducer activity				0						GGTTAATCAAtctctctctctc	0.337													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	78090555	78090555	+	IGR	DEL	A	-	-	rs113134791		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78090555delA								SPTLC2 (7445 upstream) : ALKBH1 (48194 downstream)																							TTAAAAAAACAAAAAAAATTG	0.303													3	3	---	---	---	---	
SERPINA1	5265	broad.mit.edu	37	14	94845223	94845239	+	Intron	DEL	GGAAGAGCATCGTCACT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94845223_94845239delGGAAGAGCATCGTCACT	uc001ycx.3	-						SERPINA1_uc001ycw.3_Intron|SERPINA1_uc010auw.2_Intron|SERPINA1_uc010aux.2_Intron|SERPINA1_uc001ycy.3_Intron|SERPINA1_uc010auy.2_Intron|SERPINA1_uc001ycz.3_Intron|SERPINA1_uc010auz.2_Intron|SERPINA1_uc010ava.2_Intron|SERPINA1_uc001ydb.3_Intron|SERPINA1_uc010avb.2_Intron|SERPINA1_uc001ydc.3_Intron	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1						acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)	CTCAGAACAGGGAAGAGCATCGTCACTCCACGTCTGC	0.599									Alpha-1-Antitrypsin_Deficiency				4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106770438	106770439	+	Splice_Site	INS	-	CT	CT			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106770438_106770439insCT	uc010tyt.1	-	442		c.15776_splice	c.e442-1							Parts of antibodies, mostly variable regions.												0						CCTGGCCCAGCCTCTCTTGGCT	0.520													9	4	---	---	---	---	
NIPA1	123606	broad.mit.edu	37	15	23078125	23078126	+	Intron	INS	-	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23078125_23078126insG	uc001yvc.2	-						NIPA1_uc001yvd.2_Intron|NIPA1_uc001yve.2_Intron	NM_144599	NP_653200	Q7RTP0	NIPA1_HUMAN	non-imprinted in Prader-Willi/Angelman syndrome						cell death	early endosome|integral to membrane|plasma membrane					0		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		AGAGCTGGGATGGGGGGGAATG	0.614													4	2	---	---	---	---	
FAM189A1	23359	broad.mit.edu	37	15	29536963	29536963	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29536963delG	uc010azk.1	-							NM_015307	NP_056122	O60320	F1891_HUMAN	hypothetical protein LOC23359							integral to membrane					0						ATGGAGCTGCGGGACCTCCCA	0.512													4	2	---	---	---	---	
ARHGAP11A	9824	broad.mit.edu	37	15	32922142	32922143	+	Intron	INS	-	GT	GT			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32922142_32922143insGT	uc001zgy.1	+						ARHGAP11A_uc010ubw.1_Intron|ARHGAP11A_uc001zgw.2_Intron|ARHGAP11A_uc001zgx.2_Intron|ARHGAP11A_uc010ubx.1_Intron	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GTTTCAATATAgtgtgtgtgtg	0.277													8	5	---	---	---	---	
FMN1	342184	broad.mit.edu	37	15	33114717	33114717	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33114717delT	uc001zhf.3	-							NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		tattactccatttttttttcc	0.109													4	2	---	---	---	---	
IVD	3712	broad.mit.edu	37	15	40704106	40704106	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40704106delC	uc001zls.3	+						IVD_uc001zlq.2_Intron	NM_002225	NP_002216	P26440	IVD_HUMAN	isovaleryl Coenzyme A dehydrogenase isoform 1						leucine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|isovaleryl-CoA dehydrogenase activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)		GAGCCGTCCTCAGCGCCAGGC	0.567													4	2	---	---	---	---	
TP53BP1	7158	broad.mit.edu	37	15	43704428	43704428	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43704428delT	uc001zrs.2	-						TP53BP1_uc010udp.1_Intron|TP53BP1_uc001zrq.3_Intron|TP53BP1_uc001zrr.3_Intron|TP53BP1_uc001zrp.2_Intron	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3						double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TTTTGGTTAATTAGGAAAGAG	0.458								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
PPIP5K1	9677	broad.mit.edu	37	15	43831398	43831398	+	Intron	DEL	A	-	-	rs67877426		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43831398delA	uc001zrw.2	-						PPIP5K1_uc001zrx.1_Intron|PPIP5K1_uc001zru.2_Intron|PPIP5K1_uc001zry.3_Intron|PPIP5K1_uc001zrv.2_Intron	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						tctgtctctcaaaaaaaaaaa	0.154													8	5	---	---	---	---	
SPG11	80208	broad.mit.edu	37	15	44926043	44926043	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44926043delT	uc001ztx.2	-						SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zua.1_Intron	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		ttttcctttcttttttttttt	0.035													7	4	---	---	---	---	
PRTG	283659	broad.mit.edu	37	15	55933055	55933055	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55933055delA	uc002adg.2	-							NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor						multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		ctaaaaatacaaaaaaaaaaa	0.010													6	3	---	---	---	---	
GCOM1	145781	broad.mit.edu	37	15	57954508	57954508	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57954508delC	uc002aei.2	+						GCOM1_uc002aej.2_Intron|GCOM1_uc002aek.2_Intron|GCOM1_uc002ael.2_Intron|GCOM1_uc002aem.2_Intron|GCOM1_uc002aeq.2_Intron|GCOM1_uc002aen.2_Intron|GCOM1_uc010bfy.2_Intron|GCOM1_uc002aeo.2_Intron|GCOM1_uc002aep.2_Intron|GCOM1_uc010bfx.2_Intron	NM_001018100	NP_001018110	P0CAP1	GCOM1_HUMAN	GRINL1A upstream protein isoform 7						intracellular signal transduction	extrinsic to internal side of plasma membrane|I band				ovary(1)	1						TATCTGTGTTCCTCGTTATAG	0.433													4	2	---	---	---	---	
MESDC2	23184	broad.mit.edu	37	15	81263974	81263975	+	Intron	INS	-	T	T	rs112387692		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81263974_81263975insT	uc002bfx.2	-						MESDC2_uc010uno.1_Intron	NM_015154		Q14696	MESD_HUMAN	mesoderm development candidate 2						mesoderm development|protein folding|Wnt receptor signaling pathway	endoplasmic reticulum					0						TCTTAAAACAAttttttttttc	0.030													4	2	---	---	---	---	
ADAMTSL3	57188	broad.mit.edu	37	15	84363866	84363867	+	Intron	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84363866_84363867insT	uc002bjz.3	+						ADAMTSL3_uc002bjy.1_Intron|ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			gtgcatgtgtggtgtgtgtgtg	0.158													4	2	---	---	---	---	
AKAP13	11214	broad.mit.edu	37	15	85958947	85958947	+	Intron	DEL	T	-	-	rs35819058		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85958947delT	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						ATACCGTTTCTTTTTTTTTTT	0.313													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	86547658	86547659	+	IGR	DEL	TG	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86547658_86547659delTG								KLHL25 (209469 upstream) : AGBL1 (137583 downstream)																							tgtgtgtgattgtgtgtgtgtg	0.257													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	89215882	89215882	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89215882delT								ISG20 (17003 upstream) : ACAN (130792 downstream)																							accagacttctttagaagacc	0.000													4	2	---	---	---	---	
FAM174B	400451	broad.mit.edu	37	15	93198679	93198684	+	In_Frame_Del	DEL	TGGAGC	-	-	rs68056278		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93198679_93198684delTGGAGC	uc010boe.2	-	1	348_353	c.206_211delGCTCCA	c.(205-213)AGCTCCAAC>AAC	p.SS69del	FAM174B_uc002bsl.3_Intron	NM_207446	NP_997329	Q3ZCQ3	F174B_HUMAN	hypothetical protein LOC400451	69_70	Extracellular (Potential).					integral to membrane					0						CCACTGCTGTTGGAGCTGGAGCTGCC	0.578													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93785974	93785975	+	IGR	DEL	TG	-	-	rs10603057		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93785974_93785975delTG								RGMA (153541 upstream) : MCTP2 (988826 downstream)																							agagagagaatgtgtgtgtgtg	0.079													4	2	---	---	---	---	
LMF1	64788	broad.mit.edu	37	16	929845	929845	+	Intron	DEL	G	-	-	rs10714803		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:929845delG	uc002ckj.2	-						LMF1_uc010brh.2_Intron|LMF1_uc010bri.2_Intron|LMF1_uc002ckk.2_Intron|LMF1_uc010uuu.1_Intron	NM_022773	NP_073610	Q96S06	LMF1_HUMAN	lipase maturation factor 1							endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)				ACTGCACACAGGATCCCCCCG	0.672													20	11	---	---	---	---	
CACNA1H	8912	broad.mit.edu	37	16	1255041	1255041	+	Intron	DEL	C	-	-	rs56412134		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1255041delC	uc002cks.2	+						CACNA1H_uc002ckt.2_Intron	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,						aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	CGGGTGGGGGCCCCAGATCAG	0.736													11	5	---	---	---	---	
CCNF	899	broad.mit.edu	37	16	2485677	2485678	+	Intron	INS	-	GC	GC			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2485677_2485678insGC	uc002cqd.1	+						CCNF_uc002cqe.1_Intron	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F						cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				catatatatatatatatatata	0.153													4	2	---	---	---	---	
TRAP1	10131	broad.mit.edu	37	16	3747791	3747791	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3747791delT	uc002cvt.3	-						TRAP1_uc010uxf.1_Intron	NM_016292	NP_057376	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1 precursor						cellular response to oxidative stress|protein folding	mitochondrion	ATP binding|tumor necrosis factor receptor binding|unfolded protein binding			central_nervous_system(1)	1		Ovarian(90;0.0261)				ATATGCAGAAttttttttttt	0.164													5	4	---	---	---	---	
ABAT	18	broad.mit.edu	37	16	8784906	8784906	+	Intron	DEL	A	-	-	rs75492522		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8784906delA	uc002czc.3	+							NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	GTGTTGGGGGAAAAAAAAAAA	0.403													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9364994	9364995	+	IGR	INS	-	CATC	CATC	rs140678910	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9364994_9364995insCATC								C16orf72 (151449 upstream) : GRIN2A (482272 downstream)																							ctattatacatcatccatccat	0.000													4	2	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12307998	12307999	+	Intron	INS	-	A	A	rs72530764		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12307998_12307999insA	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						TCCCTGGCAGGGGCTTTCTTCT	0.441													3	3	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15114300	15114301	+	Intron	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15114300_15114301insT	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	gtaatcccagcactttgggagg	0.094													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15114303	15114303	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15114303delT	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	atcccagcactttgggaggcc	0.095													4	2	---	---	---	---	
XYLT1	64131	broad.mit.edu	37	16	17380507	17380508	+	Intron	INS	-	ATCATCATCATCCTC	ATCATCATCATCCTC	rs141429714	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17380507_17380508insATCATCATCATCCTC	uc002dfa.2	-							NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						catggataggtatcatcatcat	0.040													4	3	---	---	---	---	
LOC653786	653786	broad.mit.edu	37	16	22565894	22565894	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22565894delT	uc002dlh.3	+							NR_003676				RecName: Full=Otoancorin; Flags: Precursor;												0						TGTTCTCCCGTTTTTTTTTTT	0.104													8	4	---	---	---	---	
PALB2	79728	broad.mit.edu	37	16	23619548	23619548	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23619548delT	uc002dlx.1	-							NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2						double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		GTTCTtcttcttttttttttt	0.199			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				4	3	---	---	---	---	
RBBP6	5930	broad.mit.edu	37	16	24576366	24576369	+	Intron	DEL	TAGT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24576366_24576369delTAGT	uc002dmh.2	+						RBBP6_uc010vcb.1_Intron|RBBP6_uc002dmi.2_Intron|RBBP6_uc010bxr.2_Intron|RBBP6_uc002dmk.2_Intron	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		AAATTATATATAGTATCTTAAATG	0.377													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25563893	25563894	+	IGR	DEL	TC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25563893_25563894delTC								ZKSCAN2 (295038 upstream) : HS3ST4 (139453 downstream)																							catctctctttctctctctcta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26385676	26385677	+	IGR	INS	-	TAGA	TAGA	rs111483317		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26385676_26385677insTAGA								HS3ST4 (236668 upstream) : C16orf82 (692542 downstream)																							gagtgggcaggtggatgggtgg	0.035													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33946555	33946556	+	IGR	INS	-	A	A	rs146340096		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33946555_33946556insA								None (None upstream) : MIR1826 (18952 downstream)																							accctcactgtagagaaaagaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46409653	46409656	+	IGR	DEL	TTCA	-	-	rs112162925		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46409653_46409656delTTCA								None (None upstream) : ANKRD26P1 (93593 downstream)																							tccattcgatttcattcaatgatt	0.000													44	27	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48974710	48974710	+	IGR	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48974710delC								N4BP1 (330590 upstream) : CBLN1 (337501 downstream)																							TCTCATGAGACCCCCAAAATT	0.463													4	2	---	---	---	---	
ADCY7	113	broad.mit.edu	37	16	50331173	50331176	+	Intron	DEL	CTCT	-	-	rs35969283		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50331173_50331176delCTCT	uc002egd.1	+						ADCY7_uc002egb.1_Intron|ADCY7_uc002egc.1_Intron	NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	CCAGGGCCTCCTCTCTCAGAGGCA	0.564													4	2	---	---	---	---	
MMP2	4313	broad.mit.edu	37	16	55510926	55510927	+	5'Flank	DEL	GA	-	-	rs35434177		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55510926_55510927delGA	uc002ehz.3	+							NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a						angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	CTagtgaagggagtcacataca	0.193													2	6	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57948837	57948838	+	Intron	INS	-	G	G	rs140363273	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57948837_57948838insG	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						tggagacagatgacctgcattc	0.069													3	7	---	---	---	---	
CDH8	1006	broad.mit.edu	37	16	62069015	62069016	+	Intron	INS	-	T	T	rs140223128	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62069015_62069016insT	uc002eog.1	-							NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GCGGCAGCACGTTTTTTTACCG	0.535													3	4	---	---	---	---	
TERF2IP	54386	broad.mit.edu	37	16	75689878	75689891	+	Intron	DEL	CACACACACGTGCA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75689878_75689891delCACACACACGTGCA	uc002fet.1	+							NM_018975	NP_061848	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting						negative regulation of DNA recombination at telomere|negative regulation of telomere maintenance|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|regulation of double-strand break repair via homologous recombination|telomere maintenance via telomerase|transcription, DNA-dependent	cytoplasm|nuclear telomere cap complex|nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1						CCCTACCCCTcacacacacgtgcacacacacacg	0.224													9	5	---	---	---	---	
CDYL2	124359	broad.mit.edu	37	16	80653484	80653484	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80653484delT	uc002ffs.2	-							NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2							nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						GTGGTCCCCCTTTGATACATG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	81424603	81424603	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81424603delT								GAN (10802 upstream) : CMIP (54172 downstream)																							CCTGAGCCTCTTCCATCGCTG	0.562													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83716639	83716639	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83716639delC	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CACCACTGCTCCTCGGCTGAC	0.562													4	2	---	---	---	---	
HSDL1	83693	broad.mit.edu	37	16	84158529	84158530	+	Intron	INS	-	CAAT	CAAT	rs72242076		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84158529_84158530insCAAT	uc002fhk.2	-						HSDL1_uc010vnv.1_Intron	NM_031463	NP_113651	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1 isoform a							mitochondrion	oxidoreductase activity|protein binding				0						CAAATACCCACCAATCACAACA	0.381													8	6	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2934618	2934619	+	Intron	INS	-	T	T	rs138961407	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2934618_2934619insT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						AGGTGGGAAGGGCTGGTTCCTG	0.624													10	6	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2936030	2936031	+	Intron	INS	-	AGCCCG	AGCCCG	rs149005891	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2936030_2936031insAGCCCG	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						GGAGTCGCCCAAGCCCGCTTCT	0.639													3	3	---	---	---	---	
ANKFY1	51479	broad.mit.edu	37	17	4089717	4089717	+	Intron	DEL	A	-	-	rs113496981		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4089717delA	uc002fxq.1	-						ANKFY1_uc002fxn.2_Intron|ANKFY1_uc002fxo.2_Intron|ANKFY1_uc002fxp.2_Intron|ANKFY1_uc010ckp.2_Intron	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1							endosome membrane	metal ion binding|protein binding			ovary(2)|skin(1)	3						tggctagcctAAAAAAAAAAA	0.040													4	2	---	---	---	---	
FGF11	2256	broad.mit.edu	37	17	7345588	7345588	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7345588delT	uc002ggz.2	+						FGF11_uc010vtw.1_Intron|FGF11_uc010cmh.1_Intron|FGF11_uc010cmi.2_Intron|FGF11_uc010vtx.1_Intron|FGF11_uc002gha.3_Intron|CHRNB1_uc002ghb.2_5'Flank	NM_004112	NP_004103	Q92914	FGF11_HUMAN	fibroblast growth factor 11						cell-cell signaling|nervous system development|signal transduction		growth factor activity				0		Prostate(122;0.157)				AGTCTAGTTCTTttttttttt	0.229													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19300211	19300211	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19300211delT								MFAP4 (9708 upstream) : RNF112 (14312 downstream)																							tagctccttcttttttttttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20488023	20488025	+	IGR	DEL	CTC	-	-	rs76850913		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20488023_20488025delCTC								LGALS9B (117175 upstream) : CCDC144NL (278685 downstream)																							GAGATGAGTTCTCCCTCCTCCTC	0.557													5	7	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21205353	21205355	+	Intron	DEL	GGA	-	-	rs66761201		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21205353_21205355delGGA	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		GGCACACGTCGGAGAGggggctg	0.581													20	16	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21205362	21205364	+	Intron	DEL	GCT	-	-	rs67557217		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21205362_21205364delGCT	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CGGAGAGggggctggggctgggg	0.576													21	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21550333	21550334	+	IGR	DEL	AG	-	-	rs149466689		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21550333_21550334delAG								C17orf51 (72602 upstream) : FAM27L (275036 downstream)																							TGCTTGAAACAGAAGCTAATGA	0.460													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21563911	21563911	+	IGR	DEL	T	-	-	rs112625646		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21563911delT								C17orf51 (86180 upstream) : FAM27L (261459 downstream)																							ctcttatggatttttttctgt	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25272426	25272427	+	IGR	INS	-	G	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25272426_25272427insG								None (None upstream) : WSB1 (348679 downstream)																							acagggaaaaaaaagaggttat	0.000													6	3	---	---	---	---	
GGNBP2	79893	broad.mit.edu	37	17	34944015	34944016	+	Intron	DEL	AA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34944015_34944016delAA	uc002hnb.2	+							NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TTGTAAAGTTAAAAAAAAAAAA	0.040													4	2	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36354486	36354486	+	Intron	DEL	A	-	-	rs66843634		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36354486delA	uc010cvk.2	-						TBC1D3_uc002hpr.2_5'Flank|TBC1D3_uc010wdn.1_Intron	NM_001123391	NP_001116863	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AAGAAGAGGGAAAAAAAAAAT	0.224													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42109902	42109903	+	IGR	DEL	GT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42109902_42109903delGT								TMEM101 (17487 upstream) : LSM12 (2101 downstream)																							GGGTATAGAGGTGTGTGTGTGT	0.455													4	2	---	---	---	---	
ITGA2B	3674	broad.mit.edu	37	17	42453970	42453970	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42453970delT	uc002igt.1	-						ITGA2B_uc002igu.1_Intron	NM_000419	NP_000410	P08514	ITA2B_HUMAN	integrin alpha 2b preproprotein						axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Tirofiban(DB00775)	TTCAAAGACCttttttttttt	0.239													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47629175	47629175	+	IGR	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47629175delC								NGFR (36810 upstream) : NXPH3 (24123 downstream)																							CCATCAGGGGCCCCACCCAGT	0.597													4	2	---	---	---	---	
PPM1E	22843	broad.mit.edu	37	17	57020677	57020677	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57020677delA	uc002iwx.2	+						PPM1E_uc010ddd.2_Intron	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E						protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			acaaaacaacaaaaaaaacac	0.279													5	4	---	---	---	---	
TMC6	11322	broad.mit.edu	37	17	76127849	76127850	+	Intron	INS	-	G	G	rs146880338	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76127849_76127850insG	uc002jul.1	-						TMC6_uc010dhf.1_5'Flank|TMC6_uc002juk.2_5'Flank|TMC6_uc010dhg.1_5'Flank|TMC6_uc002jun.3_5'Flank|TMC6_uc002juo.2_5'Flank|TMC6_uc010wtq.1_5'Flank|TMC8_uc010dhh.1_Intron|TMC8_uc002jup.2_Intron|TMC8_uc002juq.2_Intron|TMC8_uc010wtr.1_5'Flank	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6							endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AGACGGTGCGTGGGGGGGGTGC	0.743									Epidermodysplasia_Verruciformis_Familial_Clustering_of				10	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	77631602	77631603	+	IGR	INS	-	A	A	rs113081554		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77631602_77631603insA								HRNBP3 (152922 upstream) : ENPP7 (73279 downstream)																							TGGGTCGCCACAAAAATCAGCC	0.401													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	2496685	2496685	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2496685delT								None (None upstream) : METTL4 (40840 downstream)																							TTCTGTTTTCttttttctttt	0.209													4	2	---	---	---	---	
SEH1L	81929	broad.mit.edu	37	18	12979076	12979076	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12979076delT	uc002krr.2	+						SEH1L_uc002krq.2_Intron	NM_031216	NP_112493	Q96EE3	SEH1_HUMAN	sec13-like protein isoform 2						attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|carbohydrate metabolic process|cell division|glucose transport|mitotic metaphase plate congression|mitotic prometaphase|mRNA transport|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex					0						Tttttctttcttttttttttt	0.104													18	9	---	---	---	---	
OSBPL1A	114876	broad.mit.edu	37	18	21946563	21946563	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21946563delT	uc002kve.2	-							NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					aatgaagctattttTTTTTTA	0.075													4	2	---	---	---	---	
HRH4	59340	broad.mit.edu	37	18	22053787	22053787	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22053787delA	uc002kvi.2	+						HRH4_uc010xbd.1_Intron|HRH4_uc010dlx.2_Intron	NM_021624	NP_067637	Q9H3N8	HRH4_HUMAN	histamine H4 receptor isoform 1							integral to membrane|plasma membrane	histamine receptor activity			ovary(2)	2	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Clozapine(DB00363)	CGGCCTCACCAAAAAAACCTG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	40065277	40065278	+	Intron	INS	-	GT	GT	rs150921949	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40065277_40065278insGT	uc002las.1	+						uc002lat.2_Intron|uc002lau.2_Intron					Homo sapiens hypothetical gene supported by BC011527; BC021928; BC011527; BC021928, mRNA (cDNA clone IMAGE:3872963), with apparent retained intron.																		tatattccatggtgtgtgtgtg	0.223													6	3	---	---	---	---	
SMAD7	4092	broad.mit.edu	37	18	46447624	46447624	+	3'UTR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46447624delA	uc002ldg.2	-	4					SMAD7_uc002ldf.2_3'UTR|SMAD7_uc010xde.1_3'UTR	NM_005904	NP_005895	O15105	SMAD7_HUMAN	SMAD family member 7						adherens junction assembly|artery morphogenesis|BMP signaling pathway|cellular protein complex localization|negative regulation of BMP signaling pathway|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of peptidyl-serine phosphorylation|negative regulation of peptidyl-threonine phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of ubiquitin-protein ligase activity|pathway-restricted SMAD protein phosphorylation|positive regulation of anti-apoptosis|positive regulation of cell-cell adhesion|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein stabilization|regulation of activin receptor signaling pathway|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	centrosome|cytosol|nucleolus|plasma membrane|transcription factor complex	activin binding|beta-catenin binding|I-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding				0	Colorectal(1;0.0518)					ACCAACAAACAAAAAAAAAAC	0.393													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	58580221	58580222	+	IGR	DEL	CT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58580221_58580222delCT								MC4R (540220 upstream) : CDH20 (420766 downstream)																							AGTTGTTGAGCTCTCTCTCTCT	0.416													6	3	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67715076	67715076	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67715076delT	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron|RTTN_uc010dqp.2_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TTTTGTATCATTTAAACAGTC	0.229													8	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	69866758	69866758	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69866758delT								None (None upstream) : CBLN2 (337157 downstream)																							TGTCCTTTTGTTTTTTTTCTG	0.075													4	2	---	---	---	---	
NFATC1	4772	broad.mit.edu	37	18	77246095	77246095	+	Intron	DEL	T	-	-	rs67201672		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77246095delT	uc010xfg.1	+						NFATC1_uc002lnd.2_Intron|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfj.1_Intron|NFATC1_uc002lnf.2_Intron|NFATC1_uc002lng.2_Intron|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic						intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)		GACTCACGCCTTTTTTTTTTA	0.547													5	4	---	---	---	---	
TMPRSS9	360200	broad.mit.edu	37	19	2407957	2407957	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2407957delT	uc010xgx.1	+						TMPRSS9_uc002lvv.1_Intron	NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aatttttgtatttttagtaga	0.000													4	2	---	---	---	---	
ZFR2	23217	broad.mit.edu	37	19	3871980	3871980	+	5'Flank	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3871980delA	uc002lyw.2	-						ZFR2_uc010xhx.1_5'Flank|ZFR2_uc002lyx.3_5'Flank|ZFR2_uc010xhy.1_5'Flank	NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		gaggctctccaaaaaaaaaag	0.269													6	4	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4203031	4203033	+	Intron	DEL	CTC	-	-	rs72343536		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4203031_4203033delCTC	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		AGCTTCCTGTCTCCTCCtttctt	0.340													5	3	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5300943	5300943	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5300943delG	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		GTCAGCAGGTGCCATCTGCAG	0.493													4	2	---	---	---	---	
KANK3	256949	broad.mit.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	-	-	rs111751275		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8398950_8398961delTCGCTGTCGCCA	uc010dwa.2	-	5	1533_1544	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)GATGGCGACAGCGAG>GAG	p.DGDS489del	KANK3_uc002mjp.1_In_Frame_Del_p.MATA1del	NM_198471	NP_940873	Q6NY19	KANK3_HUMAN	ankyrin repeat domain 47	489_492											0						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.693													9	4	---	---	---	---	
ZNF506	440515	broad.mit.edu	37	19	19917502	19917502	+	Intron	DEL	A	-	-	rs35646134		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19917502delA	uc010eci.2	-						ZNF506_uc002nog.2_Intron|ZNF506_uc002noh.3_Intron|ZNF506_uc010ecj.1_Intron	NM_001099269	NP_001092739	Q5JVG8	ZN506_HUMAN	zinc finger protein 506 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding				0						TTATGCCACTAAATTTTTGGA	0.333													8	8	---	---	---	---	
DPY19L3	147991	broad.mit.edu	37	19	32902567	32902567	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32902567delA	uc002ntg.2	+						DPY19L3_uc002ntf.2_3'UTR|DPY19L3_uc002nth.1_Intron	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3							integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)					tctgcctcgcaggttcaggtg	0.000													4	2	---	---	---	---	
RHPN2	85415	broad.mit.edu	37	19	33499156	33499156	+	Intron	DEL	C	-	-	rs73037499	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33499156delC	uc002nuf.2	-						RHPN2_uc010xro.1_Intron|RHPN2_uc002nue.2_Intron	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					GGAAAAAAttctttttttttt	0.209													4	2	---	---	---	---	
ETV2	2116	broad.mit.edu	37	19	36135279	36135280	+	Intron	INS	-	T	T	rs147503261	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36135279_36135280insT	uc002oas.2	+						ETV2_uc002oar.2_Intron|ETV2_uc002oat.2_Intron|ETV2_uc002oau.2_Intron	NM_014209	NP_055024	O00321	ETV2_HUMAN	ets variant gene 2								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGCCAAATCCGCCCCGTCTCT	0.673													17	9	---	---	---	---	
NFKBIB	4793	broad.mit.edu	37	19	39395119	39395120	+	Intron	INS	-	TCTT	TCTT	rs145766902	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39395119_39395120insTCTT	uc002ojw.2	+						NFKBIB_uc010egk.1_Intron|NFKBIB_uc002ojx.2_Intron|NFKBIB_uc002ojy.2_Intron	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			tttggcaactctgttttgtact	0.000													2	9	---	---	---	---	
MARK4	57787	broad.mit.edu	37	19	45767749	45767749	+	Intron	DEL	A	-	-	rs77123461		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45767749delA	uc002pbb.1	+						MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Intron|MARK4_uc002pbc.1_5'Flank			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;						microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		actccatctcaaaaaaaaaaa	0.229													8	4	---	---	---	---	
CABP5	56344	broad.mit.edu	37	19	48542877	48542877	+	Intron	DEL	T	-	-	rs66988565		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48542877delT	uc002phu.1	-							NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		GAGCATACAATTTTTTTTTCA	0.343													4	4	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50752588	50752590	+	Intron	DEL	CTT	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50752588_50752590delCTT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		tctctgtccccttctctctctgg	0.010													8	8	---	---	---	---	
TMC4	147798	broad.mit.edu	37	19	54671790	54671790	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54671790delA	uc010erf.2	-						TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					actccgtctcaaaaaaaaaaa	0.294													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55119072	55119072	+	IGR	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55119072delG								LILRA1 (6532 upstream) : LILRB1 (9557 downstream)																							CTTCCTTTGTGTGTGTGTTCT	0.557													4	2	---	---	---	---	
EPS8L1	54869	broad.mit.edu	37	19	55587649	55587649	+	Intron	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55587649delG	uc002qis.3	+						EPS8L1_uc010ess.1_Intron|EPS8L1_uc010est.1_Intron|EPS8L1_uc010yfr.1_Intron|EPS8L1_uc010esu.1_5'Flank	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway							cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		aggaggggctgggggcctgga	0.070													5	3	---	---	---	---	
EBF4	57593	broad.mit.edu	37	20	2736010	2736011	+	Intron	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2736010_2736011insT	uc002wgt.3	+						EBF4_uc002wgs.3_Intron	NM_001110514	NP_001103984	Q9BQW3	COE4_HUMAN	early B-cell factor 4						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding				0						CCCACTGTTTGTTTTTTTTGAA	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	7172938	7172938	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7172938delT								BMP2 (412028 upstream) : HAO1 (690693 downstream)																							ctccacaacattttttttttt	0.090													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10615830	10615830	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10615830delA								C20orf94 (11805 upstream) : JAG1 (2502 downstream)																							TGTGGGGTGGAAAAAAAATGT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12074143	12074144	+	IGR	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12074143_12074144insA								BTBD3 (166901 upstream) : SPTLC3 (915483 downstream)																							ccccattttataaatgaggcac	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	20358863	20358864	+	IGR	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20358863_20358864insT								INSM1 (7273 upstream) : RALGAPA2 (14548 downstream)																							GGACATTGCTGttttttttgtt	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29455506	29455506	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29455506delT								None (None upstream) : FRG1B (156373 downstream)																							ATAGGTTTTATTTCAGTGATT	0.124													9	4	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	40726876	40726877	+	Intron	INS	-	G	G	rs146297756	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40726876_40726877insG	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron|PTPRT_uc010ggi.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GCTGGAGGTCTGGGGGGTGACA	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44366727	44366727	+	IGR	DEL	A	-	-	rs144993638	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44366727delA								SPINT4 (12392 upstream) : WFDC3 (36120 downstream)																							CACTCCAGAGAAAAAAAaaaa	0.234													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	45418021	45418021	+	IGR	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45418021delG								SLC2A10 (53038 upstream) : EYA2 (105242 downstream)																							atgtgggtgtggtgggtgtgc	0.030													7	6	---	---	---	---	
DDX27	55661	broad.mit.edu	37	20	47838346	47838346	+	Intron	DEL	T	-	-	rs67986670		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47838346delT	uc002xuh.2	+							NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACTCACTGTCTTTTTTTTTTT	0.383													4	2	---	---	---	---	
FAM65C	140876	broad.mit.edu	37	20	49239187	49239188	+	Intron	INS	-	AC	AC	rs151053134	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49239187_49239188insAC	uc002xvm.2	-						FAM65C_uc010zyt.1_Intron|FAM65C_uc010zyu.1_Intron|FAM65C_uc002xvn.1_Intron	NM_080829	NP_543019	Q96MK2	FA65C_HUMAN	hypothetical protein LOC140876											ovary(2)	2						cagacctcccaACACACACACA	0.337													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	53308907	53308907	+	IGR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53308907delT								DOK5 (41198 upstream) : None (None downstream)																							ATCCAAAGTCTTTTTTTTTTC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54527710	54527711	+	IGR	INS	-	A	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54527710_54527711insA								None (None upstream) : CBLN4 (44786 downstream)																							AGAGAAGCCTCAAAAAAAAAGA	0.332													4	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11064287	11064288	+	Intron	INS	-	A	A	rs148820757		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11064287_11064288insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GCTTCCACAGCAATCTTTCTAA	0.327													11	11	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11078175	11078175	+	Intron	DEL	G	-	-	rs148013007		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11078175delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccagatactcggggggctgag	0.000													9	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11093134	11093135	+	Intron	INS	-	C	C	rs141935972		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11093134_11093135insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTTCTCCCCTACCCCCCACAAC	0.401													23	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11113133	11113133	+	IGR	DEL	G	-	-	rs138890779		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11113133delG								BAGE (14196 upstream) : None (None downstream)																							aggaggtggaggttgcagtga	0.035													4	3	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32630465	32630466	+	Intron	DEL	CA	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32630465_32630466delCA	uc002yow.1	-						TIAM1_uc011adk.1_Intron|TIAM1_uc011adl.1_Intron|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						TGTTTTCTGCCACACACACACC	0.525													4	2	---	---	---	---	
HUNK	30811	broad.mit.edu	37	21	33362735	33362735	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33362735delT	uc002yph.2	+							NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase						multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						gacctcattcttttttttttt	0.000													5	3	---	---	---	---	
FAM165B	54065	broad.mit.edu	37	21	35758921	35758921	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35758921delA	uc002ytu.3	+						FAM165B_uc002ytv.2_Intron|FAM165B_uc002ytw.2_Intron	NM_058182	NP_478062	P58511	F165B_HUMAN	chromosome 21 open reading frame 51							integral to membrane					0						aaaaaaaaccaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40335568	40335569	+	IGR	INS	-	C	C	rs140729847	by1000genomes	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40335568_40335569insC								ETS2 (138692 upstream) : PSMG1 (211821 downstream)																							agaagagtaggccccccaactc	0.015													3	3	---	---	---	---	
BACE2	25825	broad.mit.edu	37	21	42647760	42647760	+	3'UTR	DEL	A	-	-	rs35121758		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42647760delA	uc002yyw.2	+	9					BACE2_uc002yyx.2_3'UTR|BACE2_uc002yyy.2_3'UTR|BACE2_uc010goo.2_RNA	NM_012105	NP_036237	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2 isoform A						membrane protein ectodomain proteolysis|negative regulation of amyloid precursor protein biosynthetic process|peptide hormone processing	cell surface|endoplasmic reticulum|endosome|Golgi apparatus|integral to membrane	aspartic-type endopeptidase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				AAAAATAATTAAAAAAAAAAC	0.383													4	2	---	---	---	---	
PKNOX1	5316	broad.mit.edu	37	21	44426611	44426611	+	Intron	DEL	T	-	-	rs77510047		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44426611delT	uc002zcq.1	+						PKNOX1_uc002zcp.1_Intron|PKNOX1_uc011aex.1_Intron|PKNOX1_uc002zcr.2_Intron	NM_004571	NP_004562	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1								sequence-specific DNA binding			large_intestine(2)	2						ATTGCTTTTATTTTTTTTTTT	0.269													3	3	---	---	---	---	
HSF2BP	11077	broad.mit.edu	37	21	45051845	45051845	+	Intron	DEL	C	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45051845delC	uc002zdi.2	-						HSF2BP_uc011aey.1_Intron	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding						spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)		cacacacactccccccccaca	0.134													3	3	---	---	---	---	
ADARB1	104	broad.mit.edu	37	21	46619651	46619651	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46619651delA	uc002zgy.2	+						ADARB1_uc002zgr.2_Intron|ADARB1_uc002zgs.2_Intron|ADARB1_uc002zgw.2_Intron|ADARB1_uc002zgv.2_Intron|ADARB1_uc002zgt.2_Intron|ADARB1_uc010gpx.2_Intron|ADARB1_uc002zgq.2_Intron|ADARB1_uc002zgu.2_Intron	NM_015833	NP_056648	P78563	RED1_HUMAN	RNA-specific adenosine deaminase B1 isoform 2						adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding			skin(1)	1				Colorectal(79;0.115)		acatatttggaaaagaaaagc	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20267700	20267700	+	IGR	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20267700delA								RTN4R (11884 upstream) : DGCR6L (34102 downstream)																							AAGGTCCCGTAAAAGCGCATC	0.552													4	2	---	---	---	---	
PI4KA	5297	broad.mit.edu	37	22	21099206	21099206	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21099206delA	uc002zsz.3	-							NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ATAAGAAATTAAAAAAAAAAG	0.353													7	5	---	---	---	---	
GNAZ	2781	broad.mit.edu	37	22	23418395	23418395	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23418395delT	uc002zwu.1	+						RTDR1_uc002zwt.2_Intron	NM_002073	NP_002064	P19086	GNAZ_HUMAN	guanine nucleotide binding protein, alpha z							endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity			kidney(1)|skin(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		cctgctgctatttttttcccc	0.159													4	2	---	---	---	---	
ADRBK2	157	broad.mit.edu	37	22	26119932	26119932	+	3'UTR	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26119932delT	uc003abx.3	+	21					ADRBK2_uc003aby.3_RNA	NM_005160	NP_005151	P35626	ARBK2_HUMAN	beta-adrenergic receptor kinase 2								ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)	AAAATGTGGGTTTTTTTTTTT	0.308													4	3	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26402277	26402277	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26402277delT	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron|MYO18B_uc010gva.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ATTCCAATTCTTTTTTTTTTT	0.373													8	6	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26649358	26649358	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26649358delT	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						ATTTAGTTGGTTTTTTTGACT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29803069	29803074	+	IGR	DEL	TGTGTG	-	-	rs139464844		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29803069_29803074delTGTGTG								AP1B1 (18500 upstream) : RFPL1S (29932 downstream)																							GTTGTTCTTTtgtgtgtgtgtgtgtg	0.131													12	7	---	---	---	---	
DEPDC5	9681	broad.mit.edu	37	22	32211692	32211692	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32211692delT	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alr.1_3'UTR|DEPDC5_uc011alt.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						gattatcatatttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39961736	39961736	+	IGR	DEL	G	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39961736delG								RPS19BP1 (32876 upstream) : CACNA1I (5022 downstream)																							tgttggtgatggtgatggtga	0.000													4	2	---	---	---	---	
TRMU	55687	broad.mit.edu	37	22	46735835	46735836	+	Intron	INS	-	A	A	rs113303726		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46735835_46735836insA	uc003bhp.2	+						TRMU_uc011arb.1_Intron|TRMU_uc003bhq.2_Intron|TRMU_uc003bhs.2_Intron|TRMU_uc003bhr.2_Intron|TRMU_uc003bht.2_Intron|TRMU_uc003bhu.2_Intron|TRMU_uc003bhv.2_Intron	NM_018006	NP_060476	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate							mitochondrion	ATP binding|sulfurtransferase activity|tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity|tRNA binding			ovary(1)	1		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		GGGGACATAAGAAAAAAAAAAG	0.391													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49470189	49470191	+	IGR	DEL	CAC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49470189_49470191delCAC								FAM19A5 (322447 upstream) : C22orf34 (337985 downstream)																							ttatcactgtcaccaccaccatc	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	505947	505948	+	IGR	DEL	AC	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:505947_505948delAC								PPP2R3B (158320 upstream) : SHOX (79131 downstream)																							CCCAAAGGGTACACACCCTGCT	0.500													8	5	---	---	---	---	
SMS	6611	broad.mit.edu	37	X	21997306	21997307	+	Intron	INS	-	T	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21997306_21997307insT	uc004dag.2	+						SMS_uc010nfs.2_Intron|SMS_uc010nft.2_Intron	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase						methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	AAAATTAATtcttttttttttt	0.158													7	6	---	---	---	---	
TAF1	6872	broad.mit.edu	37	X	70639873	70639873	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70639873delT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				tttttaattcttttttttttt	0.234													8	5	---	---	---	---	
WDR44	54521	broad.mit.edu	37	X	117529532	117529532	+	Intron	DEL	A	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117529532delA	uc004eqn.2	+						WDR44_uc004eqo.2_Intron|WDR44_uc011mtr.1_Intron|WDR44_uc010nqi.2_Intron	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN	WD repeat domain 44 protein							cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						TGTTACACACAAAAAAAAATA	0.194													4	2	---	---	---	---	
ODZ1	10178	broad.mit.edu	37	X	123663987	123663987	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123663987delT	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TGGGGAGGAGTTTTTTTTTTT	0.184													10	5	---	---	---	---	
ENOX2	10495	broad.mit.edu	37	X	129765780	129765780	+	Intron	DEL	T	-	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129765780delT	uc004evw.2	-						ENOX2_uc004evx.2_Intron|ENOX2_uc004evy.2_Intron|ENOX2_uc004evv.2_Intron	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b						cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						CCTTCACCAGTTTTTTTTTTT	0.254													5	3	---	---	---	---	
FAM122C	159091	broad.mit.edu	37	X	133963452	133963452	+	Intron	DEL	A	-	-	rs72454255		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133963452delA	uc004exz.1	+						FAM122C_uc011mvq.1_Intron|FAM122C_uc004exy.1_Intron	NM_138819	NP_620174	Q6P4D5	F222C_HUMAN	hypothetical protein LOC159091												0	Acute lymphoblastic leukemia(192;0.000127)					TGATTTCTTCAAAAAAAAAAC	0.239													18	8	---	---	---	---	
