Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
Unknown	0	broad.mit.edu	37	1	13281	13281	+	RNA	SNP	C	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13281C>G	uc001aaa.3	+	3		c.524C>G			uc010nxq.1_Intron|uc010nxr.1_RNA					Homo sapiens mRNA for DEAD/H box polypeptide 11 like 1 (DDX11L1 gene).																		CAGTGATACACCCGGCACCCT	0.572													2	6	---	---	---	---	PASS
STIL	6491	broad.mit.edu	37	1	47725984	47725984	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47725984A>C	uc001crc.1	-	16	3209	c.3054T>G	c.(3052-3054)AAT>AAG	p.N1018K	TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Missense_Mutation_p.N972K|STIL_uc010omo.1_Missense_Mutation_p.N1001K|STIL_uc001crd.1_Missense_Mutation_p.N1019K|STIL_uc001cre.1_Missense_Mutation_p.N1018K|STIL_uc001crf.1_Missense_Mutation_p.N631K|STIL_uc001crg.1_Missense_Mutation_p.N954K	NM_003035	NP_003026	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus isoform 2	1018					cell proliferation|multicellular organismal development	centrosome|cytosol				lung(2)|skin(1)	3		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				CGTTATGTGCATTTTTCTTCA	0.299													30	116	---	---	---	---	PASS
LRRC42	115353	broad.mit.edu	37	1	54433413	54433413	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54433413T>A	uc001cwj.1	+	8	1288	c.1088T>A	c.(1087-1089)CTC>CAC	p.L363H	LRRC42_uc001cwl.1_Missense_Mutation_p.L363H|LRRC42_uc001cwk.1_Missense_Mutation_p.L363H|LRRC42_uc009vzm.1_Missense_Mutation_p.L359H	NM_052940	NP_443172	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	363											0						TCCGAGAAACTCCAGTTCTAT	0.507													15	53	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067930	190067930	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067930G>A	uc001gse.1	-	8	1751	c.1519C>T	c.(1519-1521)CGA>TGA	p.R507*	FAM5C_uc010pot.1_Nonsense_Mutation_p.R405*	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	507						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					ACTTCTATTCGTCTGTCCGTT	0.483													35	170	---	---	---	---	PASS
RGS18	64407	broad.mit.edu	37	1	192150572	192150572	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192150572C>G	uc001gsg.2	+	4	610	c.434C>G	c.(433-435)ACT>AGT	p.T145S		NM_130782	NP_570138	Q9NS28	RGS18_HUMAN	regulator of G-protein signalling 18	145	RGS.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)	3						TTTATACAGACTGATGCCCCA	0.254													12	75	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222696146	222696146	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222696146G>A	uc001hnh.1	-	9	2030	c.1972C>T	c.(1972-1974)CAG>TAG	p.Q658*		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	658					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		GACAAACCCTGGGCTGGGCCA	0.478													6	278	---	---	---	---	PASS
PTPN4	5775	broad.mit.edu	37	2	120720267	120720267	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120720267G>T	uc002tmf.1	+	24	3127	c.2356G>T	c.(2356-2358)GAA>TAA	p.E786*	PTPN4_uc010flj.1_Nonsense_Mutation_p.E499*|PTPN4_uc010yyr.1_Nonsense_Mutation_p.E419*	NM_002830	NP_002821	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type	786	Tyrosine-protein phosphatase.					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)	CTGCCACTCTGAAGAAGGAAA	0.388													18	65	---	---	---	---	PASS
IWS1	55677	broad.mit.edu	37	2	128262532	128262532	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128262532T>A	uc002ton.2	-	3	1250	c.947A>T	c.(946-948)GAA>GTA	p.E316V	IWS1_uc010yzl.1_RNA|uc002too.1_5'Flank|IWS1_uc010fma.2_RNA	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	316	Glu-rich.				transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		ATCCTCAGTTTCTGAGTCACT	0.527													53	184	---	---	---	---	PASS
IWS1	55677	broad.mit.edu	37	2	128262533	128262533	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128262533C>A	uc002ton.2	-	3	1249	c.946G>T	c.(946-948)GAA>TAA	p.E316*	IWS1_uc010yzl.1_RNA|uc002too.1_5'Flank|IWS1_uc010fma.2_RNA	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	316	Glu-rich.				transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TCCTCAGTTTCTGAGTCACTG	0.522													54	181	---	---	---	---	PASS
GAD1	2571	broad.mit.edu	37	2	171686107	171686107	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171686107C>T	uc002ugi.2	+	4	690	c.268C>T	c.(268-270)CGC>TGC	p.R90C	GAD1_uc002ugh.2_Missense_Mutation_p.R90C	NM_000817	NP_000808	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 isoform GAD67	90					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	CCGCTTCCGGCGCACAGAGAC	0.532													6	100	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604751	179604751	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604751C>G	uc010zfh.1	-	46	12920	c.12696G>C	c.(12694-12696)TTG>TTC	p.L4232F	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.L4165F|TTN_uc010zfj.1_Missense_Mutation_p.L4040F|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	4160							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGCTGCTTGCAAAGCCCGGC	0.488													8	88	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209214807	209214807	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209214807C>A	uc002vcz.2	+	36	5592	c.5434C>A	c.(5434-5436)CAA>AAA	p.Q1812K		NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	1812	PIPK.				cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TGTGGAACTTCGTAAGTATGA	0.348													3	98	---	---	---	---	PASS
TUBA4A	7277	broad.mit.edu	37	2	220115231	220115231	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220115231A>C	uc002vkt.1	-	4	1248	c.1190T>G	c.(1189-1191)CTG>CGG	p.L397R	TUBA4A_uc010zkz.1_Missense_Mutation_p.L382R|TUBA4B_uc002vku.2_5'Flank|TUBA4B_uc002vkv.1_5'Flank	NM_006000	NP_005991	P68366	TBA4A_HUMAN	tubulin, alpha 4a	397					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|platelet activation|platelet degranulation|protein polymerization	cytosol|extracellular region|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)	3		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCATACATCAGGTCGAACTT	0.637													27	100	---	---	---	---	PASS
TRAF3IP1	26146	broad.mit.edu	37	2	239233980	239233980	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239233980T>C	uc002vye.2	+	2	276	c.157T>C	c.(157-159)TAC>CAC	p.Y53H	TRAF3IP1_uc002vyf.2_Missense_Mutation_p.Y53H	NM_015650	NP_056465	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting	53	Abolishes microtubules-binding when missing.					cytoplasm|cytoskeleton	protein binding			ovary(1)	1		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		GAAGGGCCTCTACACAGACGC	0.493													22	75	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52696148	52696148	+	Splice_Site	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52696148C>A	uc003des.2	-	4	540	c.528_splice	c.e4+1	p.G176_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.G176_splice|PBRM1_uc003der.2_Splice_Site_p.G176_splice|PBRM1_uc003det.2_Splice_Site_p.G176_splice|PBRM1_uc003deu.2_Splice_Site_p.G176_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.G176_splice|PBRM1_uc010hmk.1_Splice_Site_p.G176_splice|PBRM1_uc003dey.2_Splice_Site_p.G176_splice|PBRM1_uc003dez.1_Splice_Site_p.G176_splice|PBRM1_uc003dfb.1_Splice_Site_p.G74_splice	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TACACACTTACTCCTTCAGTC	0.488			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								88	186	---	---	---	---	PASS
CRYGS	1427	broad.mit.edu	37	3	186256604	186256604	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186256604A>T	uc003fqe.2	-	3	470	c.418T>A	c.(418-420)TAT>AAT	p.Y140N	CRYGS_uc003fqf.2_Missense_Mutation_p.Y140N	NM_017541	NP_060011	P22914	CRBS_HUMAN	crystallin, gamma S	140	Beta/gamma crystallin 'Greek key' 4.						structural constituent of eye lens				0	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.5e-22)	GBM - Glioblastoma multiforme(93;0.0906)		GGTAGCTCATAGAAAATCCAG	0.527													23	40	---	---	---	---	PASS
NFXL1	152518	broad.mit.edu	37	4	47880552	47880552	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47880552C>A	uc010igh.2	-	17	2246	c.2069G>T	c.(2068-2070)GGA>GTA	p.G690V	NFXL1_uc003gxo.2_Missense_Mutation_p.G15V|NFXL1_uc003gxp.2_Missense_Mutation_p.G690V|NFXL1_uc003gxq.3_RNA|NFXL1_uc010igi.2_Missense_Mutation_p.G690V	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like	690	NF-X1-type 8.					integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CTTGTTTTTTCCAGTGCAGCC	0.338													91	284	---	---	---	---	PASS
UBA6	55236	broad.mit.edu	37	4	68547886	68547886	+	Silent	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68547886G>A	uc003hdg.3	-	3	232	c.180C>T	c.(178-180)GCC>GCT	p.A60A	UBA6_uc003hdi.2_Silent_p.A60A|UBA6_uc003hdj.2_Silent_p.A60A	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2	60					protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						CATGGGACTTGGCCATCTTCT	0.348													20	56	---	---	---	---	PASS
ARHGAP10	79658	broad.mit.edu	37	4	148861022	148861022	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148861022G>C	uc003ilf.2	+	14	1275	c.1275G>C	c.(1273-1275)AAG>AAC	p.K425N	ARHGAP10_uc003ilg.2_Missense_Mutation_p.K74N	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10	425	Rho-GAP.				apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TGAGTTCAAAGGTCCAGAGAC	0.348													55	196	---	---	---	---	PASS
MED10	84246	broad.mit.edu	37	5	6372588	6372588	+	3'UTR	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6372588G>A	uc003jdo.2	-	4						NM_032286	NP_115662	Q9BTT4	MED10_HUMAN	mediator complex subunit 10						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(1)	1						CAGTCCCAGGGGATCTTCACA	0.602													11	51	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101709092	101709092	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101709092A>C	uc003knn.2	-	13	2296	c.2124T>G	c.(2122-2124)AAT>AAG	p.N708K	SLCO6A1_uc003kno.2_Missense_Mutation_p.N455K|SLCO6A1_uc003knp.2_Missense_Mutation_p.N708K|SLCO6A1_uc003knq.2_Missense_Mutation_p.N646K	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	708	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TAACTTTTGGATTCTTCACAG	0.299													5	219	---	---	---	---	PASS
GFPT2	9945	broad.mit.edu	37	5	179745930	179745930	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179745930A>G	uc003mlw.1	-	10	919	c.821T>C	c.(820-822)GTC>GCC	p.V274A		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	274	Glutamine amidotransferase type-2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	CAGGAAGATGACCCGGTTGGT	0.597													3	57	---	---	---	---	PASS
HIST1H2AH	85235	broad.mit.edu	37	6	27115055	27115055	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27115055G>A	uc003niz.2	+	1	148	c.148G>A	c.(148-150)GTG>ATG	p.V50M	HIST1H2BK_uc003nix.1_5'Flank|hsa-mir-3143|MI0014167_5'Flank	NM_080596	NP_542163	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	50					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CGGCGCGCCAGTGTACCTGGC	0.657													7	41	---	---	---	---	PASS
HLA-DOA	3111	broad.mit.edu	37	6	32974563	32974563	+	3'UTR	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32974563C>A	uc003ocr.2	-	5					HLA-DOA_uc010juj.2_Missense_Mutation_p.W193C	NM_002119	NP_002110	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						TGTCACAAACCCATGAGGATC	0.478													7	52	---	---	---	---	PASS
SYNGAP1	8831	broad.mit.edu	37	6	33411625	33411625	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33411625A>G	uc011dri.1	+	15	3491	c.3296A>G	c.(3295-3297)TAT>TGT	p.Y1099C	SYNGAP1_uc010juy.2_Missense_Mutation_p.Y1070C|SYNGAP1_uc010juz.2_Missense_Mutation_p.Y811C	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1099					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						GAGCCAAGTTATGGCCCCGCC	0.667													6	28	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56500387	56500387	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56500387C>A	uc003pdf.2	-	23	3115	c.3087G>T	c.(3085-3087)ATG>ATT	p.M1029I	DST_uc003pcz.3_Missense_Mutation_p.M851I|DST_uc011dxj.1_Missense_Mutation_p.M880I|DST_uc011dxk.1_Missense_Mutation_p.M891I|DST_uc003pcy.3_Missense_Mutation_p.M525I|DST_uc003pdb.2_Missense_Mutation_p.M525I|DST_uc003pdc.3_Missense_Mutation_p.M525I|DST_uc003pdd.3_Missense_Mutation_p.M525I	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	851					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTATTAGTACCATTGATTCCT	0.338													13	77	---	---	---	---	PASS
FHL5	9457	broad.mit.edu	37	6	97063550	97063550	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97063550G>A	uc003pos.1	+	7	1162	c.757G>A	c.(757-759)GGG>AGG	p.G253R	FHL5_uc003pot.1_Missense_Mutation_p.G253R	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator	253	LIM zinc-binding 4.					nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		CTTTAACTGCGGGAAATGCTC	0.443													18	70	---	---	---	---	PASS
WTAP	9589	broad.mit.edu	37	6	160174528	160174528	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160174528G>A	uc003qsl.2	+	7	711	c.489G>A	c.(487-489)ATG>ATA	p.M163I	WTAP_uc003qso.2_Missense_Mutation_p.M44I	NM_004906	NP_004897	Q15007	FL2D_HUMAN	Wilms' tumour 1-associating protein isoform 1	163					cell cycle|mRNA processing|RNA splicing	nuclear membrane|nucleolus					0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		AGTGTCGAATGCTTATCCAGG	0.438													15	62	---	---	---	---	PASS
AMPH	273	broad.mit.edu	37	7	38429478	38429478	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38429478G>A	uc003tgu.2	-	20	1976	c.1907C>T	c.(1906-1908)GCA>GTA	p.A636V	AMPH_uc003tgv.2_Missense_Mutation_p.A594V|AMPH_uc003tgt.2_Missense_Mutation_p.A521V	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	636	SH3.				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						ATCAGAATTTGCTGCCTCAAA	0.413													42	158	---	---	---	---	PASS
FZD9	8326	broad.mit.edu	37	7	72850178	72850178	+	3'UTR	SNP	T	C	C	rs1178947	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72850178T>C	uc003tyb.2	+	1						NM_003508	NP_003499	O00144	FZD9_HUMAN	frizzled 9 precursor						B cell differentiation|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|neuroblast proliferation|vasculature development	cell surface|filopodium membrane|integral to membrane|perinuclear region of cytoplasm	G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				GCCCCCTGCATCCCCTAGAGA	0.662													3	88	---	---	---	---	PASS
WBSCR28	135886	broad.mit.edu	37	7	73275509	73275509	+	5'UTR	SNP	G	C	C	rs111714725	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73275509G>C	uc003tzk.2	+	1					RFC2_uc011kfa.1_Intron|WBSCR28_uc003tzl.2_5'UTR	NM_182504	NP_872310	Q6UE05	WBS28_HUMAN	hypothetical protein LOC135886							integral to membrane				breast(1)	1		Lung NSC(55;0.159)				GCTGGAGTAGGTGGGGGAGGC	0.612													3	41	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139165076	139165076	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139165076C>A	uc003yuy.2	-	13	1813	c.1642G>T	c.(1642-1644)GCC>TCC	p.A548S	FAM135B_uc003yux.2_Missense_Mutation_p.A449S|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.A110S|FAM135B_uc003yvb.2_Missense_Mutation_p.A110S	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	548										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGCACTGGGGCCTGTCCATCC	0.507										HNSCC(54;0.14)			27	94	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	304680	304680	+	Silent	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:304680G>A	uc003zgf.2	+	5	616	c.504G>A	c.(502-504)TTG>TTA	p.L168L	DOCK8_uc011lls.1_Silent_p.L168L|DOCK8_uc010mgu.2_5'UTR|DOCK8_uc010mgv.2_Silent_p.L100L|DOCK8_uc010mgt.2_Silent_p.L100L|DOCK8_uc003zgg.2_Silent_p.L100L|DOCK8_uc003zgh.2_RNA	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	168					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CGGAAACCTTGGAGTGCAGTG	0.463													50	148	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78601100	78601100	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78601100A>C	uc004ajz.2	+	3	888	c.350A>C	c.(349-351)GAC>GCC	p.D117A	PCSK5_uc004ajy.2_Missense_Mutation_p.D117A|PCSK5_uc004aka.2_RNA	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	117	Catalytic.				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						AGGGATTATGACTTCAGTCGT	0.468													23	92	---	---	---	---	PASS
AKNA	80709	broad.mit.edu	37	9	117139683	117139683	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117139683T>A	uc004biq.3	-	2	539	c.404A>T	c.(403-405)GAG>GTG	p.E135V	AKNA_uc004bio.3_5'Flank|AKNA_uc004bip.3_Missense_Mutation_p.E54V|AKNA_uc004bir.3_Missense_Mutation_p.E135V|AKNA_uc004bis.3_Missense_Mutation_p.E135V|AKNA_uc010mve.2_Missense_Mutation_p.E16V|AKNA_uc004biu.1_Intron|AKNA_uc004biv.1_Missense_Mutation_p.E135V|AKNA_uc004biw.1_Missense_Mutation_p.E135V	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	135					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						TCCAGCCTCCTCAACCTCCAG	0.612													11	42	---	---	---	---	PASS
ADAMTS13	11093	broad.mit.edu	37	9	136313849	136313849	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136313849G>C	uc004cdv.3	+	22	3305	c.2861G>C	c.(2860-2862)CGG>CCG	p.R954P	ADAMTS13_uc004cdp.3_Missense_Mutation_p.R181P|ADAMTS13_uc004cdt.1_Missense_Mutation_p.R954P|ADAMTS13_uc004cdu.1_Missense_Mutation_p.R923P|ADAMTS13_uc004cdw.3_Missense_Mutation_p.R954P|ADAMTS13_uc004cdx.3_Missense_Mutation_p.R923P|ADAMTS13_uc004cdy.1_RNA|ADAMTS13_uc004cdz.3_Missense_Mutation_p.R624P	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	954	TSP type-1 6.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		TGCCCTGCTCGGTGAGTGAGG	0.677													7	22	---	---	---	---	PASS
HTR7	3363	broad.mit.edu	37	10	92617162	92617162	+	Silent	SNP	C	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92617162C>G	uc001kha.2	-	1	510	c.267G>C	c.(265-267)ACG>ACC	p.T89T	HTR7_uc001kgz.2_Silent_p.T89T|HTR7_uc001khb.2_Silent_p.T89T	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	89	Helical; Name=1; (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	GCGTGATGAGCGTCAGGATGG	0.627													10	49	---	---	---	---	PASS
ABCC2	1244	broad.mit.edu	37	10	101603571	101603571	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101603571A>C	uc001kqf.2	+	27	3896	c.3757A>C	c.(3757-3759)AAC>CAC	p.N1253H		NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),	1253	ABC transmembrane type-1 2.|Helical; Name=17; (By similarity).					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	ACAAACCCTGAACTGGCTGGT	0.413													9	421	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1017568	1017568	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1017568T>C	uc001lsw.2	-	31	5284	c.5233A>G	c.(5233-5235)ACC>GCC	p.T1745A		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1745	Thr-rich.|Approximate repeats.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GATGTAGAGGTTTTGGCCGTG	0.547													18	615	---	---	---	---	PASS
TRPM5	29850	broad.mit.edu	37	11	2426046	2426046	+	3'UTR	SNP	T	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2426046T>C	uc001lwm.3	-	24					TRPM5_uc010qxl.1_3'UTR|TRPM5_uc009ydn.2_3'UTR	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		AGGAGGGCCATTGTCTGCTGG	0.672													2	5	---	---	---	---	PASS
ATG2A	23130	broad.mit.edu	37	11	64676580	64676580	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64676580C>G	uc001obx.2	-	16	2362	c.2247G>C	c.(2245-2247)TGG>TGC	p.W749C		NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	749							protein binding			ovary(1)|central_nervous_system(1)	2						GGGCCACCTCCCACTGTGTGC	0.642													6	51	---	---	---	---	PASS
MRGPRD	116512	broad.mit.edu	37	11	68747868	68747868	+	Silent	SNP	C	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68747868C>G	uc010rqf.1	-	1	588	c.588G>C	c.(586-588)CTG>CTC	p.L196L		NM_198923	NP_944605	Q8TDS7	MRGRD_HUMAN	MAS-related GPR, member D	196	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(1)	1			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TCAGGCTGGACAGAGTCATCA	0.597													6	27	---	---	---	---	PASS
C11orf57	55216	broad.mit.edu	37	11	111951425	111951425	+	Intron	SNP	T	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111951425T>G	uc001pmr.3	+						C11orf57_uc001pmu.2_3'UTR|C11orf57_uc001pmw.3_Intron|C11orf57_uc001pmt.3_Intron|C11orf57_uc001pmv.3_Intron|C11orf57_uc001pms.3_Intron	NM_001082970	NP_001076439	Q6ZUT1	CK057_HUMAN	hypothetical protein LOC55216 isoform b											breast(2)|ovary(1)	3		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		ggccaagtaatccaaatgtct	0.025													4	11	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117332278	117332278	+	Silent	SNP	C	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117332278C>G	uc001prh.1	-	18	3482	c.3480G>C	c.(3478-3480)CTG>CTC	p.L1160L		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1100	Fibronectin type-III 3.|Extracellular (Potential).				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AAGTGATGGACAGGGCCCGGA	0.607													12	49	---	---	---	---	PASS
PRMT8	56341	broad.mit.edu	37	12	3659255	3659255	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3659255G>A	uc001qmf.2	+	3	782	c.415G>A	c.(415-417)GGG>AGG	p.G139R	PRMT8_uc009zed.2_Missense_Mutation_p.G130R|PRMT8_uc009zee.1_RNA	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4	139					regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			GAAGGTGTTTGGGGTGAGCAC	0.562													17	100	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	71029653	71029653	+	Silent	SNP	G	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71029653G>T	uc001swc.3	-	2	293	c.249C>A	c.(247-249)ATC>ATA	p.I83I	PTPRB_uc001swa.3_Silent_p.I83I|PTPRB_uc001swd.3_Silent_p.I82I|PTPRB_uc009zrr.1_Intron|PTPRB_uc001swe.2_Silent_p.I83I	NM_001109754	NP_001103224	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	Error:Variant_position_missing_in_P23467_after_alignment					angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AGCGGTCCAAGATGGCTGAGC	0.547													6	31	---	---	---	---	PASS
ATP2A2	488	broad.mit.edu	37	12	110783864	110783864	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110783864G>C	uc001tqk.3	+	19	3363	c.2800G>C	c.(2800-2802)GGC>CGC	p.G934R	ATP2A2_uc001tql.3_Missense_Mutation_p.G934R|ATP2A2_uc010sxy.1_Missense_Mutation_p.G907R|ATP2A2_uc001tqn.3_Missense_Mutation_p.G11R|ATP2A2_uc009zvn.2_5'Flank	NM_170665	NP_733765	P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, slow twitch 2 isoform	934	Helical; Name=9; (By similarity).				ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding			ovary(3)|skin(1)	4						CTGGCTCGTGGGCTCCATCTG	0.592													32	92	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19432891	19432891	+	RNA	SNP	C	A	A	rs1937748	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19432891C>A	uc010tcj.1	-	1		c.13219G>T				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						AGTAAATACTCTGCAAAACTA	0.353													4	41	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32906553	32906553	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32906553C>A	uc001uub.1	+	10	1165	c.938C>A	c.(937-939)TCT>TAT	p.S313Y	BRCA2_uc001uua.1_Missense_Mutation_p.S190Y	NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	313					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTATGTTTTTCTAAATGTAGA	0.303			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			33	131	---	---	---	---	PASS
C14orf174	161394	broad.mit.edu	37	14	77844922	77844922	+	Silent	SNP	C	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77844922C>T	uc001xtq.1	+	1	1161	c.1161C>T	c.(1159-1161)ATC>ATT	p.I387I	TMED8_uc010ast.1_5'Flank|TMED8_uc001xto.1_5'Flank	NM_001010860	NP_001010860	Q9P1V8	SAM15_HUMAN	hypothetical protein LOC161394	387											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0278)		CACAGGAGATCAACCCACAAG	0.403													20	75	---	---	---	---	PASS
LOC723972	723972	broad.mit.edu	37	15	35529678	35529678	+	RNA	SNP	A	G	G	rs76690441	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35529678A>G	uc001ziy.2	+	1		c.152A>G				NR_003144				Homo sapiens hepatopoietin PCn127 mRNA, complete cds.												0						AGTGCAACCAACGTAGGCCTC	0.463													4	180	---	---	---	---	PASS
SPRED1	161742	broad.mit.edu	37	15	38591664	38591664	+	Silent	SNP	C	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38591664C>T	uc001zka.3	+	2	458	c.123C>T	c.(121-123)AGC>AGT	p.S41S		NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain	41	WH1.				inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GACTAAGCAGCGTCACTGTCT	0.458									Legius_syndrome				5	89	---	---	---	---	PASS
BAHD1	22893	broad.mit.edu	37	15	40751725	40751725	+	Silent	SNP	G	A	A	rs145339527	byFrequency	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40751725G>A	uc001zlu.2	+	2	1133	c.1062G>A	c.(1060-1062)CCG>CCA	p.P354P	BAHD1_uc001zlt.2_Silent_p.P354P|BAHD1_uc010bbp.1_Silent_p.P354P|BAHD1_uc001zlv.2_Silent_p.P354P	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	354	Pro-rich.				heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		AGCTGTCGCCGCTGCCGATGC	0.647													3	51	---	---	---	---	PASS
SHF	90525	broad.mit.edu	37	15	45470431	45470431	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45470431C>A	uc001zuy.2	-	3	872	c.377G>T	c.(376-378)GGA>GTA	p.G126V	SHF_uc010uen.1_5'UTR|SHF_uc010ueo.1_5'UTR|SHF_uc010uep.1_5'UTR|SHF_uc010ueq.1_5'UTR|SHF_uc010uer.1_5'UTR|SHF_uc010ues.1_5'UTR|SHF_uc010uet.1_5'UTR|SHF_uc010ueu.1_5'UTR	NM_138356	NP_612365	Q7M4L6	SHF_HUMAN	Src homology 2 domain containing F	126										ovary(1)	1		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)		CTCTGGGGCTCCTGAAGCTCC	0.567													17	60	---	---	---	---	PASS
CIB2	10518	broad.mit.edu	37	15	78401625	78401625	+	Nonsense_Mutation	SNP	C	A	A	rs11416065		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78401625C>A	uc002bdb.1	-	4	619	c.298G>T	c.(298-300)GAG>TAG	p.E100*	CIB2_uc002bdc.1_Nonsense_Mutation_p.E57*|CIB2_uc010ums.1_Nonsense_Mutation_p.E100*	NM_006383	NP_006374	O75838	CIB2_HUMAN	DNA-dependent protein kinase catalytic	100	EF-hand 1.						calcium ion binding				0						GGAGCCGACTCGCAGAGCACG	0.547													3	67	---	---	---	---	PASS
FES	2242	broad.mit.edu	37	15	91430480	91430480	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91430480A>G	uc002bpv.2	+	5	644	c.548A>G	c.(547-549)CAC>CGC	p.H183R	FES_uc010uqj.1_Missense_Mutation_p.H125R|FES_uc010uqk.1_Missense_Mutation_p.H165R|FES_uc002bpw.2_RNA|FES_uc010bny.2_Missense_Mutation_p.H125R|FES_uc002bpx.2_Missense_Mutation_p.H183R|FES_uc002bpy.2_Missense_Mutation_p.H125R	NM_002005	NP_001996	P07332	FES_HUMAN	feline sarcoma oncogene isoform 1	183	Important for interaction with membranes containing phosphoinositides.				axon guidance|cell proliferation|peptidyl-tyrosine phosphorylation	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TTTGCTCACCACAACCGCTAT	0.617													22	56	---	---	---	---	PASS
GPRC5B	51704	broad.mit.edu	37	16	19883415	19883415	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19883415C>T	uc002dgt.2	-	2	861	c.753G>A	c.(751-753)ATG>ATA	p.M251I	GPRC5B_uc010vav.1_Missense_Mutation_p.M277I	NM_016235	NP_057319	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, family C, group 5,	251	Helical; Name=6; (Potential).									lung(1)|breast(1)|skin(1)	3						GGTACATGGTCATCCAGGCCA	0.607													9	26	---	---	---	---	PASS
IL21R	50615	broad.mit.edu	37	16	27460474	27460474	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27460474G>T	uc002doq.1	+	9	1720	c.1487G>T	c.(1486-1488)GGC>GTC	p.G496V	IL21R_uc002dor.1_Missense_Mutation_p.G496V|IL21R_uc002dos.1_Missense_Mutation_p.G496V|uc002dot.2_RNA	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	496	Cytoplasmic (Potential).				natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						GGCTTTGTGGGCTCTGACTGC	0.667			T	BCL6	NHL								8	43	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161926	90161926	+	3'UTR	SNP	T	C	C	rs8061283	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161926T>C	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		CCCACACCCATCTATGGTGAC	0.527													3	40	---	---	---	---	PASS
TSR1	55720	broad.mit.edu	37	17	2238674	2238674	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2238674C>A	uc002fuj.2	-	4	1393	c.436G>T	c.(436-438)GTG>TTG	p.V146L	SGSM2_uc002fum.3_5'Flank|SGSM2_uc010vqw.1_5'Flank|SGSM2_uc002fun.3_5'Flank	NM_018128	NP_060598	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation	146					ribosome assembly	nucleolus	protein binding			ovary(1)	1						ATGTCTAACACAACGTGCAGA	0.438													15	70	---	---	---	---	PASS
MIS12	79003	broad.mit.edu	37	17	5392574	5392574	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5392574A>C	uc002gcd.2	+	2	721	c.392A>C	c.(391-393)GAA>GCA	p.E131A	MIS12_uc002gce.2_Missense_Mutation_p.E131A	NM_024039	NP_076944	Q9H081	MIS12_HUMAN	MIS12 homolog	131	Potential.				cell division|chromosome segregation|kinetochore assembly|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding				0						TACAAGACTGAATTATGTACT	0.373													42	148	---	---	---	---	PASS
ASB16	92591	broad.mit.edu	37	17	42249679	42249679	+	Silent	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42249679G>A	uc002ifl.1	+	2	651	c.567G>A	c.(565-567)TTG>TTA	p.L189L	ASB16_uc002ifm.1_RNA	NM_080863	NP_543139	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box-containing protein	189	ANK 4.				intracellular signal transduction		protein binding			kidney(2)	2		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCGAGTCCTTGCAGTAGGTGC	0.572													9	40	---	---	---	---	PASS
OSBPL7	114881	broad.mit.edu	37	17	45891939	45891939	+	Silent	SNP	G	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45891939G>C	uc002ilx.1	-	14	1502	c.1299C>G	c.(1297-1299)ACC>ACG	p.T433T	OSBPL7_uc002ilw.1_5'UTR	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN	oxysterol-binding protein-like protein 7	433					lipid transport		lipid binding				0						CAGACAGGCTGGTGGTGATTT	0.657													6	31	---	---	---	---	PASS
CLTC	1213	broad.mit.edu	37	17	57761038	57761038	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57761038A>T	uc002ixq.1	+	27	4687	c.4244A>T	c.(4243-4245)AAG>ATG	p.K1415M	CLTC_uc002ixp.2_Missense_Mutation_p.K1415M|CLTC_uc002ixr.1_Missense_Mutation_p.K1419M	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	1415	Heavy chain arm.|Proximal segment.|Involved in binding clathrin light chain (By similarity).				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTAGAATTCAAGCCTCTGTTG	0.378			T	ALK|TFE3	ALCL|renal 								4	118	---	---	---	---	PASS
RAB40B	10966	broad.mit.edu	37	17	80622419	80622419	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80622419C>A	uc002kft.2	-	2	282	c.156G>T	c.(154-156)AAG>AAT	p.K52N	RAB40B_uc002kfs.2_RNA	NM_006822	NP_006813	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	52					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			central_nervous_system(1)	1	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			TGGTGGTCGTCTTGTAGTCGA	0.617													8	52	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14543161	14543161	+	5'UTR	SNP	C	A	A	rs45446896		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14543161C>A	uc010dln.2	-	1					POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2											skin(3)	3						TTTAACAGCCCGGGGAGGCCG	0.512													8	54	---	---	---	---	PASS
SKA1	220134	broad.mit.edu	37	18	47902242	47902242	+	Silent	SNP	T	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47902242T>C	uc002let.2	+	2	226	c.42T>C	c.(40-42)AAT>AAC	p.N14N	SKA1_uc002leu.2_Silent_p.N14N|SKA1_uc010xdl.1_Silent_p.N14N	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN	spindle and KT associated 1	14					cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						CTCATGTTAATGAAAAGATTG	0.313													5	152	---	---	---	---	PASS
MRO	83876	broad.mit.edu	37	18	48335764	48335764	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48335764G>T	uc002lew.3	-	3	301	c.7C>A	c.(7-9)CAA>AAA	p.Q3K	MRO_uc010xdn.1_Missense_Mutation_p.Q3K|MRO_uc010dpa.2_Intron|MRO_uc010dpb.2_Intron|MRO_uc010dpc.2_Missense_Mutation_p.Q3K|MRO_uc002lex.3_Missense_Mutation_p.Q3K	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a	3						nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		CTCTGTCTTTGGTCCATGGAA	0.433													25	93	---	---	---	---	PASS
LMAN1	3998	broad.mit.edu	37	18	57013225	57013225	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57013225T>C	uc002lhz.2	-	8	913	c.881A>G	c.(880-882)GAG>GGG	p.E294G		NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor	294	Lumenal (Potential).				blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TTGAAAGTGCTCAAATTCCTC	0.398													51	135	---	---	---	---	PASS
COPE	11316	broad.mit.edu	37	19	19014155	19014155	+	Silent	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19014155G>A	uc002nkk.2	-	7	699	c.657C>T	c.(655-657)CTC>CTT	p.L219L	COPE_uc002nkl.2_Silent_p.L168L|COPE_uc002nkm.2_Intron|COPE_uc002nkn.2_Silent_p.L242L	NM_007263	NP_009194	O14579	COPE_HUMAN	epsilon subunit of coatomer protein complex	219					COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	binding|structural molecule activity				0						CCTGCCCATTGAGCAGCAGCA	0.647													8	32	---	---	---	---	PASS
ZNF146	7705	broad.mit.edu	37	19	36728127	36728127	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36728127A>T	uc002odq.3	+	4	2308	c.785A>T	c.(784-786)CAC>CTC	p.H262L	ZNF146_uc010eet.2_Missense_Mutation_p.H262L|ZNF146_uc010eeu.2_Missense_Mutation_p.H262L	NM_007145	NP_009076	Q15072	OZF_HUMAN	zinc finger protein 146	262	Interaction with TERF2IP.|C2H2-type 9.				regulation of transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|heparin binding|zinc ion binding				0	Esophageal squamous(110;0.162)					TTGAGAATACACACAGGTAAG	0.443													5	123	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38632053	38632053	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38632053T>C	uc002ohk.2	+	11	3882	c.3373T>C	c.(3373-3375)TCC>CCC	p.S1125P		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	1125					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CTTCCGGGAGTCCCAGCCACT	0.657													5	49	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43415010	43415010	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43415010G>A	uc002ovj.1	-	3	480	c.428C>T	c.(427-429)TCG>TTG	p.S143L	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Missense_Mutation_p.P150L|PSG6_uc002ovi.2_Missense_Mutation_p.P144L|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_5'UTR|PSG6_uc002ovf.1_Missense_Mutation_p.S143L|PSG6_uc002ovg.1_Missense_Mutation_p.S143L	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	143	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				GGGAGTCTCCGCTGTGCAGAA	0.527													40	178	---	---	---	---	PASS
DNMT3B	1789	broad.mit.edu	37	20	31389219	31389219	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31389219C>A	uc002wyc.2	+	19	2453	c.2132C>A	c.(2131-2133)TCA>TAA	p.S711*	DNMT3B_uc002wyd.2_Nonsense_Mutation_p.S691*|DNMT3B_uc002wye.2_Nonsense_Mutation_p.S691*|DNMT3B_uc010gee.2_RNA|DNMT3B_uc010gef.2_RNA|DNMT3B_uc010ztz.1_Nonsense_Mutation_p.S649*|DNMT3B_uc010zua.1_Nonsense_Mutation_p.S615*|DNMT3B_uc002wyf.2_Nonsense_Mutation_p.S703*|DNMT3B_uc002wyg.2_Nonsense_Mutation_p.S410*|DNMT3B_uc010geg.2_Nonsense_Mutation_p.S10*|DNMT3B_uc010geh.2_RNA	NM_006892	NP_008823	Q9UBC3	DNM3B_HUMAN	DNA cytosine-5 methyltransferase 3 beta isoform	711					negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5						AGGGACATCTCACGGTTCCTG	0.552													3	54	---	---	---	---	PASS
EDEM2	55741	broad.mit.edu	37	20	33703674	33703674	+	Silent	SNP	A	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33703674A>C	uc002xbo.2	-	11	1399	c.1299T>G	c.(1297-1299)ACT>ACG	p.T433T	EDEM2_uc010zus.1_Silent_p.T212T|EDEM2_uc002xbq.2_Silent_p.T396T|EDEM2_uc010zut.1_Silent_p.T392T|EDEM2_uc002xbp.2_Silent_p.T281T|EDEM2_uc002xbn.2_Silent_p.T281T|EDEM2_uc002xbr.2_RNA|EDEM2_uc010zuu.1_Silent_p.T157T	NM_018217	NP_060687	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like	433					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GGTATTTCACAGTCTCGGCCA	0.537													6	38	---	---	---	---	PASS
KIAA1755	85449	broad.mit.edu	37	20	36869596	36869596	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36869596C>A	uc002xhy.1	-	3	1209	c.937G>T	c.(937-939)GAA>TAA	p.E313*	KIAA1755_uc002xhz.1_Nonsense_Mutation_p.E313*	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN	hypothetical protein LOC85449	313										ovary(4)|pancreas(1)	5		Myeloproliferative disorder(115;0.00874)				AAGGGAGTTTCCTTAGTTCCA	0.517													81	231	---	---	---	---	PASS
PLTP	5360	broad.mit.edu	37	20	44534935	44534935	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44534935G>A	uc002xqn.1	-	8	757	c.677C>T	c.(676-678)TCC>TTC	p.S226F	PLTP_uc002xql.1_Missense_Mutation_p.S138F|PLTP_uc002xqm.1_Missense_Mutation_p.S246F|PLTP_uc002xqo.1_Missense_Mutation_p.S174F|PLTP_uc002xqp.1_Missense_Mutation_p.S226F|PLTP_uc002xqq.1_Missense_Mutation_p.S195F|PLTP_uc010zxj.1_Missense_Mutation_p.S131F|PLTP_uc010ghj.1_Missense_Mutation_p.S226F	NM_006227	NP_006218	P55058	PLTP_HUMAN	phospholipid transfer protein isoform a	226					cellular lipid metabolic process|lipid transport	extracellular region	lipid binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				GTTGCTGGTGGAAGCCACAGG	0.453													4	31	---	---	---	---	PASS
RCAN1	1827	broad.mit.edu	37	21	35890360	35890360	+	3'UTR	SNP	T	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35890360T>C	uc002yue.2	-	4					RCAN1_uc002yuc.2_3'UTR|RCAN1_uc002yud.2_3'UTR|RCAN1_uc002yub.2_3'UTR	NM_004414	NP_004405	P53805	RCAN1_HUMAN	calcipressin 1 isoform a						blood circulation|calcium-mediated signaling|central nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						TGATTTGGAATGCGTCCTCGT	0.542													10	170	---	---	---	---	PASS
TFF2	7032	broad.mit.edu	37	21	43766560	43766560	+	3'UTR	SNP	G	A	A	rs225334	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43766560G>A	uc002zaw.2	-	4						NM_005423	NP_005414	Q03403	TFF2_HUMAN	trefoil factor 2 precursor						digestion	extracellular region				pancreas(1)	1						ATTTCATGAAGTATGAAGCTG	0.373													3	72	---	---	---	---	PASS
CECR1	51816	broad.mit.edu	37	22	17672628	17672628	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17672628A>C	uc002zmk.1	-	4	1038	c.826T>G	c.(826-828)TTT>GTT	p.F276V	CECR1_uc010gqu.1_Missense_Mutation_p.F276V|CECR1_uc011agi.1_Missense_Mutation_p.F234V|CECR1_uc011agj.1_Missense_Mutation_p.F234V|CECR1_uc002zmj.1_Missense_Mutation_p.F35V	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1	276					adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				GTTTCCACAAACTTCTGAGCT	0.473													49	203	---	---	---	---	PASS
EWSR1	2130	broad.mit.edu	37	22	29686417	29686417	+	Intron	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29686417C>A	uc003aet.2	+						EWSR1_uc003aes.3_Missense_Mutation_p.S330R|EWSR1_uc003aev.2_Intron|EWSR1_uc003aew.2_Intron|EWSR1_uc003aex.2_Intron|EWSR1_uc003aey.2_Intron|EWSR1_uc003aez.2_5'UTR	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						AAAGTGAGAGCCTTGTATACA	0.388			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								6	25	---	---	---	---	PASS
BRD1	23774	broad.mit.edu	37	22	50191673	50191673	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50191673C>G	uc003biv.2	-	5	2365	c.1878G>C	c.(1876-1878)GAG>GAC	p.E626D	BRD1_uc011arf.1_Missense_Mutation_p.E221D|BRD1_uc011arg.1_Missense_Mutation_p.E675D|BRD1_uc011arh.1_Missense_Mutation_p.E626D|BRD1_uc003biu.3_Missense_Mutation_p.E626D	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	626	Bromo.				histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CCTCCTCAAACTCATGGAGGT	0.438													40	134	---	---	---	---	PASS
G6PD	2539	broad.mit.edu	37	X	153762612	153762612	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153762612C>A	uc004fly.1	-	6	698	c.585G>T	c.(583-585)CAG>CAT	p.Q195H	G6PD_uc004flx.1_Missense_Mutation_p.Q225H	NM_001042351	NP_001035810	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase isoform b	195					cellular response to oxidative stress|cholesterol biosynthetic process|cytokine production|erythrocyte maturation|glucose 6-phosphate metabolic process|glutathione metabolic process|negative regulation of protein glutathionylation|pentose-phosphate shunt, oxidative branch|ribose phosphate biosynthetic process	centrosome|cytosol|internal side of plasma membrane|intracellular membrane-bounded organelle	glucose binding|glucose-6-phosphate dehydrogenase activity|NADP binding|protein homodimerization activity			ovary(4)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGCGGTAGATCTGGTCCTCAC	0.637													21	23	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	13354395	13354396	+	IGR	INS	-	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13354395_13354396insT								PRAMEF3 (22724 upstream) : PRAMEF9 (66780 downstream)																							GACACAGGTGCttttttttttt	0.257													4	3	---	---	---	---	
MDS2	259283	broad.mit.edu	37	1	23908221	23908221	+	Intron	DEL	C	-	-	rs10634856		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23908221delC	uc001bhi.3	+											Homo sapiens MDS2 gene.											ovary(2)	2						AGGCTCAAttctttttttttt	0.119			T	ETV6	MDS								9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34789507	34789508	+	IGR	INS	-	T	T	rs71029034		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34789507_34789508insT								C1orf94 (104778 upstream) : MIR552 (345692 downstream)																							tccttccttcctccttccttcc	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38135427	38135430	+	IGR	DEL	CCTT	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38135427_38135430delCCTT								RSPO1 (34936 upstream) : C1orf109 (11820 downstream)																							CACCTCAAACccttccttccttcc	0.044													3	4	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12607546	12607549	+	Intron	DEL	CTAT	-	-	rs7568368		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12607546_12607549delCTAT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		tccttccttcctatcttccttcct	0.093													4	4	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	88091375	88091375	+	Intron	DEL	G	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88091375delG	uc010fhc.1	-						RGPD1_uc002ssm.1_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						aaaaaaaaaaGACCAAAATGT	0.234													4	4	---	---	---	---	
ZC3H15	55854	broad.mit.edu	37	2	187369038	187369038	+	Intron	DEL	A	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187369038delA	uc002upo.2	+							NM_018471	NP_060941	Q8WU90	ZC3HF_HUMAN	erythropoietin 4 immediate early response							cytoplasm|nucleolus|plasma membrane	nucleic acid binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			TTATGAAAGGAAAAAAAAAAT	0.318													6	5	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10088533	10088536	+	Intron	DEL	AATC	-	-	rs148201951		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10088533_10088536delAATC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		tttttgcattaatcattttaattg	0.005			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39505927	39505928	+	Intron	INS	-	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39505927_39505928insA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	gactccatctcaaaaaaaaaaa	0.139													8	4	---	---	---	---	
RHOH	399	broad.mit.edu	37	4	40196999	40196999	+	5'Flank	DEL	T	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40196999delT	uc003guz.2	+							NM_004310	NP_004301	Q15669	RHOH_HUMAN	ras homolog gene family, member H precursor						negative regulation of I-kappaB kinase/NF-kappaB cascade|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|T cell differentiation	cytosol|mitochondrion|plasma membrane	GTP binding|GTPase inhibitor activity|kinase inhibitor activity|Rho GTPase binding			ovary(1)|lung(1)	2						ccttccttccttccttccttc	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	76010090	76010091	+	IGR	INS	-	GAAG	GAAG	rs34335133		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76010090_76010091insGAAG								PARM1 (34767 upstream) : RCHY1 (394264 downstream)																							AAGACGAAGAAgaaggaaggaa	0.208													5	3	---	---	---	---	
FAM134B	54463	broad.mit.edu	37	5	16572323	16572323	+	Intron	DEL	T	-	-	rs68191869		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16572323delT	uc003jfs.2	-							NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						ATGATTTCACttttttttttt	0.144													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44688547	44688548	+	IGR	INS	-	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44688547_44688548insA								FGF10 (299763 upstream) : MRPS30 (120479 downstream)																							ggaaaggaaggaaggaaggaag	0.000													3	3	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	66215805	66215806	+	Intron	DEL	TT	-	-	rs73765897		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66215805_66215806delTT	uc003jut.1	+						MAST4_uc003jur.3_Intron|MAST4_uc010iwz.2_Intron|MAST4_uc003jus.2_Intron	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		tccttccttctttctctctctc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	109481420	109481420	+	IGR	DEL	T	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109481420delT								MAN2A1 (277991 upstream) : TMEM232 (143514 downstream)																							tttcctttcctttccttcctt	0.015													4	3	---	---	---	---	
FGF18	8817	broad.mit.edu	37	5	170876405	170876410	+	Intron	DEL	GAGAGA	-	-	rs56932885	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170876405_170876410delGAGAGA	uc003mbk.2	+							NM_003862	NP_003853	O76093	FGF18_HUMAN	fibroblast growth factor 18 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			gtgtgtgtgtgagagagagagagaga	0.325													4	2	---	---	---	---	
UNC5A	90249	broad.mit.edu	37	5	176285783	176285784	+	Intron	INS	-	GCAG	GCAG	rs55688831	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176285783_176285784insGCAG	uc003mey.2	+						UNC5A_uc003mex.1_Intron	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			aaggcaagcaagcaggcaggga	0.238													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	49540186	49540187	+	IGR	INS	-	CTCCTTCCTTCCTTCCTTCC	CTCCTTCCTTCCTTCCTTCC			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49540186_49540187insCTCCTTCCTTCCTTCCTTCC								C6orf141 (10561 upstream) : RHAG (32706 downstream)																							ATATcttccttctccttccttc	0.109													2	5	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126317202	126317203	+	Intron	INS	-	AAG	AAG	rs35212928		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126317202_126317203insAAG	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			aggaaggaagaaagaaagaaaa	0.054													6	3	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69420250	69420251	+	Intron	INS	-	CTTA	CTTA			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69420250_69420251insCTTA	uc004afn.2	+							NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						TTATTATTCATCTTTTATTAAA	0.257													10	8	---	---	---	---	
TJP2	9414	broad.mit.edu	37	9	71776131	71776132	+	Intron	DEL	TG	-	-	rs111442939		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71776131_71776132delTG	uc011lrs.1	+						TJP2_uc004ahb.1_Intron|TJP2_uc011lrt.1_Intron	NM_201629	NP_963923	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)						cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						TCATCAGTGAtgtgtgtgtgtg	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4159644	4159645	+	IGR	INS	-	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4159644_4159645insA								KLF6 (332171 upstream) : LOC100216001 (461799 downstream)																							aggaaggaaggagaaagacaga	0.025													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	25056538	25056539	+	IGR	INS	-	TCCT	TCCT	rs147747455	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25056538_25056539insTCCT								ARHGAP21 (43941 upstream) : PRTFDC1 (81015 downstream)																							agaTACCTGGAtccttccttcc	0.020													7	4	---	---	---	---	
DDX50	79009	broad.mit.edu	37	10	70689049	70689050	+	Intron	DEL	CT	-	-	rs71187036		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70689049_70689050delCT	uc001jou.2	+						DDX50_uc010qjc.1_Intron	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						tccttccttcctctctctctct	0.015													3	4	---	---	---	---	
C10orf46	143384	broad.mit.edu	37	10	120467213	120467214	+	Intron	INS	-	A	A	rs75898650		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120467213_120467214insA	uc001lds.1	-						C10orf46_uc010qst.1_Intron	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46						ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		TCACAATTAACAAAAAAAAAAA	0.356													4	2	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69995756	69995756	+	Intron	DEL	A	-	-	rs72410022		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69995756delA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						aactctgtctaaaaaaaaaaa	0.234													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113769072	113769073	+	IGR	INS	-	CTTC	CTTC	rs144460106	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113769072_113769073insCTTC								USP28 (22816 upstream) : HTR3B (6516 downstream)																							tttcttcctttcttccttcctt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	16966790	16966790	+	IGR	DEL	C	-	-	rs56049732		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16966790delC								LMO3 (204032 upstream) : None (None downstream)																							ttccttccttcctttctctct	0.000													3	3	---	---	---	---	
ZDHHC17	23390	broad.mit.edu	37	12	77244428	77244428	+	Intron	DEL	A	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77244428delA	uc001syk.1	+							NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						TTGGCAAAAGAAAAAATCATT	0.254													4	4	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33752061	33752062	+	Intron	INS	-	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33752061_33752062insA	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		aggaaggaaggaaggaaggaag	0.000													6	3	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33752063	33752064	+	Intron	INS	-	G	G			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33752063_33752064insG	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		gaaggaaggaaggaaggaagga	0.000													5	4	---	---	---	---	
C14orf179	112752	broad.mit.edu	37	14	76527155	76527156	+	Intron	INS	-	CCTCCCTC	CCTCCCTC	rs142190540	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76527155_76527156insCCTCCCTC	uc010asm.1	+						C14orf179_uc001xsf.2_Intron|C14orf179_uc010asl.1_Intron|C14orf179_uc001xsg.2_Intron|C14orf179_uc010tve.1_Intron	NM_001102564	NP_001096034	Q96FT9	IFT43_HUMAN	hypothetical protein LOC112752 isoform 2						cilium morphogenesis|intraflagellar retrograde transport						0				BRCA - Breast invasive adenocarcinoma(234;0.0199)		ttccctcccttcctccctccct	0.000													6	3	---	---	---	---	
TUBGCP4	27229	broad.mit.edu	37	15	43690580	43690580	+	Intron	DEL	T	-	-	rs5812247		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43690580delT	uc001zro.2	+						TUBGCP4_uc001zrn.2_Intron|TUBGCP4_uc010bdh.2_Intron	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		ccccatctcataaaaaaaaaa	0.090													4	2	---	---	---	---	
ITGAX	3687	broad.mit.edu	37	16	31373682	31373683	+	Intron	INS	-	G	G	rs146732773		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31373682_31373683insG	uc002ebu.1	+						ITGAX_uc002ebt.2_Intron|ITGAX_uc010vfk.1_Intron	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GGTGGGTTCCAGGTTCTGGGGA	0.708													4	2	---	---	---	---	
C16orf87	388272	broad.mit.edu	37	16	46865177	46865178	+	5'Flank	DEL	GC	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46865177_46865178delGC	uc002eek.1	-							NM_001001436	NP_001001436	Q6PH81	CP087_HUMAN	hypothetical protein LOC388272												0						TCTGgcgggtgcgcgcgcgcgc	0.649													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87255950	87255951	+	Intron	INS	-	CAT	CAT			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87255950_87255951insCAT	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		accaccatcaccaccaccacca	0.000													4	2	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21312637	21312638	+	Intron	INS	-	TGT	TGT	rs143247012		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21312637_21312638insTGT	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	aggagACTTGGTGTGGGGCATC	0.312										Prostate(3;0.18)			2	5	---	---	---	---	
C1QTNF1	114897	broad.mit.edu	37	17	77024965	77024966	+	Intron	INS	-	GT	GT	rs146842846	by1000genomes	TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77024965_77024966insGT	uc002jwp.2	+						uc002jwo.2_5'Flank|C1QTNF1_uc002jwq.2_Intron|C1QTNF1_uc002jwr.3_Intron	NM_030968	NP_112230	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1							collagen				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			CACATTTTAAGgtgtgtgtgtg	0.436													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11610673	11610674	+	IGR	INS	-	C	C			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11610673_11610674insC								FAM38B (908694 upstream) : GNAL (78462 downstream)																							AAGACTGAAGACaaaaaaaaaa	0.302													4	2	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1061715	1061715	+	Intron	DEL	G	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1061715delG	uc002lqw.3	+						ABCA7_uc002lqy.2_Intron|ABCA7_uc010dsc.2_Intron	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aaaaaaaaaagaaaTCAGAGA	0.289													12	6	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5218213	5218214	+	Intron	INS	-	A	A	rs149426302		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5218213_5218214insA	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		ATGTTAACTTTAAAAAAAAAAA	0.406													2	4	---	---	---	---	
ZSWIM4	65249	broad.mit.edu	37	19	13915461	13915461	+	Intron	DEL	A	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13915461delA	uc002mxh.1	+						ZSWIM4_uc010xng.1_5'Flank	NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4								zinc ion binding			central_nervous_system(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			attttgtttcaaaaaaaaaaa	0.234													6	3	---	---	---	---	
TARM1	441864	broad.mit.edu	37	19	54583734	54583735	+	Intron	INS	-	A	A			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54583734_54583735insA	uc010yei.1	-							NM_001135686	NP_001129158	B6A8C7	TARM1_HUMAN	OSCAR-like transcript-2							integral to membrane					0						gactccatctcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
TMC4	147798	broad.mit.edu	37	19	54667710	54667710	+	Intron	DEL	T	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54667710delT	uc010erf.2	-						TMC4_uc002qdn.2_Intron|TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					cttcttcttcttttttttttt	0.284											OREG0003641	type=REGULATORY REGION|Gene=AK124406|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49402145	49402146	+	IGR	DEL	GT	-	-	rs72263611		TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49402145_49402146delGT								FAM19A5 (254403 upstream) : C22orf34 (406030 downstream)																							CTGGAGGCAAgtgtgtgtgtgt	0.262													4	2	---	---	---	---	
PPP2R3B	28227	broad.mit.edu	37	X	322035	322038	+	Intron	DEL	CTCA	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:322035_322038delCTCA	uc004cpg.2	-						PPP2R3B_uc011mha.1_Intron	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCGTGCCGCCTCACTCACGCTCG	0.637													4	5	---	---	---	---	
DOCK11	139818	broad.mit.edu	37	X	117752828	117752829	+	Intron	INS	-	T	T			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117752828_117752829insT	uc004eqp.2	+						DOCK11_uc004eqq.2_Intron	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation	cytosol	GTP binding			ovary(3)	3						ATCATAAGTTGttttttttttg	0.134													4	2	---	---	---	---	
TSPY3	728137	broad.mit.edu	37	Y	9366667	9366672	+	In_Frame_Del	DEL	GAAGAT	-	-			TCGA-BP-4801-01A-02D-1421-08	TCGA-BP-4801-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9366667_9366672delGAAGAT	uc004fse.2	+	2	553_558	c.526_531delGAAGAT	c.(526-531)GAAGATdel	p.ED178del	TSPY3_uc004fsf.2_In_Frame_Del_p.ED178del	NM_001077697	NP_001071165	Q01534	TSPY1_HUMAN	testis specific protein, Y-linked 3	178_179					cell differentiation|cell proliferation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus	identical protein binding				0						GATCACTGACGAAGATGAAGACATGC	0.515													4	2	---	---	---	---	
