Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
HMGN2	3151	broad.mit.edu	37	1	26801736	26801736	+	3'UTR	SNP	A	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26801736A>T	uc001bmp.3	+	6					HMGN2_uc009vsk.2_3'UTR|HMGN2_uc001bmq.3_3'UTR	NM_005517	NP_005508	P05204	HMGN2_HUMAN	high-mobility group nucleosomal binding domain						chromatin organization|regulation of transcription, DNA-dependent	chromatin|cytoplasm|nucleus	DNA binding|protein binding				0		all_cancers(24;1.9e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.38e-49)|OV - Ovarian serous cystadenocarcinoma(117;5.38e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.026)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		ATTTTGTTTTACTTTTTTTTT	0.308													10	10	---	---	---	---	PASS
HSPB11	51668	broad.mit.edu	37	1	54405733	54405733	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54405733A>T	uc001cwh.2	-	2	99	c.23T>A	c.(22-24)CTG>CAG	p.L8Q	HSPB11_uc001cwi.1_Missense_Mutation_p.L8Q	NM_016126	NP_057210	Q9Y547	HSB11_HUMAN	heat shock protein family B (small), member 11	8					cell adhesion|response to stress						0						TTCAGAGCTCAGACAGAGATC	0.323													20	90	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74575231	74575231	+	Silent	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74575231C>T	uc001dfy.3	-	5	906	c.714G>A	c.(712-714)GTG>GTA	p.V238V	LRRIQ3_uc001dfz.3_RNA	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	238	IQ.									ovary(2)	2						TGTGGAAAAACACAGGGCTGA	0.318													39	130	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82408996	82408996	+	Silent	SNP	T	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82408996T>C	uc001dit.3	+	6	922	c.741T>C	c.(739-741)TAT>TAC	p.Y247Y	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Silent_p.Y247Y|LPHN2_uc001div.2_Silent_p.Y247Y|LPHN2_uc009wcd.2_Silent_p.Y247Y	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	247	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TAATTAACTATGCCAACTACC	0.403													27	105	---	---	---	---	PASS
PPM1J	333926	broad.mit.edu	37	1	113255367	113255367	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113255367A>G	uc001ect.1	-	3	755	c.728T>C	c.(727-729)ATG>ACG	p.M243T	PPM1J_uc009wgl.1_5'Flank|PPM1J_uc001ecs.1_Missense_Mutation_p.M37T	NM_005167	NP_005158	Q5JR12	PPM1J_HUMAN	protein phosphatase 1J (PP2C domain containing)	243	PP2C-like.									breast(2)|central_nervous_system(1)	3	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCACTCACCATGAGCTGGAA	0.587													39	102	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113657274	113657274	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113657274C>G	uc001edf.1	+	15	2504	c.2306C>G	c.(2305-2307)TCT>TGT	p.S769C	LRIG2_uc009wgn.1_Missense_Mutation_p.S666C	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	769	Ig-like C2-type 3.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TGCATTATGTCTAACACCCTT	0.463													51	168	---	---	---	---	PASS
OR6K2	81448	broad.mit.edu	37	1	158670021	158670021	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158670021G>T	uc001fsu.1	-	1	422	c.422C>A	c.(421-423)ACC>AAC	p.T141N		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	141	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					AGTCAGTTGGGTACATAGCTT	0.468													24	71	---	---	---	---	PASS
TBX19	9095	broad.mit.edu	37	1	168260459	168260459	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168260459C>T	uc001gfl.2	+	2	316	c.265C>T	c.(265-267)CTC>TTC	p.L89F	TBX19_uc001gfj.3_Missense_Mutation_p.L20F	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19	89	T-box.				anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					CATGTACTCCCTCCTGCTGGA	0.557													50	139	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171560943	171560943	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171560943C>A	uc010pmg.1	+	34	8677	c.8411C>A	c.(8410-8412)CCA>CAA	p.P2804Q	BAT2L2_uc010pmh.1_Missense_Mutation_p.P1716Q|BAT2L2_uc010pmi.1_Missense_Mutation_p.P720Q|BAT2L2_uc010pmj.1_Missense_Mutation_p.P336Q	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	1079	Pro-rich.						protein C-terminus binding				0						AGAACTGGACCAATCAAACCT	0.493													36	123	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175365838	175365838	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175365838G>A	uc001gkp.1	-	3	1163	c.1082C>T	c.(1081-1083)CCG>CTG	p.P361L	TNR_uc009wwu.1_Missense_Mutation_p.P361L|TNR_uc010pmz.1_Silent_p.A326A	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	361	Fibronectin type-III 1.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CAGGGCCGTCGGCTGGTAAGA	0.612													29	52	---	---	---	---	PASS
NUP133	55746	broad.mit.edu	37	1	229641823	229641823	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229641823G>T	uc001htn.2	-	2	357	c.265C>A	c.(265-267)CCT>ACT	p.P89T		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	89					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				ACTTTAACAGGAAGAGAAGAT	0.408													44	169	---	---	---	---	PASS
MBOAT2	129642	broad.mit.edu	37	2	9048798	9048798	+	Silent	SNP	A	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9048798A>C	uc002qzg.1	-	4	481	c.348T>G	c.(346-348)ACT>ACG	p.T116T	MBOAT2_uc010yix.1_Silent_p.T116T	NM_138799	NP_620154	Q6ZWT7	MBOA2_HUMAN	O-acyltransferase (membrane bound) domain	116					phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TATAGACTCGAGTAACTTGGC	0.353													19	57	---	---	---	---	PASS
NOL10	79954	broad.mit.edu	37	2	10712145	10712145	+	3'UTR	SNP	A	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10712145A>G	uc002raq.2	-	21					NOL10_uc010yje.1_3'UTR|NOL10_uc010yjf.1_3'UTR|NOL10_uc002rap.2_3'UTR	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		AACGATGATCAGTTTGGGGGA	0.458													29	74	---	---	---	---	PASS
NCRNA00164	554226	broad.mit.edu	37	2	132912341	132912341	+	RNA	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132912341C>T	uc002tti.3	-	4		c.755G>A			NCRNA00164_uc002ttj.3_RNA	NR_027019				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						GTGTGGCCAGCCTGTAAAACA	0.313													3	11	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191480	10191480	+	Missense_Mutation	SNP	T	C	C	rs121913346		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191480T>C	uc003bvc.2	+	3	686	c.473T>C	c.(472-474)CTG>CCG	p.L158P	VHL_uc003bvd.2_Missense_Mutation_p.L117P	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	158	Interaction with Elongin BC complex.		L -> V (in VHLD; type I).|L -> P (in VHLD; type I-II; abolishes release from chaperonin complex and the interaction with Elongin BC complex).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L158V(8)|p.L158Q(6)|p.L158P(3)|p.L158fs*16(3)|p.V155fs*15(2)|p.L158R(1)|p.L158_K159del(1)|p.L158fs*15(1)|p.T157_K159del(1)|p.Y156*(1)|p.L158fs*6(1)|p.L158fs*1(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTGTATACTCTGAAAGAGCGA	0.502		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				27	34	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64589693	64589693	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64589693C>T	uc003dmg.2	-	25	3684	c.3652G>A	c.(3652-3654)GAC>AAC	p.D1218N	ADAMTS9_uc011bfo.1_Missense_Mutation_p.D1190N|ADAMTS9_uc003dmh.1_Missense_Mutation_p.D1047N|ADAMTS9_uc011bfp.1_Missense_Mutation_p.D129N	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1218	TSP type-1 7.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GCACTCTCGTCAGCCACAGAG	0.537													14	39	---	---	---	---	PASS
NEK11	79858	broad.mit.edu	37	3	130748629	130748629	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130748629C>G	uc003eny.2	+	3	403	c.77C>G	c.(76-78)GCA>GGA	p.A26G	NEK11_uc003enx.2_Missense_Mutation_p.A26G|NEK11_uc003eoa.2_Missense_Mutation_p.A26G|NEK11_uc003enz.2_5'UTR|NEK11_uc010htn.2_RNA|NEK11_uc011blk.1_5'UTR|NEK11_uc011bll.1_Missense_Mutation_p.A26G|NEK11_uc003enw.1_Missense_Mutation_p.A26G|NEK11_uc011blm.1_Missense_Mutation_p.A26G|ASTE1_uc010htm.1_5'Flank|ASTE1_uc003env.1_5'Flank|ASTE1_uc011blj.1_5'Flank	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1	26					cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						ACCTTGATTGCAAGAAGATAC	0.423													15	147	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	T	T	rs121913279		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952085A>T	uc003fjk.2	+	21	3297	c.3140A>T	c.(3139-3141)CAT>CTT	p.H1047L		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1047	PI3K/PI4K.		H -> L (in cancer).|H -> R (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane).|H -> Y (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.H1047R(1269)|p.H1047L(152)|p.H1047Y(31)|p.H1047Q(3)|p.H1047T(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AATGATGCACATCATGGTGGC	0.378	H1047R(BT20_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(MCAS_OVARY)|H1047R(HCC1954_BREAST)|H1047R(RKO_LARGE_INTESTINE)|H1047L(EFM19_BREAST)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(CAL29_URINARY_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(T47D_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(SKOV3_OVARY)|H1047R(MDAMB453_BREAST)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			40	69	---	---	---	---	PASS
SEC31A	22872	broad.mit.edu	37	4	83770070	83770070	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83770070G>T	uc003hnf.2	-	20	2553	c.2389C>A	c.(2389-2391)CAT>AAT	p.H797N	SEC31A_uc003hne.2_Missense_Mutation_p.H530N|SEC31A_uc011ccl.1_Missense_Mutation_p.H758N|SEC31A_uc003hnl.2_Missense_Mutation_p.H758N|SEC31A_uc003hng.2_Missense_Mutation_p.H797N|SEC31A_uc003hnh.2_Missense_Mutation_p.H797N|SEC31A_uc003hni.2_Missense_Mutation_p.H797N|SEC31A_uc003hnj.2_Missense_Mutation_p.H758N|SEC31A_uc011ccm.1_Missense_Mutation_p.H792N|SEC31A_uc011ccn.1_Missense_Mutation_p.H797N|SEC31A_uc003hnk.2_Missense_Mutation_p.H758N|SEC31A_uc003hnm.2_Missense_Mutation_p.H797N|SEC31A_uc003hnn.1_Missense_Mutation_p.H797N	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1	797					COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				GGTGATTCATGTCCTGCTACA	0.483													17	126	---	---	---	---	PASS
TMEM144	55314	broad.mit.edu	37	4	159174811	159174811	+	3'UTR	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159174811G>T	uc003ipx.2	+	13					TMEM144_uc010iqi.2_RNA	NM_018342	NP_060812	Q7Z5S9	TM144_HUMAN	transmembrane protein 144							integral to membrane					0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		GTGGGTAAATGATTTTTTTCC	0.363													3	4	---	---	---	---	PASS
OXCT1	5019	broad.mit.edu	37	5	41794778	41794778	+	Splice_Site	SNP	C	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41794778C>G	uc003jmn.2	-	12	1503	c.1172_splice	c.e12+1	p.G391_splice	OXCT1_uc011cpo.1_5'Flank|OXCT1_uc011cpp.1_5'Flank	NM_000436	NP_000427	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1 precursor						cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			ovary(2)|large_intestine(1)	3					Succinic acid(DB00139)	TTATTACATACCCTCTAATCA	0.428													13	77	---	---	---	---	PASS
GPX8	493869	broad.mit.edu	37	5	54456928	54456928	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54456928T>G	uc003jpq.2	+	2	348	c.311T>G	c.(310-312)TTG>TGG	p.L104W	CDC20B_uc003jpn.1_Intron|CDC20B_uc010ivu.1_Intron|CDC20B_uc003jpo.1_Intron|CDC20B_uc010ivv.1_Intron|CDC20B_uc003jpp.2_Intron|GPX8_uc003jpr.2_Intron|GPX8_uc003jps.2_RNA|GPX8_uc003jpt.2_Missense_Mutation_p.L53W	NM_001008397	NP_001008398	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8	104					response to oxidative stress	integral to membrane	glutathione peroxidase activity				0					Glutathione(DB00143)	TTCAGCGTGTTGGCTTTTCCC	0.473													33	64	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89941846	89941846	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89941846T>G	uc003kju.2	+	16	3056	c.2960T>G	c.(2959-2961)GTG>GGG	p.V987G	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	987	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGAGCTAAAGTGGGAAATAGA	0.363													4	16	---	---	---	---	PASS
PCDHA9	9752	broad.mit.edu	37	5	140230065	140230065	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140230065C>T	uc003lhu.2	+	1	2709	c.1985C>T	c.(1984-1986)ACG>ATG	p.T662M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.T662M	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	662	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGACGGCCACGGCCACTGTG	0.692													16	29	---	---	---	---	PASS
CPEB4	80315	broad.mit.edu	37	5	173372085	173372085	+	Silent	SNP	A	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173372085A>G	uc003mcs.3	+	5	2804	c.1398A>G	c.(1396-1398)AGA>AGG	p.R466R	CPEB4_uc010jju.1_Silent_p.R441R|CPEB4_uc010jjv.2_Silent_p.R449R|CPEB4_uc011dfg.1_Silent_p.R441R|CPEB4_uc003mct.3_Silent_p.R76R|CPEB4_uc003mcu.3_Silent_p.R59R	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	466							nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATGGGGAAAGAGTGGAACGAT	0.493													45	132	---	---	---	---	PASS
FAM136B	387071	broad.mit.edu	37	6	3045892	3045892	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3045892A>G	uc011dhr.1	+	1	275	c.275A>G	c.(274-276)GAT>GGT	p.D92G		NM_001012983	NP_001013001			hypothetical protein LOC387071												0	Ovarian(93;0.0386)	all_hematologic(90;0.108)				AAAGCCAAAGATTCAATAGAT	0.527													36	94	---	---	---	---	PASS
HDGFL1	154150	broad.mit.edu	37	6	22569865	22569865	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22569865G>T	uc003nds.2	+	1	188	c.61G>T	c.(61-63)GGC>TGC	p.G21C		NM_138574	NP_612641	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	21	PWWP.										0	Ovarian(93;0.163)					CAAGTTAAAGGGCTATGCCCA	0.607													17	44	---	---	---	---	PASS
SNX14	57231	broad.mit.edu	37	6	86258079	86258079	+	Silent	SNP	A	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86258079A>T	uc003pkr.2	-	9	1000	c.807T>A	c.(805-807)CTT>CTA	p.L269L	SNX14_uc003pkp.2_Silent_p.L132L|SNX14_uc003pkq.2_5'UTR|SNX14_uc011dzg.1_Silent_p.L217L|SNX14_uc003pks.2_Silent_p.L225L|SNX14_uc003pkt.2_Silent_p.L269L	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a	269	PXA.				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TCTCTCTTATAAGTAAGGTCA	0.219													12	96	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112471821	112471821	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112471821C>T	uc003pvu.2	-	17	2374	c.2065G>A	c.(2065-2067)GAA>AAA	p.E689K	LAMA4_uc003pvv.2_Missense_Mutation_p.E682K|LAMA4_uc003pvt.2_Missense_Mutation_p.E682K	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	689	Domain II and I.|Potential.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GCCACTGCTTCATCACTGCCT	0.488													8	65	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161139402	161139402	+	Silent	SNP	T	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161139402T>A	uc003qtm.3	+	8	927	c.864T>A	c.(862-864)GCT>GCA	p.A288A		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	288	Kringle 3.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GGAATGTGGCTGTTACCGTGT	0.527													59	102	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94059617	94059617	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94059617G>A	uc003ung.1	+	52	4484	c.4013G>A	c.(4012-4014)CGC>CAC	p.R1338H	COL1A2_uc011kib.1_Missense_Mutation_p.R190H	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1338	Fibrillar collagen NC1.			R -> A (in Ref. 23; AAA51887).	axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	AAGCCATCACGCCTGCCCTTC	0.383										HNSCC(75;0.22)			33	304	---	---	---	---	PASS
STRA8	346673	broad.mit.edu	37	7	134928142	134928142	+	Silent	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134928142C>T	uc011kpx.1	+	4	399	c.399C>T	c.(397-399)AGC>AGT	p.S133S		NM_182489	NP_872295	Q7Z7C7	STRA8_HUMAN	STRA8	133					DNA replication|regulation of transcription, DNA-dependent	cytoplasm|nucleus					0						AATATGCCAGCATGTATTCTG	0.502													36	53	---	---	---	---	PASS
ZNF395	55893	broad.mit.edu	37	8	28214212	28214212	+	Silent	SNP	A	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28214212A>G	uc003xgq.2	-	4	646	c.558T>C	c.(556-558)CCT>CCC	p.P186P	ZNF395_uc003xgt.2_Silent_p.P186P|ZNF395_uc003xgr.2_Silent_p.P186P|ZNF395_uc003xgs.2_Silent_p.P186P	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	186					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CGGTCCCGGGAGGACTCTGTA	0.597													19	28	---	---	---	---	PASS
MCM4	4173	broad.mit.edu	37	8	48874107	48874107	+	Silent	SNP	T	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48874107T>A	uc003xqk.1	+	3	197	c.102T>A	c.(100-102)TCT>TCA	p.S34S	PRKDC_uc003xqi.2_5'Flank|PRKDC_uc003xqj.2_5'Flank|PRKDC_uc011ldh.1_5'Flank|MCM4_uc003xql.1_Silent_p.S34S|MCM4_uc011ldi.1_Silent_p.S34S|MCM4_uc010lxw.1_RNA	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	34					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				CATCTCCCTCTCAGAGACGTA	0.577													27	37	---	---	---	---	PASS
SLC1A1	6505	broad.mit.edu	37	9	4576614	4576614	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4576614C>G	uc003zij.1	+	10	1280	c.1044C>G	c.(1042-1044)AAC>AAG	p.N348K	C9orf68_uc003zik.2_Intron	NM_004170	NP_004161	P43005	EAA3_HUMAN	solute carrier family 1, member 1	348					D-aspartate import|L-glutamate import|synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)	AAGAAAATAACCAGGTGGACA	0.468													35	82	---	---	---	---	PASS
ATP8B5P	158381	broad.mit.edu	37	9	35450233	35450233	+	RNA	SNP	A	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35450233A>T	uc010mkn.1	+	10		c.3083A>T			ATP8B5P_uc010mko.2_RNA|ATP8B5P_uc010mkp.2_RNA|ATP8B5P_uc003zwu.2_Intron					Homo sapiens cDNA, FLJ17320.												0						AGAAATGTTTACTGTGGTGTA	0.373													11	24	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73477850	73477850	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73477850C>A	uc004aid.2	-	3	680	c.436G>T	c.(436-438)GGA>TGA	p.G146*	TRPM3_uc004ahw.2_Translation_Start_Site|TRPM3_uc004ahx.2_Translation_Start_Site|TRPM3_uc004ahy.2_Translation_Start_Site|TRPM3_uc004ahz.2_Translation_Start_Site|TRPM3_uc004aia.2_Translation_Start_Site|TRPM3_uc004aib.2_Translation_Start_Site|TRPM3_uc004aic.2_Nonsense_Mutation_p.G146*|TRPM3_uc010mor.2_Nonsense_Mutation_p.G146*|TRPM3_uc004aie.2_Translation_Start_Site|TRPM3_uc004aif.2_Translation_Start_Site|TRPM3_uc004aig.2_Translation_Start_Site|TRPM3_uc004aii.2_Nonsense_Mutation_p.G148*	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	146	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TGGCCACCTCCTTGGAACTCA	0.458													41	157	---	---	---	---	PASS
GCNT1	2650	broad.mit.edu	37	9	79118325	79118325	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79118325A>G	uc010mpf.2	+	3	1369	c.1028A>G	c.(1027-1029)GAT>GGT	p.D343G	GCNT1_uc010mpg.2_Missense_Mutation_p.D343G|GCNT1_uc010mph.2_Missense_Mutation_p.D343G|GCNT1_uc004akf.3_Missense_Mutation_p.D343G|GCNT1_uc010mpi.2_Missense_Mutation_p.D343G|GCNT1_uc004akh.3_Missense_Mutation_p.D343G	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein	343	Lumenal (Potential).|Catalytic (By similarity).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0						CATAAGTATGATCTGTCTGAC	0.542													15	48	---	---	---	---	PASS
ATAD1	84896	broad.mit.edu	37	10	89550085	89550085	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89550085G>T	uc001key.1	-	3	647	c.364C>A	c.(364-366)CTT>ATT	p.L122I	ATAD1_uc010qmr.1_Missense_Mutation_p.L64I|ATAD1_uc009xth.1_RNA|ATAD1_uc001kez.1_Missense_Mutation_p.L122I	NM_032810	NP_116199	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	122						peroxisome	ATP binding|nucleoside-triphosphatase activity			large_intestine(1)|ovary(1)	2		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		GGCTGCAGAAGCCTGGAATTC	0.353													12	101	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91528517	91528517	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91528517A>C	uc001kgs.1	+	31	5186	c.5114A>C	c.(5113-5115)AAG>ACG	p.K1705T	KIF20B_uc001kgr.1_Missense_Mutation_p.K1665T|KIF20B_uc001kgt.1_Missense_Mutation_p.K916T|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1705	Interaction with PIN1.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						CCATCATCTAAGAAAACATAT	0.348													27	70	---	---	---	---	PASS
NLRP6	171389	broad.mit.edu	37	11	281411	281411	+	Silent	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:281411C>T	uc010qvs.1	+	4	1677	c.1677C>T	c.(1675-1677)ATC>ATT	p.I559I	NLRP6_uc010qvt.1_Silent_p.I559I	NM_138329	NP_612202	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	559						cytoplasm	ATP binding			upper_aerodigestive_tract(1)|skin(1)	2		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGCGCGACATCGAGCGCCACT	0.677													7	10	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57068043	57068043	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57068043C>A	uc001njr.2	-	10	5473	c.5161G>T	c.(5161-5163)GCC>TCC	p.A1721S	TNKS1BP1_uc001njp.2_Missense_Mutation_p.A293S|TNKS1BP1_uc001njq.2_Missense_Mutation_p.A294S|TNKS1BP1_uc001njs.2_Missense_Mutation_p.A1721S	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	1721	Arg/Glu/Lys-rich (charged).				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				AGTTTCAGGGCTTGAAGCCAG	0.537													32	80	---	---	---	---	PASS
CTNND1	1500	broad.mit.edu	37	11	57563067	57563067	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57563067T>G	uc001nmc.3	+	5	857	c.286T>G	c.(286-288)TAT>GAT	p.Y96D	CTNND1_uc001nlf.1_Missense_Mutation_p.Y96D|CTNND1_uc001nlh.1_Missense_Mutation_p.Y96D|CTNND1_uc001nlu.3_5'UTR|CTNND1_uc001nlt.3_5'UTR|CTNND1_uc001nls.3_5'UTR|CTNND1_uc001nlw.3_5'UTR|CTNND1_uc001nmf.3_Missense_Mutation_p.Y96D|CTNND1_uc001nmd.3_Missense_Mutation_p.Y42D|CTNND1_uc001nlk.3_Missense_Mutation_p.Y42D|CTNND1_uc001nme.3_Missense_Mutation_p.Y96D|CTNND1_uc001nll.3_Missense_Mutation_p.Y42D|CTNND1_uc001nmg.3_Missense_Mutation_p.Y42D|CTNND1_uc001nlj.3_Missense_Mutation_p.Y42D|CTNND1_uc001nlr.3_Missense_Mutation_p.Y42D|CTNND1_uc001nlp.3_Missense_Mutation_p.Y42D|CTNND1_uc001nlx.3_Intron|CTNND1_uc001nlz.3_Intron|CTNND1_uc009ymn.2_Intron|CTNND1_uc001nlm.3_Missense_Mutation_p.Y96D|CTNND1_uc001nly.3_Intron|CTNND1_uc001nmb.3_Intron|CTNND1_uc001nma.3_Intron|CTNND1_uc001nmi.3_5'UTR|CTNND1_uc001nmh.3_Missense_Mutation_p.Y96D|CTNND1_uc001nlq.3_5'UTR|CTNND1_uc001nln.3_Missense_Mutation_p.Y96D|CTNND1_uc001nli.3_Missense_Mutation_p.Y96D|CTNND1_uc001nlo.3_5'UTR|CTNND1_uc001nlv.3_5'UTR	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC	96					adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				TCACCTTCTATATAGCACCAT	0.463													12	18	---	---	---	---	PASS
HMBS	3145	broad.mit.edu	37	11	118963098	118963098	+	Intron	SNP	G	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118963098G>A	uc001puz.1	+						HMBS_uc009zao.1_3'UTR|HMBS_uc001pvc.1_Intron|HMBS_uc009zap.1_Intron|HMBS_uc001pva.1_Intron|HMBS_uc001pvb.1_Intron|HMBS_uc001pvd.1_Intron|HMBS_uc001pve.1_Intron|HMBS_uc001pvf.1_Intron	NM_000190	NP_000181	P08397	HEM3_HUMAN	hydroxymethylbilane synthase isoform 1						peptidyl-pyrromethane cofactor linkage	cytosol	hydroxymethylbilane synthase activity				0	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		GATGTCCTAGGATGTTTTTCC	0.572									Porphyria_Acute_Intermittent				34	91	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26104186	26104186	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26104186C>G	uc001uqk.2	+	3	413	c.271C>G	c.(271-273)CAG>GAG	p.Q91E	ATP8A2_uc010tdi.1_Missense_Mutation_p.Q51E|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc001uql.1_Missense_Mutation_p.Q51E	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	51	Helical; (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CTTGTATGAGCAGATTAGAAG	0.338													28	108	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24885951	24885951	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24885951C>A	uc001wpf.3	+	9	5314	c.4996C>A	c.(4996-4998)CAT>AAT	p.H1666N		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	1666	Integrase catalytic.				DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						GCTGCTTCAGCATGTGTTTGC	0.617													8	36	---	---	---	---	PASS
KHNYN	23351	broad.mit.edu	37	14	24901665	24901665	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24901665T>A	uc001wph.3	+	3	1400	c.1198T>A	c.(1198-1200)TGG>AGG	p.W400R	KHNYN_uc010tpc.1_Missense_Mutation_p.W441R|KHNYN_uc010alw.2_Missense_Mutation_p.W400R|CBLN3_uc001wpg.3_5'Flank	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351	400										ovary(2)|liver(1)	3						GGGGCCTCAATGGAAACGAGG	0.657											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	27	---	---	---	---	PASS
ACTN1	87	broad.mit.edu	37	14	69349271	69349271	+	Silent	SNP	C	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69349271C>G	uc001xkl.2	-	16	2167	c.1857G>C	c.(1855-1857)ACG>ACC	p.T619T	ACTN1_uc001xkk.2_Silent_p.T215T|ACTN1_uc010ttb.1_Silent_p.T554T|ACTN1_uc001xkm.2_Silent_p.T619T|ACTN1_uc001xkn.2_Silent_p.T619T|ACTN1_uc010ttc.1_Silent_p.T204T	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	619	Interaction with DDN.|Spectrin 3.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CATGCTCCTCCGTCAGAGCTT	0.607													15	36	---	---	---	---	PASS
BTBD7	55727	broad.mit.edu	37	14	93709191	93709191	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93709191G>C	uc001ybo.2	-	11	3153	c.2827C>G	c.(2827-2829)CCG>GCG	p.P943A	BTBD7_uc010aur.2_Missense_Mutation_p.P468A|BTBD7_uc010two.1_Missense_Mutation_p.P763A|BTBD7_uc001ybp.2_Missense_Mutation_p.P592A	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1	943										pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		TAGAAATCCGGATATTCCTGT	0.473													29	87	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63125718	63125718	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63125718C>A	uc002alb.3	+	52	7018	c.7018C>A	c.(7018-7020)CTG>ATG	p.L2340M	TLN2_uc002alc.3_Missense_Mutation_p.L733M|TLN2_uc010uic.1_Translation_Start_Site|uc002ale.1_RNA	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	2340	I/LWEQ.				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GGATGAGACCCTGGACTTTGA	0.507													22	217	---	---	---	---	PASS
RPL4	6124	broad.mit.edu	37	15	66797733	66797733	+	5'Flank	SNP	A	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66797733A>C	uc002apv.2	-						RPL4_uc010bhr.2_5'Flank|RPL4_uc002apw.2_5'Flank|RPL4_uc002apx.2_5'UTR|RPL4_uc010ujq.1_5'Flank|SNORD16_uc010bht.2_5'Flank|SNORD18A_uc002apz.1_5'Flank|ZWILCH_uc010bhu.1_Intron|ZWILCH_uc002aqb.2_Intron|ZWILCH_uc002aqa.2_Intron|ZWILCH_uc010bhv.2_Intron	NM_000968	NP_000959	P36578	RL4_HUMAN	ribosomal protein L4						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						TCCTTCAGTGAGTCTAGTCTC	0.577													70	96	---	---	---	---	PASS
ITGA11	22801	broad.mit.edu	37	15	68596122	68596122	+	Silent	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68596122C>T	uc002ari.2	-	29	3570	c.3483G>A	c.(3481-3483)CTG>CTA	p.L1161L	ITGA11_uc010bib.2_Silent_p.L1162L	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	1161	Poly-Leu.|Helical; (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	TCCACAGTGCCAGGACCAGCA	0.652													7	56	---	---	---	---	PASS
MKL2	57496	broad.mit.edu	37	16	14234406	14234406	+	5'UTR	SNP	T	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14234406T>G	uc010uza.1	+	3					MKL2_uc002dcg.2_5'UTR	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						GGCAGTGTCTTCAATAGGCCG	0.393													14	37	---	---	---	---	PASS
FHOD1	29109	broad.mit.edu	37	16	67264329	67264329	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67264329A>G	uc002esl.2	-	19	3051	c.2939T>C	c.(2938-2940)CTG>CCG	p.L980P	FHOD1_uc002esk.2_Missense_Mutation_p.L39P|FHOD1_uc010ced.2_Missense_Mutation_p.L787P	NM_013241	NP_037373	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	980	FH2.				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding			breast(2)|ovary(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		AAATTCCCGCAGCGTGTGGCA	0.617													14	86	---	---	---	---	PASS
TMEM231	79583	broad.mit.edu	37	16	75590097	75590097	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75590097T>G	uc002fem.2	-	1	74	c.11A>C	c.(10-12)TAT>TCT	p.Y4S	TMEM231_uc002fek.2_Missense_Mutation_p.M1L|TMEM231_uc002fel.2_5'UTR|TMEM231_uc010cgx.1_Missense_Mutation_p.M25L	NM_001077418	NP_001070886	Q9H6L2	TM231_HUMAN	transmembrane protein 231 isoform 2	4						integral to membrane					0						GAAGAGCTCATAGAGCGCCAT	0.672													3	3	---	---	---	---	PASS
ZNF594	84622	broad.mit.edu	37	17	5086351	5086351	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5086351C>T	uc010cla.1	-	2	1357	c.1201G>A	c.(1201-1203)GAG>AAG	p.E401K		NM_032530	NP_115919	Q96JF6	ZN594_HUMAN	zinc finger protein 594	401					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3						TATGGTTTCTCTCCTGTATGA	0.413													85	275	---	---	---	---	PASS
RCVRN	5957	broad.mit.edu	37	17	9808162	9808162	+	Silent	SNP	G	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9808162G>A	uc002gme.1	-	1	523	c.336C>T	c.(334-336)GAC>GAT	p.D112D		NM_002903	NP_002894	P35243	RECO_HUMAN	recoverin	112	EF-hand 3.|2; high affinity (By similarity).				visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						TCCCGTTACCGTCCACGTCGT	0.627													35	145	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26086097	26086097	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26086097T>C	uc002gzu.2	-	26	3428	c.3164A>G	c.(3163-3165)TAT>TGT	p.Y1055C		NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	1055					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	GTCCTGAACATAGACCTGAAA	0.627													7	11	---	---	---	---	PASS
NOL11	25926	broad.mit.edu	37	17	65730487	65730487	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65730487T>A	uc002jgd.1	+	8	865	c.862T>A	c.(862-864)TCT>ACT	p.S288T	NOL11_uc010wql.1_Missense_Mutation_p.S106T|NOL11_uc010deu.1_5'UTR	NM_015462	NP_056277	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	288						nucleolus					0	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGAATGCCTCTCTGTATGGAA	0.328													13	43	---	---	---	---	PASS
TRIM65	201292	broad.mit.edu	37	17	73888859	73888859	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73888859G>A	uc002jpx.2	-	2	523	c.487C>T	c.(487-489)CGC>TGC	p.R163C		NM_173547	NP_775818	Q6PJ69	TRI65_HUMAN	tripartite motif-containing 65	163	Potential.					intracellular	zinc ion binding				0			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTTTGCTTGCGCAGCTCTAGT	0.667													11	20	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1051287	1051287	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1051287C>G	uc002lqw.3	+	20	3049	c.2818C>G	c.(2818-2820)CTC>GTC	p.L940V	ABCA7_uc010dsb.1_Missense_Mutation_p.L802V	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	940	ABC transporter 1.				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACTCGCCACCTCTCTGGTGA	0.657													12	23	---	---	---	---	PASS
GADD45B	4616	broad.mit.edu	37	19	2477619	2477619	+	3'UTR	SNP	A	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2477619A>G	uc002lwb.1	+	4						NM_015675	NP_056490	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta						activation of MAPKKK activity|apoptosis|cell differentiation|multicellular organismal development|response to stress						0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCAGCAGAATCTGTTGAGT	0.542													3	10	---	---	---	---	PASS
UHRF1	29128	broad.mit.edu	37	19	4954476	4954476	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4954476G>T	uc002mbo.2	+	14	2101	c.1933G>T	c.(1933-1935)GGC>TGC	p.G645C	UHRF1_uc010xik.1_RNA|UHRF1_uc010duf.2_RNA|UHRF1_uc002mbp.2_Missense_Mutation_p.G658C	NM_001048201	NP_001041666	Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains	645					cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		GACGGGCAAGGGCAAGTGGAA	0.652													10	27	---	---	---	---	PASS
PGLYRP2	114770	broad.mit.edu	37	19	15586606	15586606	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15586606G>A	uc002nbf.3	-	2	1008	c.875C>T	c.(874-876)CCC>CTC	p.P292L	PGLYRP2_uc002nbg.3_Missense_Mutation_p.P292L	NM_052890	NP_443122	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2 precursor	292					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptide amidation|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)	3						GGATGGCCGGGGCTCAGGAGT	0.617													7	48	---	---	---	---	PASS
MAST3	23031	broad.mit.edu	37	19	18254635	18254635	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18254635G>T	uc002nhz.3	+	21	2315	c.2315G>T	c.(2314-2316)GGT>GTT	p.G772V		NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase	772							ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						CCCGAGCGGGGTCCCAGCCCA	0.622													7	27	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54395811	54395811	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54395811G>A	uc002qcq.1	+	7	1017	c.735G>A	c.(733-735)TGG>TGA	p.W245*	PRKCG_uc010eqz.1_Nonsense_Mutation_p.W245*|PRKCG_uc010yef.1_Nonsense_Mutation_p.W245*|PRKCG_uc010yeg.1_Nonsense_Mutation_p.W245*|PRKCG_uc010yeh.1_Nonsense_Mutation_p.W132*	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	245	C2.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		TGGAGGTGTGGGACTGGGACC	0.672													13	31	---	---	---	---	PASS
TNNT1	7138	broad.mit.edu	37	19	55645564	55645564	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55645564G>C	uc002qjb.3	-	12	709	c.620C>G	c.(619-621)TCT>TGT	p.S207C	TNNT1_uc002qiz.3_Intron|TNNT1_uc002qja.3_Intron|TNNT1_uc002qjc.3_Intron|TNNT1_uc002qje.3_Intron|TNNT1_uc002qjd.3_Intron	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a	207					muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		CAGCCAGGCAGACCGGGCCCT	0.458													2	6	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58597720	58597720	+	Intron	SNP	G	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58597720G>T	uc002qri.2	-						ZSCAN18_uc002qrj.3_Intron|ZSCAN18_uc010yhs.1_Intron|ZSCAN18_uc002qrh.2_Intron|ZSCAN18_uc010yht.1_Intron|ZSCAN18_uc002qrk.1_3'UTR|ZSCAN18_uc002qrl.2_3'UTR	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GCCAGGGCAGGCTGCAGCCCA	0.567													3	6	---	---	---	---	PASS
PARD6B	84612	broad.mit.edu	37	20	49367004	49367004	+	Silent	SNP	T	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49367004T>C	uc002xvo.2	+	3	1341	c.1098T>C	c.(1096-1098)GAT>GAC	p.D366D		NM_032521	NP_115910	Q9BYG5	PAR6B_HUMAN	PAR-6 beta	366					axonogenesis|cell cycle|cell division|establishment or maintenance of cell polarity|protein complex assembly|regulation of cell migration|tight junction assembly	cytosol|tight junction	protein binding			kidney(1)	1						TAGAAGAAGATGGAACAATCA	0.388													37	69	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19642252	19642252	+	3'UTR	SNP	T	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19642252T>A	uc002ykw.2	-	25						NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						AATGGGAAAATAATGCGACTT	0.348													7	24	---	---	---	---	PASS
C2CD2	25966	broad.mit.edu	37	21	43338331	43338331	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43338331C>A	uc002yzw.2	-	5	845	c.603G>T	c.(601-603)CAG>CAT	p.Q201H	C2CD2_uc002yzu.2_Missense_Mutation_p.Q33H|C2CD2_uc002yzv.2_Missense_Mutation_p.Q46H|C2CD2_uc002yzx.1_Missense_Mutation_p.Q46H	NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform	201						cytosol|extracellular region|nucleus				ovary(1)	1						TCTCAGCCACCTGGTCCTGGT	0.502													4	25	---	---	---	---	PASS
LSS	4047	broad.mit.edu	37	21	47629493	47629493	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47629493G>C	uc002zij.2	-	13	1320	c.1241C>G	c.(1240-1242)GCT>GGT	p.A414G	LSS_uc011afv.1_Missense_Mutation_p.A403G|LSS_uc002zil.2_Missense_Mutation_p.A414G|LSS_uc002zik.2_Missense_Mutation_p.A334G	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1	414					cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)					GAACTCATGAGCCTTCTGCAG	0.657													4	2	---	---	---	---	PASS
ZDHHC8	29801	broad.mit.edu	37	22	20130731	20130731	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20130731C>A	uc002zrq.2	+	10	1684	c.1578C>A	c.(1576-1578)AGC>AGA	p.S526R	ZDHHC8_uc002zrr.1_Missense_Mutation_p.S526R|ZDHHC8_uc010gsa.2_Missense_Mutation_p.S332R	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	526	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					GCAGCTTCAGCCCCGTGCTGG	0.706													7	19	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23006960	23006960	+	RNA	SNP	C	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23006960C>A	uc011aim.1	+	119		c.7563C>A								Parts of antibodies, mostly variable regions.												0						GGGCTCTGCTCCTCCTCACCC	0.627													3	3	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23006961	23006961	+	RNA	SNP	C	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23006961C>T	uc011aim.1	+	119		c.7564C>T								Parts of antibodies, mostly variable regions.												0						GGCTCTGCTCCTCCTCACCCT	0.627													3	4	---	---	---	---	PASS
GPC4	2239	broad.mit.edu	37	X	132437029	132437029	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132437029A>C	uc004exc.1	-	9	1749	c.1537T>G	c.(1537-1539)TAC>GAC	p.Y513D	GPC4_uc011mvg.1_Missense_Mutation_p.Y443D	NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4 precursor	513					anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)					GTGGCATTGTAGTCAAACTCT	0.478													121	74	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9581	9581	+	RNA	SNP	T	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9581T>C	uc011mfi.1	+	1		c.919T>C			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		ACCCCGCTAAATCCCCTAGAA	0.498													5	36	---	---	---	---	PASS
SAMD11	148398	broad.mit.edu	37	1	878907	878909	+	Intron	DEL	TTT	-	-	rs138742712		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:878907_878909delTTT	uc001abw.1	+						SAMD11_uc001abx.1_Intron	NM_152486	NP_689699	Q96NU1	SAM11_HUMAN	sterile alpha motif domain containing 11							nucleus					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.74e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000472)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		GCACCCCACCttttttttttttt	0.493													4	2	---	---	---	---	
ERMAP	114625	broad.mit.edu	37	1	43302574	43302575	+	Intron	INS	-	A	A	rs35894122		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43302574_43302575insA	uc001cic.1	+						ERMAP_uc010ojw.1_Intron|ERMAP_uc001cid.1_Intron|ERMAP_uc001cie.1_Intron|ERMAP_uc001cif.1_Intron	NM_001017922	NP_001017922	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein							integral to membrane|plasma membrane				ovary(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				gtggcagatttaaaaaaaaaaa	0.015													4	2	---	---	---	---	
WDR78	79819	broad.mit.edu	37	1	67358749	67358750	+	Intron	DEL	AA	-	-	rs12738212		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67358749_67358750delAA	uc001dcx.2	-						WDR78_uc001dcy.2_Intron|WDR78_uc001dcz.2_Intron|WDR78_uc009wax.2_5'Flank	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						agagagagagaaagaaagaaag	0.089													4	2	---	---	---	---	
ASB17	127247	broad.mit.edu	37	1	76388173	76388173	+	Intron	DEL	C	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76388173delC	uc001dhe.1	-						ASB17_uc001dhf.1_Intron	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box-containing 17						intracellular signal transduction					ovary(1)	1						TTATATGtttctttttttttt	0.114													5	3	---	---	---	---	
SORT1	6272	broad.mit.edu	37	1	109867853	109867855	+	Intron	DEL	CTT	-	-	rs35552184		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109867853_109867855delCTT	uc001dxm.1	-						SORT1_uc010ovi.1_Intron	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ATTATTTTAACtttttttttttt	0.202													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118236226	118236229	+	IGR	DEL	CTTT	-	-	rs10707403		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118236226_118236229delCTTT								FAM46C (65216 upstream) : GDAP2 (169879 downstream)																							tccttccttcctttctttcttcct	0.000													5	3	---	---	---	---	
XCL2	6846	broad.mit.edu	37	1	168513367	168513367	+	5'Flank	DEL	A	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168513367delA	uc001gfn.3	-							NM_003175	NP_003166	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2 precursor						blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity			ovary(1)	1	all_hematologic(923;0.215)					TATTTTTCTTAAAAAAAAAAA	0.423													4	2	---	---	---	---	
ATP2B4	493	broad.mit.edu	37	1	203593358	203593365	+	5'Flank	DEL	GAAGGAAG	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203593358_203593365delGAAGGAAG	uc001gzw.2	+						ATP2B4_uc001gzv.2_5'Flank	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			aagaaagaaagaaggaaggaaggaagga	0.000													6	4	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766824	206766827	+	Intron	DEL	GCGA	-	-	rs72244512		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766824_206766827delGCGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagagcgcgagagagagaga	0.216													4	4	---	---	---	---	
SYT14	255928	broad.mit.edu	37	1	210126265	210126267	+	Intron	DEL	TTA	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210126265_210126267delTTA	uc009xcv.2	+						SYT14_uc001hhs.3_Intron|SYT14_uc001hht.3_Intron|SYT14_uc001hhu.3_Intron|SYT14_uc010psn.1_Intron|SYT14_uc010pso.1_Intron	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4							integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		TGCATATTACTTATTATGTGATT	0.296													4	2	---	---	---	---	
C1orf55	163859	broad.mit.edu	37	1	226180816	226180817	+	Intron	INS	-	T	T	rs66975923		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226180816_226180817insT	uc001hpu.3	-						C1orf55_uc001hpv.2_Intron	NM_152608	NP_689821	Q6IQ49	CA055_HUMAN	hypothetical protein LOC163859											lung(1)	1	Breast(184;0.197)					TACTTTCTTTCTTTTTTTTTTT	0.302													6	6	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11776864	11776869	+	Intron	DEL	GGGCAT	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11776864_11776869delGGGCAT	uc002rbk.1	+						GREB1_uc002rbp.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		gcaggggtaagggcatgggcatgggc	0.214													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16134236	16134237	+	IGR	DEL	TT	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16134236_16134237delTT								MYCN (47108 upstream) : FAM49A (599664 downstream)																							tctttctttctttctttctttc	0.069													2	4	---	---	---	---	
C2orf3	6936	broad.mit.edu	37	2	75900438	75900439	+	Intron	INS	-	A	A	rs75112825		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75900438_75900439insA	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						agtctcaaaagaaaaaaaaaaa	0.084													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91766729	91766730	+	IGR	INS	-	AG	AG	rs141003417		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91766729_91766730insAG								None (None upstream) : LOC654342 (38462 downstream)																							GGAGCTGTAACACTATTTGTGA	0.317													3	3	---	---	---	---	
ZRANB3	84083	broad.mit.edu	37	2	136148440	136148440	+	Intron	DEL	T	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136148440delT	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron|ZRANB3_uc002tun.1_Intron	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		ACCtttttccttttttttttg	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	146576994	146576995	+	IGR	INS	-	C	C			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146576994_146576995insC								None (None upstream) : PABPC1P2 (767630 downstream)																							tccccctccttcctttctccct	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186133641	186133652	+	IGR	DEL	CTTCCTTCCTTG	-	-	rs4667022		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186133641_186133652delCTTCCTTCCTTG								ZNF804A (329429 upstream) : None (None downstream)																							ttcttccttccttccttccttgcttccttcct	0.028													2	5	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230634187	230634187	+	Intron	DEL	T	-	-	rs6759674		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230634187delT	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		aaaaaaaaaataataataaaa	0.353													4	2	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1363704	1363704	+	Intron	DEL	T	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1363704delT	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		ATGGTTTTAATTTTAGCATGG	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	27997118	27997121	+	IGR	DEL	CCTT	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27997118_27997121delCCTT								EOMES (232912 upstream) : CMC1 (286003 downstream)																							ccttcctttcccttccttccttcc	0.000													6	3	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52649377	52649377	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52649377delT	uc003des.2	-	15	1926	c.1914delA	c.(1912-1914)AAAfs	p.K638fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.K638fs|PBRM1_uc003der.2_Frame_Shift_Del_p.K606fs|PBRM1_uc003det.2_Frame_Shift_Del_p.K653fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.K653fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.K638fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.K638fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.K638fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.K638fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.K551fs|PBRM1_uc003dfc.2_Frame_Shift_Del_p.K5fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	638					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCAGCTTGAGTTTGGGAGAAG	0.363			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								79	43	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69245689	69245690	+	Intron	INS	-	AAAAC	AAAAC	rs144990660	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69245689_69245690insAAAAC	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnu.2_Intron|FRMD4B_uc011bga.1_Intron	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTTCAGACCAAAAAACAAAACA	0.287													2	4	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132438748	132438749	+	Intron	DEL	AT	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132438748_132438749delAT	uc003epe.1	-						NCRNA00119_uc003epg.1_5'Flank|NPHP3_uc003epf.1_Intron|NCRNA00119_uc010htu.1_5'Flank	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						atatatatacatatatatatat	0.248													5	4	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7656930	7656931	+	Intron	DEL	AC	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7656930_7656931delAC	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TTGTGCGTGTacacacacacac	0.485													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38387897	38387900	+	IGR	DEL	AAGC	-	-	rs6812640	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38387897_38387900delAAGC								TBC1D1 (247104 upstream) : FLJ13197 (226422 downstream)																							ggaaggaaggaagcaaggaaggaa	0.123													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49512654	49512654	+	IGR	DEL	T	-	-	rs113012804		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49512654delT								CWH43 (448561 upstream) : None (None downstream)																							ACATTCTGCGTTTTTTTGGGG	0.368													9	5	---	---	---	---	
EPHA5	2044	broad.mit.edu	37	4	66218917	66218918	+	Intron	INS	-	TA	TA	rs139336386	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66218917_66218918insTA	uc003hcy.2	-						EPHA5_uc003hcx.2_Intron|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Intron|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Intron	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						TGTCAAAATTGtatatatatat	0.173										TSP Lung(17;0.13)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190588705	190588716	+	IGR	DEL	GTGTGTGTGTAG	-	-	rs72438449		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190588705_190588716delGTGTGTGTGTAG								None (None upstream) : FRG1 (273258 downstream)																							gtgtgtgtgtgtgtgtgtgtagagagagatta	0.066													4	2	---	---	---	---	
HMGCS1	3157	broad.mit.edu	37	5	43297956	43297956	+	Intron	DEL	G	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43297956delG	uc003jnr.3	-						HMGCS1_uc003jnp.3_5'Flank|HMGCS1_uc003jnq.3_Intron	NM_001098272	NP_001091742	Q01581	HMCS1_HUMAN	hydroxymethylglutaryl-CoA synthase 1						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0						aaaaaaaaaagaaaaaaaaac	0.020													4	2	---	---	---	---	
SLC38A9	153129	broad.mit.edu	37	5	54952383	54952383	+	Intron	DEL	T	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54952383delT	uc003jqf.2	-						SLC38A9_uc003jqd.2_Intron|SLC38A9_uc010ivx.2_Intron|SLC38A9_uc003jqe.2_Intron|SLC38A9_uc010ivy.2_Intron	NM_173514	NP_775785	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9						amino acid transport|sodium ion transport	integral to membrane					0		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				TTGGAGGTTCTTTTTTTTTTA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	109481424	109481425	+	IGR	INS	-	T	T	rs144746217	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109481424_109481425insT								MAN2A1 (277995 upstream) : TMEM232 (143509 downstream)																							ctttcctttccttccttccttc	0.015													6	6	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137289730	137289731	+	Intron	INS	-	T	T	rs147698927		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137289730_137289731insT	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						CAATCTCTCTCttttttttttt	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8323263	8323264	+	IGR	INS	-	TTCCTTCT	TTCCTTCT	rs139963481	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8323263_8323264insTTCCTTCT								EEF1E1 (220435 upstream) : SLC35B3 (88469 downstream)																							tctttctttccttccttctttc	0.000													7	6	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29926345	29926346	+	Intron	INS	-	G	G			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29926345_29926346insG	uc011dmb.1	+							NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						GGCTTGTAAAATGACAACTTAG	0.490													5	3	---	---	---	---	
COL9A1	1297	broad.mit.edu	37	6	70984252	70984252	+	Intron	DEL	T	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70984252delT	uc003pfg.3	-						COL9A1_uc003pfe.3_Intron|COL9A1_uc003pff.3_Intron	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						atcttgttcctttttatggct	0.090													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	101835412	101835415	+	IGR	DEL	GAAA	-	-	rs57947721	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101835412_101835415delGAAA								ASCC3 (506188 upstream) : GRIK2 (11490 downstream)																							aggaaggaaggaaagaaagaaaga	0.137													4	2	---	---	---	---	
ANLN	54443	broad.mit.edu	37	7	36465193	36465194	+	Intron	INS	-	TTAA	TTAA	rs144494427	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36465193_36465194insTTAA	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						gtgagccactgctcccggcTAA	0.104													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659470	57659471	+	IGR	DEL	TA	-	-	rs79867563	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659470_57659471delTA								ZNF716 (126205 upstream) : None (None downstream)																							GCGTTGATCTTACAGTCTGGTG	0.371													7	4	---	---	---	---	
CCDC146	57639	broad.mit.edu	37	7	76923781	76923784	+	Intron	DEL	GTGT	-	-	rs150611810		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76923781_76923784delGTGT	uc003uga.2	+						CCDC146_uc010ldp.2_Intron|CCDC146_uc003ugc.2_Intron	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				TGAGAGGTAGgtgtgtgtgtgtgt	0.402													5	3	---	---	---	---	
SLC26A5	375611	broad.mit.edu	37	7	103015123	103015124	+	Intron	INS	-	T	T	rs72245175		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103015123_103015124insT	uc003vbz.2	-						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Intron|SLC26A5_uc003vby.2_Intron|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						TCCATATAGTGTTTTTTTTTTT	0.158													13	7	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111474750	111474750	+	Intron	DEL	A	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111474750delA	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCCCTAAGTTAAAAAAAAAAA	0.318													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8964466	8964467	+	IGR	INS	-	GTGTGT	GTGTGT	rs68018779	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8964466_8964467insGTGTGT								ERI1 (73617 upstream) : PPP1R3B (29307 downstream)																							TTTTGTAAATCgtgtgtgtgtg	0.292													4	2	---	---	---	---	
DEFB134	613211	broad.mit.edu	37	8	11853467	11853468	+	Intron	INS	-	A	A	rs34837269		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11853467_11853468insA	uc011kxn.1	-							NM_001033019	NP_001028191	Q4QY38	DB134_HUMAN	beta-defensin 134 precursor						defense response to bacterium	extracellular region					0			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.159)		TCAGTTCAGCCAAAAAAAAAAa	0.059													4	2	---	---	---	---	
ADHFE1	137872	broad.mit.edu	37	8	67357547	67357547	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67357547delA	uc003xwb.3	+	6	482	c.448delA	c.(448-450)AATfs	p.N150fs	ADHFE1_uc003xwd.3_RNA|ADHFE1_uc003xwc.3_Frame_Shift_Del_p.N102fs|ADHFE1_uc003xwe.3_RNA|ADHFE1_uc003xwf.3_Intron|ADHFE1_uc011les.1_Frame_Shift_Del_p.N80fs|ADHFE1_uc011leq.1_Intron|ADHFE1_uc011ler.1_Intron	NM_144650	NP_653251	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	150					2-oxoglutarate metabolic process|molecular hydrogen transport	mitochondrial matrix	hydroxyacid-oxoacid transhydrogenase activity|metal ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			TAAGGCTGCTAATCTGTATGC	0.493													129	85	---	---	---	---	
TMEM64	169200	broad.mit.edu	37	8	91637754	91637754	+	3'UTR	DEL	A	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91637754delA	uc003yen.2	-	3					TMEM64_uc003yeo.2_3'UTR|TMEM64_uc011lgf.1_3'UTR	NM_001008495	NP_001008495	Q6YI46	TMM64_HUMAN	transmembrane protein 64 isoform 1							integral to membrane					0			BRCA - Breast invasive adenocarcinoma(11;0.0598)			TTCTTGCTTTAAAAAAAAAAA	0.353													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90940321	90940322	+	IGR	INS	-	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90940321_90940322insA								CDK20 (350654 upstream) : SPIN1 (62518 downstream)																							catcagtttccaaaaaaaaaaa	0.149													4	2	---	---	---	---	
C9orf125	84302	broad.mit.edu	37	9	104239493	104239494	+	Intron	INS	-	AAACAAAC	AAACAAAC	rs67389871	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104239493_104239494insAAACAAAC	uc004bbm.2	-						uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302							integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				GTAACTTaaaaaaacaaacaaa	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6446713	6446716	+	IGR	DEL	CCTT	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6446713_6446716delCCTT								PFKFB3 (169208 upstream) : PRKCQ (22389 downstream)																							tcctcccttcccttccttccttcc	0.000													5	4	---	---	---	---	
GBF1	8729	broad.mit.edu	37	10	104018532	104018533	+	Intron	DEL	AA	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104018532_104018533delAA	uc001kux.1	+						GBF1_uc001kuw.2_Intron|GBF1_uc001kuy.1_Intron|GBF1_uc001kuz.1_Intron	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine						COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		actctgcctcaaaaaaaaaaaa	0.109													6	3	---	---	---	---	
C10orf79	80217	broad.mit.edu	37	10	105924158	105924158	+	Intron	DEL	T	-	-	rs140844875		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105924158delT	uc001kxw.2	-						C10orf79_uc009xxq.2_Intron	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217												0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		ATTCCACAAAttttttttttt	0.149													6	3	---	---	---	---	
ZNF143	7702	broad.mit.edu	37	11	9494462	9494462	+	Intron	DEL	T	-	-	rs141312409		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9494462delT	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		AGtttaattcttttttttttt	0.343													8	4	---	---	---	---	
TPH1	7166	broad.mit.edu	37	11	18042322	18042322	+	3'UTR	DEL	A	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18042322delA	uc001mnp.2	-	10					TPH1_uc009yhe.2_RNA	NM_004179	NP_004170	P17752	TPH1_HUMAN	tryptophan hydroxylase 1						aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity				0					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	AGCTGCTACCAAAAAAAAAAA	0.303													4	2	---	---	---	---	
A2ML1	144568	broad.mit.edu	37	12	9020747	9020748	+	Intron	DEL	TG	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9020747_9020748delTG	uc001quz.3	+						A2ML1_uc001qva.1_Intron|A2ML1_uc010sgm.1_Intron|A2ML1_uc001qvb.1_Intron	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor							extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						CTTTCTCACTTGTAAGAAAAGT	0.416													63	32	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													3	3	---	---	---	---	
CCDC38	120935	broad.mit.edu	37	12	96330081	96330081	+	Intron	DEL	T	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96330081delT	uc001tek.1	-							NM_182496	NP_872302	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38											skin(1)	1						GATTTGAAGATTTTTTTTTTG	0.308													4	2	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109877328	109877339	+	5'Flank	DEL	CCACAGCCTCTA	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109877328_109877339delCCACAGCCTCTA	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						GTGGTCATCTCCACAGCCTCTACCACTTTGGC	0.311													3	9	---	---	---	---	
IFT81	28981	broad.mit.edu	37	12	110606829	110606836	+	Intron	DEL	CCTTCCTT	-	-	rs35097591	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110606829_110606836delCCTTCCTT	uc001tqi.2	+						IFT81_uc001tqh.2_Intron|IFT81_uc001tqj.2_Intron	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1						cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1						ttccttcctcccttccttccttccttcc	0.043													4	3	---	---	---	---	
LHFP	10186	broad.mit.edu	37	13	39943736	39943737	+	Intron	INS	-	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39943736_39943737insT	uc001uxf.2	-							NM_005780	NP_005771	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		tccttccttcctccctctctcc	0.243			T	HMGA2	lipoma								6	3	---	---	---	---	
KIAA1409	57578	broad.mit.edu	37	14	94084806	94084806	+	Intron	DEL	A	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94084806delA	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ATTCTGGAGTAAAAAAAAAAA	0.313													7	4	---	---	---	---	
RCOR1	23186	broad.mit.edu	37	14	103192668	103192668	+	Intron	DEL	A	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103192668delA	uc001ymb.2	+							NM_015156	NP_055971	Q9UKL0	RCOR1_HUMAN	REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1						tctcccctccaaaaaaaaaaa	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84981001	84981001	+	IGR	DEL	C	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84981001delC								LOC388152 (82081 upstream) : GOLGA6L5 (66737 downstream)																							ACCTCCCTTTCCAAGCCTGCC	0.582													4	2	---	---	---	---	
CCDC135	84229	broad.mit.edu	37	16	57764612	57764613	+	Intron	INS	-	CT	CT	rs140947586	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57764612_57764613insCT	uc002emi.2	+						CCDC135_uc002emj.2_Intron|CCDC135_uc002emk.2_Intron	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135							cytoplasm				central_nervous_system(1)	1						AGTCTTGCCCCGTTCTGATCTC	0.307													4	3	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58564365	58564366	+	Intron	INS	-	T	T			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58564365_58564366insT	uc002env.2	-						CNOT1_uc002enw.2_Intron|CNOT1_uc002enu.3_Intron|CNOT1_uc002ent.2_Intron|CNOT1_uc010vik.1_Intron	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TAAGTAGAGAATACTAATGTTA	0.238													11	5	---	---	---	---	
NFATC3	4775	broad.mit.edu	37	16	68243753	68243754	+	Intron	INS	-	AC	AC	rs149664233	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68243753_68243754insAC	uc002evo.1	+						NFATC3_uc010vkm.1_Intron|NFATC3_uc010vkn.1_Intron|NFATC3_uc010vkp.1_Intron|NFATC3_uc010vkq.1_Intron|NFATC3_uc002evm.1_Intron|NFATC3_uc002evn.1_Intron|NFATC3_uc010vks.1_Intron|NFATC3_uc010vkt.1_Intron|NFATC3_uc010vkv.1_Intron|NFATC3_uc010vkw.1_Intron|NFATC3_uc010vky.1_Intron|NFATC3_uc010vkz.1_Intron|NFATC3_uc010vlb.1_Intron|NFATC3_uc010vlc.1_Intron	NM_173165	NP_775188	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells,						inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		cacacacacagacacacacaca	0.208													4	2	---	---	---	---	
MYH3	4621	broad.mit.edu	37	17	10544822	10544833	+	Intron	DEL	TGTCTTTTTTTT	-	-	rs72032178		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10544822_10544833delTGTCTTTTTTTT	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						GATTTAACTCTGTCtttttttttttttttttt	0.127													3	5	---	---	---	---	
MYH3	4621	broad.mit.edu	37	17	10547483	10547486	+	Intron	DEL	AAAC	-	-	rs147605554		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10547483_10547486delAAAC	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						caaaaaaaaaaaacaaacaaaaaa	0.201													4	5	---	---	---	---	
SUPT6H	6830	broad.mit.edu	37	17	27014943	27014944	+	Intron	DEL	TT	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27014943_27014944delTT	uc002hby.2	+						SUPT6H_uc010crt.2_Intron|SUPT6H_uc002hbz.1_5'Flank	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog						chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					AAAGCAAAACtttttttttttt	0.302													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32560352	32560353	+	IGR	INS	-	AGAA	AGAA	rs140694482	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32560352_32560353insAGAA								ACCN1 (76527 upstream) : CCL2 (21943 downstream)																							gaaagagagagagaaagaaaga	0.000													5	5	---	---	---	---	
SOCS7	30837	broad.mit.edu	37	17	36546898	36546901	+	Intron	DEL	TTCC	-	-	rs34208536		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36546898_36546901delTTCC	uc002hqa.2	+						SOCS7_uc010cvl.2_Intron|SOCS7_uc002hqb.2_Intron	NM_014598	NP_055413	O14512	SOCS7_HUMAN	suppressor of cytokine signaling 7						intracellular signal transduction|negative regulation of signal transduction|regulation of growth	cytoplasm|nucleus|plasma membrane	protein binding|SH3 domain binding			skin(1)	1	Breast(7;3.47e-17)					tttgttcgttttccttccttcctt	0.000													4	3	---	---	---	---	
FAM59A	64762	broad.mit.edu	37	18	29973144	29973144	+	Intron	DEL	T	-	-	rs10708225		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29973144delT	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A											ovary(1)|skin(1)	2						CTCTGAATTGttttttttttt	0.308													4	3	---	---	---	---	
GALR1	2587	broad.mit.edu	37	18	74964874	74964879	+	Intron	DEL	CACCAT	-	-	rs5826510		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74964874_74964879delCACCAT	uc002lms.3	+							NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1						digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		ccaccaccaccaccatcaccaccacc	0.000													4	4	---	---	---	---	
EML2	24139	broad.mit.edu	37	19	46125009	46125009	+	Intron	DEL	T	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46125009delT	uc002pcn.2	-						EML2_uc002pco.2_Intron|EML2_uc002pcp.2_Intron|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_Intron|EML2_uc010ekj.2_Intron	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		cttttccaccttttttttttt	0.199													4	2	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49407783	49407784	+	Intron	DEL	TC	-	-			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49407783_49407784delTC	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		AGGACTGGtttctttttttttt	0.327													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57870034	57870035	+	IGR	INS	-	TG	TG	rs141058133	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57870034_57870035insTG								ZNF831 (35869 upstream) : EDN3 (5464 downstream)																							TAAGTTGAGACtgtgtgtgtgt	0.391													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	16055958	16055959	+	IGR	INS	-	AAGG	AAGG	rs146806868	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16055958_16055959insAAGG								SAMSN1 (100235 upstream) : NRIP1 (277597 downstream)																							aggaaagaagaaaggaagaaag	0.079													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499424	40499424	+	IGR	DEL	G	-	-	rs2410102		TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499424delG								ETS2 (302548 upstream) : PSMG1 (47966 downstream)																							gttttgttttgttttttttgC	0.313													10	5	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47419706	47419707	+	Intron	INS	-	G	G	rs149102148	by1000genomes	TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47419706_47419707insG	uc002zhu.1	+						COL6A1_uc010gqd.1_Intron|COL6A1_uc002zhv.1_5'Flank|COL6A1_uc002zhw.1_5'Flank	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	ACGCTGCTCACGGGGGGGTGGG	0.624													4	2	---	---	---	---	
ATP11C	286410	broad.mit.edu	37	X	138871361	138871362	+	Intron	INS	-	A	A			TCGA-BP-4960-01A-01D-1462-08	TCGA-BP-4960-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138871361_138871362insA	uc004faz.2	-						ATP11C_uc004fay.2_Intron|ATP11C_uc004fba.2_Intron	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a						ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					gactccatctcaaaaaaaaaaa	0.119													6	4	---	---	---	---	
