Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PLEKHG5	57449	broad.mit.edu	37	1	6532596	6532596	+	Silent	SNP	C	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6532596C>G	uc001ano.1	-	11	1340	c.1239G>C	c.(1237-1239)GTG>GTC	p.V413V	PLEKHG5_uc001ann.1_Silent_p.V394V|PLEKHG5_uc001anq.1_Silent_p.V434V|PLEKHG5_uc001anp.1_Silent_p.V434V|PLEKHG5_uc001anj.1_5'Flank|PLEKHG5_uc009vma.1_Silent_p.V197V|PLEKHG5_uc010nzr.1_Silent_p.V426V|PLEKHG5_uc001ank.1_Silent_p.V357V|PLEKHG5_uc009vmb.1_Silent_p.V357V|PLEKHG5_uc001anl.1_Silent_p.V357V|PLEKHG5_uc001anm.1_Silent_p.V357V	NM_001042663	NP_001036128	O94827	PKHG5_HUMAN	pleckstrin homology domain containing family G	413	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		CGTTGATGATCACCCGCAGTT	0.642													10	15	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12336481	12336481	+	Missense_Mutation	SNP	C	T	T	rs41279448	byFrequency	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12336481C>T	uc001atv.2	+	19	2977	c.2836C>T	c.(2836-2838)CGC>TGC	p.R946C	VPS13D_uc001atw.2_Missense_Mutation_p.R946C|VPS13D_uc001atx.2_Missense_Mutation_p.R134C	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	946					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCAGCATACCCGCGAGGTTCT	0.488											OREG0013110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	59	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974955	16974955	+	RNA	SNP	A	G	G	rs149751487	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974955A>G	uc010och.1	+	7		c.1415A>G			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						GCATGCTTTGATGTCTGGGAC	0.657													4	43	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22920118	22920118	+	Silent	SNP	C	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22920118C>G	uc001bfx.1	+	7	1667	c.1542C>G	c.(1540-1542)GCC>GCG	p.A514A		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	514	Extracellular (Potential).|Fibronectin type-III 2.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGTCCGAGCCCGCACCTCAG	0.687													4	8	---	---	---	---	PASS
AK2	204	broad.mit.edu	37	1	33476292	33476292	+	3'UTR	SNP	A	G	G	rs74066439		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33476292A>G	uc001bwo.1	-	7					uc001bwn.2_Intron|AK2_uc010ohq.1_3'UTR|AK2_uc009vud.1_3'UTR	NM_013411	NP_037543	P54819	KAD2_HUMAN	adenylate kinase 2 isoform b						nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TGTTGTTCCAAGTATTCCTCT	0.473													7	10	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214171381	214171381	+	Silent	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214171381C>T	uc001hkh.2	+	2	1775	c.1503C>T	c.(1501-1503)TCC>TCT	p.S501S	PROX1_uc001hkg.1_Silent_p.S501S	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	501					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		GTGCTCCCTCCGGCTCCTTCT	0.562													16	107	---	---	---	---	PASS
TTC13	79573	broad.mit.edu	37	1	231076263	231076263	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231076263C>A	uc001huf.3	-	7	743	c.712G>T	c.(712-714)GAC>TAC	p.D238Y	TTC13_uc009xfi.2_Missense_Mutation_p.D185Y|TTC13_uc009xfj.2_RNA|TTC13_uc001hug.3_Missense_Mutation_p.D185Y|TTC13_uc009xfk.1_Missense_Mutation_p.D128Y	NM_024525	NP_078801	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13 isoform a	238	TPR 2.						binding			ovary(1)|skin(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		TTAGTGAGGTCATTCACTGCT	0.448													24	47	---	---	---	---	PASS
ZFP36L2	678	broad.mit.edu	37	2	43452170	43452170	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43452170A>G	uc002rsv.3	-	2	1064	c.773T>C	c.(772-774)CTC>CCC	p.L258P	LOC100129726_uc010ynx.1_5'Flank	NM_006887	NP_008818	P47974	TISD_HUMAN	zinc finger protein 36, C3H type-like 2	258					cell proliferation	nucleus	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				CGAGAAGCTGAGGCTGTGGTG	0.682													8	16	---	---	---	---	PASS
CCDC142	84865	broad.mit.edu	37	2	74709054	74709054	+	Missense_Mutation	SNP	T	G	G	rs138040614		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74709054T>G	uc002slr.2	-	1	1304	c.911A>C	c.(910-912)CAA>CCA	p.Q304P	TTC31_uc002sls.2_5'Flank|TTC31_uc010yrv.1_5'Flank|TTC31_uc002slt.2_5'Flank|TTC31_uc002slu.2_5'Flank|CCDC142_uc002slo.2_RNA|CCDC142_uc002slq.2_Missense_Mutation_p.Q304P|CCDC142_uc002slp.2_Missense_Mutation_p.Q304P	NM_032779	NP_116168	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	304										central_nervous_system(1)	1						GGTCCAGTATTGGCTCCACAA	0.662													32	46	---	---	---	---	PASS
IMMT	10989	broad.mit.edu	37	2	86389158	86389158	+	Silent	SNP	A	C	C			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86389158A>C	uc002sqz.3	-	8	1225	c.837T>G	c.(835-837)GGT>GGG	p.G279G	IMMT_uc002sqy.3_Silent_p.G20G|IMMT_uc002srb.3_Silent_p.G268G|IMMT_uc002sra.3_Silent_p.G278G|IMMT_uc010ytd.1_Silent_p.G267G|IMMT_uc010yte.1_Silent_p.G232G|IMMT_uc002src.1_Silent_p.G20G|IMMT_uc002srd.2_Silent_p.G279G|IMMT_uc002sre.3_Silent_p.G267G|IMMT_uc010ytf.1_Silent_p.G201G|IMMT_uc010fgs.1_Silent_p.G276G	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	279	Mitochondrial intermembrane (Potential).					integral to mitochondrial inner membrane	protein binding			skin(1)	1						CCTTCAATGCACCCTCCACTG	0.398													6	13	---	---	---	---	PASS
DDX11L2	84771	broad.mit.edu	37	2	114357557	114357557	+	Nonstop_Mutation	SNP	A	G	G	rs115341812	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114357557A>G	uc010yxx.1	-	3	709	c.382T>C	c.(382-384)TAG>CAG	p.*128Q						SubName: Full=DEAD/H box polypeptide 11 like 2;												0						GCCTACTTCTAGTGAAACTGG	0.567													4	23	---	---	---	---	PASS
TADA3	10474	broad.mit.edu	37	3	9825848	9825848	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9825848C>A	uc003bsx.1	-	8	1518	c.970G>T	c.(970-972)GCC>TCC	p.A324S	TADA3_uc010hcn.1_Missense_Mutation_p.A324S|TADA3_uc003bsy.2_Missense_Mutation_p.A324S|TADA3_uc003bsw.1_Missense_Mutation_p.A153S	NM_006354	NP_006345	O75528	TADA3_HUMAN	transcriptional adaptor 3 isoform a	324					estrogen receptor signaling pathway|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	ligand-dependent nuclear receptor binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity				0						AGGCCCTGGGCAATTAGCTCC	0.612													3	31	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183734	10183734	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183734C>A	uc003bvc.2	+	1	416	c.203C>A	c.(202-204)TCG>TAG	p.S68*	VHL_uc003bvd.2_Nonsense_Mutation_p.S68*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	68			Missing (in VHLD; type I).|S -> W (in pheochromocytoma and VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.S68*(12)|p.S68P(2)|p.N67fs*59(1)|p.S68S(1)|p.R60fs*35(1)|p.N67_V74del(1)|p.S68L(1)|p.S68T(1)|p.N67fs*64(1)|p.N67fs*63(1)|p.P61fs*61(1)|p.R69fs*63(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TCGGTGAACTCGCGCGAGCCC	0.716		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				7	6	---	---	---	---	PASS
PARP15	165631	broad.mit.edu	37	3	122345722	122345722	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122345722C>T	uc003efm.2	+	9	1346	c.1280C>T	c.(1279-1281)GCT>GTT	p.A427V	PARP15_uc003efn.2_Intron|PARP15_uc003efo.1_Missense_Mutation_p.A174V|PARP15_uc003efp.1_Missense_Mutation_p.A193V|PARP15_uc011bjt.1_Intron	NM_001113523	NP_001106995	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	405	Macro 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5				GBM - Glioblastoma multiforme(114;0.0531)		ATAATCGATGCTATTGTAGAC	0.353													10	117	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121828700	121828700	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121828700C>T	uc003idn.2	-	2	356	c.106G>A	c.(106-108)GGA>AGA	p.G36R	PRDM5_uc003ido.2_Missense_Mutation_p.G36R|PRDM5_uc010ine.2_Missense_Mutation_p.G36R|PRDM5_uc010inf.2_Missense_Mutation_p.G36R|PRDM5_uc003idp.1_Missense_Mutation_p.G36R	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	36	SET.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						GCAAAGGGTCCGAACTTTTCA	0.343													70	155	---	---	---	---	PASS
ELF2	1998	broad.mit.edu	37	4	139983076	139983076	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139983076C>T	uc003ihp.1	-	7	919	c.713G>A	c.(712-714)TGG>TAG	p.W238*	ELF2_uc003ihm.1_Nonsense_Mutation_p.W190*|ELF2_uc003ihn.1_Nonsense_Mutation_p.W178*|ELF2_uc003iho.1_Nonsense_Mutation_p.W161*|ELF2_uc011chc.1_Nonsense_Mutation_p.W53*	NM_201999	NP_973728	Q15723	ELF2_HUMAN	E74-like factor 2 (ets domain transcription	250	ETS.				negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)					ATGCTTTCCCCAAAGCTTAGA	0.363													57	143	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175896895	175896895	+	Silent	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175896895G>A	uc003iuc.2	+	5	889	c.219G>A	c.(217-219)TTG>TTA	p.L73L	ADAM29_uc003iud.2_Silent_p.L73L|ADAM29_uc010irr.2_Silent_p.L73L|ADAM29_uc011cki.1_Silent_p.L73L	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	73					proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AGAAGCTTTTGTTTTCCAAAC	0.493													21	70	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21752149	21752149	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21752149T>A	uc010iuc.2	-	12	2540	c.2082A>T	c.(2080-2082)AAA>AAT	p.K694N	CDH12_uc011cno.1_Missense_Mutation_p.K654N|CDH12_uc003jgk.2_Missense_Mutation_p.K694N|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	694	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						GAGAGTCTGGTTTTATATCCC	0.453										HNSCC(59;0.17)			46	107	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37186442	37186442	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37186442A>C	uc011cpa.1	-	24	4366	c.4135T>G	c.(4135-4137)TTA>GTA	p.L1379V	C5orf42_uc011coy.1_5'Flank|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.L454V|C5orf42_uc011cpb.1_Missense_Mutation_p.L260V	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	1379										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TTGTCTCTTAAAGGAACCCTC	0.353													59	120	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115323525	115323525	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115323525C>T	uc003kro.2	+	4	1158	c.994C>T	c.(994-996)CGG>TGG	p.R332W	AQPEP_uc003krp.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	332	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						CATCTGGGCCCGGAAAGATGC	0.418													40	150	---	---	---	---	PASS
GFRAL	389400	broad.mit.edu	37	6	55216193	55216193	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55216193A>G	uc003pcm.1	+	5	599	c.513A>G	c.(511-513)ATA>ATG	p.I171M		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	171	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			AAGCAGCCATACGGTTCTTCT	0.438													10	287	---	---	---	---	PASS
ORC5L	5001	broad.mit.edu	37	7	103777250	103777250	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103777250C>G	uc003vcb.2	-	13	1351	c.1240G>C	c.(1240-1242)GAC>CAC	p.D414H	ORC5L_uc011klp.1_Missense_Mutation_p.D282H	NM_002553	NP_002544	O43913	ORC5_HUMAN	origin recognition complex subunit 5 isoform 1	414					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding				0						CTGATGAAGTCTAGAGACACT	0.358													16	164	---	---	---	---	PASS
ZNF800	168850	broad.mit.edu	37	7	127013721	127013721	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127013721C>G	uc003vlx.1	-	5	1932	c.1669G>C	c.(1669-1671)GAG>CAG	p.E557Q	ZNF800_uc003vlw.1_Missense_Mutation_p.E460Q|ZNF800_uc003vly.1_Missense_Mutation_p.E557Q|ZNF800_uc010lla.2_Missense_Mutation_p.E557Q	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN	zinc finger protein 800	557					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GCTCTGATCTCTAAACTGGCT	0.363													51	140	---	---	---	---	PASS
ATP6V1B2	526	broad.mit.edu	37	8	20077883	20077883	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20077883A>T	uc003wzp.2	+	14	1720	c.1506A>T	c.(1504-1506)GAA>GAT	p.E502D	ATP6V1B2_uc003wzq.1_RNA	NM_001693	NP_001684	P21281	VATB2_HUMAN	vacuolar H+ATPase B2	502					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|endomembrane system|Golgi apparatus|melanosome|plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)		CCCTCAGCGAATTTTACCCTC	0.463													37	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	15001690	15001690	+	Intron	SNP	A	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15001690A>G	uc003zln.1	-						LOC389705_uc010mid.1_RNA					Homo sapiens cDNA FLJ46077 fis, clone TESTI2003768, weakly  similar to Chloride channel protein 3.																		GAAAAATTGTATAATTGTTCC	0.289													76	208	---	---	---	---	PASS
SECISBP2	79048	broad.mit.edu	37	9	91972394	91972394	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91972394G>A	uc004aqj.1	+	15	2262	c.2182G>A	c.(2182-2184)GCT>ACT	p.A728T	SECISBP2_uc011ltk.1_Missense_Mutation_p.A727T|SECISBP2_uc004aqk.1_Missense_Mutation_p.A655T|SECISBP2_uc010mqo.1_Missense_Mutation_p.A433T|SECISBP2_uc011ltl.1_Missense_Mutation_p.A660T	NM_024077	NP_076982	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	728					translation	nucleus	mRNA 3'-UTR binding			ovary(2)|skin(1)	3						CTTTGTGTTTGCTCTCAACCG	0.498													122	262	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139906470	139906470	+	Silent	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139906470C>T	uc011mem.1	-	34	5506	c.5358G>A	c.(5356-5358)CTG>CTA	p.L1786L	ABCA2_uc011mel.1_Silent_p.L1787L|ABCA2_uc004ckl.1_Silent_p.L1717L|ABCA2_uc004ckm.1_Silent_p.L1817L	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	1786					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TGCCCTGCAGCCTGGGGCAAG	0.632													15	47	---	---	---	---	PASS
MARCH8	220972	broad.mit.edu	37	10	45959707	45959707	+	Silent	SNP	T	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45959707T>A	uc001jci.1	-	4	461	c.222A>T	c.(220-222)CCA>CCT	p.P74P	MARCH8_uc001jch.2_Silent_p.P74P|MARCH8_uc001jcj.1_Silent_p.P74P|MARCH8_uc001jck.1_Silent_p.P74P|MARCH8_uc001jcg.1_5'Flank	NM_001002266	NP_001002266	Q5T0T0	MARH8_HUMAN	cellular modulator of immune recognition isoform	74	RING-CH-type.					cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding				0						CCTGGCTGGATGGCGTGATAG	0.532													20	102	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72493772	72493772	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72493772G>A	uc001jrh.2	+	8	1340	c.1340G>A	c.(1339-1341)AGC>AAC	p.S447N	ADAMTS14_uc001jrg.2_Missense_Mutation_p.S450N|ADAMTS14_uc001jri.1_5'UTR	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	447	Peptidase M12B.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						CTGGAGCTCAGCCGCTACCTC	0.642													27	54	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1017820	1017820	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1017820C>T	uc001lsw.2	-	31	5032	c.4981G>A	c.(4981-4983)GCC>ACC	p.A1661T		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1661	Pro-rich.|Thr-rich.|1; truncated.|Approximate repeats.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GACCCTGTGGCCTTGAGCGTT	0.567													42	637	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14852297	14852297	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14852297C>A	uc001mln.2	+	8	2214	c.1861C>A	c.(1861-1863)CAA>AAA	p.Q621K	PDE3B_uc010rcr.1_Missense_Mutation_p.Q570K	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	621					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						GGAAACTCAACAAGAAGAGGA	0.328													34	71	---	---	---	---	PASS
SLC22A6	9356	broad.mit.edu	37	11	62744739	62744739	+	Silent	SNP	A	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62744739A>G	uc001nwk.2	-	9	1789	c.1482T>C	c.(1480-1482)CCT>CCC	p.P494P	SLC22A6_uc001nwl.2_Intron|SLC22A6_uc001nwj.2_Silent_p.P494P|SLC22A6_uc001nwm.2_Intron	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a	494	Helical; (Potential).				alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0						TGGCGGCCACAGGAACAGCAC	0.637													37	86	---	---	---	---	PASS
FADD	8772	broad.mit.edu	37	11	70052630	70052630	+	3'UTR	SNP	T	C	C			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70052630T>C	uc001opm.2	+	2						NM_003824	NP_003815	Q13158	FADD_HUMAN	Fas-associated via death domain						activation of caspase activity|activation of pro-apoptotic gene products|cellular response to mechanical stimulus|defense response to virus|induction of apoptosis via death domain receptors|innate immune response|interspecies interaction between organisms|necrotic cell death|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|signal transduction	cytosol	death receptor binding|identical protein binding			ovary(1)|lung(1)|pancreas(1)	3	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CAGCCTGGACTTTGGTTCTCT	0.577													3	28	---	---	---	---	PASS
FAM168A	23201	broad.mit.edu	37	11	73130927	73130927	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73130927G>A	uc001otz.1	-	5	575	c.296C>T	c.(295-297)GCG>GTG	p.A99V	FAM168A_uc001oty.1_Missense_Mutation_p.A90V|FAM168A_uc009ytp.1_Missense_Mutation_p.A90V	NM_015159	NP_055974	Q92567	F168A_HUMAN	hypothetical protein LOC23201	99											0						ACTGAAAGCCGCAGAGGATGC	0.502													24	67	---	---	---	---	PASS
APOBEC1	339	broad.mit.edu	37	12	7807218	7807218	+	Silent	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7807218G>A	uc001qtb.2	-	2	61	c.27C>T	c.(25-27)ACC>ACT	p.T9T	APOBEC1_uc001qtc.2_Intron|APOBEC1_uc010sgf.1_Silent_p.T9T	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	9					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						TGGGGTCACCGGTTGAAGGAC	0.323													32	72	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082243	8082243	+	Intron	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082243C>T	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		AAGTGAAATACTTTAAGACAC	0.254													3	23	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082245	8082245	+	Intron	SNP	T	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082245T>G	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GTGAAATACTTTAAGACACGT	0.254													3	27	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	9548786	9548786	+	RNA	SNP	T	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9548786T>G	uc009zgp.2	+	4		c.2961T>G								Homo sapiens cDNA clone IMAGE:4838157.																		ttctcttactttggtaacatc	0.119													3	2	---	---	---	---	PASS
ESPL1	9700	broad.mit.edu	37	12	53673565	53673565	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53673565G>T	uc001sck.2	+	12	2505	c.2414G>T	c.(2413-2415)AGA>ATA	p.R805I	ESPL1_uc001scj.2_Missense_Mutation_p.R480I|ESPL1_uc010soe.1_Missense_Mutation_p.R16I	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	805					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						GTCTCTGAGAGACTGAAGGAC	0.597													33	106	---	---	---	---	PASS
RPS26	6231	broad.mit.edu	37	12	56437240	56437240	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56437240G>A	uc001sjf.2	+	3	540	c.275G>A	c.(274-276)CGC>CAC	p.R92H		NM_001029	NP_001020	P62854	RS26_HUMAN	ribosomal protein S26	92					endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|protein binding|structural constituent of ribosome			breast(1)	1			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CGTGAAGCCCGCAAGGACCGA	0.483													5	123	---	---	---	---	PASS
C12orf63	374467	broad.mit.edu	37	12	97051866	97051866	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97051866G>T	uc001tet.1	+	4	660	c.582G>T	c.(580-582)CAG>CAT	p.Q194H		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	194										skin(6)|ovary(1)	7						TTGCCATTCAGTTCAATACAG	0.303													35	110	---	---	---	---	PASS
SIRT4	23409	broad.mit.edu	37	12	120741603	120741603	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120741603G>T	uc001tyc.2	+	2	259	c.239G>T	c.(238-240)GGG>GTG	p.G80V		NM_012240	NP_036372	Q9Y6E7	SIRT4_HUMAN	sirtuin 4	80	Deacetylase sirtuin-type.|NAD (By similarity).				chromatin silencing|negative regulation of insulin secretion|protein ADP-ribosylation|protein deacetylation	mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|protein binding|zinc ion binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAAAAAGTGGGGCTTTATGCC	0.562													23	68	---	---	---	---	PASS
PNP	4860	broad.mit.edu	37	14	20940624	20940624	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20940624C>T	uc001vxo.3	+	2	311	c.169C>T	c.(169-171)CCC>TCC	p.P57S	PNP_uc010ahm.1_Missense_Mutation_p.P57S|PNP_uc010ahn.2_Missense_Mutation_p.P57S|PNP_uc001vxn.3_5'UTR	NM_000270	NP_000261	P00491	PNPH_HUMAN	nucleoside phosphorylase	57					immune response|inosine catabolic process|interleukin-2 secretion|NAD biosynthesis via nicotinamide riboside salvage pathway|nicotinamide riboside catabolic process|positive regulation of alpha-beta T cell differentiation|positive regulation of T cell proliferation|purine base metabolic process|purine nucleotide catabolic process|purine-containing compound salvage|response to drug|urate biosynthetic process	cytoskeleton|cytosol	drug binding|nucleoside binding|phosphate binding|purine base binding|purine-nucleoside phosphorylase activity			ovary(2)	2					Aciclovir(DB00787)|Cladribine(DB00242)|Mercaptopurine(DB01033)	CCCCAACTTTCCCCGAAGTAC	0.478													25	64	---	---	---	---	PASS
CDH24	64403	broad.mit.edu	37	14	23522709	23522709	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23522709T>C	uc001wil.2	-	7	1482	c.1222A>G	c.(1222-1224)ATC>GTC	p.I408V	CDH24_uc010akf.2_Missense_Mutation_p.I408V|CDH24_uc001win.3_Missense_Mutation_p.I408V	NM_022478	NP_071923	Q86UP0	CAD24_HUMAN	cadherin-like 24 isoform 1	408	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|cell-cell adhesion|homophilic cell adhesion	cell-cell junction|cell-cell junction|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|delta-catenin binding			central_nervous_system(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		ACCTACCTGATTGGGCTGGCA	0.612													8	35	---	---	---	---	PASS
PAX9	5083	broad.mit.edu	37	14	37132609	37132609	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37132609C>T	uc001wty.3	+	3	1229	c.512C>T	c.(511-513)GCC>GTC	p.A171V	PAX9_uc010amq.2_5'Flank	NM_006194	NP_006185	P55771	PAX9_HUMAN	paired box 9	171	Interaction with KDM5B.				multicellular organismal development|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		GCGGCGGCCGCCAAGGTGCCC	0.682													8	20	---	---	---	---	PASS
ASB2	51676	broad.mit.edu	37	14	94419726	94419726	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94419726G>T	uc001ycc.1	-	3	951	c.462C>A	c.(460-462)AAC>AAA	p.N154K	ASB2_uc001ycd.2_Missense_Mutation_p.N202K|ASB2_uc001yce.1_Missense_Mutation_p.N100K	NM_016150	NP_057234	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box-containing protein	154					intracellular signal transduction					ovary(1)|pancreas(1)	2		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		CTCGGGATTTGTTGGAGATGT	0.587													6	212	---	---	---	---	PASS
RFX7	64864	broad.mit.edu	37	15	56395867	56395867	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56395867T>A	uc010bfn.2	-	5	403	c.403A>T	c.(403-405)AGC>TGC	p.S135C	RFX7_uc010ugk.1_5'Flank|RFX7_uc002adn.1_5'Flank	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	38	RFX-type winged-helix.				regulation of transcription, DNA-dependent	nucleus	DNA binding				0						TCACAATAGCTCCTGCAAAAG	0.398													6	10	---	---	---	---	PASS
HMG20A	10363	broad.mit.edu	37	15	77763256	77763256	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77763256A>G	uc002bcr.2	+	6	656	c.455A>G	c.(454-456)TAC>TGC	p.Y152C	HMG20A_uc002bcs.2_Missense_Mutation_p.Y152C	NM_018200	NP_060670	Q9NP66	HM20A_HUMAN	high-mobility group 20A	152	HMG box.				chromatin modification	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						TCCTAGCGCTACCTTGATGAA	0.358													20	47	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79750572	79750572	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79750572C>T	uc002bew.1	+	2	2158	c.2083C>T	c.(2083-2085)CGG>TGG	p.R695W	KIAA1024_uc010unk.1_Missense_Mutation_p.R695W	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	695						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						TGAAAGCCTGCGGGTCAAGGC	0.542													6	200	---	---	---	---	PASS
BCAR1	9564	broad.mit.edu	37	16	75276437	75276437	+	Silent	SNP	C	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75276437C>T	uc002fdv.2	-	2	687	c.564G>A	c.(562-564)GGG>GGA	p.G188G	BCAR1_uc010cgu.2_Silent_p.G159G|BCAR1_uc010vna.1_Silent_p.G186G|BCAR1_uc010vnb.1_Silent_p.G234G|BCAR1_uc002fdw.2_Silent_p.G188G|BCAR1_uc010vnc.1_Intron|BCAR1_uc010vnd.1_Silent_p.G206G|BCAR1_uc002fdx.2_Silent_p.G206G	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	188	Substrate for kinases (By similarity).				actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		AGATGTCATGCCCCATCCCGG	0.652													4	139	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10432798	10432798	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10432798G>A	uc010coi.2	-	25	3246	c.3118C>T	c.(3118-3120)CTT>TTT	p.L1040F	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.L1040F|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1040	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GACCCTTCAAGCTAAATATAA	0.388													44	146	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11845736	11845736	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11845736T>A	uc002gne.2	+	67	12845	c.12777T>A	c.(12775-12777)TGT>TGA	p.C4259*	DNAH9_uc010coo.2_Nonsense_Mutation_p.C3477*|DNAH9_uc002gnf.2_Nonsense_Mutation_p.C571*	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	4259					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCCAGGAGTGTGGCCGGATGA	0.532													12	84	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34190556	34190556	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34190556G>A	uc002hke.1	-	7	724	c.575C>T	c.(574-576)ACT>ATT	p.T192I	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Missense_Mutation_p.T152I|C17orf66_uc010wcm.1_Missense_Mutation_p.T158I	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	192							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CTCTGGACCAGTTTGGGCCTA	0.353													23	80	---	---	---	---	PASS
ACLY	47	broad.mit.edu	37	17	40061042	40061042	+	Silent	SNP	G	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40061042G>T	uc002hyg.2	-	10	1168	c.1005C>A	c.(1003-1005)GGC>GGA	p.G335G	ACLY_uc002hyh.2_Silent_p.G335G|ACLY_uc002hyi.2_Silent_p.G389G|ACLY_uc010wfx.1_Silent_p.G389G|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1	335					ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				TGAGGATCTTGCCTGGATTTG	0.473													11	52	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40330118	40330118	+	Silent	SNP	A	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40330118A>G	uc002hzb.2	-	4	918	c.585T>C	c.(583-585)AAT>AAC	p.N195N		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	195	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGGGACTCACATTATTGGCCT	0.607													45	142	---	---	---	---	PASS
ABCA5	23461	broad.mit.edu	37	17	67302951	67302951	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67302951A>T	uc002jif.2	-	5	1921	c.703T>A	c.(703-705)TTT>ATT	p.F235I	ABCA5_uc002jig.2_Missense_Mutation_p.F235I|ABCA5_uc002jih.2_Missense_Mutation_p.F235I|ABCA5_uc010dfe.2_Missense_Mutation_p.F235I	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5	235	Helical; (Potential).				cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					ATTGCCAAAAAGTATCCAAAA	0.299													28	70	---	---	---	---	PASS
XAB2	56949	broad.mit.edu	37	19	7688070	7688070	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7688070C>G	uc002mgx.2	-	9	1251	c.1225G>C	c.(1225-1227)GGA>CGA	p.G409R		NM_020196	NP_064581	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	409					transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding			central_nervous_system(2)|breast(1)|skin(1)	4						TCCAGCTGTCCGTTGTCCTCA	0.368								Direct_reversal_of_damage|NER					25	84	---	---	---	---	PASS
ZNF738	148203	broad.mit.edu	37	19	21544571	21544571	+	Missense_Mutation	SNP	G	A	A	rs1142653	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21544571G>A	uc002nps.3	+	2	215	c.7G>A	c.(7-9)GAC>AAC	p.D3N	ZNF738_uc002npt.3_RNA	NR_027130				SubName: Full=cDNA FLJ14673 fis, clone NT2RP2003714, moderately similar to Zinc finger protein 430;												0						CCCATAGGACGACCTGAGGTA	0.453													3	41	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22362673	22362673	+	3'UTR	SNP	G	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22362673G>T	uc002nqs.1	-	3						NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CACCTTTGTAGATTTTCTCTC	0.343													6	31	---	---	---	---	PASS
TSKS	60385	broad.mit.edu	37	19	50266419	50266419	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50266419G>A	uc002ppm.2	-	1	97	c.86C>T	c.(85-87)TCC>TTC	p.S29F		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	29							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		GACTAGCTGGGAGCAGCTCTC	0.642													27	141	---	---	---	---	PASS
ZNF610	162963	broad.mit.edu	37	19	52856954	52856954	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52856954A>G	uc002pyx.3	+	4	489	c.83A>G	c.(82-84)GAC>GGC	p.D28G	ZNF610_uc002pyy.3_Missense_Mutation_p.D28G|ZNF610_uc002pyz.3_Missense_Mutation_p.D28G|ZNF610_uc002pza.2_Missense_Mutation_p.D28G	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	28	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		ACATTCATGGACGTGGCCATC	0.418													7	169	---	---	---	---	PASS
PHF20	51230	broad.mit.edu	37	20	34487362	34487362	+	Silent	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34487362G>A	uc002xek.1	+	10	1464	c.1353G>A	c.(1351-1353)AAG>AAA	p.K451K	PHF20_uc002xei.1_Silent_p.K451K|PHF20_uc010gfo.1_Silent_p.K451K|PHF20_uc002xej.1_Silent_p.K335K	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	451					regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					TAGACCATAAGTTTAGATGCA	0.358													4	105	---	---	---	---	PASS
SYNJ1	8867	broad.mit.edu	37	21	34099147	34099147	+	Silent	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34099147G>A	uc002yqh.2	-	2	177	c.177C>T	c.(175-177)CTC>CTT	p.L59L	SYNJ1_uc011ads.1_Silent_p.L20L|SYNJ1_uc002yqf.2_Silent_p.L20L|SYNJ1_uc002yqg.2_Silent_p.L20L|SYNJ1_uc002yqi.2_Silent_p.L59L|uc002yqj.1_5'Flank|uc002yqk.2_5'Flank	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	20							inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5						TTTCCACTATGAGGCTGAAAG	0.483													36	71	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26693016	26693016	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26693016G>A	uc003acb.2	+	4	1288	c.1132G>A	c.(1132-1134)GGC>AGC	p.G378S	SEZ6L_uc003acc.2_Missense_Mutation_p.G378S|SEZ6L_uc011akc.1_Missense_Mutation_p.G378S|SEZ6L_uc003acd.2_Missense_Mutation_p.G378S|SEZ6L_uc011akd.1_Missense_Mutation_p.G378S|SEZ6L_uc003ace.2_Missense_Mutation_p.G378S|SEZ6L_uc003acf.1_Missense_Mutation_p.G151S|SEZ6L_uc010gvc.1_Missense_Mutation_p.G151S	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	378	CUB 1.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						CCAGGACGACGGCCTTGGGAC	0.557													12	28	---	---	---	---	PASS
FAM183A	440585	broad.mit.edu	37	1	43613850	43613851	+	Intron	INS	-	A	A	rs142077481	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43613850_43613851insA	uc009vwo.2	+							NM_001101376	NP_001094846	A6NL82	F183A_HUMAN	hCG23177											ovary(3)	3						GCGGTCCCAGCAAAAACTCTTT	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	44672875	44672875	+	IGR	DEL	A	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44672875delA								KLF17 (72068 upstream) : DMAP1 (6250 downstream)																							cctgtctcagaaaaaaaaaaa	0.000													5	4	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	65915368	65915368	+	Intron	DEL	T	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65915368delT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		cctatttatcttttttttttt	0.224													4	2	---	---	---	---	
MCOLN2	255231	broad.mit.edu	37	1	85412990	85412991	+	Intron	DEL	CA	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85412990_85412991delCA	uc001dkm.2	-						MCOLN2_uc001dkn.2_Intron	NM_153259	NP_694991	Q8IZK6	MCLN2_HUMAN	mucolipin 2							integral to membrane	ion channel activity			ovary(3)|upper_aerodigestive_tract(1)	4				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		caccccccaccacacacacaca	0.069													6	4	---	---	---	---	
TTF2	8458	broad.mit.edu	37	1	117628870	117628871	+	Intron	DEL	TG	-	-	rs3831091		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117628870_117628871delTG	uc001egy.2	+							NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		ACCTCCAAAAtgtgtgtgtgtg	0.337													5	3	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154728783	154728783	+	Intron	DEL	A	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154728783delA	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			gaggaagaggaagaggaagaa	0.119													4	2	---	---	---	---	
TRIM46	80128	broad.mit.edu	37	1	155148781	155148781	+	Intron	DEL	G	-	-	rs4971059	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155148781delG	uc001fhs.1	+						RAG1AP1_uc010pey.1_Intron|KRTCAP2_uc001fho.2_5'Flank|KRTCAP2_uc001fhp.1_5'Flank|TRIM46_uc009wpe.1_Intron|TRIM46_uc010pez.1_Intron|TRIM46_uc001fhq.2_Intron|TRIM46_uc001fhr.2_Intron|TRIM46_uc001fht.1_Intron|TRIM46_uc010pfa.1_Intron|TRIM46_uc001fhu.1_Intron|TRIM46_uc009wpg.1_Intron|TRIM46_uc009wpf.2_3'UTR|TRIM46_uc001fhv.3_Intron|TRIM46_uc001fhw.1_Intron	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	tripartite motif-containing 46							intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTGGCATTGTGGGTTTCCAAA	0.488													5	3	---	---	---	---	
DCAF6	55827	broad.mit.edu	37	1	168024985	168024985	+	Intron	DEL	G	-	-	rs35042830		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168024985delG	uc001gew.2	+						DCAF6_uc001gev.2_Intron|DCAF6_uc001gex.2_Intron|DCAF6_uc010plk.1_Intron|DCAF6_uc001gey.2_Intron|DCAF6_uc001gez.2_Intron	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b						positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						GAAAGTTAAAGGGCATTTTCT	0.289													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218664195	218664196	+	IGR	INS	-	C	C			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218664195_218664196insC								TGFB2 (46236 upstream) : LYPLAL1 (682996 downstream)																							ttgcttgctttttctttccttc	0.119													4	2	---	---	---	---	
MARK1	4139	broad.mit.edu	37	1	220749378	220749379	+	Intron	DEL	CT	-	-	rs76839238		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220749378_220749379delCT	uc001hmn.3	+						MARK1_uc001hml.2_Intron|MARK1_uc009xdw.2_Intron|MARK1_uc010pun.1_Intron|MARK1_uc001hmm.3_Intron	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1						intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		TCTTTTCAGACTCTGCTAAAAT	0.347													4	4	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237679135	237679136	+	Intron	INS	-	T	T	rs115368235	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237679135_237679136insT	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			cttcctccctcttctcctcctc	0.000													5	3	---	---	---	---	
ALMS1	7840	broad.mit.edu	37	2	73830581	73830582	+	Intron	INS	-	A	A	rs113408397		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73830581_73830582insA	uc002sje.1	+						ALMS1_uc002sjf.1_Intron|ALMS1_uc002sjh.1_3'UTR	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TTATGGCACTGAAAAAAAAAAA	0.351													2	4	---	---	---	---	
ACTR3	10096	broad.mit.edu	37	2	114699660	114699661	+	Intron	INS	-	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114699660_114699661insT	uc002tkx.1	+						ACTR3_uc010yyc.1_Intron|ACTR3_uc010yyd.1_Intron	NM_005721	NP_005712	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog						cellular component movement|cilium morphogenesis	Arp2/3 protein complex	actin binding|ATP binding			skin(1)	1						TTTCTGAAGAGTTTTTTTTTTT	0.248													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129393430	129393437	+	IGR	DEL	CCTTCCTT	-	-	rs72091728		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129393430_129393437delCCTTCCTT								HS6ST1 (317259 upstream) : None (None downstream)																							tccctccctcccttccttccttccttcc	0.192													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	138713053	138713055	+	IGR	DEL	ACA	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138713053_138713055delACA								THSD7B (277766 upstream) : HNMT (8535 downstream)																							gtctTTAAAGacaacaacaacaa	0.089													4	2	---	---	---	---	
LY75	4065	broad.mit.edu	37	2	160628210	160628211	+	3'UTR	DEL	TT	-	-	rs3836181		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160628210_160628211delTT	uc002ubb.3	-	39					LY75_uc010fos.2_3'UTR|CD302_uc002uba.2_3'UTR|CD302_uc010zco.1_3'UTR	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		ACCTAAAGACTTTTCACAGCAG	0.302													3	6	---	---	---	---	
XPC	7508	broad.mit.edu	37	3	14190590	14190590	+	Intron	DEL	T	-	-	rs111520695		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14190590delT	uc011ave.1	-						XPC_uc011avf.1_Intron|XPC_uc011avg.1_Intron	NM_004628	NP_004619	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C						nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal	cytoplasm|nucleoplasm|XPC complex	bubble DNA binding|damaged DNA binding|loop DNA binding|protein binding|single-stranded DNA binding			ovary(2)|breast(1)	3						tttttctcccttttttttttt	0.284			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		NER	Xeroderma_Pigmentosum				5	3	---	---	---	---	
VPRBP	9730	broad.mit.edu	37	3	51471278	51471279	+	Intron	INS	-	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51471278_51471279insA	uc003dbe.1	-							NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		gactccatgtcaaaaaaaaaaa	0.168													6	3	---	---	---	---	
PLS1	5357	broad.mit.edu	37	3	142402697	142402698	+	Intron	INS	-	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142402697_142402698insT	uc010huv.2	+						PLS1_uc003euz.2_Intron|PLS1_uc003eva.2_Intron	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1							cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						aaaaccatgTGTTTTTTTTTTT	0.109													4	2	---	---	---	---	
KIAA1530	57654	broad.mit.edu	37	4	1346685	1346685	+	Intron	DEL	A	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1346685delA	uc003gde.3	+							NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654												0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			gtgagctgtgattgcaccact	0.164													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	34658614	34658617	+	IGR	DEL	AAGG	-	-	rs34265374		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34658614_34658617delAAGG								None (None upstream) : None (None downstream)																							tttgggcagcaaggaaggaaggaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	153938442	153938445	+	IGR	DEL	TCCC	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153938442_153938445delTCCC								FHDC1 (37594 upstream) : TRIM2 (135825 downstream)																							CAGCAATTAATccctccctccctc	0.020													4	2	---	---	---	---	
PDLIM3	27295	broad.mit.edu	37	4	186444722	186444723	+	Intron	INS	-	TT	TT	rs10641473		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186444722_186444723insTT	uc003ixw.3	-						PDLIM3_uc003ixx.3_Intron|PDLIM3_uc010isi.2_Intron|PDLIM3_uc003ixy.2_Intron|PDLIM3_uc003ixz.2_Intron	NM_014476	NP_055291	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain protein 3 isoform a							sarcomere	zinc ion binding			ovary(2)	2		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		TGCAAAAACAATTTTTTTTTTT	0.243													5	3	---	---	---	---	
RNF145	153830	broad.mit.edu	37	5	158608809	158608809	+	Intron	DEL	A	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158608809delA	uc003lxp.2	-						RNF145_uc011ddy.1_Intron|RNF145_uc003lxo.1_Intron|RNF145_uc011ddz.1_Intron|RNF145_uc010jiq.1_Intron|RNF145_uc011dea.1_Intron	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145							integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGAAGACTTAAAAAAAAAAA	0.294													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161266786	161266793	+	IGR	DEL	TCTTTCTT	-	-	rs28419071	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161266786_161266793delTCTTTCTT								GABRA6 (137188 upstream) : GABRA1 (7404 downstream)																							tctttctttctctttctttctttctttc	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172178243	172178244	+	IGR	INS	-	AAGG	AAGG	rs28532090		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172178243_172178244insAAGG								NEURL1B (59712 upstream) : DUSP1 (16858 downstream)																							agaaggaaagaaaggaaggaag	0.099													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28675315	28675316	+	IGR	INS	-	A	A	rs143414094		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28675315_28675316insA								SCAND3 (120203 upstream) : TRIM27 (195464 downstream)																							gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SLC22A16	85413	broad.mit.edu	37	6	110759758	110759764	+	Intron	DEL	ATATAAC	-	-	rs138799996	byFrequency	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110759758_110759764delATATAAC	uc003puf.2	-						SLC22A16_uc003pue.2_Intron	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN	solute carrier family 22, member 16						acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity			ovary(1)	1		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)		tatattacttatataacagaaaaagaa	0.111													4	5	---	---	---	---	
HDAC2	3066	broad.mit.edu	37	6	114266362	114266362	+	Intron	DEL	A	-	-	rs144420552		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114266362delA	uc003pwd.1	-						HDAC2_uc003pwc.1_Intron|HDAC2_uc003pwe.1_Intron	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2						blood coagulation|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of proteolysis|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|transcription factor binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Vorinostat(DB02546)	attaaaaattaaaaaaaaaaa	0.114													4	2	---	---	---	---	
ZBTB2	57621	broad.mit.edu	37	6	151704902	151704903	+	Intron	DEL	AC	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151704902_151704903delAC	uc003qoh.2	-							NM_020861	NP_065912	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		agacaggcagacacacacacac	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164059731	164059732	+	IGR	INS	-	TT	TT	rs71023239		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164059731_164059732insTT								QKI (64839 upstream) : None (None downstream)																							tccttccttCCttttttttttt	0.010													6	3	---	---	---	---	
AP4M1	9179	broad.mit.edu	37	7	99700433	99700434	+	Intron	DEL	AG	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99700433_99700434delAG	uc003utb.3	+						MCM7_uc003usv.1_5'Flank|MCM7_uc003usw.1_5'Flank|MCM7_uc003usx.1_5'Flank|AP4M1_uc011kjg.1_Intron|AP4M1_uc010lgl.1_Intron|AP4M1_uc003utc.3_Intron|AP4M1_uc010lgm.2_Intron|AP4M1_uc003utd.2_Intron|AP4M1_uc011kjh.1_Intron|AP4M1_uc003ute.3_Intron|AP4M1_uc003utf.3_Intron	NM_004722	NP_004713	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCACCTGGTAGCTAGGAGGGG	0.574													94	42	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126249241	126249242	+	Intron	INS	-	A	A	rs143326708	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126249241_126249242insA	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	GAGATTTCTCTAAAGAGGCTGA	0.302										HNSCC(24;0.065)			5	7	---	---	---	---	
CPA5	93979	broad.mit.edu	37	7	129989560	129989592	+	Intron	DEL	CAAAAATTAAAAATTACAAAAAAACCTGTATCC	-	-	rs11272432	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129989560_129989592delCAAAAATTAAAAATTACAAAAAAACCTGTATCC	uc010lmd.1	+						CPA5_uc003vps.2_Intron|CPA5_uc003vpt.2_Intron|CPA5_uc010lme.1_Intron|CPA5_uc003vpu.1_Intron	NM_001127441	NP_001120913	Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5 isoform 1						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)					tacgtacccacaaaaattaaaaattacaaaaaaacctgtatcccaaatctgtt	0.017													5	4	---	---	---	---	
XKR6	286046	broad.mit.edu	37	8	11058893	11058894	+	5'Flank	DEL	GG	-	-	rs79111379		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11058893_11058894delGG	uc003wtk.1	-							NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		gagggacggcgggggggggggg	0.243													4	2	---	---	---	---	
PCMTD1	115294	broad.mit.edu	37	8	52744235	52744238	+	Intron	DEL	CAAT	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52744235_52744238delCAAT	uc003xqx.3	-						PCMTD1_uc011ldm.1_Intron|PCMTD1_uc003xqw.3_Intron|PCMTD1_uc011ldn.1_Intron|PCMTD1_uc010lya.2_Intron	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TAGAGCTACACAATCACTTAAATG	0.299													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44731109	44731110	+	IGR	INS	-	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44731109_44731110insA								None (None upstream) : FAM27C (259126 downstream)																							aaggaaggaagaaaaaaaaaaa	0.040													4	2	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136799004	136799006	+	Intron	DEL	AAT	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136799004_136799006delAAT	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		tggatggatgaatgatggatgga	0.000													4	2	---	---	---	---	
ENTPD2	954	broad.mit.edu	37	9	139946905	139946906	+	Intron	INS	-	A	A	rs149050700	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139946905_139946906insA	uc004ckw.1	-						ENTPD2_uc004ckv.1_5'Flank|ENTPD2_uc004ckx.1_Intron	NM_203468	NP_982293	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2							integral to membrane	ATP binding				0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CTCCCCCCCCCACCCAGTCATG	0.658													12	7	---	---	---	---	
SYT15	83849	broad.mit.edu	37	10	46968899	46968908	+	Intron	DEL	CACACACACA	-	-	rs72038340		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46968899_46968908delCACACACACA	uc001jea.2	-						SYT15_uc001jdz.2_Intron|SYT15_uc001jeb.2_Intron|SYT15_uc010qfp.1_5'Flank	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a							integral to membrane|plasma membrane					0						cacacacacgcacacacacacacacacaca	0.276													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	63250862	63250865	+	Intron	DEL	AGGA	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63250862_63250865delAGGA	uc001jlr.2	+											Homo sapiens, clone IMAGE:5222445, mRNA.																		ggaaggaaggaggaaggaaggaag	0.108													4	2	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114710508	114710508	+	5'UTR	DEL	A	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114710508delA	uc001lae.3	+	1					TCF7L2_uc001lac.3_5'UTR|TCF7L2_uc010qrk.1_5'UTR|TCF7L2_uc010qrl.1_5'UTR|TCF7L2_uc010qrm.1_5'UTR|TCF7L2_uc010qrn.1_5'UTR|TCF7L2_uc001lad.3_5'UTR|TCF7L2_uc001lag.3_5'UTR|TCF7L2_uc001laf.3_5'UTR|TCF7L2_uc010qro.1_5'UTR|TCF7L2_uc001lah.2_5'UTR|TCF7L2_uc010qrp.1_5'UTR|TCF7L2_uc010qrq.1_5'UTR|TCF7L2_uc010qrr.1_5'Flank|TCF7L2_uc010qrs.1_5'Flank|TCF7L2_uc010qrt.1_5'Flank	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CTGGTGGGTGAAAAAAAAATG	0.473													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125014251	125014252	+	IGR	INS	-	ACA	ACA	rs141228159		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125014251_125014252insACA								BUB3 (89365 upstream) : GPR26 (411619 downstream)																							ccaccaccaccaccatcatcac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135454782	135454784	+	IGR	DEL	AAG	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135454782_135454784delAAG								FRG2B (14483 upstream) : LOC653544 (35495 downstream)																							AAGTGTAGACAAGAGGGTCATCT	0.438													4	3	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14252331	14252334	+	Intron	DEL	TTCA	-	-	rs62745561		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14252331_14252334delTTCA	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		ccttccttccttcattttttcGTG	0.142													3	3	---	---	---	---	
SYTL2	54843	broad.mit.edu	37	11	85524734	85524737	+	5'Flank	DEL	CCTC	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85524734_85524737delCCTC	uc010rti.1	-						SYTL2_uc010rtj.1_5'Flank	NM_032943	NP_116561	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform a						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		AGACAAGTCtcctccctccctccc	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127462186	127462187	+	IGR	INS	-	AGG	AGG	rs146290646	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127462186_127462187insAGG								KIRREL3 (588831 upstream) : ETS1 (866469 downstream)																							ggaaggaagaaagggagggaag	0.050													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54282976	54282977	+	IGR	INS	-	C	C			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54282976_54282977insC								CALCOCO1 (161669 upstream) : HOXC13 (49599 downstream)																							tcctttcctttcttccttcctt	0.000													2	4	---	---	---	---	
CHPT1	56994	broad.mit.edu	37	12	102113732	102113733	+	Intron	INS	-	TAAA	TAAA	rs143042949	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102113732_102113733insTAAA	uc001tin.2	+						CHPT1_uc001tio.2_Intron|CHPT1_uc001tip.1_Intron	NM_020244	NP_064629	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1						platelet activating factor biosynthetic process|regulation of cell growth	Golgi membrane|integral to membrane|microsome	diacylglycerol binding|diacylglycerol cholinephosphotransferase activity|metal ion binding				0						aaaaaaaaagttaaaaaaaagt	0.139													2	4	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122820961	122820963	+	Intron	DEL	AAA	-	-	rs34358047		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122820961_122820963delAAA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GGGATAGATTaaaaaaaaaaaaa	0.345											OREG0022220	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20085255	20085255	+	IGR	DEL	G	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20085255delG								P704P (64983 upstream) : OR4Q3 (130332 downstream)																							AAACTAGGCTGTGACAACAAG	0.294													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	27508204	27508205	+	IGR	DEL	AG	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27508204_27508205delAG								NOVA1 (441244 upstream) : None (None downstream)																							gAAGAAATAAAGAGAGAGAGAG	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	29194383	29194390	+	IGR	DEL	CACACACA	-	-	rs72342588		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29194383_29194390delCACACACA								None (None upstream) : FOXG1 (41897 downstream)																							GCCCCTCTGCcacacacacacacacaca	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	52387443	52387443	+	IGR	DEL	G	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52387443delG								MAPK6 (28982 upstream) : BCL2L10 (14381 downstream)																							cattgcaggtgggaacattta	0.408													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15083569	15083570	+	Intron	INS	-	GCA	GCA	rs66497434		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15083569_15083570insGCA	uc010uzl.1	+						PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002dda.3_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_5'UTR	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	ACGCACGCGGCGCAGCAGCCCC	0.634													4	2	---	---	---	---	
GGA2	23062	broad.mit.edu	37	16	23498305	23498305	+	Intron	DEL	G	-	-	rs116219854		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23498305delG	uc002dlq.2	-						GGA2_uc010bxo.1_Intron	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		cttttctgttgtttttttttt	0.030													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	31345841	31345856	+	IGR	DEL	TCCTTTCCTTCCTTCC	-	-	rs36070632		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31345841_31345856delTCCTTTCCTTCCTTCC								ITGAM (1630 upstream) : ITGAX (20653 downstream)																							cttccttccttcctttccttccttccttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51462070	51462071	+	IGR	INS	-	TCCTTCCT	TCCTTCCT	rs142525402	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51462070_51462071insTCCTTCCT								SALL1 (276887 upstream) : None (None downstream)																							ctccctccctctccttccttcc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	59816476	59816477	+	IGR	INS	-	AGGAAGGAAGGAAAGA	AGGAAGGAAGGAAAGA	rs151263487	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59816476_59816477insAGGAAGGAAGGAAAGA								None (None upstream) : None (None downstream)																							AAATggaagggaggaaggaagg	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88226611	88226611	+	IGR	DEL	G	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88226611delG								BANP (115688 upstream) : ZNF469 (267268 downstream)																							tggtggtgatggtggtgatgg	0.000													4	3	---	---	---	---	
PELP1	27043	broad.mit.edu	37	17	4602023	4602025	+	Intron	DEL	TGT	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4602023_4602025delTGT	uc002fyi.3	-						PELP1_uc010vsf.1_Intron	NM_014389	NP_055204	Q8IZL8	PELP1_HUMAN	proline, glutamic acid and leucine rich protein						transcription, DNA-dependent	cytoplasm|MLL1 complex	protein binding			ovary(1)|central_nervous_system(1)	2						ggactagaaatgttgttgttgtt	0.000													4	2	---	---	---	---	
DULLARD	23399	broad.mit.edu	37	17	7147350	7147351	+	3'UTR	INS	-	C	C	rs147084197	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7147350_7147351insC	uc002gfd.2	-	8					GABARAP_uc002gfb.2_5'Flank|DULLARD_uc002gfe.2_3'UTR|DULLARD_uc002gff.2_3'UTR|DULLARD_uc002gfc.2_Intron	NM_001143775	NP_001137247	O95476	CNEP1_HUMAN	dullard homolog						nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0						CCATCCAGACTCCAAGTGGAGT	0.614													6	8	---	---	---	---	
POLDIP2	26073	broad.mit.edu	37	17	26680546	26680547	+	Intron	INS	-	A	A	rs11454138		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26680546_26680547insA	uc002haz.2	-						POLDIP2_uc010wag.1_Intron	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		gactccatatcaaaaaaaaaaa	0.248													6	3	---	---	---	---	
KRTAP9-9	81870	broad.mit.edu	37	17	39412339	39412340	+	3'UTR	INS	-	C	C			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39412339_39412340insC	uc010wfq.1	+	3						NM_030975	NP_112237	B5MDD6	B5MDD6_HUMAN	keratin associated protein 9-9							keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ATTCTCTTTTTCTTATACCTTG	0.371													4	2	---	---	---	---	
EVPL	2125	broad.mit.edu	37	17	74017493	74017501	+	Intron	DEL	CCGCCCCTG	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74017493_74017501delCCGCCCCTG	uc002jqi.2	-						EVPL_uc010wss.1_Intron|EVPL_uc010wst.1_Intron	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin						keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						TGCTGTGCTCccgcccctgccgcccctgc	0.383													3	3	---	---	---	---	
CBX4	8535	broad.mit.edu	37	17	77809592	77809592	+	Intron	DEL	C	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77809592delC	uc002jxe.2	-							NM_003655	NP_003646	O00257	CBX4_HUMAN	chromobox homolog 4						anti-apoptosis|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|PcG protein complex	enzyme binding|transcription corepressor activity			skin(2)	2			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TTCTGTGATGCCCCCCCCCCC	0.622											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
BAIAP2	10458	broad.mit.edu	37	17	79031790	79031794	+	Intron	DEL	GCCTG	-	-	rs140357171	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79031790_79031794delGCCTG	uc002jzg.2	+						BAIAP2_uc002jyz.3_Intron|BAIAP2_uc002jza.2_Intron|BAIAP2_uc002jzc.2_Intron|BAIAP2_uc002jzb.2_Intron|BAIAP2_uc002jzd.2_Intron|BAIAP2_uc002jzf.2_Intron|BAIAP2_uc002jze.2_Intron|BAIAP2_uc010wuh.1_Intron	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2						axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCCCCCCCCCGCCTGGTAGTCGCCT	0.590													8	5	---	---	---	---	
AATK	9625	broad.mit.edu	37	17	79098839	79098847	+	Intron	DEL	GCAGGGTGA	-	-	rs141491493		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79098839_79098847delGCAGGGTGA	uc010dia.2	-						AATK_uc010dhz.2_5'Flank|hsa-mir-3065|MI0014228_5'Flank	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase							integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			aggggcaggggcagggtgagcagggtgag	0.330													4	2	---	---	---	---	
DOT1L	84444	broad.mit.edu	37	19	2206521	2206524	+	Intron	DEL	AAAA	-	-	rs150155214		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2206521_2206524delAAAA	uc002lvb.3	+							NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase							nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actctgtctcaaaaaaaaaaaaaa	0.196													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																							aaaaaaaaaacaaaaaaaaaa	0.348													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3332802	3332803	+	IGR	INS	-	CTTA	CTTA	rs138483500	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3332802_3332803insCTTA								CELF5 (35731 upstream) : NFIC (26813 downstream)																							ttccctccttccttcccttcct	0.000													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8230721	8230722	+	IGR	INS	-	GAAAGGG	GAAAGGG			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8230721_8230722insGAAAGGG								FBN3 (18340 upstream) : LASS4 (43495 downstream)																							gaaggaaggaaagaaaggaagg	0.153													4	2	---	---	---	---	
TYK2	7297	broad.mit.edu	37	19	10462914	10462915	+	Intron	INS	-	T	T			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10462914_10462915insT	uc002moc.3	-						TYK2_uc010dxe.2_Intron	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2						intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			cgcctggctaattttttttgta	0.000													11	5	---	---	---	---	
CEACAM21	90273	broad.mit.edu	37	19	42083433	42083434	+	Intron	DEL	AC	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42083433_42083434delAC	uc002ore.3	+						CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_Intron|CEACAM21_uc002org.3_Intron	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane				ovary(1)	1						ACCCAGTAGGacacacacacac	0.302													5	4	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49416101	49416101	+	Intron	DEL	A	-	-	rs72240043		TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49416101delA	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		actccctctcaaaaaaaaaaa	0.249													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47019864	47019864	+	IGR	DEL	G	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47019864delG								LOC284749 (20483 upstream) : PREX1 (220929 downstream)																							aggaggggaaggaggaaagga	0.124													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085949	11085960	+	Intron	DEL	CACCACCATCAA	-	-	rs77600321	by1000genomes	TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085949_11085960delCACCACCATCAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tcaccaccaccaccaccatcaacaccacACTG	0.170													11	5	---	---	---	---	
COL18A1	80781	broad.mit.edu	37	21	46930987	46930988	+	Intron	DEL	CA	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46930987_46930988delCA	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron|SLC19A1_uc010gpy.1_Intron|COL18A1_uc002zhj.2_Intron|COL18A1_uc002zhk.2_Intron	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		tccacacccccacacaccacac	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	18843723	18843724	+	Intron	INS	-	A	A			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18843723_18843724insA	uc002zoe.2	+											Homo sapiens cDNA FLJ76361 complete cds.																		AGGGGCACCCCACGGCCTGGAG	0.619													8	4	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26402277	26402277	+	Intron	DEL	T	-	-			TCGA-BP-4968-01A-01D-1462-08	TCGA-BP-4968-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26402277delT	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron|MYO18B_uc010gva.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ATTCCAATTCTTTTTTTTTTT	0.373													4	2	---	---	---	---	
