Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SPEN	23013	broad.mit.edu	37	1	16256120	16256120	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16256120G>A	uc001axk.1	+	11	3589	c.3385G>A	c.(3385-3387)GTT>ATT	p.V1129I	SPEN_uc010obp.1_Missense_Mutation_p.V1088I	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	1129					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GAGAGAAGACGTTAGGAAAAA	0.393													16	38	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17271891	17271891	+	Intron	SNP	C	T	T	rs2781606	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17271891C>T	uc001azt.2	+						CROCC_uc009voz.1_Intron|CROCC_uc001azu.2_5'UTR	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCCAGCATCTCGCTGGCTACA	0.587													3	22	---	---	---	---	PASS
EPHB2	2048	broad.mit.edu	37	1	23191446	23191446	+	Silent	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23191446C>T	uc009vqj.1	+	5	1189	c.1044C>T	c.(1042-1044)CGC>CGT	p.R348R	EPHB2_uc001bge.2_Silent_p.R348R|EPHB2_uc001bgf.2_Silent_p.R348R|EPHB2_uc010odu.1_Silent_p.R348R|hsa-mir-4253|MI0015860_5'Flank	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	348	Extracellular (Potential).|Fibronectin type-III 1.				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CCCCTCCCCGCGACTCCGGAG	0.652									Hereditary_Prostate_Cancer				24	144	---	---	---	---	PASS
MTF1	4520	broad.mit.edu	37	1	38300861	38300861	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38300861T>C	uc001cce.1	-	6	1021	c.880A>G	c.(880-882)AAT>GAT	p.N294D	MTF1_uc009vvj.1_5'UTR	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	294	C2H2-type 6.					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TCACAGCCATTACTGGGGCAG	0.378													5	152	---	---	---	---	PASS
HIVEP3	59269	broad.mit.edu	37	1	41976454	41976454	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41976454C>A	uc001cgz.3	-	9	8102	c.6889G>T	c.(6889-6891)GGG>TGG	p.G2297W	HIVEP3_uc001cha.3_Missense_Mutation_p.G2296W|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	2297					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GCAGGTGCCCCGGTCCCATGG	0.736													3	16	---	---	---	---	PASS
NEGR1	257194	broad.mit.edu	37	1	72163794	72163794	+	Silent	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72163794C>T	uc001dfw.2	-	4	664	c.564G>A	c.(562-564)TTG>TTA	p.L188L	NEGR1_uc001dfv.2_Silent_p.L60L|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor	188	Ig-like C2-type 2.				cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		CATAAATGTCCAAATATTGTC	0.368													7	92	---	---	---	---	PASS
PTBP2	58155	broad.mit.edu	37	1	97236294	97236294	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97236294G>C	uc001drq.2	+	5	565	c.319G>C	c.(319-321)GCT>CCT	p.A107P	PTBP2_uc001drn.2_Missense_Mutation_p.A107P|PTBP2_uc001dro.2_Missense_Mutation_p.A107P|PTBP2_uc010otz.1_Missense_Mutation_p.A118P|PTBP2_uc001drp.2_RNA|PTBP2_uc009wdw.2_Missense_Mutation_p.A55P|PTBP2_uc001drr.2_Missense_Mutation_p.A107P|PTBP2_uc010oua.1_Missense_Mutation_p.A115P|PTBP2_uc001dru.2_RNA|PTBP2_uc001drm.2_Missense_Mutation_p.A107P	NM_021190	NP_067013	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	107	RRM 1.						nucleotide binding				0		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		CGAGGAAGCAGCTATTACTAT	0.299													16	158	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	G	G	rs146714035	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145367739A>G	uc001end.3	+	85	10595	c.10560A>G	c.(10558-10560)AAA>AAG	p.K3520K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3445											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.244													5	155	---	---	---	---	PASS
HCN3	57657	broad.mit.edu	37	1	155252388	155252388	+	Silent	SNP	T	C	C	rs140564885		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155252388T>C	uc001fjz.1	+	2	473	c.465T>C	c.(463-465)GCT>GCC	p.A155A	RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_5'UTR	NM_020897	NP_065948	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic	155	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)|breast(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGGAGGGTGCTGAGATCCTGC	0.562													22	59	---	---	---	---	PASS
CADM3	57863	broad.mit.edu	37	1	159170640	159170640	+	Silent	SNP	C	T	T	rs143855176		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159170640C>T	uc001ftl.2	+	9	1267	c.1125C>T	c.(1123-1125)GAC>GAT	p.D375D	CADM3_uc001ftk.2_Silent_p.D409D|uc001ftm.1_RNA	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	375	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					ATGCTCCAGACGCGGACACGG	0.582													15	114	---	---	---	---	PASS
C1orf129	80133	broad.mit.edu	37	1	170964596	170964596	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170964596C>T	uc001ghg.2	+	13	1391	c.1261C>T	c.(1261-1263)CCC>TCC	p.P421S	C1orf129_uc009wvy.2_Missense_Mutation_p.P228S|C1orf129_uc010plz.1_Missense_Mutation_p.P421S	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	421							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCAGTATTTCCCCCAGCTCTT	0.473													31	115	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181549889	181549889	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181549889G>T	uc001gow.2	+	6	1093	c.928G>T	c.(928-930)GGG>TGG	p.G310W	CACNA1E_uc009wxr.2_Missense_Mutation_p.G217W|CACNA1E_uc009wxs.2_Missense_Mutation_p.G217W	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	310	I.|Extracellular (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						CACCATGGAAGGGTGGACCAC	0.527													7	60	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197087083	197087083	+	Silent	SNP	A	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197087083A>G	uc001gtu.2	-	17	4158	c.3901T>C	c.(3901-3903)TTG>CTG	p.L1301L	ASPM_uc001gtv.2_Silent_p.L1301L|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	1301					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						ATTACAGCCAATTGAATAATT	0.313													47	221	---	---	---	---	PASS
GOLT1A	127845	broad.mit.edu	37	1	204170926	204170926	+	Missense_Mutation	SNP	G	A	A	rs150924607	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204170926G>A	uc001has.1	-	3	317	c.131C>T	c.(130-132)ACG>ATG	p.T44M	GOLT1A_uc001hat.1_Missense_Mutation_p.T44M	NM_198447	NP_940849	Q6ZVE7	GOT1A_HUMAN	golgi transport 1 homolog A	44	Helical; Name=2; (Potential).				protein transport|vesicle-mediated transport	Golgi membrane|integral to membrane					0	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)			GGACAGGCCCGTCAGGAACAG	0.602													10	97	---	---	---	---	PASS
DSTYK	25778	broad.mit.edu	37	1	205131208	205131208	+	Silent	SNP	G	T	T	rs148048922		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205131208G>T	uc001hbw.2	-	6	1838	c.1774C>A	c.(1774-1776)CGG>AGG	p.R592R	DSTYK_uc001hbx.2_Silent_p.R592R|DSTYK_uc001hby.1_Silent_p.R53R	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN	receptor interacting protein kinase 5 isoform 1	592						cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(1)	1						CTATTGAGCCGAGTCCGGAAT	0.537													3	74	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525256	248525256	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525256C>A	uc001ieh.1	+	1	374	c.374C>A	c.(373-375)TCA>TAA	p.S125*		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	125	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AATAAGATCTCAGCCCCTGAG	0.488													23	245	---	---	---	---	PASS
C2orf71	388939	broad.mit.edu	37	2	29295510	29295510	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29295510T>G	uc002rmt.1	-	1	1618	c.1618A>C	c.(1618-1620)ATG>CTG	p.M540L		NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939	540					response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						TTCAGAATCATTTCCTGGGCC	0.552													12	137	---	---	---	---	PASS
PCBP1	5093	broad.mit.edu	37	2	70315104	70315104	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70315104G>T	uc002sgf.2	+	1	520	c.229G>T	c.(229-231)GAC>TAC	p.D77Y	ASPRV1_uc002sga.2_5'Flank|uc002sgb.1_5'Flank|uc002sgd.2_5'Flank|uc002sge.1_5'Flank	NM_006196	NP_006187	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	77					nuclear mRNA splicing, via spliceosome	cytoplasm|nucleoplasm|ribonucleoprotein complex	protein binding|RNA binding|single-stranded DNA binding				0						TATGATCATCGACAAGCTGGA	0.597													24	225	---	---	---	---	PASS
LOXL3	84695	broad.mit.edu	37	2	74760680	74760680	+	3'UTR	SNP	C	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74760680C>G	uc002smp.1	-	14					HTRA2_uc002smi.1_3'UTR|HTRA2_uc002smj.1_3'UTR|HTRA2_uc002smk.1_3'UTR|HTRA2_uc002sml.1_3'UTR|HTRA2_uc002smm.1_3'UTR|HTRA2_uc002smn.1_3'UTR|LOXL3_uc002smo.1_3'UTR|LOXL3_uc010ffm.1_3'UTR|LOXL3_uc002smq.1_3'UTR	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor							extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						GTAATGGCAGCCTCAGACCCC	0.532													6	16	---	---	---	---	PASS
PDCD6IP	10015	broad.mit.edu	37	3	33905544	33905544	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33905544C>T	uc003cfx.2	+	16	2322	c.2167C>T	c.(2167-2169)CCT>TCT	p.P723S	PDCD6IP_uc003cfy.2_Missense_Mutation_p.P728S|PDCD6IP_uc011axw.1_Missense_Mutation_p.P504S	NM_013374	NP_037506	Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	723	Pro-rich.|Interaction with EIAV p9.|Self-association.				apoptosis|cell cycle|cell division|interspecies interaction between organisms|protein transport	cytosol|melanosome|microtubule organizing center	calcium-dependent protein binding			ovary(1)|skin(1)	2						TCCTTCAATTCCTACACCTGC	0.299													7	60	---	---	---	---	PASS
GNAI2	2771	broad.mit.edu	37	3	50290461	50290461	+	Silent	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50290461C>T	uc003cyq.1	+	4	430	c.309C>T	c.(307-309)GAC>GAT	p.D103D	GNAI2_uc003cyo.1_Silent_p.D87D|GNAI2_uc003cyp.1_Silent_p.D87D|GNAI2_uc010hlg.1_Silent_p.D22D|GNAI2_uc011bdn.1_Silent_p.D66D|GNAI2_uc003cyr.1_Silent_p.D22D	NM_002070	NP_002061	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein),	103					adenosine receptor signaling pathway|cell cycle|cell division|gamma-aminobutyric acid signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|platelet activation|response to nutrient|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		CCCAGGACGACGCCAGGCAGC	0.642													13	124	---	---	---	---	PASS
FAM19A1	407738	broad.mit.edu	37	3	68466568	68466568	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68466568A>G	uc003dnd.2	+	3	473	c.257A>G	c.(256-258)GAT>GGT	p.D86G	FAM19A1_uc003dne.2_Missense_Mutation_p.D86G|FAM19A1_uc003dng.2_Missense_Mutation_p.D86G	NM_213609	NP_998774	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine	86						endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		TCTTGCGTCGATGGTAGGTAC	0.398													18	127	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	183035915	183035915	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183035915T>C	uc003fli.1	-	7	784	c.694A>G	c.(694-696)AGC>GGC	p.S232G	MCF2L2_uc003flj.1_Missense_Mutation_p.S232G|MCF2L2_uc003flp.1_Missense_Mutation_p.S267G	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	232					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GATAGCATGCTTCTGGGCAGC	0.582													4	28	---	---	---	---	PASS
ABCC5	10057	broad.mit.edu	37	3	183669339	183669339	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183669339G>A	uc003fmg.2	-	20	2999	c.2834C>T	c.(2833-2835)TCC>TTC	p.S945F	ABCC5_uc011bqt.1_Missense_Mutation_p.S473F|ABCC5_uc010hxl.2_Missense_Mutation_p.S945F	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	945	ABC transmembrane type-1 2.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATGCAGCCGGGAGGAAGCTCG	0.577													21	115	---	---	---	---	PASS
PDS5A	23244	broad.mit.edu	37	4	39851255	39851255	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39851255A>G	uc003guv.3	-	27	3644	c.3104T>C	c.(3103-3105)CTT>CCT	p.L1035P	PDS5A_uc010ifo.2_Missense_Mutation_p.L995P	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	1035					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						TAAAACTTCAAGCATGAACCA	0.358													12	54	---	---	---	---	PASS
TMPRSS11D	9407	broad.mit.edu	37	4	68749693	68749693	+	5'UTR	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68749693C>T	uc003hdq.2	-	1					LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_5'UTR	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D						proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GCCTACTCAACTGCTTTGAGA	0.318													12	105	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69795667	69795667	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69795667C>A	uc003hef.2	-	6	1479	c.1448G>T	c.(1447-1449)TGG>TTG	p.W483L	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	483	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						GTGCTGGAACCAGGTGAGGTC	0.473													8	122	---	---	---	---	PASS
UGT2B7	7364	broad.mit.edu	37	4	69962460	69962460	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69962460T>G	uc003heg.3	+	1	268	c.222T>G	c.(220-222)ATT>ATG	p.I74M	UGT2B7_uc010ihq.2_Missense_Mutation_p.I74M	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	74					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						CTCTTAAAATTGAAATTTATC	0.378													17	150	---	---	---	---	PASS
POU4F2	5458	broad.mit.edu	37	4	147560212	147560212	+	Translation_Start_Site	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147560212C>A	uc003ikv.2	+	1	168	c.-80C>A	c.(-82--78)GGCTG>GGATG			NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor						estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)					CCAGCCCCGGCTGGCCCGGCA	0.692													4	6	---	---	---	---	PASS
TTC29	83894	broad.mit.edu	37	4	147830304	147830304	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147830304C>T	uc003ikw.3	-	5	501	c.274G>A	c.(274-276)GAT>AAT	p.D92N	TTC29_uc010ipc.2_RNA|TTC29_uc003ikx.3_Missense_Mutation_p.D118N|TTC29_uc010ipd.1_Missense_Mutation_p.D92N	NM_031956	NP_114162	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	92							binding				0	all_hematologic(180;0.151)					CTCAGGGCATCCCACCGCTCC	0.527													7	72	---	---	---	---	PASS
C4orf43	55319	broad.mit.edu	37	4	164435307	164435307	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164435307A>C	uc003iqq.3	+	4	517	c.236A>C	c.(235-237)GAA>GCA	p.E79A		NM_018352	NP_060822	Q96EY4	CD043_HUMAN	hypothetical protein LOC55319	79											0						GAACTAATTGAAAGGTAAACA	0.353													6	137	---	---	---	---	PASS
CCL28	56477	broad.mit.edu	37	5	43412375	43412375	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43412375G>A	uc003jnu.2	-	1	114	c.44C>T	c.(43-45)GCG>GTG	p.A15V	CCL28_uc003jns.2_RNA|CCL28_uc003jnt.2_RNA	NM_148672	NP_683513	Q9NRJ3	CCL28_HUMAN	chemokine (C-C motif) ligand 28 precursor	15					chemotaxis|immune response	extracellular space	chemokine activity			ovary(1)|kidney(1)	2						ATGTAGGGCCGCACAGACAGC	0.572													3	60	---	---	---	---	PASS
SKP1	6500	broad.mit.edu	37	5	133493645	133493645	+	Intron	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133493645T>C	uc003kzc.3	-						SKP1_uc003kzd.3_3'UTR|SKP1_uc010jdv.2_Intron	NM_170679	NP_733779	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1 isoform b						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|G1/S transition of mitotic cell cycle|histone H2A monoubiquitination|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTTTTTATTCTGCCCTGCTGA	0.373													3	10	---	---	---	---	PASS
CLK4	57396	broad.mit.edu	37	5	178030625	178030625	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178030625T>C	uc003mjf.1	-	13	1547	c.1439A>G	c.(1438-1440)AAG>AGG	p.K480R	CLK4_uc003mjg.1_Missense_Mutation_p.K444R|CLK4_uc010jku.1_Missense_Mutation_p.K300R|CLK4_uc003mjh.1_Missense_Mutation_p.K300R|CLK4_uc010jkv.1_RNA|CLK4_uc011dgg.1_3'UTR	NM_020666	NP_065717	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	480						nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(1)	1	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		ATTTCATTTCTTTTTTAATAA	0.318													4	124	---	---	---	---	PASS
VARS2	57176	broad.mit.edu	37	6	30887607	30887607	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30887607C>T	uc003nsc.1	+	11	1779	c.1147C>T	c.(1147-1149)CAG>TAG	p.Q383*	VARS2_uc011dmx.1_Nonsense_Mutation_p.Q383*|VARS2_uc011dmy.1_Nonsense_Mutation_p.Q243*|VARS2_uc011dmz.1_Nonsense_Mutation_p.Q413*|VARS2_uc011dna.1_Nonsense_Mutation_p.Q383*|VARS2_uc011dnb.1_RNA|VARS2_uc011dnc.1_RNA|VARS2_uc011dnd.1_5'UTR|VARS2_uc010jsg.1_5'UTR	NM_020442	NP_065175	Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	383					valyl-tRNA aminoacylation	mitochondrion	ATP binding|valine-tRNA ligase activity			ovary(3)|central_nervous_system(1)	4						CTATGCTGTTCAGCCACATGT	0.597													13	186	---	---	---	---	PASS
MUT	4594	broad.mit.edu	37	6	49419319	49419319	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49419319T>C	uc003ozg.3	-	6	1447	c.1192A>G	c.(1192-1194)ACT>GCT	p.T398A		NM_000255	NP_000246	P22033	MUTA_HUMAN	methylmalonyl Coenzyme A mutase precursor	398					fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity				0	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTTTCACAGTTGGCAAACCC	0.423													21	140	---	---	---	---	PASS
PRDM13	59336	broad.mit.edu	37	6	100062550	100062550	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100062550A>G	uc003pqg.1	+	4	2300	c.2039A>G	c.(2038-2040)AAG>AGG	p.K680R		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	680					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		GGGGATCCCAAGAGCGACGAC	0.687													8	49	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4011189	4011189	+	Silent	SNP	G	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4011189G>T	uc003smx.2	+	12	1945	c.1806G>T	c.(1804-1806)CGG>CGT	p.R602R		NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	602	Ig-like C2-type 6.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ATGACCCCCGGGTTTCACTCC	0.527													4	46	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18625053	18625053	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18625053C>A	uc003suh.2	+	2	213	c.172C>A	c.(172-174)CAA>AAA	p.Q58K	HDAC9_uc003sue.2_Missense_Mutation_p.Q58K|HDAC9_uc011jyd.1_Missense_Mutation_p.Q58K|HDAC9_uc003sui.2_Missense_Mutation_p.Q58K|HDAC9_uc003suj.2_Missense_Mutation_p.Q58K|HDAC9_uc011jya.1_Missense_Mutation_p.Q99K|HDAC9_uc003sua.1_Missense_Mutation_p.Q77K|HDAC9_uc011jyb.1_Missense_Mutation_p.Q58K|HDAC9_uc003sud.1_Missense_Mutation_p.Q58K|HDAC9_uc011jyc.1_Missense_Mutation_p.Q58K|HDAC9_uc003suf.1_Missense_Mutation_p.Q86K|HDAC9_uc010kud.1_Missense_Mutation_p.Q58K|HDAC9_uc011jye.1_Missense_Mutation_p.Q27K|HDAC9_uc011jyf.1_Missense_Mutation_p.Q27K	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	58					B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	GCAGCAGCAACAAATCCAGAA	0.493													31	69	---	---	---	---	PASS
AMPH	273	broad.mit.edu	37	7	38530710	38530710	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38530710T>A	uc003tgu.2	-	5	405	c.336A>T	c.(334-336)AAA>AAT	p.K112N	AMPH_uc003tgv.2_Missense_Mutation_p.K112N	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	112	BAR.				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						CATCCACGAGTTTTTGATGGA	0.393													107	285	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48314761	48314761	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48314761G>A	uc003toq.2	+	17	5523	c.5498G>A	c.(5497-5499)CGG>CAG	p.R1833Q	ABCA13_uc010kyr.2_Missense_Mutation_p.R1336Q	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	1833					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TCTGGATTTCGGCAGAATTCA	0.413													11	70	---	---	---	---	PASS
DMTF1	9988	broad.mit.edu	37	7	86811528	86811528	+	Intron	SNP	C	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86811528C>G	uc003uih.2	+						DMTF1_uc003uii.2_5'UTR|DMTF1_uc003uij.2_5'UTR|DMTF1_uc011khb.1_Intron|DMTF1_uc003uik.2_RNA|DMTF1_uc003uil.2_Intron|DMTF1_uc003uin.2_5'UTR	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					TGCTGATTGGCAGACTCTTGT	0.443													12	56	---	---	---	---	PASS
MOSPD3	64598	broad.mit.edu	37	7	100211116	100211116	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100211116G>A	uc003uvq.2	+	4	500	c.298G>A	c.(298-300)GCA>ACA	p.A100T	MOSPD3_uc003uvr.2_Missense_Mutation_p.A100T|MOSPD3_uc003uvs.2_Missense_Mutation_p.A100T|MOSPD3_uc003uvt.2_Intron	NM_001040097	NP_001035186	O75425	MSPD3_HUMAN	motile sperm domain containing 3 isoform a	100	MSP.					integral to membrane	structural molecule activity			ovary(2)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TCGCCATGTGGCACCCATTCC	0.572													20	68	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100459452	100459452	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100459452G>C	uc003uwp.2	+	12	1772	c.1630G>C	c.(1630-1632)GCC>CCC	p.A544P	SLC12A9_uc003uwq.2_Missense_Mutation_p.A455P|SLC12A9_uc011kki.1_Missense_Mutation_p.A75P|SLC12A9_uc003uwr.2_Missense_Mutation_p.A280P|SLC12A9_uc003uws.2_Missense_Mutation_p.A75P|SLC12A9_uc003uwt.2_Missense_Mutation_p.A280P|SLC12A9_uc003uwv.2_Missense_Mutation_p.A75P	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	544	Extracellular (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCCCGGGGCGCCCTGCCTCT	0.657													5	41	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100681776	100681776	+	Missense_Mutation	SNP	C	A	A	rs143338962		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100681776C>A	uc003uxp.1	+	3	7132	c.7079C>A	c.(7078-7080)ACA>AAA	p.T2360K	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2360	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|37.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACACTTTCTACAACTCCTGCT	0.463													72	326	---	---	---	---	PASS
SND1	27044	broad.mit.edu	37	7	127341301	127341301	+	Silent	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127341301T>C	uc003vmi.2	+	5	739	c.513T>C	c.(511-513)CAT>CAC	p.H171H		NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	171					gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						ACGGTTCACATACTATCCGGG	0.483													25	182	---	---	---	---	PASS
GIMAP8	155038	broad.mit.edu	37	7	150171404	150171404	+	Silent	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150171404G>A	uc003whj.2	+	4	1317	c.987G>A	c.(985-987)CTG>CTA	p.L329L		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	329						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CCTTCCTGCTGGTGACACCAC	0.418													6	159	---	---	---	---	PASS
RBM33	155435	broad.mit.edu	37	7	155537939	155537939	+	Silent	SNP	T	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155537939T>G	uc010lqk.1	+	14	2990	c.2622T>G	c.(2620-2622)CTT>CTG	p.L874L	RBM33_uc011kvv.1_Silent_p.L683L|RBM33_uc003wmg.2_5'Flank	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	874							nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		AGAACAGACTTCTTGTTAAAA	0.463													4	17	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	317111	317111	+	Silent	SNP	C	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:317111C>G	uc003zgf.2	+	7	922	c.810C>G	c.(808-810)GTC>GTG	p.V270V	DOCK8_uc011lls.1_Silent_p.V270V|DOCK8_uc010mgu.2_5'UTR|DOCK8_uc010mgv.2_Silent_p.V202V|DOCK8_uc003zgg.2_Silent_p.V202V|DOCK8_uc003zgh.2_RNA	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	270					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GAATATTGGTCAAGTTGCTGA	0.388													7	236	---	---	---	---	PASS
EPB41L4B	54566	broad.mit.edu	37	9	111966009	111966009	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111966009C>T	uc004bdz.1	-	19	2175	c.1880G>A	c.(1879-1881)GGT>GAT	p.G627D		NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	627						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						CTCCTTTCCACCCTGTTAAAG	0.363													7	129	---	---	---	---	PASS
KIF12	113220	broad.mit.edu	37	9	116859632	116859632	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116859632G>C	uc004bif.2	-	4	419	c.181C>G	c.(181-183)CGG>GGG	p.R61G	KIF12_uc004big.2_RNA	NM_138424	NP_612433	Q96FN5	KIF12_HUMAN	kinesin family member 12	194	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						TCCACCACCCGCAGCTGCTCC	0.622													7	33	---	---	---	---	PASS
PTGS1	5742	broad.mit.edu	37	9	125133419	125133419	+	Intron	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125133419G>A	uc004bmg.1	+						PTGS1_uc011lys.1_Intron|PTGS1_uc010mwb.1_Intron|PTGS1_uc004bmf.1_Intron|PTGS1_uc004bmh.1_5'UTR	NM_000962	NP_000953	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 isoform 1						cyclooxygenase pathway|hormone biosynthetic process|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum membrane|Golgi apparatus|microsome|plasma membrane	heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|skin(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dipyrone(DB04817)|Etodolac(DB00749)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Mesalazine(DB00244)|Minoxidil(DB00350)|Nabumetone(DB00461)|Naproxen(DB00788)|Phenacetin(DB03783)|Piroxicam(DB00554)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Tolmetin(DB00500)	GCCTCCTGGTGGAGCCTTGAA	0.657													5	54	---	---	---	---	PASS
RABGAP1	23637	broad.mit.edu	37	9	125760994	125760994	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125760994G>A	uc011lzh.1	+	10	1457	c.1323G>A	c.(1321-1323)TGG>TGA	p.W441*	RABGAP1_uc004bnl.3_RNA	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	441					cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						GATTATTCTGGCCCTTCAGCA	0.373													21	203	---	---	---	---	PASS
RPL35	11224	broad.mit.edu	37	9	127620168	127620168	+	3'UTR	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127620168C>A	uc004boy.1	-	4						NM_007209	NP_009140	P42766	RL35_HUMAN	ribosomal protein L35						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	mRNA binding|protein binding|structural constituent of ribosome			ovary(1)	1				GBM - Glioblastoma multiforme(294;0.182)		GCAGTCTCAGCCAGCTGTGCT	0.582													5	57	---	---	---	---	PASS
ACBD5	91452	broad.mit.edu	37	10	27529390	27529390	+	Silent	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27529390G>A	uc010qdp.1	-	2	230	c.39C>T	c.(37-39)AGC>AGT	p.S13S	ACBD5_uc010qdm.1_Silent_p.S11S|ACBD5_uc010qdn.1_5'UTR|ACBD5_uc010qdo.1_5'UTR|ACBD5_uc001ito.2_5'UTR|ACBD5_uc001itp.2_5'UTR|ACBD5_uc001itq.2_5'UTR|ACBD5_uc001itr.1_5'UTR	NM_145698	NP_663736	Q5T8D3	ACBD5_HUMAN	acyl-Coenzyme A binding domain containing 5	11					transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding				0						AGCAGCACCAGCTTTCCCAAG	0.627													4	24	---	---	---	---	PASS
ZNF485	220992	broad.mit.edu	37	10	44112888	44112888	+	3'UTR	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44112888T>C	uc010qfc.1	+	5					ZNF485_uc010qfd.1_3'UTR	NM_145312	NP_660355	Q8NCK3	ZN485_HUMAN	zinc finger protein 485						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AATTATGCATTTAACAGAAAT	0.328													6	37	---	---	---	---	PASS
ZNF32	7580	broad.mit.edu	37	10	44140022	44140022	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44140022T>C	uc001jbb.2	-	3	487	c.298A>G	c.(298-300)ACT>GCT	p.T100A	uc001jba.2_Intron|ZNF32_uc001jbc.2_Missense_Mutation_p.T100A	NM_001005368	NP_001005368	P17041	ZNF32_HUMAN	zinc finger protein 32	100					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		TTTTGACCAGTGTGGATTCTC	0.473													9	126	---	---	---	---	PASS
RTKN2	219790	broad.mit.edu	37	10	63958099	63958099	+	Silent	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63958099T>C	uc001jlw.2	-	12	1495	c.1398A>G	c.(1396-1398)TTA>TTG	p.L466L	RTKN2_uc009xpf.1_Silent_p.L268L|RTKN2_uc001jlv.2_Silent_p.L120L	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	466					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					AAGGAGGTGGTAAGGATTCTT	0.383													27	166	---	---	---	---	PASS
SLC25A28	81894	broad.mit.edu	37	10	101372327	101372327	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101372327G>T	uc001kpx.2	-	3	679	c.550C>A	c.(550-552)CAT>AAT	p.H184N	SLC25A28_uc001kpy.2_5'UTR	NM_031212	NP_112489	Q96A46	MFRN2_HUMAN	solute carrier family 25, member 28	184	Solcar 2.|Helical; Name=3; (Potential).				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)		GCTGCATCATGAAGTAATGTT	0.498											OREG0020433	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	106	---	---	---	---	PASS
TRIM5	85363	broad.mit.edu	37	11	5686705	5686705	+	Intron	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5686705G>A	uc001mbm.1	-						TRIM78P_uc009yer.2_RNA|TRIM5_uc001mbl.1_Intron|TRIM5_uc001mbn.2_Intron|TRIM5_uc001mbo.2_Intron|TRIM5_uc001mbp.2_3'UTR	NM_033034	NP_149023	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform alpha						interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		ATAAAGACTTGAGAGAAAACT	0.353													20	85	---	---	---	---	PASS
OR52N4	390072	broad.mit.edu	37	11	5776181	5776181	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5776181A>G	uc001mbu.2	+	1	259	c.211A>G	c.(211-213)ACT>GCT	p.T71A	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		GCTTTCCTTTACTGACCTTGT	0.448													7	132	---	---	---	---	PASS
LTBP3	4054	broad.mit.edu	37	11	65318874	65318874	+	Silent	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65318874G>A	uc001oej.2	-	10	1889	c.1620C>T	c.(1618-1620)CCC>CCT	p.P540P	LTBP3_uc001oeh.2_5'Flank|LTBP3_uc010roi.1_Silent_p.P423P|LTBP3_uc001oei.2_Silent_p.P540P|LTBP3_uc010roj.1_Silent_p.P241P|LTBP3_uc010rok.1_Silent_p.P451P	NM_001130144	NP_001123616	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding	540						extracellular region	calcium ion binding|growth factor binding			central_nervous_system(2)|lung(1)	3						CCAGCTCACCGGGGTAGGGCC	0.627													12	42	---	---	---	---	PASS
XRRA1	143570	broad.mit.edu	37	11	74555233	74555233	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74555233A>G	uc009yub.2	-	17	2331	c.1999T>C	c.(1999-2001)TAT>CAT	p.Y667H	XRRA1_uc001ovm.2_RNA|XRRA1_uc001ovn.2_Missense_Mutation_p.Y290H|XRRA1_uc001ovo.2_Missense_Mutation_p.Y275H|XRRA1_uc001ovq.3_Missense_Mutation_p.Y580H|XRRA1_uc001ovp.3_Missense_Mutation_p.Y392H|XRRA1_uc001ovr.2_Missense_Mutation_p.Y290H|XRRA1_uc001ovs.1_Missense_Mutation_p.Y269H	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	667					response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						TTGTGAACATAGGGTTTCTGA	0.512													78	220	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2800179	2800179	+	Silent	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2800179G>A	uc009zdu.1	+	50	6793	c.6480G>A	c.(6478-6480)GCG>GCA	p.A2160A	CACNA1C_uc009zdv.1_Silent_p.A2074A|CACNA1C_uc001qkb.2_Silent_p.A2077A|CACNA1C_uc001qkc.2_Silent_p.A2096A|CACNA1C_uc001qke.2_Silent_p.A2066A|CACNA1C_uc001qkf.2_Silent_p.A2085A|CACNA1C_uc001qjz.2_Silent_p.A2077A|CACNA1C_uc001qkd.2_Silent_p.A2096A|CACNA1C_uc001qkg.2_Silent_p.A2083A|CACNA1C_uc009zdw.1_Silent_p.A2118A|CACNA1C_uc001qkh.2_Silent_p.A2085A|CACNA1C_uc001qkl.2_Silent_p.A2125A|CACNA1C_uc001qkn.2_Silent_p.A2077A|CACNA1C_uc001qko.2_Silent_p.A2097A|CACNA1C_uc001qkp.2_Silent_p.A2077A|CACNA1C_uc001qkr.2_Silent_p.A2094A|CACNA1C_uc001qku.2_Silent_p.A2112A|CACNA1C_uc001qkq.2_Silent_p.A2105A|CACNA1C_uc001qks.2_Silent_p.A2077A|CACNA1C_uc001qkt.2_Silent_p.A2096A|CACNA1C_uc001qki.1_Silent_p.A1884A|CACNA1C_uc001qkj.1_Silent_p.A1848A|CACNA1C_uc001qkk.1_Silent_p.A1813A|CACNA1C_uc001qkm.1_Silent_p.A1873A|CACNA1C_uc010sea.1_Silent_p.A768A|uc001qkx.1_Intron|CACNA1C_uc001qky.1_Silent_p.A395A	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	2160	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	TGGAGAGCGCGGCCGACAACA	0.652													3	18	---	---	---	---	PASS
MLF2	8079	broad.mit.edu	37	12	6859423	6859423	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6859423C>T	uc010sfi.1	-	6	382	c.319G>A	c.(319-321)GTC>ATC	p.V107I	MLF2_uc001qqp.2_Missense_Mutation_p.V107I|MLF2_uc009zey.1_Missense_Mutation_p.V107I	NM_005439	NP_005430	Q15773	MLF2_HUMAN	myeloid leukemia factor 2	107					defense response	cytoplasm|nucleus	protein binding			large_intestine(1)	1						TAGGAGATGACAGTGGAAGAT	0.587													21	212	---	---	---	---	PASS
KRT79	338785	broad.mit.edu	37	12	53228032	53228032	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53228032C>T	uc001sbb.2	-	1	46	c.13G>A	c.(13-15)GTC>ATC	p.V5I		NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	5	Head.					keratin filament	structural molecule activity			ovary(2)|skin(2)	4						TGCCGAGAGACGGAGGACCTC	0.617													4	50	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57600464	57600464	+	Silent	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57600464G>A	uc001snd.2	+	76	12265	c.11799G>A	c.(11797-11799)GCG>GCA	p.A3933A		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3933	Extracellular (Potential).|LDL-receptor class B 31.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CACCTGCTGCGCCTCCTACCA	0.612													9	41	---	---	---	---	PASS
MYF5	4617	broad.mit.edu	37	12	81110806	81110806	+	5'UTR	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81110806C>T	uc001szg.2	+	1						NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5						muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						CCATCCCTCTCGCTGCCGTCC	0.622													5	45	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85450294	85450294	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85450294A>C	uc001tac.2	+	8	1834	c.1723A>C	c.(1723-1725)ATC>CTC	p.I575L	LRRIQ1_uc001tab.1_Missense_Mutation_p.I575L|LRRIQ1_uc001taa.1_Missense_Mutation_p.I550L	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	575										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		GCAGAAAATAATCAAAGATAA	0.289													27	102	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132491323	132491323	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132491323C>T	uc001ujn.2	+	14	3240	c.3205C>T	c.(3205-3207)CTT>TTT	p.L1069F	EP400_uc001ujl.2_Missense_Mutation_p.L1068F|EP400_uc001ujm.2_Missense_Mutation_p.L1069F	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1105	Interactions with RUVBL1 and RUVBL2.|Helicase ATP-binding.				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GCTGGCCAAACTTTACAGGAA	0.438													16	72	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36096963	36096963	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36096963G>A	uc001wti.2	-	33	5063	c.4672C>T	c.(4672-4674)CAG>TAG	p.Q1558*	RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Nonsense_Mutation_p.Q1558*|RALGAPA1_uc010tpv.1_Nonsense_Mutation_p.Q1571*|RALGAPA1_uc010tpw.1_Nonsense_Mutation_p.Q1605*	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	1558	Minimal domain that binds to TCF3/E12 (By similarity).				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						acaaagaactggaTATTTGGA	0.303													18	95	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51259502	51259502	+	Silent	SNP	A	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51259502A>C	uc001wym.2	-	5	554	c.363T>G	c.(361-363)CCT>CCG	p.P121P	NIN_uc001wyi.2_Silent_p.P121P|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Silent_p.P121P|NIN_uc010tqp.1_Silent_p.P127P|NIN_uc001wyo.2_Silent_p.P121P|NIN_uc001wyp.1_Silent_p.P83P	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	121					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					CCGTCACTTCAGGAAACTCCT	0.547			T	PDGFRB	MPD								12	39	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96789061	96789061	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96789061T>C	uc001yfi.2	-	17	2917	c.2552A>G	c.(2551-2553)AAA>AGA	p.K851R		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	851										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TGGATTTATTTTCAGTACAAT	0.383													21	67	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25334027	25334027	+	Intron	SNP	C	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25334027C>G	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_Intron|uc001yyd.2_Intron|SNORD116-20_uc001yyf.2_RNA|SNORD116-22_uc001yyg.1_5'Flank|SNORD116-23_uc001yyh.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CCGTCATCCTCGTCGAACTGA	0.458													12	151	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28501377	28501377	+	Silent	SNP	C	T	T	rs139718674	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28501377C>T	uc001zbj.2	-	18	2710	c.2604G>A	c.(2602-2604)ACG>ACA	p.T868T	HERC2_uc001zbl.1_Silent_p.T563T	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	868					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGGTCACCACCGTCTGCTTCA	0.627													4	25	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33988670	33988670	+	Silent	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33988670T>C	uc001zhi.2	+	39	6182	c.6112T>C	c.(6112-6114)TTG>CTG	p.L2038L	RYR3_uc010bar.2_Silent_p.L2038L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2038	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAAGAGGAGTTGCTCATGAT	0.517													10	50	---	---	---	---	PASS
PLCB2	5330	broad.mit.edu	37	15	40594520	40594520	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40594520T>A	uc001zld.2	-	5	704	c.403A>T	c.(403-405)AAA>TAA	p.K135*	PLCB2_uc010bbo.2_Nonsense_Mutation_p.K135*|PLCB2_uc010ucm.1_Nonsense_Mutation_p.K135*|PLCB2_uc001zle.3_Nonsense_Mutation_p.K135*	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	135					activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		AGCGGATGTTTGACTAGGGCC	0.647													11	39	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62209539	62209539	+	Splice_Site	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62209539C>A	uc002agz.2	-	60	8129	c.8055_splice	c.e60+1	p.E2685_splice	VPS13C_uc002aha.2_Splice_Site_p.E2642_splice|VPS13C_uc002ahb.1_Splice_Site_p.E2685_splice|VPS13C_uc002ahc.1_Splice_Site_p.E2642_splice|VPS13C_uc002ahd.1_Intron	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A						protein localization					ovary(2)	2						AAGAGACATACCTCAAGTAAA	0.343													4	47	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	65954291	65954291	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65954291A>C	uc002aph.2	-	32	5868	c.5490T>G	c.(5488-5490)GAT>GAG	p.D1830E	DENND4A_uc002api.2_Missense_Mutation_p.D1873E	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	1830					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GTGTGAGACGATCGTATGCCA	0.363													3	36	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89382103	89382103	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89382103G>A	uc010upo.1	+	3	654	c.280G>A	c.(280-282)GTG>ATG	p.V94M	ACAN_uc002bmx.2_Missense_Mutation_p.V94M|ACAN_uc010upp.1_Missense_Mutation_p.V94M|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	94					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TGAAGGGCGCGTGCGGGTCAA	0.622													17	110	---	---	---	---	PASS
ADAMTS17	170691	broad.mit.edu	37	15	100514514	100514514	+	3'UTR	SNP	C	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100514514C>G	uc002bvv.1	-	22					ADAMTS17_uc002bvw.1_RNA	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CTTGTGGCAGCCGGGTGGGGG	0.547													6	6	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102516492	102516492	+	3'UTR	SNP	C	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102516492C>G	uc002cdi.2	+	11					WASH3P_uc002cdl.2_3'UTR|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_3'UTR|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						CACCTTCCCCCCCAGACCCAG	0.627													5	27	---	---	---	---	PASS
TPSAB1	7177	broad.mit.edu	37	16	1291647	1291647	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1291647T>C	uc002ckz.2	+	4	498	c.446T>C	c.(445-447)TTC>TCC	p.F149S	TPSAB1_uc010uux.1_Missense_Mutation_p.F85S	NM_003294	NP_003285	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1 precursor	149	Peptidase S1.				defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				TCAGAGACCTTCCCCCCGGGG	0.677													7	17	---	---	---	---	PASS
TRAF7	84231	broad.mit.edu	37	16	2225568	2225568	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2225568G>A	uc002cow.2	+	17	1670	c.1571G>A	c.(1570-1572)CGG>CAG	p.R524Q		NM_032271	NP_115647	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7	524	WD 4.				activation of MAPKKK activity|apoptosis|regulation of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic membrane-bounded vesicle|ubiquitin ligase complex	identical protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						CACTGGGTGCGGGCCCTGGTG	0.632													6	74	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15198590	15198590	+	Intron	SNP	C	T	T	rs113675370		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198590C>T	uc002ddc.2	+						uc010uzr.1_Missense_Mutation_p.R100H|uc010uzs.1_RNA|uc002ddh.2_3'UTR|uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGAAGAATGACGATGCTCCGC	0.488													5	100	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70065826	70065826	+	Intron	SNP	T	C	C	rs3169319	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70065826T>C	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						GATCCAAACATAGTGTTACAG	0.453													6	104	---	---	---	---	PASS
SF3B3	23450	broad.mit.edu	37	16	70601345	70601345	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70601345C>T	uc002ezf.2	+	21	3069	c.2858C>T	c.(2857-2859)GCC>GTC	p.A953V		NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3	953					protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				GCTGCTATTGCCCCATTCCAG	0.493													4	113	---	---	---	---	PASS
CDH13	1012	broad.mit.edu	37	16	83520205	83520205	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83520205A>T	uc002fgx.2	+	7	1025	c.905A>T	c.(904-906)GAT>GTT	p.D302V	CDH13_uc010vns.1_Missense_Mutation_p.D349V|CDH13_uc010vnt.1_Missense_Mutation_p.D48V|CDH13_uc010vnu.1_Missense_Mutation_p.D263V	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein	302	Cadherin 2.				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		TTCTACATCGATCCTGAGAAA	0.488													6	94	---	---	---	---	PASS
KIAA0513	9764	broad.mit.edu	37	16	85100771	85100771	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85100771C>A	uc002fiu.2	+	2	314	c.94C>A	c.(94-96)CAG>AAG	p.Q32K	KIAA0513_uc002fis.3_Missense_Mutation_p.Q32K|KIAA0513_uc010voj.1_Missense_Mutation_p.Q32K|KIAA0513_uc002fit.2_Missense_Mutation_p.Q32K	NM_014732	NP_055547	O60268	K0513_HUMAN	hypothetical protein LOC9764	32						cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)		CCCTGTGCTGCAGGACGGCGA	0.652													3	55	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3984690	3984690	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3984690C>T	uc002fxe.2	-	18	2873	c.2809G>A	c.(2809-2811)GTC>ATC	p.V937I	ZZEF1_uc002fxk.1_Missense_Mutation_p.V938I	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	937							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GCAACAGAGACGAGAGTGTCC	0.537													9	89	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34190111	34190111	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34190111A>G	uc002hke.1	-	8	793	c.644T>C	c.(643-645)GTG>GCG	p.V215A	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Missense_Mutation_p.V175A|C17orf66_uc010wcm.1_Missense_Mutation_p.V181A	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	215							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		AGCCCGGATCACATGCTTATT	0.552													38	146	---	---	---	---	PASS
FAM117A	81558	broad.mit.edu	37	17	47788829	47788829	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47788829C>T	uc002ipk.2	-	8	1219	c.1150G>A	c.(1150-1152)GTC>ATC	p.V384I	FAM117A_uc010wlz.1_Missense_Mutation_p.V112I	NM_030802	NP_110429	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	384										ovary(1)	1						ATCAGGTTGACGGGGCAGAAG	0.607													4	89	---	---	---	---	PASS
CHAD	1101	broad.mit.edu	37	17	48545894	48545894	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48545894G>A	uc010dbr.2	-	1	334	c.281C>T	c.(280-282)GCC>GTC	p.A94V	ACSF2_uc002iqu.2_Intron|ACSF2_uc010wml.1_Intron|ACSF2_uc010wmm.1_Intron|ACSF2_uc010wmn.1_Intron|ACSF2_uc010wmo.1_Intron|CHAD_uc010dbs.2_Missense_Mutation_p.A94V|ACSF2_uc010dbt.1_Intron	NM_001267	NP_001258	O15335	CHAD_HUMAN	chondroadherin precursor	94	LRR 1.				regulation of cell growth	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(2)|central_nervous_system(1)	3	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GCCGCGGAAGGCACCGGCGGC	0.617													12	52	---	---	---	---	PASS
MRC2	9902	broad.mit.edu	37	17	60743545	60743545	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60743545C>T	uc002jad.2	+	3	1013	c.611C>T	c.(610-612)ACG>ATG	p.T204M	MRC2_uc002jac.2_Missense_Mutation_p.T204M	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	204	Extracellular (Potential).|Fibronectin type-II.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						TGCACCAGCACGGGCCGCGAG	0.612													3	16	---	---	---	---	PASS
CD79B	974	broad.mit.edu	37	17	62009607	62009607	+	Silent	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62009607C>T	uc002jdq.1	-	1	98	c.15G>A	c.(13-15)GCG>GCA	p.A5A	CD79B_uc002jdo.1_5'Flank|CD79B_uc002jdp.1_Silent_p.A5A|CD79B_uc002jdr.1_Silent_p.A5A	NM_000626	NP_000617	P40259	CD79B_HUMAN	CD79B antigen isoform 1 precursor	5					cell surface receptor linked signaling pathway|immune response	Golgi apparatus|integral to plasma membrane|nucleus	transmembrane receptor activity				0						CAGGAGACAACGCCAGCCTGG	0.622			Mis|O		DLBCL								4	17	---	---	---	---	PASS
SLC38A10	124565	broad.mit.edu	37	17	79220707	79220707	+	Silent	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79220707G>A	uc002jzz.1	-	15	2595	c.2220C>T	c.(2218-2220)GAC>GAT	p.D740D	SLC38A10_uc002jzy.1_Silent_p.D658D	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	740					amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TATCCTCCTCGTCCTCCTGCC	0.647													9	66	---	---	---	---	PASS
ELP2	55250	broad.mit.edu	37	18	33750159	33750159	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33750159G>T	uc002kzk.1	+	20	2220	c.2210G>T	c.(2209-2211)CGA>CTA	p.R737L	ELP2_uc010xcg.1_Missense_Mutation_p.R802L|ELP2_uc002kzl.1_RNA|ELP2_uc002kzm.1_Missense_Mutation_p.R711L|ELP2_uc010xch.1_Missense_Mutation_p.R732L|ELP2_uc002kzn.1_Missense_Mutation_p.R667L|ELP2_uc002kzo.1_Missense_Mutation_p.R667L	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2	737	WD 13.				regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						CCTTCTCAACGGTCAGTCTCT	0.512													22	95	---	---	---	---	PASS
TCF4	6925	broad.mit.edu	37	18	52895520	52895520	+	Missense_Mutation	SNP	G	A	A	rs148802110		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52895520G>A	uc002lfz.2	-	19	2552	c.1940C>T	c.(1939-1941)CCT>CTT	p.P647L	TCF4_uc002lfw.3_Missense_Mutation_p.P491L|TCF4_uc010xdu.1_Missense_Mutation_p.P517L|TCF4_uc010xdv.1_Missense_Mutation_p.P517L|TCF4_uc002lfx.2_Missense_Mutation_p.P580L|TCF4_uc010xdw.1_Missense_Mutation_p.P517L|TCF4_uc002lfy.2_Missense_Mutation_p.P605L|TCF4_uc010xdx.1_Missense_Mutation_p.P623L|TCF4_uc010dph.1_Missense_Mutation_p.P651L|TCF4_uc010xdy.1_Missense_Mutation_p.P627L|TCF4_uc002lga.2_Missense_Mutation_p.P753L|TCF4_uc002lgb.1_Missense_Mutation_p.P487L|TCF4_uc010dpi.2_Missense_Mutation_p.P657L|TCF4_uc002lfv.2_Missense_Mutation_p.P430L	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b	647					positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CAAGGAGAGAGGGGGAGGCTC	0.502													9	129	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59195205	59195205	+	Silent	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59195205G>A	uc010dps.1	+	6	1035	c.1023G>A	c.(1021-1023)CTG>CTA	p.L341L	CDH20_uc002lif.2_Silent_p.L335L	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	341	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				TTCAGCCCCTGAGTTTTGAAA	0.438													6	64	---	---	---	---	PASS
ZNRF4	148066	broad.mit.edu	37	19	5456632	5456632	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5456632C>A	uc002mca.3	+	1	1207	c.1130C>A	c.(1129-1131)CCG>CAG	p.P377Q		NM_181710	NP_859061	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4 precursor	377	Cytoplasmic (Potential).					integral to membrane	zinc ion binding	p.P377Q(1)		large_intestine(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CCCTCCCTACCGGGCCACCGG	0.687													4	70	---	---	---	---	PASS
SHKBP1	92799	broad.mit.edu	37	19	41092770	41092770	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41092770G>T	uc002oob.2	+	13	1305	c.1256G>T	c.(1255-1257)GGG>GTG	p.G419V	SHKBP1_uc002ooc.2_Missense_Mutation_p.G394V|SHKBP1_uc002ood.2_Missense_Mutation_p.G419V|SHKBP1_uc010xvl.1_Missense_Mutation_p.G342V|SHKBP1_uc002ooe.2_Missense_Mutation_p.G256V|SHKBP1_uc002oof.2_Missense_Mutation_p.G256V|SHKBP1_uc010xvm.1_Intron|SHKBP1_uc010xvn.1_Missense_Mutation_p.G297V	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	419						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|pancreas(1)	2			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTGGGCTCGGGGCCTCAGCTC	0.627													13	179	---	---	---	---	PASS
CYP2B6	1555	broad.mit.edu	37	19	41515984	41515984	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41515984C>T	uc002opr.1	+	6	915	c.908C>T	c.(907-909)ACC>ATC	p.T303I	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Intron	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	303					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	ACTGAGACCACCAGCACCACT	0.562													17	82	---	---	---	---	PASS
SEPW1	6415	broad.mit.edu	37	19	48284546	48284546	+	Splice_Site	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48284546G>A	uc010xyw.1	+	6	385	c.184_splice	c.e6-1	p.K62_splice	SEPW1_uc002pho.1_5'Flank	NM_003009	NP_003000	P63302	SELW_HUMAN	selenoprotein W, 1						cell redox homeostasis	cytoplasm	selenium binding				0		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		all cancers(93;0.000291)|OV - Ovarian serous cystadenocarcinoma(262;0.000305)|Epithelial(262;0.0146)|GBM - Glioblastoma multiforme(486;0.0273)		CCCCTCCCTAGAAAGGCGATG	0.602													5	65	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31023504	31023504	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31023504G>T	uc002wxs.2	+	12	3415	c.2989G>T	c.(2989-2991)GAG>TAG	p.E997*	ASXL1_uc010geb.2_Nonsense_Mutation_p.E888*	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	997					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						TCCTCACGGTGAGTCCACGGA	0.517			F|N|Mis		MDS|CMML								24	71	---	---	---	---	PASS
LPIN3	64900	broad.mit.edu	37	20	39987126	39987126	+	Silent	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39987126C>T	uc002xjx.2	+	19	2446	c.2355C>T	c.(2353-2355)TTC>TTT	p.F785F	LPIN3_uc010ggh.2_Silent_p.F786F|LPIN3_uc010zwf.1_RNA	NM_022896	NP_075047	Q9BQK8	LPIN3_HUMAN	lipin 3	785	C-LIP.				fatty acid metabolic process	nucleus	phosphatidate phosphatase activity			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.000739)				CACGCATCTTCACAGTCAACC	0.607													10	69	---	---	---	---	PASS
ZMYND8	23613	broad.mit.edu	37	20	45927547	45927547	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45927547G>T	uc002xta.1	-	4	573	c.319C>A	c.(319-321)CCC>ACC	p.P107T	ZMYND8_uc010ghr.1_Missense_Mutation_p.P82T|ZMYND8_uc002xst.1_Missense_Mutation_p.P82T|ZMYND8_uc002xsu.1_Missense_Mutation_p.P107T|ZMYND8_uc002xsv.1_Missense_Mutation_p.P82T|ZMYND8_uc002xsw.1_5'UTR|ZMYND8_uc002xsx.1_5'UTR|ZMYND8_uc002xsy.1_Missense_Mutation_p.P82T|ZMYND8_uc002xsz.1_Missense_Mutation_p.P82T|ZMYND8_uc010zxy.1_Missense_Mutation_p.P134T|ZMYND8_uc002xtb.1_Missense_Mutation_p.P127T|ZMYND8_uc002xss.2_Missense_Mutation_p.P107T|ZMYND8_uc010zxz.1_Missense_Mutation_p.P102T|ZMYND8_uc002xtc.1_Missense_Mutation_p.P127T|ZMYND8_uc002xtd.1_Missense_Mutation_p.P102T|ZMYND8_uc002xte.1_Missense_Mutation_p.P107T|ZMYND8_uc010zya.1_Missense_Mutation_p.P107T|ZMYND8_uc002xtf.1_Missense_Mutation_p.P127T|ZMYND8_uc002xtg.2_Missense_Mutation_p.P101T|ZMYND8_uc010ghs.1_Missense_Mutation_p.P101T|ZMYND8_uc002xth.2_Missense_Mutation_p.P127T	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b	107	PHD-type.						protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			TAAACCCGGGGACAGAGCTCA	0.507													6	58	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33641251	33641251	+	3'UTR	SNP	C	T	T	rs11557587		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641251C>T	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						ttttttttttctttttttttt	0.154													3	31	---	---	---	---	PASS
GCFC1	94104	broad.mit.edu	37	21	34117899	34117899	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34117899A>C	uc002yqn.2	-	12	2244	c.2054T>G	c.(2053-2055)CTT>CGT	p.L685R	GCFC1_uc002yql.2_Missense_Mutation_p.L194R|GCFC1_uc002yqm.2_Missense_Mutation_p.L179R|GCFC1_uc002yqo.2_RNA|GCFC1_uc002yqp.2_Missense_Mutation_p.L685R	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate	685						cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						TAGTTTAGGAAGAATCACCTT	0.363													21	174	---	---	---	---	PASS
UMODL1	89766	broad.mit.edu	37	21	43496429	43496429	+	Intron	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43496429G>A	uc002zaf.1	+						UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Intron|UMODL1_uc002zag.1_Intron|uc002zah.1_RNA	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						AGTCACCGTTGGCATCCATTG	0.448													19	35	---	---	---	---	PASS
SEC14L4	284904	broad.mit.edu	37	22	30886259	30886259	+	Intron	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30886259G>A	uc003aid.2	-						SEC14L4_uc011akz.1_Intron|SEC14L4_uc003aie.2_Intron|SEC14L4_uc003aif.2_Missense_Mutation_p.S313F	NM_174977	NP_777637	Q9UDX3	S14L4_HUMAN	SEC14p-like protein TAP3 isoform a							integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)	GGTGATCAGGGAGCACAAACC	0.582													9	71	---	---	---	---	PASS
OSBP2	23762	broad.mit.edu	37	22	31091334	31091334	+	Silent	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31091334G>A	uc003aiy.1	+	1	542	c.438G>A	c.(436-438)GCG>GCA	p.A146A	OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Silent_p.A146A|OSBP2_uc011alb.1_Silent_p.A146A|OSBP2_uc003aiz.1_Silent_p.A146A	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a	146					lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						CGCTGCCAGCGTTAAAGCCCC	0.652													4	43	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37494473	37494473	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37494473C>T	uc003aqs.1	-	3	460	c.346G>A	c.(346-348)GCC>ACC	p.A116T	TMPRSS6_uc003aqt.1_Missense_Mutation_p.A107T|TMPRSS6_uc003aqu.2_Missense_Mutation_p.A107T	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	116	Extracellular (Potential).			A -> V (in Ref. 1; CAC85953).	angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity	p.A116D(1)		breast(4)|ovary(1)|skin(1)	6						TGGGCTTTGGCGGTTTCACTG	0.562													10	448	---	---	---	---	PASS
TUBGCP6	85378	broad.mit.edu	37	22	50660936	50660936	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50660936G>A	uc003bkb.1	-	14	2868	c.2356C>T	c.(2356-2358)CGA>TGA	p.R786*	TUBGCP6_uc003bka.1_5'Flank|TUBGCP6_uc010har.1_Nonsense_Mutation_p.R778*|TUBGCP6_uc010has.1_RNA|TUBGCP6_uc010hat.1_5'UTR	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	786					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CTCTCCAGTCGGTGCCTCTGG	0.572													7	55	---	---	---	---	PASS
HCCS	3052	broad.mit.edu	37	X	11130140	11130140	+	5'UTR	SNP	T	G	G			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11130140T>G	uc004cuk.2	+	2					uc004cui.1_5'Flank|HCCS_uc004cuj.2_5'UTR|HCCS_uc004cul.1_5'UTR	NM_005333	NP_005324	P53701	CCHL_HUMAN	holocytochrome c synthase						organ morphogenesis|oxidation-reduction process	mitochondrial inner membrane	holocytochrome-c synthase activity|metal ion binding				0						TTTTGGCAGGTGGAAATTTAA	0.448											OREG0019665	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	60	---	---	---	---	PASS
ALAS2	212	broad.mit.edu	37	X	55042056	55042056	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55042056G>A	uc004dua.3	-	8	1261	c.1123C>T	c.(1123-1125)CGT>TGT	p.R375C	ALAS2_uc004dub.3_Missense_Mutation_p.R362C|ALAS2_uc004dud.3_Missense_Mutation_p.R338C	NM_000032	NP_000023	P22557	HEM0_HUMAN	5-aminolevulinate synthase 2 isoform a	375					cellular iron ion homeostasis|erythrocyte differentiation|heme biosynthetic process|hemoglobin biosynthetic process|oxygen homeostasis|response to hypoxia	mitochondrial inner membrane|mitochondrial matrix	5-aminolevulinate synthase activity|coenzyme binding|glycine binding|protein binding|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(1)	1					Glycine(DB00145)	ATTCCATCACGCTCCCCAATC	0.522													5	109	---	---	---	---	PASS
GPR174	84636	broad.mit.edu	37	X	78426732	78426732	+	Silent	SNP	C	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78426732C>A	uc004edg.1	+	1	264	c.228C>A	c.(226-228)ATC>ATA	p.I76I		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	76	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						CACTGAGGATCTTCTACTACT	0.388										HNSCC(63;0.18)			8	53	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83128044	83128044	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128044C>T	uc004eei.1	+	4	349	c.328C>T	c.(328-330)CTT>TTT	p.L110F	CYLC1_uc004eeh.1_Missense_Mutation_p.L109F	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	110					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						CAAAACCCATCTTAAAAAAGC	0.368													9	63	---	---	---	---	PASS
SPANXN1	494118	broad.mit.edu	37	X	144337530	144337530	+	3'UTR	SNP	T	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144337530T>C	uc004fcb.2	+	2						NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein												0	Acute lymphoblastic leukemia(192;6.56e-05)					ACCTGAAGGATCTTCAAAGCA	0.448													5	91	---	---	---	---	PASS
L1CAM	3897	broad.mit.edu	37	X	153130647	153130647	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153130647G>A	uc004fjb.2	-	21	2876	c.2768C>T	c.(2767-2769)GCG>GTG	p.A923V	L1CAM_uc004fjc.2_Missense_Mutation_p.A923V|L1CAM_uc010nuo.2_Missense_Mutation_p.A918V	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	923	Extracellular (Potential).|Fibronectin type-III 4.				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGGTGCAACGCCTCGGGGTG	0.687													3	27	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	6230	6230	+	5'UTR	SNP	C	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6230C>T	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		CCTCCCTCTCTCCTACTCCTG	0.547													4	1	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8419594	8419595	+	Intron	DEL	CA	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8419594_8419595delCA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc001apd.2_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		TAGGAGGACGCACAGTCACTGC	0.564													6	5	---	---	---	---	
UBR4	23352	broad.mit.edu	37	1	19474752	19474752	+	Intron	DEL	A	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19474752delA	uc001bbi.2	-						UBR4_uc001bbk.1_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGCAAAGAGAAAAAAAAAAA	0.448													4	3	---	---	---	---	
GMEB1	10691	broad.mit.edu	37	1	29041385	29041386	+	3'UTR	INS	-	A	A	rs35942724		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29041385_29041386insA	uc001bra.2	+	10					GMEB1_uc001bqz.2_3'UTR|GMEB1_uc001brb.2_3'UTR	NM_006582	NP_006573	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|metal ion binding|transcription coactivator activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GACCCTTTTTTAAAAAAAAAAA	0.342													7	6	---	---	---	---	
MAP7D1	55700	broad.mit.edu	37	1	36643701	36643703	+	In_Frame_Del	DEL	AGA	-	-	rs76219908		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36643701_36643703delAGA	uc001bzz.2	+	9	1823_1825	c.1607_1609delAGA	c.(1606-1611)GAGAAG>GAG	p.K537del	MAP7D1_uc001caa.2_In_Frame_Del_p.K505del|MAP7D1_uc001cab.2_In_Frame_Del_p.K500del|MAP7D1_uc001cac.2_In_Frame_Del_p.K237del|MAP7D1_uc001cad.2_In_Frame_Del_p.K83del	NM_018067	NP_060537	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	537	Pro-rich.					cytoplasm|spindle				ovary(3)|breast(2)	5		Myeloproliferative disorder(586;0.0393)				GCCAGTAACGAGAAGGAGTCAGC	0.719													5	3	---	---	---	---	
C1orf175	374977	broad.mit.edu	37	1	55167626	55167627	+	Intron	INS	-	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55167626_55167627insC	uc010ooe.1	+						C1orf175_uc001cxq.2_Intron|C1orf175_uc001cxs.2_Intron|C1orf175_uc010ood.1_Intron|C1orf175_uc010oof.1_Intron|C1orf175_uc001cxr.1_Intron|C1orf175_uc009vzq.1_Intron|C1orf175_uc001cxt.1_Intron|C1orf175_uc009vzr.1_Intron	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977							integral to membrane	binding				0						tgccttttaggttagtgggggt	0.307													4	2	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669701	94669701	+	Intron	DEL	T	-	-	rs77020055		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669701delT	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTCTTCCttttttttttt	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120429341	120429342	+	IGR	DEL	AC	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120429341_120429342delAC								NBPF7 (41562 upstream) : ADAM30 (6815 downstream)																							TCTCTCTcatacacacacacac	0.277													4	3	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153800931	153800932	+	Intron	INS	-	AC	AC	rs144104082	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800931_153800932insAC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTCTcacacatacacacacaca	0.233													11	5	---	---	---	---	
SCAMP3	10067	broad.mit.edu	37	1	155228958	155228960	+	Intron	DEL	TTT	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155228958_155228960delTTT	uc001fjs.2	-						RAG1AP1_uc010pey.1_Intron|SCAMP3_uc001fjr.2_Intron|SCAMP3_uc001fju.2_Intron|SCAMP3_uc001fjv.2_Intron|SCAMP3_uc001fjt.2_Intron	NM_005698	NP_005689	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3 isoform 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane				ovary(3)	3	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			ccacctcagcttttttttttttt	0.000													4	2	---	---	---	---	
SNRPE	6635	broad.mit.edu	37	1	203833063	203833066	+	Intron	DEL	TCTG	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203833063_203833066delTCTG	uc001hai.2	+						SNRPE_uc010pqn.1_Intron	NM_003094	NP_003085	P62304	RUXE_HUMAN	small nuclear ribonucleoprotein polypeptide E						histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|RNA binding				0	all_cancers(21;0.103)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TTTTCTTTCCTCTGTCTATGTTGA	0.191													2	4	---	---	---	---	
SIPA1L2	57568	broad.mit.edu	37	1	232601294	232601295	+	Intron	DEL	AT	-	-	rs34645211		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232601294_232601295delAT	uc001hvg.2	-							NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				acatacacacatacacacacac	0.218													3	4	---	---	---	---	
ARID4B	51742	broad.mit.edu	37	1	235397593	235397594	+	Intron	DEL	TT	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235397593_235397594delTT	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron|ARID4B_uc001hwt.3_Intron	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			ACAGTGACTCTTTGAAACATTC	0.257													4	4	---	---	---	---	
KIF3C	3797	broad.mit.edu	37	2	26152485	26152486	+	Intron	INS	-	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26152485_26152486insT	uc002rgu.2	-						KIF3C_uc010eyj.1_Intron|KIF3C_uc010ykr.1_Intron	NM_002254	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C						blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCATAGGCTCttttttttttt	0.292													5	3	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29129301	29129301	+	Intron	DEL	T	-	-	rs113220687		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29129301delT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					cagccttaaattttttttttt	0.194													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	47617363	47617364	+	IGR	INS	-	CTTC	CTTC	rs139588955	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47617363_47617364insCTTC								EPCAM (3198 upstream) : MSH2 (12842 downstream)																							ttctttccttgcttccttcctt	0.168													3	3	---	---	---	---	
AFF3	3899	broad.mit.edu	37	2	100210335	100210340	+	In_Frame_Del	DEL	GGCTGA	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100210335_100210340delGGCTGA	uc002tag.2	-	14	2019_2024	c.1783_1788delTCAGCC	c.(1783-1788)TCAGCCdel	p.SA595del	AFF3_uc002taf.2_In_Frame_Del_p.SA620del|AFF3_uc010fiq.1_In_Frame_Del_p.SA595del|AFF3_uc010yvr.1_In_Frame_Del_p.SA748del|AFF3_uc002tah.1_In_Frame_Del_p.SA620del	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	595_596					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						CGCCGTCCCCGGCTGAGGTCCTCTCG	0.782													15	7	---	---	---	---	
ACOXL	55289	broad.mit.edu	37	2	111700740	111700740	+	Intron	DEL	A	-	-	rs34037443		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111700740delA	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						aaagaaaaagaaaaagggagg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133018714	133018715	+	IGR	DEL	GT	-	-	rs141065944		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133018714_133018715delGT								NCRNA00164 (3172 upstream) : GPR39 (155432 downstream)																							GGGCGGGGTGGTGGGGGGTGCC	0.530													4	4	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186180379	186180379	+	Intron	DEL	T	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186180379delT	uc003ixh.2	+							NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TGGTAGAGTATTTTTTTTTTT	0.289													3	3	---	---	---	---	
TERT	7015	broad.mit.edu	37	5	1258843	1258843	+	Intron	DEL	T	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1258843delT	uc003jcb.1	-						TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1						anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TACTTTTTGCTTTATCATCCA	0.468									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				4	2	---	---	---	---	
MTMR12	54545	broad.mit.edu	37	5	32263539	32263539	+	Intron	DEL	T	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32263539delT	uc003jhq.2	-						MTMR12_uc010iuk.2_Intron|MTMR12_uc010iul.2_Intron	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12							cytoplasm	phosphatase activity			ovary(1)	1						ACTGAGTCTCttttttttttt	0.174													6	3	---	---	---	---	
SCAMP1	9522	broad.mit.edu	37	5	77756566	77756567	+	Intron	INS	-	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77756566_77756567insC	uc003kfl.2	+						SCAMP1_uc010jaa.2_Intron|SCAMP1_uc011ctc.1_Intron|SCAMP1_uc011ctd.1_Intron|SCAMP1_uc003kfm.2_Intron|SCAMP1_uc003kfn.2_Intron	NM_004866	NP_004857	O15126	SCAM1_HUMAN	secretory carrier membrane protein 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|recycling endosome membrane|trans-Golgi network	protein binding				0		all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		gtttcttttctccttccttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41381345	41381345	+	IGR	DEL	T	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41381345delT								C7orf10 (480988 upstream) : INHBA (347258 downstream)																							tttctctccctccctcttttc	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65268568	65268570	+	IGR	DEL	CTT	-	-	rs75342027		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65268568_65268570delCTT								CCT6P1 (39907 upstream) : VKORC1L1 (69687 downstream)																							CCTCTTTTTCCTTCttttttaaa	0.365													7	6	---	---	---	---	
ZNF394	84124	broad.mit.edu	37	7	99097022	99097022	+	Intron	DEL	A	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99097022delA	uc003uqs.2	-						ZNF394_uc003uqt.2_Intron|ZNF394_uc003uqu.1_Intron	NM_032164	NP_115540	Q53GI3	ZN394_HUMAN	zinc finger protein 394						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					gaacaacaagaaaaaaaaaaa	0.169													5	3	---	---	---	---	
LHFPL3	375612	broad.mit.edu	37	7	104255128	104255135	+	Intron	DEL	TTCTTTCT	-	-	rs10585148	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104255128_104255135delTTCTTTCT	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3							integral to membrane					0						ccttccttccttctttctttctttcttt	0.000													4	2	---	---	---	---	
KIAA1549	57670	broad.mit.edu	37	7	138555817	138555817	+	Intron	DEL	C	-	-	rs35334186		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138555817delC	uc011kql.1	-						KIAA1549_uc011kqi.1_Intron|KIAA1549_uc003vuk.3_Intron|KIAA1549_uc011kqj.1_Intron|KIAA1549_uc011kqk.1_Intron	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1							integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						cctgccttggcccccccaagt	0.065			O	BRAF	pilocytic astrocytoma								4	6	---	---	---	---	
TRAM1	23471	broad.mit.edu	37	8	71520608	71520609	+	5'Flank	INS	-	A	A	rs112550133		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71520608_71520609insA	uc003xyo.1	-						TRAM1_uc011lfc.1_5'UTR	NM_014294	NP_055109	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1						cotranslational protein targeting to membrane|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity			ovary(1)	1			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			CCGCCCGGGGGAAAAAAAAAAA	0.723													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125850087	125850088	+	IGR	INS	-	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125850087_125850088insT								MTSS1 (109357 upstream) : LOC157381 (101796 downstream)																							tccttccttccttccttccttc	0.000													4	4	---	---	---	---	
SCRIB	23513	broad.mit.edu	37	8	144874132	144874133	+	Intron	INS	-	C	C	rs149884795	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144874132_144874133insC	uc003yzp.1	-						SCRIB_uc003yzn.1_Intron|SCRIB_uc003yzo.1_Intron	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b						activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CGGCAGGCTGACCCCCCCGACC	0.738													3	3	---	---	---	---	
KANK1	23189	broad.mit.edu	37	9	710630	710630	+	Intron	DEL	C	-	-	rs68161748		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:710630delC	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		aaaaaaaaaacaaaaaaaaac	0.000													13	6	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27434230	27434231	+	Intron	INS	-	A	A	rs117799729		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27434230_27434231insA	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						AAAAAAAAAACAAAAAAAAAAC	0.158													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30450744	30450745	+	IGR	DEL	TT	-	-	rs148421389		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30450744_30450745delTT								KIAA1462 (46324 upstream) : MTPAP (147986 downstream)																							TAGTTCCGGGtttttttttttt	0.307													6	3	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51073487	51073488	+	Intron	DEL	AC	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51073487_51073488delAC	uc001jif.2	-						PARG_uc001jih.2_Intron|PARG_uc001jig.2_Intron|PARG_uc010qgv.1_Intron|PARG_uc009xoi.2_Intron|PARG_uc010qgw.1_Intron|PARG_uc009xoj.2_Intron|PARG_uc010qgx.1_Intron	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		AAAAGATTATacacacacacac	0.252													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132769952	132769955	+	IGR	DEL	TTTT	-	-	rs10829858	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132769952_132769955delTTTT								GLRX3 (787168 upstream) : TCERG1L (120701 downstream)																							tccttccttcttttcttccttcct	0.113													5	3	---	---	---	---	
HTATIP2	10553	broad.mit.edu	37	11	20404388	20404396	+	Intron	DEL	TAGACACCT	-	-	rs141798698		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20404388_20404396delTAGACACCT	uc009yia.1	+						HTATIP2_uc009yib.1_Intron|HTATIP2_uc001mpx.2_Intron|HTATIP2_uc001mpz.2_Intron	NM_006410	NP_006401	Q9BUP3	HTAI2_HUMAN	HIV-1 Tat interactive protein 2, 30kDa isoform						angiogenesis|anti-apoptosis|apoptosis|cell differentiation|cellular amino acid metabolic process|induction of apoptosis|interspecies interaction between organisms|nuclear import|regulation of angiogenesis|regulation of transcription from RNA polymerase II promoter	cytoplasm|nuclear envelope	NAD binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor|protein binding|transcription coactivator activity				0						tcttcaaatatagacaccttggggattag	0.110													4	2	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47745432	47745432	+	Intron	DEL	T	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47745432delT	uc009ylv.2	-						FNBP4_uc001ngi.2_Intron|FNBP4_uc001ngj.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						CTGTCAAAAGttttttttttt	0.154													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	102415498	102415501	+	IGR	DEL	TTCC	-	-	rs10543432		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102415498_102415501delTTCC								MMP7 (14020 upstream) : MMP20 (32066 downstream)																							ccccccttctttccttccttcctt	0.069													5	3	---	---	---	---	
POU6F1	5463	broad.mit.edu	37	12	51585884	51585891	+	Intron	DEL	CTCGGCCT	-	-	rs11276817		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51585884_51585891delCTCGGCCT	uc001rxy.2	-						POU6F1_uc001rxz.2_Intron|POU6F1_uc001rya.2_Intron	NM_002702	NP_002693	Q14863	PO6F1_HUMAN	POU class 6 homeobox 1						brain development|heart development|muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1						CAGCCCATGGCTCGGCCTCTCCAAAAAG	0.558													4	4	---	---	---	---	
CBX5	23468	broad.mit.edu	37	12	54646179	54646179	+	Intron	DEL	A	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54646179delA	uc001sfh.3	-						CBX5_uc001sfk.3_Intron|CBX5_uc001sfi.3_Intron|CBX5_uc001sfj.3_Intron	NM_001127322	NP_001120794	P45973	CBX5_HUMAN	heterochromatin protein 1-alpha						blood coagulation|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|nuclear centromeric heterochromatin|nuclear envelope|nucleolus|transcriptional repressor complex	methylated histone residue binding|protein binding, bridging|repressing transcription factor binding				0						aggaaaaatgaaaaaaaaaaa	0.129													4	2	---	---	---	---	
GLIPR1	11010	broad.mit.edu	37	12	75884362	75884363	+	Intron	DEL	AC	-	-	rs150016880		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75884362_75884363delAC	uc001sxs.2	+						GLIPR1_uc009zsb.1_Intron	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor						cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3						AAAAACAACAACAAAAAAAAAC	0.282													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	112367401	112367413	+	IGR	DEL	GAAAGAAAGGAAA	-	-	rs112182778	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112367401_112367413delGAAAGAAAGGAAA								MAPKAPK5 (36174 upstream) : TMEM116 (1690 downstream)																							agaaagaaaggaaagaaaggaaagaaagaaagg	0.033													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114112058	114112065	+	IGR	DEL	TCCTTCTC	-	-	rs71086202	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114112058_114112065delTCCTTCTC								LHX5 (202181 upstream) : RBM19 (142478 downstream)																							cttccttccttccttctctccttccttc	0.168													3	3	---	---	---	---	
TBC1D4	9882	broad.mit.edu	37	13	75923091	75923096	+	Intron	DEL	GTGTGT	-	-	rs151307196		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75923091_75923096delGTGTGT	uc001vjl.1	-						TBC1D4_uc010aer.2_Intron|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		gagagagagagtgtgtgtgtgtgtgt	0.189													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79423336	79423343	+	IGR	DEL	TTTTTTTT	-	-	rs71203096		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79423336_79423343delTTTTTTTT								RNF219 (188636 upstream) : RBM26 (470757 downstream)																							ACCCACAGTAtttttttttttttttttt	0.447													4	2	---	---	---	---	
ACIN1	22985	broad.mit.edu	37	14	23528863	23528863	+	Intron	DEL	T	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23528863delT	uc001wit.3	-						CDH24_uc001wil.2_5'Flank|CDH24_uc010akf.2_5'Flank|CDH24_uc001win.3_5'Flank|ACIN1_uc001wio.3_Intron|ACIN1_uc001wip.3_Intron|ACIN1_uc001wiq.3_Intron|ACIN1_uc001wir.3_Intron|ACIN1_uc001wis.3_Intron|ACIN1_uc010akg.2_Intron	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		AGTTTCAGCCttttttttttt	0.254													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106919168	106919168	+	RNA	DEL	C	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106919168delC	uc010tyt.1	-	245		c.10611delG			uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						ACGTTAACCTCCCCCTCACTG	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	41455326	41455326	+	IGR	DEL	C	-	-	rs150346198		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41455326delC								INO80 (46986 upstream) : EXD1 (19607 downstream)																							aaatactGGGCCCCCGCAAGG	0.388													3	4	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48058484	48058484	+	Intron	DEL	G	-	-	rs528882	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058484delG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CTTTTTTTTTGTTGTTATGGG	0.358													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84958415	84958426	+	IGR	DEL	CGAGGACATTGG	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84958415_84958426delCGAGGACATTGG								LOC388152 (59495 upstream) : GOLGA6L5 (89312 downstream)																							TCGGGCACCACGAGGACATTGGTGAGGACAGG	0.557													9	5	---	---	---	---	
SPIRE2	84501	broad.mit.edu	37	16	89916879	89916880	+	In_Frame_Ins	INS	-	GAG	GAG	rs146569219	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89916879_89916880insGAG	uc002foz.1	+	3	508_509	c.456_457insGAG	c.(454-459)insGAG	p.157_158insE	SPIRE2_uc010civ.1_In_Frame_Ins_p.72_73insE|SPIRE2_uc010ciw.1_In_Frame_Ins_p.157_158insE|SPIRE2_uc002fpa.1_In_Frame_Ins_p.109_110insE|SPIRE2_uc010cix.1_In_Frame_Ins_p.26_27insE	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	157_158	KIND.				transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		ACGGGGGTCCCGAGGAGGAGGA	0.728													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																							GTTTGTTACCTCTATCTATTGACT	0.343													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35210426	35210429	+	IGR	DEL	AAGG	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35210426_35210429delAAGG								MRM1 (245020 upstream) : LHX1 (84070 downstream)																							agaaagaaaaaaggaaggaaggaa	0.191													7	6	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76087407	76087408	+	Intron	INS	-	A	A			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76087407_76087408insA	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			gactccgtctcaaaaaaaaaaa	0.178													9	4	---	---	---	---	
ZADH2	284273	broad.mit.edu	37	18	72920998	72920999	+	Frame_Shift_Ins	INS	-	C	C			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72920998_72920999insC	uc002llx.2	-	1	283_284	c.15_16insG	c.(13-18)GTGCCCfs	p.V5fs	TSHZ1_uc002lly.2_5'Flank	NM_175907	NP_787103	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain	5_6						peroxisome	oxidoreductase activity|zinc ion binding				0		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		GCCCCGGTGGGCACCAGCCGCA	0.604													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7801332	7801339	+	IGR	DEL	TTCCTTCC	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7801332_7801339delTTCCTTCC								CLEC4G (4275 upstream) : CD209 (3542 downstream)																							AACtctttctttccttccttccttcctt	0.005													3	3	---	---	---	---	
OR1M1	125963	broad.mit.edu	37	19	9203785	9203786	+	5'Flank	INS	-	AT	AT	rs4804096	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9203785_9203786insAT	uc010xkj.1	+							NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3						cacacacacacatatatatata	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14997642	14997642	+	IGR	DEL	A	-	-	rs34351275		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14997642delA								OR7A17 (5475 upstream) : OR7C2 (54659 downstream)																							ccatctcactaaaaaaaaaaa	0.184													5	3	---	---	---	---	
MLL4	9757	broad.mit.edu	37	19	36215779	36215780	+	Intron	INS	-	GGGTCTGGATCA	GGGTCTGGATCA	rs141957853	by1000genomes	TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36215779_36215780insGGGTCTGGATCA	uc010eei.2	+							NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4						chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGAAAGCAAAGGGGTCTGGATC	0.604													4	2	---	---	---	---	
DMRTC2	63946	broad.mit.edu	37	19	42352413	42352414	+	Intron	INS	-	A	A	rs79959130		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42352413_42352414insA	uc002ors.2	+						DMRTC2_uc002orr.1_Intron|DMRTC2_uc010xwe.1_Intron	NM_001040283	NP_001035373	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2						cell differentiation|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0						gactccatctcaaaaaaaaaaa	0.243													3	3	---	---	---	---	
SLC2A10	81031	broad.mit.edu	37	20	45358265	45358281	+	Intron	DEL	TTTTTTTTTTTTTTTTT	-	-	rs139690638		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45358265_45358281delTTTTTTTTTTTTTTTTT	uc002xsl.2	+							NM_030777	NP_110404	O95528	GTR10_HUMAN	solute carrier family 2 member 10							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				GCACTATGAGttttttttttttttttttttttttttt	0.226													5	3	---	---	---	---	
DYRK1A	1859	broad.mit.edu	37	21	38845338	38845339	+	Intron	INS	-	T	T			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38845338_38845339insT	uc002ywk.2	+						DYRK1A_uc002ywh.1_Intron|DYRK1A_uc002ywi.2_Intron|DYRK1A_uc002ywj.2_Intron|DYRK1A_uc002ywl.2_Intron|DYRK1A_uc002ywm.2_Intron	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation						nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4						TTTGCattaaattttttttttt	0.297													4	2	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33411227	33411228	+	Intron	INS	-	T	T	rs74280322		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33411227_33411228insT	uc003amz.2	-							NM_001135774	NP_001129246	O14994	SYN3_HUMAN	synapsin III isoform IIIg						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						aaaaaaaaaaaCTACTGTATCT	0.188													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	37759371	37759372	+	IGR	DEL	AC	-	-	rs113389448		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37759371_37759372delAC								DYNLT3 (52482 upstream) : CXorf27 (90698 downstream)																							acacacaaagacacacacacac	0.168													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	39545531	39545538	+	IGR	DEL	GAAGGAAG	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39545531_39545538delGAAGGAAG								MID1IP1 (879750 upstream) : BCOR (364963 downstream)																							aggaaggaaagaaggaaggaaggaagga	0.130													6	3	---	---	---	---	
USP9X	8239	broad.mit.edu	37	X	41091472	41091473	+	Intron	INS	-	TTTTTG	TTTTTG	rs71955511		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41091472_41091473insTTTTTG	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						TTTCAAGCCTTtttttgttttt	0.332													4	2	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101093122	101093123	+	Intron	INS	-	C	C	rs145072756		TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101093122_101093123insC	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						CTGCACGGGTGCCCAGCCTGTC	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	122034077	122034080	+	IGR	DEL	AGGA	-	-			TCGA-BP-4983-01A-01D-1462-08	TCGA-BP-4983-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122034077_122034080delAGGA								None (None upstream) : GRIA3 (284016 downstream)																							TGTACTACTGaggaaggaaggaag	0.289													5	3	---	---	---	---	
