Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
GBP6	163351	broad.mit.edu	37	1	89847441	89847441	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89847441G>A	uc001dnf.2	+	7	1334	c.1060G>A	c.(1060-1062)GAC>AAC	p.D354N	GBP6_uc010ost.1_Missense_Mutation_p.D224N	NM_198460	NP_940862	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	354							GTP binding|GTPase activity			ovary(2)	2		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		GGAGCTGCTGGACATGCATGC	0.547													18	51	---	---	---	---	PASS
SPAST	6683	broad.mit.edu	37	2	32323916	32323916	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32323916A>G	uc002roc.2	+	4	859	c.638A>G	c.(637-639)AAT>AGT	p.N213S	SPAST_uc002rod.2_Intron	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1	213	Required for interaction with RTN1.				cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GACGTCTATAATGACAGTACT	0.343													14	96	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52712580	52712580	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52712580G>A	uc003des.2	-	2	184	c.172C>T	c.(172-174)CGA>TGA	p.R58*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.R58*|PBRM1_uc003der.2_Nonsense_Mutation_p.R58*|PBRM1_uc003det.2_Nonsense_Mutation_p.R58*|PBRM1_uc003deu.2_Nonsense_Mutation_p.R58*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.R58*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.R58*|PBRM1_uc003dey.2_Nonsense_Mutation_p.R58*|PBRM1_uc003dez.1_Nonsense_Mutation_p.R58*|PBRM1_uc003dfb.1_5'UTR	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	58					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTATAGTCTCGGATGGTATTA	0.433			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								42	52	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121415221	121415221	+	Silent	SNP	T	C	C			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121415221T>C	uc003eei.3	-	13	4260	c.4134A>G	c.(4132-4134)CAA>CAG	p.Q1378Q	GOLGB1_uc010hrc.2_Silent_p.Q1383Q|GOLGB1_uc003eej.3_Silent_p.Q1344Q|GOLGB1_uc011bjm.1_Silent_p.Q1264Q|GOLGB1_uc010hrd.1_Silent_p.Q1342Q	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1378	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		CAATTTGTAGTTGGCTGCTTT	0.403													118	298	---	---	---	---	PASS
PPARGC1A	10891	broad.mit.edu	37	4	23833232	23833232	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23833232G>T	uc003gqs.2	-	3	497	c.377C>A	c.(376-378)TCC>TAC	p.S126Y	PPARGC1A_uc003gqt.2_RNA|PPARGC1A_uc011bxp.1_RNA|PPARGC1A_uc010ier.1_RNA	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor	126					androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				AGGCATGGAGGAAGGACTAGC	0.542													52	337	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94376877	94376877	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94376877C>T	uc011cdt.1	+	11	1868	c.1610C>T	c.(1609-1611)ACG>ATG	p.T537M	GRID2_uc011cdu.1_Missense_Mutation_p.T442M	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	537	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	GTGGACTTTACGACACGTTAC	0.433													32	134	---	---	---	---	PASS
PCDHA3	56145	broad.mit.edu	37	5	140181824	140181824	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140181824C>T	uc003lhf.2	+	1	1042	c.1042C>T	c.(1042-1044)CCT>TCT	p.P348S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.P348S	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	348	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATAATGTACCTGAGTTAGT	0.438													7	150	---	---	---	---	PASS
PPP2R2B	5521	broad.mit.edu	37	5	146077636	146077636	+	Silent	SNP	G	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146077636G>A	uc003loe.2	-	3	765	c.240C>T	c.(238-240)TTC>TTT	p.F80F	PPP2R2B_uc010jgm.2_Silent_p.F69F|PPP2R2B_uc003log.3_Silent_p.F80F|PPP2R2B_uc003lof.3_Silent_p.F80F|PPP2R2B_uc003loi.3_Silent_p.F83F|PPP2R2B_uc003loh.3_Silent_p.F80F|PPP2R2B_uc003loj.3_Silent_p.F60F|PPP2R2B_uc003lok.3_Silent_p.F69F|PPP2R2B_uc011dbu.1_Silent_p.F86F|PPP2R2B_uc011dbv.1_Silent_p.F138F	NM_004576	NP_004567	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein	80					apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCAGGTAATCGAACTCGGGTT	0.383													82	194	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47897277	47897277	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47897277G>C	uc003tny.1	-	28	4516	c.4516C>G	c.(4516-4518)CAG>GAG	p.Q1506E		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	1506	Extracellular (Potential).|REJ.				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						CATGGGCTCTGTGTCTCCGCC	0.547													22	74	---	---	---	---	PASS
CHRNB3	1142	broad.mit.edu	37	8	42591917	42591917	+	3'UTR	SNP	G	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42591917G>A	uc003xpi.1	+	6						NM_000749	NP_000740	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta						synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)	1	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TGGTAAATGTGCTCATTTGTG	0.478													7	17	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113243821	113243821	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113243821C>A	uc003ynu.2	-	69	10940	c.10781G>T	c.(10780-10782)GGA>GTA	p.G3594V	CSMD3_uc003yns.2_Missense_Mutation_p.G2796V|CSMD3_uc003ynt.2_Missense_Mutation_p.G3554V|CSMD3_uc011lhx.1_Missense_Mutation_p.G3425V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3594	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTGAATAAATCCTTGAAATAC	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			63	182	---	---	---	---	PASS
IFNA8	3445	broad.mit.edu	37	9	21409486	21409486	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21409486T>A	uc003zpc.1	+	1	341	c.311T>A	c.(310-312)CTT>CAT	p.L104H		NM_002170	NP_002161	P32881	IFNA8_HUMAN	interferon, alpha 8 precursor	104					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		GATGAGACCCTTCTAGATGAA	0.502													50	114	---	---	---	---	PASS
NOC4L	79050	broad.mit.edu	37	12	132633361	132633361	+	Silent	SNP	G	T	T			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132633361G>T	uc001ujz.1	+	9	863	c.822G>T	c.(820-822)CTG>CTT	p.L274L		NM_024078	NP_076983	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog	274					rRNA processing	integral to membrane|nuclear membrane|nucleolus	protein binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		AGGTGCTGCTGATTGTGCATG	0.726													3	24	---	---	---	---	PASS
ATP7B	540	broad.mit.edu	37	13	52539025	52539025	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52539025T>C	uc001vfw.2	-	5	2009	c.1852A>G	c.(1852-1854)ATT>GTT	p.I618V	ATP7B_uc010adv.2_Intron|ATP7B_uc001vfx.2_Missense_Mutation_p.I618V|ATP7B_uc001vfy.2_Missense_Mutation_p.I507V|ATP7B_uc010tgt.1_Missense_Mutation_p.I618V|ATP7B_uc010tgu.1_Missense_Mutation_p.I618V|ATP7B_uc010tgv.1_Missense_Mutation_p.I618V|ATP7B_uc010tgs.1_5'Flank|ATP7B_uc010tgw.1_Intron	NM_000053	NP_000044	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	618	HMA 6.|Cytoplasmic (Potential).				ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)		ATTTTGATAATATCCCGTGGA	0.358									Wilson_disease				13	122	---	---	---	---	PASS
RPGRIP1	57096	broad.mit.edu	37	14	21771589	21771589	+	Silent	SNP	C	T	T			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21771589C>T	uc001wag.2	+	5	687	c.687C>T	c.(685-687)AGC>AGT	p.S229S		NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator	229					response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		TCATGGCCAGCAATACCATGC	0.443													21	39	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64447732	64447732	+	Silent	SNP	G	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64447732G>A	uc001xgm.2	+	16	1907	c.1677G>A	c.(1675-1677)CAG>CAA	p.Q559Q	SYNE2_uc001xgl.2_Silent_p.Q559Q	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	559	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTAATAAACAGTATATGATGG	0.259													66	151	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71478315	71478315	+	Intron	SNP	T	C	C			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71478315T>C	uc001xmo.2	+						PCNX_uc001xmn.3_3'UTR|PCNX_uc010are.1_Intron|PCNX_uc010arf.1_5'Flank	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1							integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AGATTAAATCTGAAATATGTA	0.294													5	39	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106322164	106322164	+	RNA	SNP	G	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106322164G>A	uc010tyt.1	-	3598		c.55322C>T			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Intron|uc001ysk.1_Intron|uc001ysl.1_Intron|uc001ysm.1_Intron|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0						GGGAAGCCCCGGGTGCTGCTG	0.587													13	31	---	---	---	---	PASS
ITGB3	3690	broad.mit.edu	37	17	45377874	45377874	+	Silent	SNP	G	C	C			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377874G>C	uc002ilj.2	+	12	1964	c.1944G>C	c.(1942-1944)CGG>CGC	p.R648R	ITGB3_uc010wkr.1_RNA	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor	648	Extracellular (Potential).				activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	AGTTTGACCGGGGAGCCCTAC	0.483													23	56	---	---	---	---	PASS
STAP2	55620	broad.mit.edu	37	19	4325497	4325497	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4325497G>T	uc002mab.2	-	10	972	c.875C>A	c.(874-876)TCT>TAT	p.S292Y	STAP2_uc002mac.2_Missense_Mutation_p.S292Y|STAP2_uc002mad.2_Missense_Mutation_p.S185Y	NM_001013841	NP_001013863	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	292	Pro-rich.					cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCTGGCTAGACGCAGGTGA	0.587													50	94	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38985140	38985140	+	Silent	SNP	G	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38985140G>A	uc002oit.2	+	39	6553	c.6423G>A	c.(6421-6423)GCG>GCA	p.A2141A	RYR1_uc002oiu.2_Silent_p.A2141A|RYR1_uc002oiv.1_5'Flank	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2141	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TGCCGCGGGCGTACACCATCT	0.677													9	37	---	---	---	---	PASS
DEFB123	245936	broad.mit.edu	37	20	30037860	30037860	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30037860T>A	uc002wvy.2	+	2	178	c.87T>A	c.(85-87)TAT>TAA	p.Y29*		NM_153324	NP_697019	Q8N688	DB123_HUMAN	defensin, beta 123 precursor	29					defense response to bacterium	extracellular region					0	Lung NSC(7;0.000139)|all_lung(7;0.000197)|all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GGAATCTTTATGGCAAATGCC	0.428													23	178	---	---	---	---	PASS
GDF5	8200	broad.mit.edu	37	20	34021690	34021690	+	Intron	SNP	A	C	C			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34021690A>C	uc010gfc.1	-						uc002xcj.2_Missense_Mutation_p.D34A|GDF5_uc002xck.1_3'UTR|GDF5_uc010zvc.1_3'UTR	NM_000557	NP_000548	P43026	GDF5_HUMAN	growth differentiation factor 5 preproprotein						cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			ACCCAGGAAGACAGAGGGCCA	0.557													28	90	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	16150885	16150885	+	Intron	SNP	G	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16150885G>A	uc002zkr.3	-						uc002zks.3_RNA					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																		GTCTTCTCTGGTCTTCTCATT	0.438													3	8	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	16150909	16150909	+	Intron	SNP	A	G	G			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16150909A>G	uc002zkr.3	-						uc002zks.3_RNA					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																		AGGACATAACAGGTTCTCTTT	0.428													3	11	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21104191	21104191	+	Splice_Site	SNP	A	G	G			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21104191A>G	uc002zsz.3	-	28	3300	c.3069_splice	c.e28+1	p.Q1023_splice		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GGTTTCAAGTACCTGCAGGTG	0.483													11	28	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50376678	50376678	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50376678T>A	uc004dpe.2	-	4	2421	c.2395A>T	c.(2395-2397)ACT>TCT	p.T799S	SHROOM4_uc004dpd.3_RNA|SHROOM4_uc004dpf.1_Missense_Mutation_p.T683S	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	799					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					TGGGTAAAAGTCTTGTTGCTA	0.433													37	251	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70342188	70342188	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70342188A>G	uc004dyy.2	+	8	1439	c.1240A>G	c.(1240-1242)ACT>GCT	p.T414A	MED12_uc011mpq.1_Missense_Mutation_p.T414A|MED12_uc004dyz.2_Missense_Mutation_p.T414A|MED12_uc004dza.2_Missense_Mutation_p.T261A	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	414					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					CAGTGCCTTCACTCAGCAGGT	0.483													39	107	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	7693	7693	+	RNA	SNP	C	T	T			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:7693C>T	uc004cou.3	+	1		c.108C>T			uc011mfi.1_5'Flank|uc004cov.3_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP42.																		CTTATCTGCTTCCTAGTCCTG	0.433													2	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	5454794	5454795	+	IGR	INS	-	AAGG	AAGG			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5454794_5454795insAAGG								AJAP1 (610944 upstream) : NPHP4 (468075 downstream)																							gagaggaagaaaaggaaggaag	0.000													6	3	---	---	---	---	
TXNDC12	51060	broad.mit.edu	37	1	52520880	52520880	+	5'UTR	DEL	T	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52520880delT	uc001cti.2	-	1					BTF3L4_uc001ctk.2_5'Flank|BTF3L4_uc001ctl.2_5'Flank|BTF3L4_uc010onh.1_5'Flank	NM_015913	NP_056997	O95831	AIFM1_HUMAN	thioredoxin domain containing 12 precursor						activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(1)	1						ACTTCCCAGATTTTTTTTTTT	0.592													4	2	---	---	---	---	
IL12RB2	3595	broad.mit.edu	37	1	67787765	67787766	+	Intron	DEL	TC	-	-	rs71945445		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67787765_67787766delTC	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						ATTTGGCAAGtctctctctctc	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	119394681	119394692	+	IGR	DEL	AAGGAAGGAAGA	-	-	rs71070768	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119394681_119394692delAAGGAAGGAAGA								SPAG17 (666833 upstream) : TBX15 (30974 downstream)																							ggaaggaaggaaggaaggaagaaagaaagaaa	0.019													5	3	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218537764	218537765	+	Intron	INS	-	G	G	rs145256552	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218537764_218537765insG	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						GCCAAAAAAGCGGGGGGAAAAA	0.431													5	3	---	---	---	---	
ALPP	250	broad.mit.edu	37	2	233245512	233245515	+	Intron	DEL	GGCA	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233245512_233245515delGGCA	uc002vsq.2	+						ALPP_uc002vsr.2_5'Flank	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein							anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GTTGGAGCAGGGCAGGCTCAGCAT	0.652													5	3	---	---	---	---	
VGLL4	9686	broad.mit.edu	37	3	11685143	11685144	+	Intron	INS	-	A	A	rs34152653		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11685143_11685144insA	uc003bwf.2	-						VGLL4_uc010hdx.1_5'UTR|VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482	Q14135	VGLL4_HUMAN	vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		ATGCAAAAGTTAAAAAAAAAAA	0.406													5	3	---	---	---	---	
C3orf63	23272	broad.mit.edu	37	3	56660899	56660900	+	Intron	INS	-	CTT	CTT	rs149346596	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56660899_56660900insCTT	uc003did.3	-						C3orf63_uc003dib.3_Intron|C3orf63_uc003dic.3_Intron|C3orf63_uc003die.3_Intron	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b											ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		GAAAAATACTGCTTCTTATAAA	0.327													2	4	---	---	---	---	
ROBO1	6091	broad.mit.edu	37	3	78760592	78760593	+	Intron	INS	-	G	G			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78760592_78760593insG	uc003dqe.2	-						ROBO1_uc003dqb.2_Intron|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Intron|ROBO1_uc003dqf.1_Intron	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		tttctttctttccttccttcct	0.000													4	2	---	---	---	---	
BTLA	151888	broad.mit.edu	37	3	112218320	112218320	+	5'UTR	DEL	A	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112218320delA	uc003dza.3	-	1					BTLA_uc003dzb.3_5'UTR	NM_181780	NP_861445	Q7Z6A9	BTLA_HUMAN	B and T lymphocyte associated isoform 1						T cell costimulation		receptor activity				0		Acute lymphoblastic leukemia(4;1.34e-07)|all_hematologic(4;0.000361)				TGAAATAACTAAAAAAAAAAA	0.413													6	3	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132404893	132404893	+	Intron	DEL	A	-	-	rs78161722		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132404893delA	uc003epe.1	-						NPHP3_uc003eoz.1_5'Flank|NPHP3_uc003epd.1_Intron	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						actccgtctcaaaaaaaaaaa	0.144													4	4	---	---	---	---	
XRN1	54464	broad.mit.edu	37	3	142089972	142089972	+	Intron	DEL	A	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142089972delA	uc003eus.2	-						XRN1_uc010huu.2_Intron|XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						aacctgtctcaaaaaaaaaaa	0.124													10	5	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196281881	196281882	+	Intron	INS	-	AGGTAGAATTA	AGGTAGAATTA	rs147559216	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196281881_196281882insAGGTAGAATTA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AGAGTGCGGTTAGGTAGAATTA	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196395233	196395234	+	IGR	INS	-	AAATGA	AAATGA	rs143273785	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196395233_196395234insAAATGA								LRRC33 (6361 upstream) : C3orf34 (37915 downstream)																							gagagagagagagaaatgaagg	0.084													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3276462	3276462	+	IGR	DEL	G	-	-	rs140838536	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3276462delG								C5orf38 (520950 upstream) : IRX1 (319706 downstream)																							ggaggaaggagggaggggagg	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	70422906	70422906	+	Intron	DEL	T	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70422906delT	uc010iyn.2	-											Homo sapiens cDNA FLJ78390 complete cds.																		ATTATCTGACttttttttttt	0.189													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	85703789	85703790	+	IGR	INS	-	AAGG	AAGG	rs2591283	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85703789_85703790insAAGG								NBPF22P (110427 upstream) : COX7C (209994 downstream)																							agggagggagaaaggaaggaag	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475753	90475753	+	IGR	DEL	G	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475753delG								GPR98 (15721 upstream) : ARRDC3 (188788 downstream)																							aaggaaggaaggaaggaagga	0.030													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97210056	97210057	+	IGR	DEL	AC	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97210056_97210057delAC								RIOK2 (691051 upstream) : RGMB (894942 downstream)																							ACAGATGcatacacacacacac	0.183													4	2	---	---	---	---	
PCDHGA10	56106	broad.mit.edu	37	5	140852548	140852548	+	Intron	DEL	A	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140852548delA	uc003lkl.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			agtgaaactcaaaaaaaaaaa	0.050													2	4	---	---	---	---	
HK3	3101	broad.mit.edu	37	5	176314899	176314899	+	Intron	DEL	T	-	-	rs113393288		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176314899delT	uc003mfa.2	-						HK3_uc003mez.2_Intron	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3						glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCCCATCACTtttttttttt	0.323													4	2	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180058912	180058926	+	Intron	DEL	CGCGTGGCCTGGCCT	-	-	rs140253537	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180058912_180058926delCGCGTGGCCTGGCCT	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc003mmb.1_5'Flank|FLT4_uc011dgy.1_Intron|FLT4_uc011dgz.1_Intron|FLT4_uc011dha.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CAGCCAGCACCGCGTGGCCTGGCCTCACCATGTGC	0.670									Congenital_Hereditary_Lymphedema				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12489005	12489005	+	IGR	DEL	G	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12489005delG								EDN1 (191579 upstream) : PHACTR1 (227883 downstream)																							aagaggaggaggaagaagaag	0.338													4	2	---	---	---	---	
FTSJD2	23070	broad.mit.edu	37	6	37420622	37420622	+	Intron	DEL	T	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37420622delT	uc003ons.2	+						FTSJD2_uc010jwu.2_Intron	NM_015050	NP_055865	Q8N1G2	MTR1_HUMAN	FtsJ methyltransferase domain containing 2						mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CCTGTTTACATTTTTTTTTTT	0.244													6	3	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	945239	945239	+	Intron	DEL	A	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945239delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aggagaaaggagaaaggagaa	0.000													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71145868	71145869	+	Intron	INS	-	CTTC	CTTC	rs141566749	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71145868_71145869insCTTC	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				tccttccttttcttccttcctt	0.000													5	3	---	---	---	---	
GATS	352954	broad.mit.edu	37	7	99821839	99821840	+	Intron	DEL	TT	-	-	rs71843400		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99821839_99821840delTT	uc003uua.3	-						GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc010lgt.2_Intron|GATS_uc011kjl.1_5'Flank|GATS_uc010lgu.2_Intron	NM_178831	NP_849153	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCCAACAGGAtttttttttttt	0.302													4	2	---	---	---	---	
SRPK2	6733	broad.mit.edu	37	7	104811193	104811196	+	Intron	DEL	AGGA	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104811193_104811196delAGGA	uc003vct.2	-						SRPK2_uc003vcu.2_Intron|SRPK2_uc003vcv.2_Intron|SRPK2_uc003vcw.1_Intron	NM_182691	NP_872633	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						gaagaaagggaggaaggaaggaag	0.000													2	4	---	---	---	---	
LRGUK	136332	broad.mit.edu	37	7	133876637	133876637	+	Intron	DEL	T	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133876637delT	uc003vrm.1	+							NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						TTTTATGGGGTTTTTTTTTTT	0.264													4	2	---	---	---	---	
CSPP1	79848	broad.mit.edu	37	8	68066152	68066152	+	Intron	DEL	T	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68066152delT	uc003xxi.2	+						CSPP1_uc003xxg.1_Intron|CSPP1_uc003xxh.1_Intron|CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ATCTTTGGACttttttttttt	0.244													4	3	---	---	---	---	
INTS8	55656	broad.mit.edu	37	8	95888082	95888085	+	Intron	DEL	CAAA	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95888082_95888085delCAAA	uc003yhb.2	+						INTS8_uc011lgq.1_Intron|INTS8_uc011lgr.1_Intron|INTS8_uc010mba.2_Intron	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8						snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					GCTTCTCATTCAAACAAACCTCTA	0.382													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	110948437	110948440	+	IGR	DEL	AGGA	-	-	rs147604132	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110948437_110948440delAGGA								SYBU (244417 upstream) : KCNV1 (30795 downstream)																							ggagggagggaggaaggaaggaag	0.103													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44730970	44730973	+	IGR	DEL	AAGG	-	-	rs149119595		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44730970_44730973delAAGG								None (None upstream) : FAM27C (259263 downstream)																							tcaagaaagaaaggaaggaaggaa	0.000													4	3	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994275	114994277	+	Intron	DEL	AGA	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994275_114994277delAGA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						agaagagaagagaagagaagaga	0.079													10	5	---	---	---	---	
QSOX2	169714	broad.mit.edu	37	9	139100415	139100415	+	3'UTR	DEL	T	-	-	rs111392257		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139100415delT	uc010nbi.2	-	12						NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2 precursor						cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity			ovary(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TAGAAGAGCGTTTGTAAAACC	0.443													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	43063100	43063101	+	IGR	INS	-	AA	AA	rs34202394		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43063100_43063101insAA								ZNF37B (14820 upstream) : ZNF33B (6532 downstream)																							TTTGGAGCCAGAAAAAAAAAAA	0.218													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45145607	45145608	+	IGR	INS	-	TCCT	TCCT	rs12249712	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45145607_45145608insTCCT								CXCL12 (265065 upstream) : TMEM72 (261156 downstream)																							ccttccttccatccttccttcc	0.218													7	4	---	---	---	---	
BRSK2	9024	broad.mit.edu	37	11	1464904	1464904	+	Intron	DEL	G	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1464904delG	uc001lti.2	+						BRSK2_uc009ycv.1_Intron|BRSK2_uc001lth.1_Intron|BRSK2_uc001ltj.2_Intron|BRSK2_uc001ltk.2_Intron|BRSK2_uc001ltl.2_Intron|BRSK2_uc001ltm.2_Intron|BRSK2_uc001ltn.2_Intron|BRSK2_uc010qwx.1_Intron	NM_003957	NP_003948	Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2						establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		AGAGCGTggcgggggggcgcg	0.617													10	6	---	---	---	---	
ZNF143	7702	broad.mit.edu	37	11	9493101	9493101	+	Intron	DEL	T	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9493101delT	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		TGTTTTGGTGttttttttttt	0.134													4	2	---	---	---	---	
COPB1	1315	broad.mit.edu	37	11	14498309	14498310	+	Intron	DEL	TT	-	-	rs11337817		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14498309_14498310delTT	uc001mli.2	-						COPB1_uc001mlg.2_Intron|COPB1_uc001mlh.2_Intron	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						CTACTGCttctttttttttttt	0.282													4	2	---	---	---	---	
METT5D1	196074	broad.mit.edu	37	11	28349476	28349480	+	Intron	DEL	GTTAT	-	-	rs10604663		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28349476_28349480delGTTAT	uc001msh.2	+						METT5D1_uc001msg.2_Intron|METT5D1_uc001mse.2_Intron|METT5D1_uc001msi.2_Intron	NM_001113528	NP_001107000	A6NJ78	MET15_HUMAN	methyltransferase 5 domain containing 1 isoform								methyltransferase activity				0						AAGTTAAGCAGTTATGTTGAACCAT	0.244													5	3	---	---	---	---	
ELP4	26610	broad.mit.edu	37	11	31648802	31648802	+	Intron	DEL	G	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31648802delG	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					CAAATTCTCTGGGGGGGGGGG	0.373													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	129902696	129902697	+	IGR	INS	-	T	T	rs146858068	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129902696_129902697insT								NCRNA00167 (27315 upstream) : APLP2 (37019 downstream)																							CTTTTTCCATGGTTTTTTTTTT	0.376													2	4	---	---	---	---	
CACNA2D4	93589	broad.mit.edu	37	12	2016939	2016951	+	Intron	DEL	GCCTGGTGAGTAT	-	-	rs113797488		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2016939_2016951delGCCTGGTGAGTAT	uc001qjp.2	-						CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		TGGTGGGCCAGCCTGGTGAGTATGCCTGGTGGG	0.662													6	3	---	---	---	---	
FMNL3	91010	broad.mit.edu	37	12	50045326	50045327	+	Intron	INS	-	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50045326_50045327insA	uc001ruv.1	-						FMNL3_uc001ruw.1_Intron|FMNL3_uc001rut.1_Intron|FMNL3_uc001ruu.1_Intron	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						CTCTGAGAGTTAAAAAAAAAaa	0.267													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	74711567	74711568	+	IGR	INS	-	TCCT	TCCT			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74711567_74711568insTCCT								None (None upstream) : ATXN7L3B (219983 downstream)																							cttttccttcctccttccttcc	0.134													5	3	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122850224	122850225	+	Intron	INS	-	A	A	rs150479919		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122850224_122850225insA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_5'Flank|CLIP1_uc010tae.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CTGGGCTATTTAAAAAAAAAAA	0.252													6	5	---	---	---	---	
GOLGA3	2802	broad.mit.edu	37	12	133352941	133352942	+	Intron	INS	-	G	G	rs58544277		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133352941_133352942insG	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		AGCTCCTTCCTCCCTGCTGCTC	0.663													6	3	---	---	---	---	
DIAPH3	81624	broad.mit.edu	37	13	60378720	60378722	+	Intron	DEL	GTT	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60378720_60378722delGTT	uc001vht.2	-						DIAPH3_uc001vhu.2_Intron	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		AGTAGTAGCAgttgttgttgttg	0.172													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	83420810	83420811	+	IGR	INS	-	GGT	GGT			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83420810_83420811insGGT								None (None upstream) : None (None downstream)																							aggaaggaagggaggaaaggaa	0.000													4	2	---	---	---	---	
AHSA1	10598	broad.mit.edu	37	14	77935239	77935240	+	Intron	INS	-	G	G	rs141792523	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77935239_77935240insG	uc001xtw.2	+							NM_012111	NP_036243	O95433	AHSA1_HUMAN	activator of heat shock 90kDa protein ATPase						protein folding|response to stress	cytosol|endoplasmic reticulum	ATPase activator activity|chaperone binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		ttagtagagatggagtttcacc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45207047	45207047	+	IGR	DEL	C	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45207047delC								TRIM69 (147022 upstream) : C15orf43 (41856 downstream)																							TCATTTTGAACATGATATGCC	0.254													33	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90686999	90687000	+	IGR	DEL	AA	-	-	rs10553548		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90686999_90687000delAA								IDH2 (41291 upstream) : SEMA4B (41152 downstream)																							CCCATCCTAGAAAAAAAAAAAA	0.332													4	2	---	---	---	---	
ST8SIA2	8128	broad.mit.edu	37	15	93007302	93007303	+	Intron	INS	-	T	T	rs34156050		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93007302_93007303insT	uc002bra.2	+						ST8SIA2_uc002brb.2_Intron	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TGtttcttttcttttttttttt	0.441													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102293062	102293064	+	Intron	DEL	CTC	-	-	rs62026972		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102293062_102293064delCTC	uc010usj.1	+						uc002bxo.2_5'Flank|uc002bxp.3_RNA|uc002bxq.2_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank|uc002bys.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		AGTTCATCTTCTCAGAGCTGCTG	0.576													4	2	---	---	---	---	
OTOA	146183	broad.mit.edu	37	16	21725617	21725618	+	Intron	INS	-	CTTT	CTTT	rs71988323		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21725617_21725618insCTTT	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron|OTOA_uc002dji.2_Intron|OTOA_uc010vbk.1_Intron	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		tctttcttttcctttcttcctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55005968	55005968	+	IGR	DEL	T	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55005968delT								IRX5 (37575 upstream) : IRX6 (352503 downstream)																							tttcctttcctttccttcctt	0.000													5	3	---	---	---	---	
WWP2	11060	broad.mit.edu	37	16	69832384	69832384	+	Intron	DEL	T	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69832384delT	uc002exu.1	+						WWP2_uc002ext.2_Intron|WWP2_uc002exv.1_Intron	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						AGGTTAGGGATTTTTTTTTTT	0.279													5	4	---	---	---	---	
CLEC18C	283971	broad.mit.edu	37	16	70045881	70045882	+	Intron	INS	-	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70045881_70045882insA	uc002exy.2	+						PDXDC2_uc002eyb.2_Intron|PDXDC2_uc002eyc.2_Intron	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						CACGGCTGACCAAAAAAAAAAC	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	8564334	8564335	+	IGR	INS	-	TTCC	TTCC			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8564334_8564335insTTCC								MYH10 (30298 upstream) : CCDC42 (68912 downstream)																							tctatttttctttccttccttc	0.025													5	4	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925055	47925058	+	Intron	DEL	ACAC	-	-	rs113382605		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925055_47925058delACAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						acacacacagacacacacacacac	0.191													4	2	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76087408	76087408	+	Intron	DEL	A	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76087408delA	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			actccgtctcaaaaaaaaaaa	0.179													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	23566241	23566244	+	IGR	DEL	TTCC	-	-	rs10536694		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23566241_23566244delTTCC								ZNF521 (634027 upstream) : SS18 (29975 downstream)																							TTttctttctttccttccttcctt	0.289													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32882997	32882998	+	IGR	INS	-	A	A			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32882997_32882998insA								ZNF507 (4426 upstream) : DPY19L3 (13679 downstream)																							aagagaaagagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PIH1D1	55011	broad.mit.edu	37	19	49952941	49952942	+	Intron	INS	-	TT	TT			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49952941_49952942insTT	uc002pns.2	-						PIH1D1_uc010yap.1_Intron|PIH1D1_uc010yaq.1_Intron	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN	NOP17						box C/D snoRNP assembly	pre-snoRNP complex					0		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		CATGACAATCCTTTTCTGCACA	0.520													16	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37958211	37958218	+	IGR	DEL	CCTTCCTC	-	-	rs34097871		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37958211_37958218delCCTTCCTC								CLDN14 (9344 upstream) : SIM2 (113773 downstream)																							ttccttccttccttcctccctccctCTC	0.135													4	5	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43614037	43614039	+	Intron	DEL	CCT	-	-	rs79792173		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43614037_43614039delCCT	uc003bdt.1	-							NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				actccttgtccctcctcagactg	0.256													3	4	---	---	---	---	
PLXNB2	23654	broad.mit.edu	37	22	50722939	50722940	+	Intron	INS	-	C	C	rs146267024	by1000genomes	TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50722939_50722940insC	uc003bkv.3	-						PLXNB2_uc003bkt.1_5'Flank|PLXNB2_uc003bku.1_5'Flank	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor						regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCTGAAGGTGACCCCCCACCCC	0.703													4	7	---	---	---	---	
DMD	1756	broad.mit.edu	37	X	31157592	31157595	+	Intron	DEL	ACAC	-	-	rs72233023		TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31157592_31157595delACAC	uc004dda.1	-						DMD_uc004dcq.1_Intron|DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc004dcm.1_Intron|DMD_uc004dcn.1_Intron|DMD_uc004dco.1_Intron|DMD_uc004dcp.1_Intron|DMD_uc011mkb.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				gtgtttatatacacacacacacac	0.000													4	2	---	---	---	---	
FAM120C	54954	broad.mit.edu	37	X	54112020	54112020	+	Intron	DEL	A	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54112020delA	uc004dsz.3	-						FAM120C_uc011moh.1_Intron	NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954											ovary(1)|central_nervous_system(1)	2						aactccgtctaaaaaaaaaaa	0.134													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	63241881	63241882	+	IGR	DEL	AC	-	-			TCGA-BP-4987-01A-01D-1462-08	TCGA-BP-4987-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63241881_63241882delAC								MIR1468 (235914 upstream) : FAM123B (163116 downstream)														p.0?(2)									cacacacactacacacacacac	0.317													4	2	---	---	---	---	
