Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CTRC	11330	broad.mit.edu	37	1	15771156	15771156	+	Silent	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15771156C>T	uc001awi.1	+	6	572	c.549C>T	c.(547-549)CAC>CAT	p.H183H	CTRC_uc001awj.1_Intron	NM_007272	NP_009203	Q99895	CTRC_HUMAN	chymotrypsin C preproprotein	183	Peptidase S1.				proteolysis		serine-type endopeptidase activity				0		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTGGATCACGCCACGTGCT	0.632													10	50	---	---	---	---	PASS
KIAA0754	643314	broad.mit.edu	37	1	39879328	39879328	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39879328G>A	uc009vvt.1	+	1	4153	c.3391G>A	c.(3391-3393)GCC>ACC	p.A1131T	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	995	Ala-rich.|10.										0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGGAGCCCGCCTCCCCAGC	0.711													3	9	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144829025	144829025	+	Intron	SNP	A	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144829025A>G	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|uc001elr.3_RNA			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						GTGATCAGTCAGACATTTTAA	0.473													2	11	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145296440	145296440	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145296440G>A	uc001end.3	+	3	397	c.362G>A	c.(361-363)CGC>CAC	p.R121H	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.R121H|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	121											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GATGCCTCCCGCTCATTGTAT	0.562													11	444	---	---	---	---	PASS
LOC728855	728855	broad.mit.edu	37	1	149648550	149648550	+	Intron	SNP	T	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149648550T>C	uc009wlc.2	+						LOC728855_uc009wld.2_Intron|uc001eso.1_RNA					Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0						GGGGTCACGATCCTGGAGTAG	0.423													22	387	---	---	---	---	PASS
IRF2BP2	359948	broad.mit.edu	37	1	234743247	234743247	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234743247C>A	uc001hwg.2	-	2	1431	c.1400G>T	c.(1399-1401)AGA>ATA	p.R467I	IRF2BP2_uc009xfw.2_Missense_Mutation_p.R77I|IRF2BP2_uc001hwf.2_Missense_Mutation_p.R451I	NM_182972	NP_892017	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	467					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GCCCAGCCTTCTTTGGTTCAT	0.612													49	158	---	---	---	---	PASS
SNX17	9784	broad.mit.edu	37	2	27598749	27598749	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27598749C>T	uc002rkg.1	+	11	1237	c.1015C>T	c.(1015-1017)CGG>TGG	p.R339W	SNX17_uc010ylj.1_Missense_Mutation_p.R319W|SNX17_uc010ylk.1_Missense_Mutation_p.R125W|SNX17_uc010eza.1_Missense_Mutation_p.R125W|SNX17_uc002rki.1_RNA|SNX17_uc002rkh.1_Missense_Mutation_p.R125W|SNX17_uc010yll.1_Missense_Mutation_p.R125W|SNX17_uc010ylm.1_Missense_Mutation_p.R125W|SNX17_uc010yln.1_Missense_Mutation_p.R327W|SNX17_uc010ylo.1_Missense_Mutation_p.R257W|SNX17_uc010ylp.1_Missense_Mutation_p.R314W|SNX17_uc010ylq.1_Missense_Mutation_p.R125W	NM_014748	NP_055563	Q15036	SNX17_HUMAN	sorting nexin 17	339					cell communication|endosome transport|intracellular protein transport|regulation of endocytosis|signal transduction	cytoplasmic vesicle membrane|cytosol|early endosome|Golgi apparatus	low-density lipoprotein particle receptor binding|phosphatidylinositol binding|protein C-terminus binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCCCAGGCCGGGGCCGGGG	0.607													18	74	---	---	---	---	PASS
QPCT	25797	broad.mit.edu	37	2	37586819	37586819	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37586819A>G	uc002rqg.2	+	3	486	c.364A>G	c.(364-366)AAT>GAT	p.N122D	QPCT_uc002rqh.2_Missense_Mutation_p.N73D	NM_012413	NP_036545	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase precursor	122					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	extracellular region	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|zinc ion binding			central_nervous_system(1)	1		Ovarian(717;0.051)|all_hematologic(82;0.21)				GTCTTTCTCAAATATCATCAG	0.478													5	104	---	---	---	---	PASS
NPHP1	4867	broad.mit.edu	37	2	110919218	110919218	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110919218C>T	uc002tfn.3	-	10	1175	c.1081G>A	c.(1081-1083)GCC>ACC	p.A361T	NPHP1_uc002tfm.3_Missense_Mutation_p.A306T|NPHP1_uc002tfl.3_Missense_Mutation_p.A362T|NPHP1_uc002tfo.3_Missense_Mutation_p.A243T|NPHP1_uc010ywx.1_Missense_Mutation_p.A305T|NPHP1_uc010fjv.1_Missense_Mutation_p.A305T	NM_207181	NP_997064	O15259	NPHP1_HUMAN	nephrocystin 1 isoform 2	361					actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2						TCTCTGAAGGCCAGTTGTGAA	0.358													19	77	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162730485	162730485	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162730485A>C	uc002ubx.3	+	8	1102	c.918A>C	c.(916-918)GAA>GAC	p.E306D	SLC4A10_uc010fpa.1_Missense_Mutation_p.E318D|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Intron|SLC4A10_uc010zcs.1_Intron	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	306	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						AAAGGCATGAAAAAGGACCTC	0.478													6	26	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179598118	179598118	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179598118A>T	uc010zfg.1	-	51	12394	c.12170T>A	c.(12169-12171)TTG>TAG	p.L4057*	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Nonsense_Mutation_p.L718*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4984							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGGCGACCAAGGGTCTCCC	0.478													20	180	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188315	10188315	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188315T>C	uc003bvc.2	+	2	671	c.458T>C	c.(457-459)CTG>CCG	p.L153P	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	153	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L153P(4)|p.?(2)|p.L153fs*6(2)|p.L153fs*4(1)|p.?fs(1)|p.G144fs*19(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AATATCACACTGCCAGGTACT	0.403		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				52	158	---	---	---	---	PASS
NBEAL2	23218	broad.mit.edu	37	3	47043759	47043759	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47043759G>A	uc003cqp.2	+	31	5311	c.5132G>A	c.(5131-5133)CGC>CAC	p.R1711H	NBEAL2_uc010hjm.1_Missense_Mutation_p.R1088H|NBEAL2_uc010hjn.1_Missense_Mutation_p.R107H|NBEAL2_uc010hjo.1_5'Flank	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1711							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCCGAATGGCGCCACTTCATC	0.627													3	19	---	---	---	---	PASS
ALAS1	211	broad.mit.edu	37	3	52236547	52236547	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52236547T>C	uc003dcy.1	+	4	561	c.224T>C	c.(223-225)GTC>GCC	p.V75A	ALAS1_uc003dcx.1_Missense_Mutation_p.V75A|ALAS1_uc003dcz.1_Missense_Mutation_p.V75A|ALAS1_uc011bec.1_Missense_Mutation_p.V92A	NM_000688	NP_000679	P13196	HEM1_HUMAN	5-aminolevulinate synthase 1 precursor	75					heme biosynthetic process	mitochondrial matrix	5-aminolevulinate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(2)|upper_aerodigestive_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	AAGGCCAAGGTCCAACAGACT	0.493													17	70	---	---	---	---	PASS
SHQ1	55164	broad.mit.edu	37	3	72897496	72897496	+	5'UTR	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72897496G>A	uc003dpf.2	-	1					SHQ1_uc010hod.2_5'UTR	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog						ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CAGCATCGCCGCACCGGACGC	0.687													3	33	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186459690	186459690	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186459690G>A	uc011bsa.1	+	10	1717	c.1505G>A	c.(1504-1506)GGC>GAC	p.G502D	KNG1_uc003fqr.2_Intron	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	502	|His-rich.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	CATGGTCATGGCCACGGAAAA	0.423													6	31	---	---	---	---	PASS
C6orf201	404220	broad.mit.edu	37	6	4125471	4125471	+	Intron	SNP	G	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4125471G>T	uc003mwa.3	+						C6orf201_uc003mvz.3_RNA|C6orf201_uc011dhw.1_3'UTR|C6orf201_uc003mwb.3_RNA|PECI_uc003mwc.2_Intron|PECI_uc003mwd.2_Intron|PECI_uc003mwe.2_Intron|PECI_uc003mwf.2_Intron|PECI_uc010jnr.1_Intron	NM_001085401	NP_001078870	Q7Z4U5	CF201_HUMAN	hypothetical protein LOC404220												0	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TTGCTTTCTAGGAGCTGACTT	0.522													35	98	---	---	---	---	PASS
RREB1	6239	broad.mit.edu	37	6	7230362	7230362	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7230362A>T	uc003mxc.2	+	10	2420	c.2030A>T	c.(2029-2031)GAC>GTC	p.D677V	RREB1_uc003mxb.2_Missense_Mutation_p.D677V|RREB1_uc010jnx.2_Missense_Mutation_p.D677V	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	677	C2H2-type 8.				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				AACATCTGCGACTACATCGCC	0.637													11	32	---	---	---	---	PASS
C6orf62	81688	broad.mit.edu	37	6	24714642	24714642	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24714642C>T	uc003nel.2	-	3	840	c.333G>A	c.(331-333)ATG>ATA	p.M111I		NM_030939	NP_112201	Q9GZU0	CF062_HUMAN	hypothetical protein LOC81688	111						intracellular					0						GAATGAAATCCATCTCCTGAG	0.348													16	137	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46657418	46657418	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46657418G>T	uc003oyj.2	+	1	1553	c.1553G>T	c.(1552-1554)AGG>ATG	p.R518M	TDRD6_uc010jze.2_Missense_Mutation_p.R512M	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	518					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			AAGCTGATGAGGAGAATGTGT	0.418													50	140	---	---	---	---	PASS
PHF3	23469	broad.mit.edu	37	6	64416765	64416765	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64416765A>G	uc003pep.1	+	12	3736	c.3710A>G	c.(3709-3711)GAG>GGG	p.E1237G	PHF3_uc010kah.1_Missense_Mutation_p.E1051G|PHF3_uc003pen.2_Missense_Mutation_p.E1149G|PHF3_uc011dxs.1_Missense_Mutation_p.E506G	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	1237					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TACCTGACAGAGGTACTGTGA	0.373													47	179	---	---	---	---	PASS
PRDM13	59336	broad.mit.edu	37	6	100061916	100061916	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100061916C>A	uc003pqg.1	+	4	1666	c.1405C>A	c.(1405-1407)CTG>ATG	p.L469M		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	469					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		CAACGGGGAGCTGCTCTACGG	0.642													3	38	---	---	---	---	PASS
LRP11	84918	broad.mit.edu	37	6	150174138	150174138	+	Splice_Site	SNP	C	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150174138C>A	uc003qng.2	-	2	1095	c.771_splice	c.e2+1	p.K257_splice	LRP11_uc003qnh.1_Splice_Site_p.K257_splice	NM_032832	NP_116221	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein							integral to membrane	receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		ACATGCGTTACCTTCATGTCC	0.522													15	70	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567272	5567272	+	3'UTR	SNP	C	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567272C>A	uc003sos.3	-	5					ACTB_uc003sor.3_3'UTR|ACTB_uc003sot.3_3'UTR|ACTB_uc003soq.3_3'UTR|ACTB_uc010ksy.2_3'UTR	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		aaaaaaaaaccaaaacaaaac	0.363													6	60	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180449	20180449	+	3'UTR	SNP	G	C	C	rs113534252		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180449G>C	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacacagacacacacac	0.164													4	48	---	---	---	---	PASS
DYNC1I1	1780	broad.mit.edu	37	7	95614210	95614210	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95614210C>T	uc003uoc.3	+	8	992	c.715C>T	c.(715-717)CGG>TGG	p.R239W	DYNC1I1_uc003uod.3_Missense_Mutation_p.R222W|DYNC1I1_uc003uob.2_Missense_Mutation_p.R202W|DYNC1I1_uc003uoe.3_Missense_Mutation_p.R219W|DYNC1I1_uc010lfl.2_Missense_Mutation_p.R228W	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	239					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CCGGACAATACGGGTAATTGA	0.413													9	247	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113559039	113559039	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113559039C>A	uc010ljy.1	-	1	44	c.13G>T	c.(13-15)GAA>TAA	p.E5*		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	5					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						CTAGGTACTTCAGAAGGCTCC	0.363													22	118	---	---	---	---	PASS
PARP12	64761	broad.mit.edu	37	7	139724549	139724549	+	Silent	SNP	G	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139724549G>C	uc003vvl.1	-	12	2791	c.1917C>G	c.(1915-1917)GCC>GCG	p.A639A	PARP12_uc003vvk.1_Silent_p.A425A|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	639	PARP catalytic.					nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					AGCCCTCCTTGGCCGGCGGAC	0.582													26	51	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151848537	151848537	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151848537A>G	uc003wla.2	-	50	12875	c.12656T>C	c.(12655-12657)CTT>CCT	p.L4219P	MLL3_uc003wkz.2_Missense_Mutation_p.L3337P|MLL3_uc003wkx.2_Missense_Mutation_p.L377P|MLL3_uc003wky.2_Missense_Mutation_p.L1783P	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	4219					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CTTGTTCAAAAGGGTCAGATC	0.463			N		medulloblastoma								3	77	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38068103	38068103	+	3'UTR	SNP	G	T	T	rs111385150	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38068103G>T	uc003xky.1	+	5					BAG4_uc003xkz.1_3'UTR	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4						anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				GCCTGTTGATGACAAGAAGCA	0.338													4	29	---	---	---	---	PASS
NKAIN3	286183	broad.mit.edu	37	8	63492147	63492147	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63492147C>G	uc010lyq.1	+	2	236	c.104C>G	c.(103-105)GCG>GGG	p.A35G		NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	35	Helical; (Potential).					integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				TTCCAGTGGGCGCCTATTCTT	0.383													40	154	---	---	---	---	PASS
PSMB7	5695	broad.mit.edu	37	9	127118949	127118949	+	Intron	SNP	A	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127118949A>C	uc004boj.2	-						PSMB7_uc010mwm.2_3'UTR|LOC100129034_uc010mwl.2_RNA	NM_002799	NP_002790	Q99436	PSB7_HUMAN	proteasome beta 7 subunit proprotein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0						TTAATGTGGAAAGAACCAGGA	0.517													5	33	---	---	---	---	PASS
ABL1	25	broad.mit.edu	37	9	133760875	133760875	+	Silent	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133760875C>T	uc004bzw.2	+	11	3201	c.3198C>T	c.(3196-3198)TTC>TTT	p.F1066F	ABL1_uc004bzv.2_Silent_p.F1085F	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	1066	F-actin-binding.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	TCTACACGTTCTGCGTGAGCT	0.552			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								24	75	---	---	---	---	PASS
C1QL3	389941	broad.mit.edu	37	10	16556703	16556703	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16556703G>A	uc001ioj.1	-	2	1532	c.592C>T	c.(592-594)CGT>TGT	p.R198C		NM_001010908	NP_001010908	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3	198	C1q.					collagen				ovary(1)	1						GCACTAGCACGCACCTATGTG	0.408													4	54	---	---	---	---	PASS
SEC31B	25956	broad.mit.edu	37	10	102265353	102265353	+	Intron	SNP	T	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102265353T>A	uc001krc.1	-						SEC31B_uc010qpo.1_Intron|SEC31B_uc001krd.1_5'UTR|SEC31B_uc001krf.1_Intron|SEC31B_uc001kre.1_5'UTR|SEC31B_uc001krg.1_5'UTR|SEC31B_uc010qpp.1_3'UTR|SEC31B_uc009xwn.1_3'UTR|SEC31B_uc009xwo.1_3'UTR|SEC31B_uc010qpq.1_3'UTR	NM_015490	NP_056305	Q9NQW1	SC31B_HUMAN	SEC31 homolog B						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane				ovary(1)	1		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		AGACACCCAATTTGACCTAGA	0.507													7	10	---	---	---	---	PASS
ANO9	338440	broad.mit.edu	37	11	430378	430378	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:430378G>T	uc001lpi.2	-	8	650	c.565C>A	c.(565-567)CTG>ATG	p.L189M	ANO9_uc001lph.2_5'Flank|ANO9_uc010qvv.1_Missense_Mutation_p.L45M	NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	189	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4						ACGAAGTACAGGGCCACCTTT	0.517													3	29	---	---	---	---	PASS
MPPED2	744	broad.mit.edu	37	11	30439129	30439129	+	Silent	SNP	C	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30439129C>A	uc001msr.2	-	4	708	c.588G>T	c.(586-588)CTG>CTT	p.L196L	MPPED2_uc001msq.3_Silent_p.L196L|MPPED2_uc009yji.2_Silent_p.L70L	NM_001584	NP_001575	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2	196					nervous system development		hydrolase activity|metal ion binding			skin(1)	1						ACTTGTCCAGCAGAGACTGAC	0.517													3	68	---	---	---	---	PASS
OSBP	5007	broad.mit.edu	37	11	59361486	59361486	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59361486T>G	uc001noc.1	-	8	2034	c.1554A>C	c.(1552-1554)GAA>GAC	p.E518D	OSBP_uc009ymr.1_RNA	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	518					lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CCTTTACCTGTTCACAGAGGG	0.463													13	39	---	---	---	---	PASS
ZP1	22917	broad.mit.edu	37	11	60638381	60638381	+	Intron	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60638381G>A	uc001nqd.2	+						ZP1_uc001nqe.2_Translation_Start_Site	NM_207341	NP_997224	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 precursor						single fertilization	integral to membrane|plasma membrane|proteinaceous extracellular matrix					0						TCCCGTCTCTGTGCTGGATGG	0.562													42	149	---	---	---	---	PASS
IGHMBP2	3508	broad.mit.edu	37	11	68704210	68704210	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68704210C>A	uc001ook.1	+	13	2364	c.2262C>A	c.(2260-2262)GAC>GAA	p.D754E	IGHMBP2_uc001ool.1_Missense_Mutation_p.D378E|IGHMBP2_uc001oom.1_Missense_Mutation_p.D332E	NM_002180	NP_002171	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	754	R3H.|SS DNA-binding (By similarity).				cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ATTCCCACGACAGGCTGCGGG	0.592													3	49	---	---	---	---	PASS
CASC1	55259	broad.mit.edu	37	12	25264775	25264775	+	Silent	SNP	A	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25264775A>T	uc001rgl.2	-	13	1774	c.1692T>A	c.(1690-1692)GCT>GCA	p.A564A	CASC1_uc001rgk.2_Silent_p.A570A|CASC1_uc001rgm.3_Silent_p.A628A|CASC1_uc001rgj.2_Silent_p.A524A|CASC1_uc010sje.1_Silent_p.A505A|CASC1_uc010sjf.1_Silent_p.A452A	NM_001082973	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1 isoform b	564										ovary(2)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			CTTCTTTCAAAGCAATAATGA	0.328													41	143	---	---	---	---	PASS
RPLP0	6175	broad.mit.edu	37	12	120636946	120636946	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120636946A>C	uc001txp.2	-	4	530	c.293T>G	c.(292-294)ATC>AGC	p.I98S	RPLP0_uc001txq.2_Missense_Mutation_p.I98S|RPLP0_uc001txr.2_Missense_Mutation_p.I98S|uc001txs.1_5'Flank	NM_053275	NP_444505	P05388	RLA0_HUMAN	ribosomal protein P0	98					endocrine pancreas development|interspecies interaction between organisms|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CATGTCCCTGATCTCAGTGAG	0.473													12	61	---	---	---	---	PASS
CENPJ	55835	broad.mit.edu	37	13	25466970	25466970	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25466970A>T	uc001upt.3	-	10	3280	c.3027T>A	c.(3025-3027)GAT>GAA	p.D1009E	CENPJ_uc010tdf.1_RNA|CENPJ_uc010aae.2_RNA|CENPJ_uc010aaf.2_RNA|CENPJ_uc001upu.2_Missense_Mutation_p.D43E	NM_018451	NP_060921	Q9HC77	CENPJ_HUMAN	centromere protein J	1009					cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding			ovary(2)	2		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TTCTTTTCAAATCTTCCCGTA	0.343													38	209	---	---	---	---	PASS
PRKCH	5583	broad.mit.edu	37	14	61789073	61789073	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61789073C>T	uc001xfn.2	+	1	559	c.254C>T	c.(253-255)GCC>GTC	p.A85V	PRKCH_uc010tsa.1_Intron|uc001xfm.2_Intron	NM_006255	NP_006246	P24723	KPCL_HUMAN	protein kinase C, eta	85	C2.				intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTCGAGTTGGCCGTCTTCCAC	0.642													4	50	---	---	---	---	PASS
ACTN1	87	broad.mit.edu	37	14	69349260	69349260	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69349260G>A	uc001xkl.2	-	16	2178	c.1868C>T	c.(1867-1869)GCC>GTC	p.A623V	ACTN1_uc001xkk.2_Missense_Mutation_p.A219V|ACTN1_uc010ttb.1_Missense_Mutation_p.A558V|ACTN1_uc001xkm.2_Missense_Mutation_p.A623V|ACTN1_uc001xkn.2_Missense_Mutation_p.A623V|ACTN1_uc010ttc.1_Missense_Mutation_p.A208V	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	623	Interaction with DDN.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CTGCTGTCGGGCATGCTCCTC	0.612													3	50	---	---	---	---	PASS
SLC12A6	9990	broad.mit.edu	37	15	34544539	34544539	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34544539C>T	uc001zhw.2	-	9	1329	c.1165G>A	c.(1165-1167)GTT>ATT	p.V389I	SLC12A6_uc001zhv.2_Missense_Mutation_p.V338I|SLC12A6_uc001zhx.2_Missense_Mutation_p.V374I|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.V330I|SLC12A6_uc001zib.2_Missense_Mutation_p.V380I|SLC12A6_uc001zic.2_Missense_Mutation_p.V389I|SLC12A6_uc010bau.2_Missense_Mutation_p.V389I|SLC12A6_uc001zid.2_Missense_Mutation_p.V330I|SLC12A6_uc001zht.2_5'Flank|SLC12A6_uc001zhu.2_Missense_Mutation_p.V201I	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	389	Cytoplasmic (Potential).				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TTAGAGCAAACGTCAATGTGT	0.393													19	83	---	---	---	---	PASS
EID1	23741	broad.mit.edu	37	15	49170496	49170496	+	Silent	SNP	C	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49170496C>A	uc001zxc.1	+	1	207	c.123C>A	c.(121-123)TCC>TCA	p.S41S	SHC4_uc010uey.1_5'Flank|SHC4_uc010uez.1_5'Flank|SHC4_uc001zxb.1_Intron	NM_014335	NP_055150	Q9Y6B2	EID1_HUMAN	CREBBP/EP300 inhibitor 1	41					cell cycle|cell differentiation|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	histone acetyltransferase binding|histone acetyltransferase regulator activity|transcription corepressor activity			liver(1)	1		all_lung(180;0.00455)		all cancers(107;2.73e-08)|GBM - Glioblastoma multiforme(94;9.58e-07)		GGGAGCTATCCCTGCGTCCCT	0.662													5	44	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2817282	2817282	+	Silent	SNP	A	T	T	rs111703345		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2817282A>T	uc002crk.2	+	11	7302	c.6753A>T	c.(6751-6753)CCA>CCT	p.P2251P	SRRM2_uc002crj.1_Silent_p.P2155P|SRRM2_uc002crl.1_Silent_p.P2251P|SRRM2_uc010bsu.1_Silent_p.P2155P	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	2251	Ala-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CTGCCATTCCAACAGCAGTGA	0.622													23	80	---	---	---	---	PASS
FLII	2314	broad.mit.edu	37	17	18152473	18152473	+	Silent	SNP	A	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18152473A>G	uc002gsr.1	-	16	1953	c.1902T>C	c.(1900-1902)CCT>CCC	p.P634P	FLII_uc002gsq.1_Silent_p.P505P|FLII_uc010cpy.1_Silent_p.P623P|FLII_uc010vxn.1_Silent_p.P603P|FLII_uc010vxo.1_Silent_p.P579P|FLII_uc002gss.1_Silent_p.P633P	NM_002018	NP_002009	Q13045	FLII_HUMAN	flightless I homolog	634	Interaction with ACTL6A.				multicellular organismal development|muscle contraction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	actin binding			central_nervous_system(1)|skin(1)	2	all_neural(463;0.228)					TGAGGGGCACAGGCTCCAACT	0.592													4	131	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41197795	41197795	+	Missense_Mutation	SNP	G	A	A	rs80357582		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41197795G>A	uc002icq.2	-	23	5724	c.5492C>T	c.(5491-5493)CCT>CTT	p.P1831L	BRCA1_uc010whp.1_Missense_Mutation_p.P680L|BRCA1_uc010whl.1_Missense_Mutation_p.P727L|BRCA1_uc010whm.1_Missense_Mutation_p.P141L|BRCA1_uc002icp.3_Missense_Mutation_p.P1760L|BRCA1_uc002icu.2_3'UTR|BRCA1_uc010cyx.2_Missense_Mutation_p.P1784L|BRCA1_uc002ict.2_Missense_Mutation_p.P1852L|BRCA1_uc010whn.1_Missense_Mutation_p.P322L|BRCA1_uc010who.1_Missense_Mutation_p.P49L	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1831	BRCT 2.				androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGTCACCACAGGTGCCTCACA	0.532			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			11	66	---	---	---	---	PASS
AZI1	22994	broad.mit.edu	37	17	79180636	79180636	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79180636A>T	uc002jzp.1	-	5	623	c.423T>A	c.(421-423)AAT>AAA	p.N141K	AZI1_uc002jzn.1_Missense_Mutation_p.N141K|AZI1_uc002jzo.1_Missense_Mutation_p.N141K|AZI1_uc010wum.1_Missense_Mutation_p.N141K	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	141					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			AACTCCGGGCATTGGATGGCA	0.637													26	62	---	---	---	---	PASS
HEXDC	284004	broad.mit.edu	37	17	80400154	80400154	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80400154A>C	uc002kew.2	+	12	1406	c.1355A>C	c.(1354-1356)CAC>CCC	p.H452P	HEXDC_uc002kev.3_Missense_Mutation_p.T482P|HEXDC_uc010diq.2_Silent_p.A454A|HEXDC_uc010wvm.1_RNA			Q8WVB3	HEXDC_HUMAN	SubName: Full=Hexosaminidase (Glycosyl hydrolase family 20, catalytic domain) containing, isoform CRA_c; SubName: Full=Hexosaminidase D;	452					carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)|skin(1)	2	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GAAAACGTGCACCCCAGCCTG	0.677													6	11	---	---	---	---	PASS
C3	718	broad.mit.edu	37	19	6681963	6681963	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6681963A>G	uc002mfm.2	-	35	4401	c.4339T>C	c.(4339-4341)TAC>CAC	p.Y1447H	C3_uc002mfl.2_Missense_Mutation_p.Y183H	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1447	Properdin-binding.				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		TTGTCCAGGTAGATGATGAGG	0.527													59	179	---	---	---	---	PASS
PGPEP1	54858	broad.mit.edu	37	19	18466813	18466813	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18466813A>G	uc002nis.1	+	3	280	c.196A>G	c.(196-198)AGT>GGT	p.S66G	PGPEP1_uc002nir.1_RNA|PGPEP1_uc002nit.1_5'UTR|PGPEP1_uc010xqg.1_5'UTR	NM_017712	NP_060182	Q9NXJ5	PGPI_HUMAN	pyroglutamyl-peptidase I	66							cysteine-type peptidase activity				0						GGAGAAGCACAGTCCACAGGT	0.567													22	72	---	---	---	---	PASS
RPSAP58	388524	broad.mit.edu	37	19	24010294	24010294	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24010294C>G	uc002nrn.2	+	4	754	c.331C>G	c.(331-333)CAG>GAG	p.Q111E		NM_002295	NP_002286			ribosomal protein SA												0						CTTCACTAACCAGATCCAGGC	0.567													3	38	---	---	---	---	PASS
SNX5	27131	broad.mit.edu	37	20	17930825	17930825	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17930825C>T	uc002wqc.2	-	8	828	c.742G>A	c.(742-744)GCA>ACA	p.A248T	SNX5_uc002wqb.2_RNA|SNX5_uc002wqd.2_Missense_Mutation_p.A248T|SNX5_uc002wqe.2_Missense_Mutation_p.A143T|SNX5_uc010zrt.1_Missense_Mutation_p.A248T	NM_014426	NP_055241	Q9Y5X3	SNX5_HUMAN	sorting nexin 5	248	BAR.				cell communication|pinocytosis|protein transport	cytoplasmic vesicle membrane|early endosome membrane|extrinsic to endosome membrane|extrinsic to internal side of plasma membrane|macropinocytic cup|phagocytic cup|ruffle	phosphatidylinositol binding			large_intestine(1)	1						AAGCAGGCTGCGGTGTGGATA	0.448													17	101	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628283	29628283	+	Silent	SNP	G	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628283G>C	uc010ztl.1	+	3	227	c.195G>C	c.(193-195)GGG>GGC	p.G65G	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Silent_p.G17G					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATGAAGCAGGGGACATAGAAG	0.378													5	139	---	---	---	---	PASS
REM1	28954	broad.mit.edu	37	20	30064360	30064360	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30064360T>G	uc002wwa.2	+	2	396	c.112T>G	c.(112-114)TCC>GCC	p.S38A		NM_014012	NP_054731	O75628	REM1_HUMAN	RAS-like GTP-binding protein REM	38					small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CACAGTGCCTTCCACTCAATC	0.647													13	63	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47542435	47542435	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47542435G>A	uc002zia.1	+	20	1680	c.1598G>A	c.(1597-1599)CGC>CAC	p.R533H	COL6A2_uc002zhy.1_Missense_Mutation_p.R533H|COL6A2_uc002zhz.1_Missense_Mutation_p.R533H|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	533	Triple-helical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCCGGCCCACGCGGCCCCGAG	0.632													11	64	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659734	24659734	+	RNA	SNP	T	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659734T>C	uc002zzs.3	+	7		c.3466T>C			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						CTCTCTCCTGTGGGAGGGGGG	0.632													3	17	---	---	---	---	PASS
LOC347376	347376	broad.mit.edu	37	X	50648692	50648692	+	Silent	SNP	C	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50648692C>T	uc010njs.2	+	1	261	c.255C>T	c.(253-255)TTC>TTT	p.F85F		NR_003933				RecName: Full=Histone H3; Flags: Fragment;												0						ATCTGCGCTTCCAGAGGGCAG	0.483													9	5	---	---	---	---	PASS
PHF8	23133	broad.mit.edu	37	X	54048718	54048718	+	Silent	SNP	T	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54048718T>C	uc004dsu.2	-	4	448	c.375A>G	c.(373-375)AGA>AGG	p.R125R	PHF8_uc004dst.2_Silent_p.R89R|PHF8_uc004dsw.2_Silent_p.R89R|PHF8_uc004dsy.2_Silent_p.R89R	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	125					brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						TCCGGAGCTCTCTGACGAACG	0.537													43	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	700532	700532	+	RNA	DEL	T	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:700532delT	uc001abo.2	-	7		c.1022delA								Homo sapiens cDNA clone IMAGE:4129277, partial cds.																		aaaaaaaaaaTTCCTTTGGGA	0.214													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	74185633	74185634	+	IGR	INS	-	A	A	rs138771062		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74185633_74185634insA								None (None upstream) : LRRIQ3 (306070 downstream)																							tgagactatggaaaaaaaaaaa	0.020													4	4	---	---	---	---	
C1orf183	55924	broad.mit.edu	37	1	112269334	112269335	+	3'UTR	DEL	CA	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112269334_112269335delCA	uc001ebo.1	-	2					C1orf183_uc001ebp.1_3'UTR	NM_019099	NP_061972	Q9NTI7	CA183_HUMAN	hypothetical protein LOC55924 isoform 1											ovary(2)	2		all_cancers(81;7.29e-06)|all_epithelial(167;4.98e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.16e-05)		Lung(183;0.0155)|Colorectal(144;0.0289)|all cancers(265;0.0592)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0852)|COAD - Colon adenocarcinoma(174;0.113)		cacacacatgcacacacacaca	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	158683166	158683166	+	IGR	DEL	T	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158683166delT								OR6K2 (12724 upstream) : OR6K3 (3794 downstream)																							ttatcttgaattataatcccc	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207273434	207273439	+	IGR	DEL	TGTGTA	-	-	rs35665980		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273434_207273439delTGTGTA								C4BPB (99 upstream) : C4BPA (4072 downstream)																							tgtgtgtgtgtgtgtatgtgtgtgtg	0.257													4	2	---	---	---	---	
ATAD2B	54454	broad.mit.edu	37	2	24051898	24051898	+	Intron	DEL	A	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24051898delA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc002rej.3_Intron	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTTAGGTGGAACAAATTTTG	0.204													17	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	76593204	76593205	+	IGR	INS	-	TTCC	TTCC	rs12165204	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76593204_76593205insTTCC								C2orf3 (655093 upstream) : LRRTM4 (381653 downstream)																							tctttccttctttccttccttc	0.000													4	2	---	---	---	---	
REG3G	130120	broad.mit.edu	37	2	79253988	79254003	+	Intron	DEL	TAGGGGAAAGTCCATG	-	-	rs117454068	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79253988_79254003delTAGGGGAAAGTCCATG	uc002snw.2	+						REG3G_uc002snx.2_Intron|REG3G_uc010ffu.2_Intron	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor						acute-phase response	extracellular region	sugar binding				0						TTGGAGGTGATAGGGGAAAGTCCATGCAGGTCTCAG	0.528													5	3	---	---	---	---	
C2orf51	200523	broad.mit.edu	37	2	88825335	88825337	+	Intron	DEL	AAG	-	-	rs35903656		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88825335_88825337delAAG	uc002stb.1	+							NM_152670	NP_689883	Q96LM6	TSC21_HUMAN	chromosome 2 open reading frame 51							nucleus				skin(1)	1						TTTTTGGTACAAGAAGAAGAAGA	0.300													10	7	---	---	---	---	
ACVR2A	92	broad.mit.edu	37	2	148602569	148602570	+	Intron	INS	-	TTTT	TTTT	rs66904974		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148602569_148602570insTTTT	uc002twg.2	+						ACVR2A_uc010zbn.1_Intron|ACVR2A_uc002twh.2_5'UTR	NM_001616	NP_001607	P27037	AVR2A_HUMAN	activin A receptor, type IIA precursor						activin receptor signaling pathway|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of erythrocyte differentiation|positive regulation of osteoblast differentiation|positive regulation of protein phosphorylation	cytoplasm|inhibin-betaglycan-ActRII complex|integral to plasma membrane	ATP binding|coreceptor activity|inhibin beta-A binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			stomach(8)|large_intestine(2)|lung(1)|breast(1)|kidney(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0969)		CCCAGTGAGCGttttttttttt	0.347													5	3	---	---	---	---	
LY75	4065	broad.mit.edu	37	2	160628210	160628211	+	3'UTR	DEL	TT	-	-	rs3836181		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160628210_160628211delTT	uc002ubb.3	-	39					LY75_uc010fos.2_3'UTR|CD302_uc002uba.2_3'UTR|CD302_uc010zco.1_3'UTR	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		ACCTAAAGACTTTTCACAGCAG	0.302													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	206708884	206708891	+	IGR	DEL	GAGAAAGG	-	-	rs71882224		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206708884_206708891delGAGAAAGG								NRP2 (46028 upstream) : INO80D (149555 downstream)																							aagaaagaaagagaaaggaaggaaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224731196	224731197	+	IGR	INS	-	TTCT	TTCT	rs142567720	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224731196_224731197insTTCT								AP1S3 (28877 upstream) : WDFY1 (8869 downstream)																							tccttccttccttctttctttc	0.064													3	3	---	---	---	---	
TEX264	51368	broad.mit.edu	37	3	51728004	51728015	+	Intron	DEL	TTCCTTCCTTCC	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51728004_51728015delTTCCTTCCTTCC	uc010hls.2	+						TEX264_uc003dbk.3_Intron|TEX264_uc010hlt.2_Intron|TEX264_uc003dbl.3_Intron|TEX264_uc003dbm.3_Intron	NM_001129884	NP_001123356	Q9Y6I9	TX264_HUMAN	testis expressed 264 precursor							extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		ATCCCTttctttccttccttccttccttcctt	0.156													9	4	---	---	---	---	
CACNA1D	776	broad.mit.edu	37	3	53760701	53760701	+	Intron	DEL	T	-	-	rs66963106		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53760701delT	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron|CACNA1D_uc003dgw.3_Intron	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	AATAAGGTTATTTTTTTTCAC	0.179													4	2	---	---	---	---	
ROBO2	6092	broad.mit.edu	37	3	77667102	77667107	+	Intron	DEL	AACTAG	-	-	rs3830603		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77667102_77667107delAACTAG	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron|ROBO2_uc003dqa.2_3'UTR	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ATTTggccaaaactagaactagaact	0.155													4	2	---	---	---	---	
MYLK	4638	broad.mit.edu	37	3	123456059	123456060	+	Intron	INS	-	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123456059_123456060insT	uc003ego.2	-						MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		gagcaagactctgtctgaagag	0.233													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	12947367	12947368	+	IGR	INS	-	GAAG	GAAG	rs35599383		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12947367_12947368insGAAG								None (None upstream) : HSP90AB2P (387669 downstream)																							acaaatgctcagaaggaaggaa	0.025													4	2	---	---	---	---	
SLC34A2	10568	broad.mit.edu	37	4	25664605	25664605	+	Intron	DEL	T	-	-	rs34583336		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25664605delT	uc003grr.2	+						SLC34A2_uc003grs.2_Intron|SLC34A2_uc010iev.2_Intron	NM_006424	NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (sodium phosphate),						cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			skin(3)|ovary(1)|kidney(1)	5		Breast(46;0.0503)				CCCTCTCATCttttttttttt	0.269													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49149390	49149390	+	IGR	DEL	A	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49149390delA								CWH43 (85297 upstream) : None (None downstream)																							attcgggttgattccattcca	0.000													4	2	---	---	---	---	
CDKL2	8999	broad.mit.edu	37	4	76521161	76521168	+	Intron	DEL	GAAGGAAG	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76521161_76521168delGAAGGAAG	uc003hiq.2	-						CDKL2_uc011cbp.1_Intron	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2						sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			aggaaggaaagaaggaaggaaggaagga	0.043													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97710727	97710728	+	IGR	INS	-	TTCC	TTCC	rs145116079	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97710727_97710728insTTCC								PDHA2 (948103 upstream) : C4orf37 (769306 downstream)																							ccctccctcctttccttccttc	0.139													7	4	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10424069	10424069	+	Intron	DEL	T	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10424069delT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						ATATATAACCTTTTTTTTTTT	0.214													4	3	---	---	---	---	
TMEM161B	153396	broad.mit.edu	37	5	87536472	87536473	+	Intron	INS	-	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87536472_87536473insA	uc003kjc.2	-						TMEM161B_uc011cty.1_Intron|TMEM161B_uc010jax.2_Intron|TMEM161B_uc011ctz.1_Intron	NM_153354	NP_699185	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B							integral to membrane				skin(2)	2		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		gtcttgtctccaaaaaaaaaaa	0.109													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102138827	102138828	+	IGR	INS	-	A	A			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102138827_102138828insA								SLCO6A1 (304107 upstream) : PAM (62699 downstream)																							attctgtgtccaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123556070	123556070	+	IGR	DEL	A	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123556070delA								CSNK1G3 (603608 upstream) : ZNF608 (416540 downstream)																							TTAACTATACAAAAAAAAAAA	0.363													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172716853	172716857	+	IGR	DEL	TTTCA	-	-	rs34275088		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172716853_172716857delTTTCA								NKX2-5 (54591 upstream) : STC2 (24869 downstream)																							ccttccttcctttcatcccttcctt	0.000													4	4	---	---	---	---	
UST	10090	broad.mit.edu	37	6	149274907	149274908	+	Intron	INS	-	A	A	rs147617058		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149274907_149274908insA	uc003qmg.2	+							NM_005715	NP_005706	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		gactccatctcaaaaaaaaaaa	0.104													6	3	---	---	---	---	
C7orf44	55744	broad.mit.edu	37	7	43749033	43749034	+	Intron	INS	-	TG	TG	rs141879129	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43749033_43749034insTG	uc003tin.1	-						C7orf44_uc003til.2_Intron|C7orf44_uc003tii.2_Intron|C7orf44_uc003tij.2_Intron|C7orf44_uc010kxu.1_Intron|C7orf44_uc003tik.2_Intron|C7orf44_uc003tim.1_Intron|C7orf44_uc003tio.1_Intron|C7orf44_uc003tiq.1_Intron|C7orf44_uc003tip.1_Intron	NM_018224	NP_060694	Q9GZY4	CG044_HUMAN	hypothetical protein LOC55744							integral to membrane				ovary(1)	1						ctttgttttattgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56336119	56336134	+	IGR	DEL	TCCCTCCTTTCCTCCT	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56336119_56336134delTCCCTCCTTTCCTCCT								PSPH (152029 upstream) : DKFZp434L192 (227782 downstream)																							tctctttccctccctcctttcctccttcccacctcc	0.000													4	2	---	---	---	---	
LOC100132832	100132832	broad.mit.edu	37	7	76669648	76669649	+	Intron	INS	-	ATCTC	ATCTC			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76669648_76669649insATCTC	uc003ufy.2	+						PMS2L11_uc011kgn.1_Intron	NR_028058				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						TGCACAGAAATATTTAATTTGC	0.208													5	6	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90250977	90250978	+	Intron	INS	-	CCTTCCTG	CCTTCCTG	rs6465274	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90250977_90250978insCCTTCCTG	uc003uky.2	+						CDK14_uc003ukt.1_Intron|CDK14_uc003ukv.1_Intron|CDK14_uc003uku.1_Intron|CDK14_uc003ukx.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						cttccttccttccttcctgcct	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	91341666	91341667	+	IGR	INS	-	AGGG	AGGG	rs143993987	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91341666_91341667insAGGG								FZD1 (443535 upstream) : MTERF (89793 downstream)																							ggaaggaaggaagggagggaag	0.000													3	3	---	---	---	---	
CPA5	93979	broad.mit.edu	37	7	129989560	129989592	+	Intron	DEL	CAAAAATTAAAAATTACAAAAAAACCTGTATCC	-	-	rs11272432	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129989560_129989592delCAAAAATTAAAAATTACAAAAAAACCTGTATCC	uc010lmd.1	+						CPA5_uc003vps.2_Intron|CPA5_uc003vpt.2_Intron|CPA5_uc010lme.1_Intron|CPA5_uc003vpu.1_Intron	NM_001127441	NP_001120913	Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5 isoform 1						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)					tacgtacccacaaaaattaaaaattacaaaaaaacctgtatcccaaatctgtt	0.017													4	2	---	---	---	---	
PODXL	5420	broad.mit.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	-	-	rs11277659		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131241030_131241035delGGCGAC	uc003vqw.3	-	1	342_347	c.84_89delGTCGCC	c.(82-90)CCGTCGCCC>CCC	p.28_30PSP>P	PODXL_uc003vqx.3_In_Frame_Del_p.28_30PSP>P	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	28_30	Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.573													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155739522	155739525	+	IGR	DEL	TTCC	-	-	rs5888641		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739522_155739525delTTCC								SHH (134555 upstream) : C7orf4 (593660 downstream)																							ccttccttctttccttccttcctt	0.000													6	4	---	---	---	---	
SNAI2	6591	broad.mit.edu	37	8	49834011	49834011	+	5'Flank	DEL	T	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49834011delT	uc003xqp.2	-							NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2						canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				GCTGGGAGGGTTTTTTTTTCC	0.567													4	2	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63653922	63653933	+	Intron	DEL	GAAGGAAGGAAG	-	-	rs72466142	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63653922_63653933delGAAGGAAGGAAG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				gagagagaaagaaggaaggaaggaaggaagga	0.000													4	2	---	---	---	---	
CSPP1	79848	broad.mit.edu	37	8	68072192	68072193	+	Intron	INS	-	T	T	rs113132721		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68072192_68072193insT	uc003xxi.2	+						CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ttccttccttctttcttttctt	0.000													4	2	---	---	---	---	
C8orf34	116328	broad.mit.edu	37	8	69501823	69501824	+	Intron	INS	-	GAAG	GAAG			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69501823_69501824insGAAG	uc010lyz.2	+						C8orf34_uc003xyb.2_Intron	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			GAAGGAAGGATgaaggaaggaa	0.050													5	3	---	---	---	---	
GDAP1	54332	broad.mit.edu	37	8	75275019	75275020	+	Intron	INS	-	TTTTTTT	TTTTTTT	rs6150661		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75275019_75275020insTTTTTTT	uc003yah.2	+						GDAP1_uc011lfj.1_Intron|GDAP1_uc003yai.2_Intron	NM_018972	NP_061845	Q8TB36	GDAP1_HUMAN	ganglioside-induced differentiation-associated							cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			CTCTCTCTCTCttttttttttt	0.396													7	4	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100646034	100646035	+	Intron	INS	-	GTGTGT	GTGTGT	rs139474452	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100646034_100646035insGTGTGT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GAATGTGTCAGgtgtgtgtgtg	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	137130781	137130784	+	IGR	DEL	TTCC	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137130781_137130784delTTCC								KHDRBS3 (470935 upstream) : None (None downstream)																							cctcccttctttccttccttcctt	0.142													9	4	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395300	33395300	+	Intron	DEL	C	-	-	rs77570582		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395300delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_5'UTR|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGCAGCCTCGCCCACACACGC	0.602													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66960593	66960594	+	IGR	INS	-	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66960593_66960594insT								LOC442421 (457566 upstream) : AQP7P1 (293673 downstream)																							ATACAGGTTTCCACCCCCCCCC	0.406													8	5	---	---	---	---	
SUSD1	64420	broad.mit.edu	37	9	114928204	114928206	+	Intron	DEL	AAG	-	-	rs10594519		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114928204_114928206delAAG	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0						gaagaaagaaaagaaagaaagaa	0.044													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2663088	2663088	+	IGR	DEL	A	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2663088delA								ADARB2 (883370 upstream) : PFKP (446664 downstream)																							agactctgtcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
DNAJC1	64215	broad.mit.edu	37	10	22193337	22193337	+	Intron	DEL	A	-	-	rs77439330		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22193337delA	uc001irc.2	-						DNAJC1_uc001ird.2_Intron	NM_022365	NP_071760	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1						negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding			lung(1)	1		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				AGGGAGTGGGAAAAAAAAAAA	0.274													9	4	---	---	---	---	
PTF1A	256297	broad.mit.edu	37	10	23482410	23482410	+	Intron	DEL	A	-	-	rs74121766		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23482410delA	uc001irp.2	+							NM_178161	NP_835455	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a						endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex				pancreas(1)|skin(1)	2						ttttttttttatttttCTGCC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	31966057	31966058	+	IGR	INS	-	CACA	CACA	rs138927552	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31966057_31966058insCACA								ZEB1 (147930 upstream) : ARHGAP12 (129167 downstream)																							acacatgcatgcacacacacac	0.356													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42356474	42356475	+	IGR	INS	-	GGATG	GGATG	rs74985651		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42356474_42356475insGGATG								None (None upstream) : LOC441666 (470840 downstream)																							cattccattccattccattcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383710	42383711	+	IGR	INS	-	T	T			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383710_42383711insT								None (None upstream) : LOC441666 (443604 downstream)																							atcaaatggaatcaaaataacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	77089189	77089196	+	Intron	DEL	CTTCCTTT	-	-	rs4746286		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77089189_77089196delCTTCCTTT	uc001jxd.1	+											Homo sapiens cDNA FLJ13383 fis, clone PLACE1001024.																		tccttccttccttcctttctttctttct	0.000													6	4	---	---	---	---	
RAB11FIP2	22841	broad.mit.edu	37	10	119800246	119800247	+	Intron	INS	-	A	A	rs141454052	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119800246_119800247insA	uc001ldj.1	-						RAB11FIP2_uc009xyz.1_Intron	NM_014904	NP_055719	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2						protein transport	plasma membrane|recycling endosome membrane	protein homodimerization activity				0		Colorectal(252;0.235)		all cancers(201;0.0238)		TTATTTAGTTTAAAAAACTGAT	0.312													3	3	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17452095	17452095	+	Intron	DEL	T	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17452095delT	uc001mnc.2	-							NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	tcaacaCTGGTTTTTTTTTTT	0.244													6	4	---	---	---	---	
ACP2	53	broad.mit.edu	37	11	47266071	47266071	+	Intron	DEL	A	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47266071delA	uc001nei.2	-						ACP2_uc010rhe.1_Intron|ACP2_uc009ylj.2_Intron|ACP2_uc010rhf.1_Intron|ACP2_uc010rhg.1_Intron|ACP2_uc010rhh.1_Intron|ACP2_uc010rhi.1_Intron|ACP2_uc009ylk.2_Intron	NM_001610	NP_001601	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal isoform 1							integral to membrane|lysosomal lumen|lysosomal membrane	acid phosphatase activity			ovary(1)	1						catccccccgaaaaaaaataa	0.174													4	2	---	---	---	---	
FOLH1B	219595	broad.mit.edu	37	11	89405323	89405326	+	Intron	DEL	TTTA	-	-	rs34562444		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89405323_89405326delTTTA	uc001pda.2	+							NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B						proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						aattatattgtttatttatttttg	0.142													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	100517164	100517187	+	IGR	DEL	GAAGGAAGGAAAGAAGGAAGGAAA	-	-	rs12281290		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100517164_100517187delGAAGGAAGGAAAGAAGGAAGGAAA								CNTN5 (289692 upstream) : ARHGAP42 (41220 downstream)																							aggaaggaaggaaggaaggaaagaaggaaggaaagaaggaagga	0.009													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	121859323	121859324	+	IGR	DEL	AG	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121859323_121859324delAG								SORL1 (354852 upstream) : LOC399959 (100487 downstream)																							aaagaaagaaagagagaaagaa	0.000													4	2	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54720425	54720426	+	Intron	DEL	GT	-	-	rs71444847		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54720425_54720426delGT	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						ATTTGGAGGGgtgtgtgtgtgt	0.312													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	84705030	84705031	+	IGR	INS	-	TTCT	TTCT			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84705030_84705031insTTCT								None (None upstream) : SLC6A15 (548238 downstream)																							tccttccttccttctttccttc	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80680379	80680398	+	IGR	DEL	GAAGGAAGGAAGGAAGGAAA	-	-	rs12857535		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80680379_80680398delGAAGGAAGGAAGGAAGGAAA								NDFIP2 (550174 upstream) : SPRY2 (229716 downstream)																							aggaaggaaggaaggaaggaaggaaggaaagaaggaagga	0.055													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480497	98480504	+	IGR	DEL	TTTCTTTC	-	-	rs71397737		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480497_98480504delTTTCTTTC								C14orf64 (36036 upstream) : C14orf177 (697446 downstream)																							tttctttctttttctttctttctttctt	0.038													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106636322	106636323	+	Intron	INS	-	A	A	rs144999810		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106636322_106636323insA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ACAATGTCACGAAGAGTCAAGT	0.446													4	4	---	---	---	---	
FSD2	123722	broad.mit.edu	37	15	83438317	83438318	+	Intron	INS	-	A	A	rs71455426		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83438317_83438318insA	uc002bjd.2	-						FSD2_uc010uol.1_Intron|FSD2_uc010uom.1_Intron	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing											central_nervous_system(1)	1						ggactcatctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
PGPEP1L	145814	broad.mit.edu	37	15	99514432	99514440	+	Intron	DEL	GGGGGGGGT	-	-	rs72362970		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99514432_99514440delGGGGGGGGT	uc002bum.2	-						PGPEP1L_uc010bop.2_Intron|PGPEP1L_uc002bun.2_Intron	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein						proteolysis		cysteine-type peptidase activity				0						ATGGGGGGGGGGGGGGGGTGGGCACCAAG	0.612													4	2	---	---	---	---	
CCDC64B	146439	broad.mit.edu	37	16	3078617	3078619	+	Intron	DEL	ATT	-	-	rs150643417		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3078617_3078619delATT	uc002ctf.3	-						CCDC64B_uc002cte.3_Intron	NM_001103175	NP_001096645	A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B												0						AGTGGGGATCATTATAACCCGTA	0.645													3	3	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19058155	19058156	+	Intron	DEL	AA	-	-	rs34279699		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19058155_19058156delAA	uc002dfq.2	+						TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						accttgtctcaaaaaaaaaaaa	0.149													6	3	---	---	---	---	
MRM1	79922	broad.mit.edu	37	17	34964977	34964977	+	3'UTR	DEL	A	-	-	rs4796229	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34964977delA	uc002hne.2	+	5					MRM1_uc002hnf.2_3'UTR	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog						RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CCACAGTCTGAGGGGGGGGGA	0.592											OREG0024339	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ACE	1636	broad.mit.edu	37	17	61562490	61562491	+	Intron	INS	-	G	G	rs144726912	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61562490_61562491insG	uc002jau.1	+						ACE_uc010ddu.1_Intron|ACE_uc002jav.1_Intron|ACE_uc010ddv.1_Intron|ACE_uc010wpj.1_Intron|ACE_uc002jaw.1_Intron|ACE_uc010wpk.1_Intron	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1						arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GGGTAGGGACAGGGCAGGGTAC	0.649													6	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68974725	68974726	+	IGR	INS	-	GGGA	GGGA			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68974725_68974726insGGGA								KCNJ2 (798544 upstream) : None (None downstream)																							aggaaaagaaggggagggaggg	0.084													4	4	---	---	---	---	
SMCHD1	23347	broad.mit.edu	37	18	2751166	2751167	+	Intron	INS	-	AT	AT	rs148373283	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2751166_2751167insAT	uc002klm.3	+						SMCHD1_uc002klk.3_Intron|SMCHD1_uc002kll.3_Intron	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible						chromosome organization		ATP binding				0						ATTTAAATAACGTGTGCTTTAA	0.267													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11610673	11610674	+	IGR	INS	-	C	C			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11610673_11610674insC								FAM38B (908694 upstream) : GNAL (78462 downstream)																							AAGACTGAAGACaaaaaaaaaa	0.302													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14214109	14214115	+	IGR	DEL	AAAATAC	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14214109_14214115delAAAATAC								ZNF519 (81680 upstream) : LOC284233 (123307 downstream)																							CTCAAAATATAAAATACAAAGAAATGT	0.246													6	3	---	---	---	---	
DSC1	1823	broad.mit.edu	37	18	28723876	28723879	+	Intron	DEL	TATT	-	-	rs35474327		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28723876_28723879delTATT	uc002kwn.2	-						DSC1_uc002kwm.2_Intron	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein						homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ttcttttatatatttatttattta	0.123													3	3	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67807195	67807195	+	Intron	DEL	A	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67807195delA	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TTTCGAATTTAAAAAAAAAAA	0.289													4	3	---	---	---	---	
PDE4A	5141	broad.mit.edu	37	19	10544890	10544890	+	Intron	DEL	T	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10544890delT	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	tctttcttccttttttttttt	0.050													4	4	---	---	---	---	
LOC729991-MEF2B	4207	broad.mit.edu	37	19	19288517	19288517	+	Intron	DEL	G	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19288517delG	uc010xqo.1	-						LOC729991-MEF2B_uc010xqp.1_Intron|LOC729991-MEF2B_uc002nlo.2_Intron|LOC729991-MEF2B_uc002nlp.2_Intron|LOC729991_uc002nlq.2_Intron	NM_005919	NP_005910	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B isoform b						muscle organ development	transcription factor complex	histone deacetylase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						gaaaagaaaagaaaagaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36109007	36109010	+	IGR	DEL	TTCC	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36109007_36109010delTTCC								SRC (75188 upstream) : BLCAP (36810 downstream)																							ccttccttctttccttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499424	40499425	+	IGR	INS	-	T	T	rs2410102		TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499424_40499425insT								ETS2 (302548 upstream) : PSMG1 (47965 downstream)																							gttttgttttgttttttttgCC	0.312													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756088	44756096	+	IGR	DEL	CACCACCAA	-	-	rs72268009	by1000genomes	TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756088_44756096delCACCACCAA								CRYAA (163175 upstream) : SIK1 (78302 downstream)																							tcaccaccaccaccaccaacaccaccacc	0.000													3	3	---	---	---	---	
USP11	8237	broad.mit.edu	37	X	47104944	47104944	+	Intron	DEL	T	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47104944delT	uc004dhp.2	+						USP11_uc004dhq.2_Intron	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TATATTTAGCttttttttttt	0.274													4	2	---	---	---	---	
MCF2	4168	broad.mit.edu	37	X	138724842	138724842	+	5'UTR	DEL	A	-	-			TCGA-BP-4998-01A-01D-1462-08	TCGA-BP-4998-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138724842delA	uc004fau.2	-	1					MCF2_uc004fav.2_5'UTR|MCF2_uc011mwl.1_5'UTR|MCF2_uc010nsh.1_5'UTR|MCF2_uc011mwm.1_5'UTR|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					GCTGGGGAGGAAAAAAAAAAA	0.428													3	3	---	---	---	---	
