Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
VPS13D	55187	broad.mit.edu	37	1	12396026	12396026	+	Intron	SNP	G	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12396026G>C	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc001aty.1_3'UTR	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TTCTGTTTTAGTCTTTGCAGG	0.403													6	9	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12396027	12396027	+	Intron	SNP	T	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12396027T>A	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc001aty.1_3'UTR	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TCTGTTTTAGTCTTTGCAGGA	0.408													6	9	---	---	---	---	PASS
RCC2	55920	broad.mit.edu	37	1	17747210	17747210	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17747210C>G	uc001bal.2	-	6	906	c.859G>C	c.(859-861)GGA>CGA	p.G287R	RCC2_uc001bam.2_Missense_Mutation_p.G287R	NM_001136204	NP_001129676	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	287	RCC1 4.				cell division|mitotic prometaphase	chromosome, centromeric region|cytosol|microtubule|nucleolus|spindle					0		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		ACTTCCATACCCAGCTGACCA	0.423													22	86	---	---	---	---	PASS
TEKT2	27285	broad.mit.edu	37	1	36552420	36552420	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36552420A>G	uc001bzr.2	+	5	731	c.604A>G	c.(604-606)AAG>GAG	p.K202E	TEKT2_uc001bzs.2_Missense_Mutation_p.K108E|ADPRHL2_uc001bzt.2_5'Flank|ADPRHL2_uc001bzu.2_5'Flank	NM_014466	NP_055281	Q9UIF3	TEKT2_HUMAN	tektin 2	202					cell projection organization|microtubule cytoskeleton organization	actin cytoskeleton|cilium axoneme|flagellar axoneme|focal adhesion|microtubule|nucleolus					0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CATCTCGCTGAAGGTTGACCC	0.547													22	77	---	---	---	---	PASS
SSX2IP	117178	broad.mit.edu	37	1	85117618	85117618	+	Silent	SNP	G	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85117618G>T	uc001dkh.2	-	13	1727	c.1452C>A	c.(1450-1452)ACC>ACA	p.T484T	SSX2IP_uc001dkf.2_Silent_p.T456T|SSX2IP_uc001dkg.2_RNA|SSX2IP_uc010orz.1_Silent_p.T457T|SSX2IP_uc001dki.2_Silent_p.T484T|SSX2IP_uc010osa.1_Silent_p.T457T|SSX2IP_uc001dkj.2_Silent_p.T484T|SSX2IP_uc009wci.2_Silent_p.T3T	NM_014021	NP_054740	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting	484					cell adhesion	nucleus|protein complex				ovary(2)	2				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGTGGTCAAAGGTAGTCATAT	0.328													21	142	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144931029	144931029	+	Intron	SNP	G	A	A	rs149466177		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144931029G>A	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Missense_Mutation_p.P227L|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCCATCTGGGGGTACCTTTGT	0.552			T	PDGFRB	MPD								21	138	---	---	---	---	PASS
CD84	8832	broad.mit.edu	37	1	160523749	160523749	+	Silent	SNP	C	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160523749C>T	uc001fwh.3	-	3	600	c.576G>A	c.(574-576)ACG>ACA	p.T192T	CD84_uc001fwf.3_Silent_p.T192T|CD84_uc001fwg.3_Silent_p.T192T|CD84_uc009wtn.2_Silent_p.T192T|CD84_uc001fwi.3_Silent_p.T78T|CD84_uc001fwj.2_Silent_p.T192T|CD84_uc001fwk.2_Silent_p.T192T	NM_003874	NP_003865	Q9UIB8	SLAF5_HUMAN	CD84 molecule	192	Extracellular (Potential).|Ig-like C2-type.				blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GGGCTGTACACGTGTAAGTCA	0.507													29	91	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186324584	186324584	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186324584T>C	uc001grv.2	-	17	2426	c.2129A>G	c.(2128-2130)CAA>CGA	p.Q710R		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	710	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTTGGTATTTTGTGATCGCAA	0.274			T	NTRK1	papillary thyroid								34	109	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222721137	222721137	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222721137C>G	uc001hnh.1	-	1	308	c.250G>C	c.(250-252)GAC>CAC	p.D84H		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	84					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		TCCATGATGTCCCAGTACCGG	0.522													22	95	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73717074	73717074	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73717074A>G	uc002sje.1	+	12	8102	c.7991A>G	c.(7990-7992)AAA>AGA	p.K2664R	ALMS1_uc002sjf.1_Missense_Mutation_p.K2620R|ALMS1_uc002sjg.2_Missense_Mutation_p.K2050R|ALMS1_uc002sjh.1_Missense_Mutation_p.K2050R	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2662					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						GATGAATTCAAAATCAGCAAA	0.393													49	196	---	---	---	---	PASS
TMBIM1	64114	broad.mit.edu	37	2	219140333	219140333	+	Silent	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219140333G>A	uc002vho.1	-	13	1527	c.801C>T	c.(799-801)TAC>TAT	p.Y267Y	PNKD_uc002vhn.2_Intron|TMBIM1_uc002vhp.1_Silent_p.Y267Y|TMBIM1_uc010zjz.1_Silent_p.Y93Y|TMBIM1_uc010zka.1_Silent_p.Y156Y	NM_022152	NP_071435	Q969X1	TMBI1_HUMAN	transmembrane BAX inhibitor motif containing 1	267						integral to membrane					0		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTGTGTGTCGTAAGCCAGGA	0.443													11	35	---	---	---	---	PASS
ZFAND2B	130617	broad.mit.edu	37	2	220073738	220073738	+	Silent	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220073738G>A	uc002vka.2	+	8	868	c.696G>A	c.(694-696)CTG>CTA	p.L232L	ZFAND2B_uc010zkt.1_3'UTR|ZFAND2B_uc010fwd.1_3'UTR|ZFAND2B_uc002vjy.1_3'UTR|ZFAND2B_uc002vjz.1_3'UTR|ZFAND2B_uc002vkb.1_3'UTR	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	232	UIM 2.					endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACAAGCACTGTCAGCCAGTG	0.488													22	81	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183763	10183763	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183763A>G	uc003bvc.2	+	1	445	c.232A>G	c.(232-234)AAT>GAT	p.N78D	VHL_uc003bvd.2_Missense_Mutation_p.N78D	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	78			N -> H (in VHLD; type I).|N -> T (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.N78K(6)|p.N78I(3)|p.F76fs*80(2)|p.F76fs*81(2)|p.N78H(2)|p.N78S(2)|p.N78T(1)|p.S72_V87>L(1)|p.C77_N78>Y(1)|p.R60fs*35(1)|p.V74fs*51(1)|p.N78_R79insN(1)|p.C77fs*53(1)|p.N78Y(1)|p.N78fs*81(1)|p.V74fs*77(1)|p.N78D(1)|p.N78fs*54(1)|p.C77_R79del(1)|p.N78fs*80(1)|p.C77*(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CATCTTCTGCAATCGCAGTCC	0.721		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	12	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52663035	52663035	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52663035G>A	uc003des.2	-	12	1330	c.1318C>T	c.(1318-1320)CAA>TAA	p.Q440*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.Q440*|PBRM1_uc003der.2_Nonsense_Mutation_p.Q408*|PBRM1_uc003det.2_Nonsense_Mutation_p.Q440*|PBRM1_uc003deu.2_Nonsense_Mutation_p.Q440*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.Q440*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.Q440*|PBRM1_uc003dey.2_Nonsense_Mutation_p.Q440*|PBRM1_uc003dez.1_Nonsense_Mutation_p.Q440*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.Q338*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	440	Bromo 3.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.Q440*(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCATATTCTTGATTCTTCAGT	0.328			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								9	40	---	---	---	---	PASS
APBB2	323	broad.mit.edu	37	4	40829224	40829224	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40829224G>A	uc003gvl.2	-	14	2284	c.1654C>T	c.(1654-1656)CGG>TGG	p.R552W	APBB2_uc010ifu.2_Missense_Mutation_p.R124W|APBB2_uc003gvm.2_Missense_Mutation_p.R531W|APBB2_uc003gvn.2_Missense_Mutation_p.R553W|APBB2_uc003gvk.2_Missense_Mutation_p.R4W	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,	552	PID 1.				cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						GCATTCTTCCGTTCAGCCATA	0.507													34	138	---	---	---	---	PASS
CNGA1	1259	broad.mit.edu	37	4	47939840	47939840	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47939840A>C	uc003gxt.3	-	11	937	c.671T>G	c.(670-672)CTA>CGA	p.L224R	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Missense_Mutation_p.L293R	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	224	Cytoplasmic (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2						TCCTTGTTCTAGGTAACCTAA	0.299													12	137	---	---	---	---	PASS
CLPTM1L	81037	broad.mit.edu	37	5	1330417	1330417	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1330417G>A	uc003jch.2	-	9	1104	c.1058C>T	c.(1057-1059)GCG>GTG	p.A353V	CLPTM1L_uc003jcg.2_Intron	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like	353	Helical; (Potential).				apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		TCCAACACCCGCCGGGACCAG	0.627													17	62	---	---	---	---	PASS
NSUN2	54888	broad.mit.edu	37	5	6600260	6600260	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6600260G>C	uc003jdu.2	-	19	2148	c.2083C>G	c.(2083-2085)CGG>GGG	p.R695G	NSUN2_uc003jds.2_Missense_Mutation_p.R141G|NSUN2_uc003jdt.2_Missense_Mutation_p.R459G|NSUN2_uc011cmk.1_Missense_Mutation_p.R660G|NSUN2_uc003jdv.2_Missense_Mutation_p.R459G	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	695						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TAATGAAGCCGTTCATTCTTG	0.517													18	76	---	---	---	---	PASS
HLA-DPA1	3113	broad.mit.edu	37	6	33036464	33036464	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33036464C>T	uc003ocs.1	-	4	777	c.746G>A	c.(745-747)CGT>CAT	p.R249H	HLA-DPA1_uc010juk.2_Missense_Mutation_p.R249H	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP	249	Cytoplasmic (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1						ATGGCCAGAACGCAGAGACTT	0.567													35	158	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33663430	33663430	+	Intron	SNP	C	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33663430C>A	uc011drk.1	+						C6orf125_uc003oez.1_RNA	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3						activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						TCCACAGCACCCATGGAGGGA	0.642													22	65	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76591436	76591436	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76591436G>A	uc003pih.1	+	23	2596	c.2317G>A	c.(2317-2319)GAC>AAC	p.D773N	MYO6_uc003pig.1_Missense_Mutation_p.D773N|MYO6_uc003pii.1_Missense_Mutation_p.D773N	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	773					actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CATGAAGTCTGACCCTGACCA	0.373													29	138	---	---	---	---	PASS
MICALL2	79778	broad.mit.edu	37	7	1474748	1474748	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1474748A>G	uc003skj.3	-	16	2774	c.2627T>C	c.(2626-2628)ATT>ACT	p.I876T	MICALL2_uc003skh.3_Intron|MICALL2_uc003ski.3_Missense_Mutation_p.I363T	NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1	876						cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		CAGCTTCTCAATCATGTCCCG	0.657													17	52	---	---	---	---	PASS
GPNMB	10457	broad.mit.edu	37	7	23307604	23307604	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23307604G>A	uc003swc.2	+	8	1414	c.1253G>A	c.(1252-1254)GGG>GAG	p.G418E	GPNMB_uc003swb.2_Missense_Mutation_p.G406E|GPNMB_uc011jyy.1_Missense_Mutation_p.G360E|GPNMB_uc011jyz.1_Missense_Mutation_p.G307E	NM_001005340	NP_001005340	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb isoform a	418	Extracellular (Potential).				negative regulation of cell proliferation	melanosome				ovary(3)|breast(2)	5			GBM - Glioblastoma multiforme(13;0.154)			ACCTGCCAAGGGAGGTGAGTA	0.493													29	100	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732843	52732843	+	3'UTR	SNP	C	T	T	rs116069210	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732843C>T	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTCTTTTAACTCCTAACAAA	0.284													3	16	---	---	---	---	PASS
ZNF658	26149	broad.mit.edu	37	9	40772750	40772750	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40772750C>T	uc004abs.2	-	5	2677	c.2525G>A	c.(2524-2526)TGT>TAT	p.C842Y	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Missense_Mutation_p.C842Y	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	842	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CTGATGTGCACAGAGGTGTGT	0.428													40	166	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790192	78790192	+	Intron	SNP	C	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790192C>G	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.R683G|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						ggaatggaatcgaatcgaatc	0.129													2	3	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109694675	109694675	+	Intron	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109694675G>A	uc004bcz.2	+						ZNF462_uc010mto.2_Silent_p.R1896R|ZNF462_uc004bda.2_Silent_p.R1895R|ZNF462_uc011lvz.1_5'Flank	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						ATGAAACCCGGCCGGGGGGAT	0.587													5	32	---	---	---	---	PASS
PRDM12	59335	broad.mit.edu	37	9	133543580	133543580	+	Silent	SNP	C	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133543580C>A	uc004bzt.1	+	3	510	c.450C>A	c.(448-450)ATC>ATA	p.I150I		NM_021619	NP_067632	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	150	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		GCTACTTCATCGATGCCAGCC	0.517													23	75	---	---	---	---	PASS
HHEX	3087	broad.mit.edu	37	10	94454334	94454334	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94454334C>G	uc001kid.2	+	4	685	c.622C>G	c.(622-624)CTG>GTG	p.L208V		NM_002729	NP_002720	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	208					anterior/posterior pattern formation|B cell differentiation|cell cycle|DNA conformation change|negative regulation of angiogenesis|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of vascular endothelial growth factor receptor signaling pathway|poly(A)+ mRNA export from nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|Wnt receptor signaling pathway	cytoplasm|nucleus|protein-DNA complex	DNA bending activity|eukaryotic initiation factor 4E binding|protein homodimerization activity|repressing transcription factor binding|sequence-specific DNA binding|TBP-class protein binding|transcription regulatory region DNA binding			ovary(1)	1						AAAAGAAGAACTGGAAAGTTT	0.403													24	92	---	---	---	---	PASS
TALDO1	6888	broad.mit.edu	37	11	747520	747520	+	Silent	SNP	C	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:747520C>T	uc001lqz.2	+	1	89	c.39C>T	c.(37-39)TCC>TCT	p.S13S	TALDO1_uc010qwl.1_Silent_p.S13S|TALDO1_uc001lra.2_Silent_p.S13S	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1	13					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)		GGATGGAGTCCGCGCTGGACC	0.572													3	7	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10825853	10825853	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10825853G>C	uc001mjc.2	-	6	881	c.464C>G	c.(463-465)CCA>CGA	p.P155R	EIF4G2_uc001mjb.2_5'UTR|EIF4G2_uc009ygf.2_5'UTR|EIF4G2_uc001mjd.2_Missense_Mutation_p.P155R|EIF4G2_uc001mjf.1_5'UTR|SNORD97_uc009yge.2_5'Flank	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	155	MIF4G.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CTTCTGTCCTGGTTGACCCTC	0.428													43	216	---	---	---	---	PASS
ACTN3	89	broad.mit.edu	37	11	66322058	66322058	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66322058C>T	uc001oio.1	+	5	539	c.521C>T	c.(520-522)CCG>CTG	p.P174L	ACTN3_uc010rpi.1_RNA	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3	174	Actin-binding.|CH 2.				focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0						AAGACAGCACCGTACCGCAAC	0.587													4	22	---	---	---	---	PASS
INPPL1	3636	broad.mit.edu	37	11	71948448	71948448	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71948448C>G	uc001osf.2	+	26	3307	c.3160C>G	c.(3160-3162)CCA>GCA	p.P1054A	INPPL1_uc001osg.2_Missense_Mutation_p.P812A	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1054	Pro-rich.				actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4						TCCAGACTTTCCACCTCCACC	0.662													33	89	---	---	---	---	PASS
THY1	7070	broad.mit.edu	37	11	119290972	119290972	+	Silent	SNP	C	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119290972C>G	uc001pwq.2	-	2	196	c.162G>C	c.(160-162)CTG>CTC	p.L54L	uc001pwo.2_Intron|uc001pwp.1_Intron|THY1_uc001pwr.2_Silent_p.L54L|THY1_uc001pws.2_RNA	NM_006288	NP_006279	P04216	THY1_HUMAN	Thy-1 cell surface antigen preproprotein	54	Ig-like V-type.			LT -> AP (in Ref. 5).	angiogenesis|cell-cell adhesion|cytoskeleton organization|focal adhesion assembly|negative regulation of axonogenesis|negative regulation of cell migration|negative regulation of protein kinase activity|negative regulation of T cell receptor signaling pathway|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell activation|retinal cone cell development|T cell receptor signaling pathway	endoplasmic reticulum|growth cone|integral to plasma membrane|membrane raft	GPI anchor binding|integrin binding|Rho GTPase activator activity				0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		TCTCACGGGTCAGGCTGAACT	0.562													28	103	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33222938	33222938	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33222938A>C	uc010abf.2	+	2	187	c.29A>C	c.(28-30)GAT>GCT	p.D10A	PDS5B_uc001uun.2_Missense_Mutation_p.D10A|PDS5B_uc001uuo.2_Missense_Mutation_p.D10A|PDS5B_uc010abg.2_RNA|PDS5B_uc001uuq.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	10					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AGGACCAATGATGGAAAAATT	0.328													27	115	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33316758	33316758	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33316758G>A	uc010abf.2	+	23	2663	c.2505G>A	c.(2503-2505)TGG>TGA	p.W835*	PDS5B_uc010abg.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	835					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TGGTTCGATGGCTACTTGGAA	0.328													26	103	---	---	---	---	PASS
OR10G3	26533	broad.mit.edu	37	14	22038804	22038804	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22038804C>A	uc010tmb.1	-	1	72	c.72G>T	c.(70-72)AGG>AGT	p.R24S		NM_001005465	NP_001005465	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|central_nervous_system(1)	2	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		AAAAGAGTGTCCTTAGCCTGA	0.443													17	84	---	---	---	---	PASS
RDH11	51109	broad.mit.edu	37	14	68151872	68151872	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68151872T>A	uc001xjv.3	-	6	804	c.714A>T	c.(712-714)GAA>GAT	p.E238D	RDH11_uc001xjw.3_Missense_Mutation_p.E225D|RDH11_uc001xjx.3_Missense_Mutation_p.E168D	NM_016026	NP_057110	Q8TC12	RDH11_HUMAN	retinol dehydrogenase 11	238	Cytoplasmic (Potential).				retinol metabolic process|steroid metabolic process	endoplasmic reticulum membrane|integral to membrane	binding|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity			ovary(1)	1				all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	Vitamin A(DB00162)	GCCGAACCAGTTCAGATTGGA	0.522													15	63	---	---	---	---	PASS
AK7	122481	broad.mit.edu	37	14	96858459	96858459	+	5'UTR	SNP	G	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96858459G>C	uc001yfn.2	+	1					AK7_uc001yfm.1_5'UTR	NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7						cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		AGCGAGTGGCGCTTTCACCTT	0.607													5	26	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106667827	106667827	+	RNA	SNP	C	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106667827C>A	uc010tyt.1	-	877		c.22038G>T								Parts of antibodies, mostly variable regions.												0						GTCTCAGGGACCCCCCAGGCC	0.587													21	115	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20496765	20496765	+	RNA	SNP	G	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20496765G>T	uc001ytf.1	+	6		c.818G>T								full-length cDNA clone CS0DI026YN18 of Placenta Cot 25-normalized of Homo sapiens (human).																		GTTTTTTATAGTGTGTATTTT	0.358													5	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20644585	20644585	+	Intron	SNP	C	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20644585C>T	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron|uc010tyy.1_3'UTR					RecName: Full=Putative HERC2-like protein 3;																		CTCTGAGTGACGGCACTGCAC	0.617													3	5	---	---	---	---	PASS
ZFYVE19	84936	broad.mit.edu	37	15	41105065	41105065	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41105065G>T	uc001zmt.1	+	7	1509	c.995G>T	c.(994-996)CGA>CTA	p.R332L	ZFYVE19_uc001zmu.1_Intron|ZFYVE19_uc001zmv.1_Missense_Mutation_p.R157L|ZFYVE19_uc001zmw.1_Missense_Mutation_p.R157L|ZFYVE19_uc001zmx.1_Missense_Mutation_p.R157L|ZFYVE19_uc010bcc.1_Missense_Mutation_p.R157L	NM_001077268	NP_001070736	Q96K21	ZFY19_HUMAN	zinc finger, FYVE domain containing 19	332	Potential.						zinc ion binding				0		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CTGGCCAAGCGACTAGCCATG	0.627													6	37	---	---	---	---	PASS
RFX7	64864	broad.mit.edu	37	15	56390306	56390306	+	Silent	SNP	A	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56390306A>G	uc010bfn.2	-	8	1080	c.1080T>C	c.(1078-1080)GTT>GTC	p.V360V	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Silent_p.V174V	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	263					regulation of transcription, DNA-dependent	nucleus	DNA binding				0						CAGCTGCCACAACGATACCAA	0.398													16	61	---	---	---	---	PASS
ZC3H7A	29066	broad.mit.edu	37	16	11873154	11873154	+	Silent	SNP	A	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11873154A>G	uc002dbk.2	-	3	372	c.174T>C	c.(172-174)GAT>GAC	p.D58D	ZC3H7A_uc002dbl.2_Silent_p.D58D|ZC3H7A_uc002dbm.1_Silent_p.D58D	NM_014153	NP_054872	Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	58	TPR 1.					nucleus	nucleic acid binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						AGTTGTTCCAATCATGTTCCC	0.333													62	242	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30977377	30977377	+	Silent	SNP	C	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30977377C>G	uc002ead.1	+	8	2861	c.2175C>G	c.(2173-2175)GCC>GCG	p.A725A		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	725					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						AGGAGGCAGCCTACGGCTTGC	0.677													21	68	---	---	---	---	PASS
PDXDC2	283970	broad.mit.edu	37	16	70012183	70012183	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70012183T>G	uc010vlq.1	-	5	630	c.452A>C	c.(451-453)AAA>ACA	p.K151T	CLEC18C_uc002exy.2_Intron|PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_Intron					SubName: Full=Putative uncharacterized protein;												0						TTGAAACATTTTCCTATGGAT	0.443													41	150	---	---	---	---	PASS
CCT6B	10693	broad.mit.edu	37	17	33269618	33269618	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33269618T>A	uc002hig.2	-	7	864	c.770A>T	c.(769-771)GAG>GTG	p.E257V	CCT6B_uc010ctg.2_Missense_Mutation_p.E220V|CCT6B_uc010wcc.1_Missense_Mutation_p.E212V	NM_006584	NP_006575	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B	257					chaperone-mediated protein complex assembly|protein folding|spermatogenesis	cytoplasm	ATP binding|protein transporter activity|unfolded protein binding			pancreas(1)	1		Ovarian(249;0.17)				TACCAATTTCTCTTTCTCTTC	0.323													23	83	---	---	---	---	PASS
KRT24	192666	broad.mit.edu	37	17	38859430	38859430	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38859430G>C	uc002hvd.2	-	1	573	c.516C>G	c.(514-516)ATC>ATG	p.I172M		NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN	keratin 24	172	Rod.|Coil 1A.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)				ACCACTCCTTGATTTTGTTCT	0.463													53	178	---	---	---	---	PASS
APOH	350	broad.mit.edu	37	17	64216834	64216834	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64216834G>T	uc002jfn.3	-	5	501	c.442C>A	c.(442-444)CCT>ACT	p.P148T		NM_000042	NP_000033	P02749	APOH_HUMAN	apolipoprotein H precursor	148	Sushi 3.				blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding				0			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			GCAAACGTAGGTATGGATGGT	0.383													25	99	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9070296	9070296	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9070296T>G	uc002mkp.2	-	3	17354	c.17150A>C	c.(17149-17151)AAC>ACC	p.N5717T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5719	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CACTGCAGTGTTTGTATGCAT	0.498													18	78	---	---	---	---	PASS
TMEM59L	25789	broad.mit.edu	37	19	18724826	18724826	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18724826G>C	uc002njy.3	+	2	403	c.316G>C	c.(316-318)GCC>CCC	p.A106P	TMEM59L_uc010ebu.1_Missense_Mutation_p.A106P	NM_012109	NP_036241	Q9UK28	TM59L_HUMAN	brain-specific membrane-anchored protein	106						Golgi membrane|integral to membrane|membrane fraction				ovary(2)|skin(2)	4						GTGTGAAGCAGGTGAGGGCCC	0.667													12	58	---	---	---	---	PASS
ZNF607	84775	broad.mit.edu	37	19	38190552	38190552	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38190552A>T	uc002ohc.1	-	5	1076	c.480T>A	c.(478-480)CAT>CAA	p.H160Q	ZNF607_uc002ohb.1_Missense_Mutation_p.H159Q	NM_032689	NP_116078	Q96SK3	ZN607_HUMAN	zinc finger protein 607	160	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			TAATTTTCTGATGCTTTCTAA	0.388													46	218	---	---	---	---	PASS
ZNF780A	284323	broad.mit.edu	37	19	40578057	40578057	+	3'UTR	SNP	C	T	T	rs144951298	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40578057C>T	uc002omw.3	-	9						NM_001142579	NP_001136051	O75290	Z780A_HUMAN	zinc finger protein 780A isoform c						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					aaatctaccgcggacccctgg	0.000													5	27	---	---	---	---	PASS
ZNF780A	284323	broad.mit.edu	37	19	40578071	40578071	+	3'UTR	SNP	G	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40578071G>A	uc002omw.3	-	9						NM_001142579	NP_001136051	O75290	Z780A_HUMAN	zinc finger protein 780A isoform c						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					cccctggaccggcctgctagc	0.000													5	30	---	---	---	---	PASS
MZF1	7593	broad.mit.edu	37	19	59073897	59073897	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59073897T>C	uc002qto.2	-	6	2308	c.1747A>G	c.(1747-1749)ACG>GCG	p.T583A	LOC100131691_uc002qtm.2_Intron|MZF1_uc002qtn.2_Missense_Mutation_p.T583A	NM_198055	NP_932172	P28698	MZF1_HUMAN	zinc finger protein 42 isoform 2	583	C2H2-type 8.				viral reproduction	nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		TGCGTGAGCGTAGGCCGCTGG	0.687													3	10	---	---	---	---	PASS
PYGB	5834	broad.mit.edu	37	20	25249816	25249816	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25249816G>T	uc002wup.2	+	3	506	c.397G>T	c.(397-399)GGG>TGG	p.G133W		NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase	133					glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)	TGCTGGCCTTGGGAATGGAGG	0.542													15	45	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36693020	36693020	+	Silent	SNP	C	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36693020C>T	uc003apg.2	-	25	3372	c.3141G>A	c.(3139-3141)GAG>GAA	p.E1047E		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1047	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GGCGGGTCTTCTCCAGCTCCT	0.632			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				18	71	---	---	---	---	PASS
MAGEA4	4103	broad.mit.edu	37	X	151092616	151092616	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151092616G>T	uc004fez.2	+	3	636	c.480G>T	c.(478-480)AAG>AAT	p.K160N	MAGEA4_uc004ffa.2_Missense_Mutation_p.K160N|MAGEA4_uc004ffb.2_Missense_Mutation_p.K160N|MAGEA4_uc004ffc.2_Missense_Mutation_p.K160N|MAGEA4_uc004ffd.2_Missense_Mutation_p.K160N	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	160	MAGE.						protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AGTCCCTGAAGATGATCTTTG	0.522													52	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	12854	12854	+	RNA	SNP	T	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:12854T>C	uc004cox.3	+	1		c.518T>C			uc004coy.2_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		TCAAGCAGTCCTATACAACCG	0.478													14	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	5050112	5050113	+	IGR	DEL	TC	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5050112_5050113delTC								AJAP1 (206262 upstream) : NPHP4 (872757 downstream)																							aggccttctgtctctctctctc	0.000													4	3	---	---	---	---	
CROCCL1	84809	broad.mit.edu	37	1	16960908	16960913	+	Intron	DEL	GTGTGC	-	-	rs2900842	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16960908_16960913delGTGTGC	uc001azg.1	-						CROCCL1_uc001azf.2_5'Flank|CROCCL1_uc001azi.1_Intron|uc001azj.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0						gtgtgtgtgtgtgtgcgcgtgtgtgA	0.107													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32888256	32888257	+	IGR	INS	-	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32888256_32888257insA								BSDC1 (28194 upstream) : ZBTB8A (42401 downstream)																							ctccatctcagaaaaaaaaaaa	0.139													4	3	---	---	---	---	
ACADM	34	broad.mit.edu	37	1	76215398	76215398	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76215398delT	uc001dgw.3	+						ACADM_uc010ord.1_Intron|ACADM_uc009wbp.2_Intron|ACADM_uc009wbr.2_Intron|ACADM_uc010ore.1_Intron|ACADM_uc010orf.1_Intron|ACADM_uc001dgx.3_Intron|ACADM_uc010org.1_Intron|ACADM_uc009wbs.1_Intron	NM_000016	NP_000007	P11310	ACADM_HUMAN	medium-chain acyl-CoA dehydrogenase isoform a						carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4						Cttttctttcttttttttttt	0.100													4	2	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162258999	162258999	+	Intron	DEL	T	-	-	rs67625897		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162258999delT	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			ccttccttcctttccttcctt	0.194													4	3	---	---	---	---	
FMOD	2331	broad.mit.edu	37	1	203198890	203198890	+	Intron	DEL	A	-	-	rs11809805	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203198890delA	uc010pqi.1	-						CHIT1_uc001gzm.1_Intron|CHIT1_uc001gzn.2_5'Flank|CHIT1_uc009xam.1_5'Flank|CHIT1_uc009xan.1_5'Flank|CHIT1_uc001gzo.2_5'Flank	NM_002023		Q06828	FMOD_HUMAN	fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			GGTGGGGGGGATGGGAGCAGG	0.542													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230528929	230528929	+	IGR	DEL	G	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230528929delG								PGBD5 (15562 upstream) : COG2 (249273 downstream)																							ggggaagggagggggggagga	0.000													3	4	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37260028	37260028	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37260028delT	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				ttttgttttgttttttttttt	0.095													4	2	---	---	---	---	
THUMPD2	80745	broad.mit.edu	37	2	39982898	39982899	+	Intron	INS	-	AGTAT	AGTAT	rs10688564		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39982898_39982899insAGTAT	uc002rru.2	-						THUMPD2_uc002rrv.2_Intron|THUMPD2_uc010ynt.1_Intron	NM_025264	NP_079540	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2								methyltransferase activity			skin(1)	1		all_hematologic(82;0.248)				CATCTATTTTGAGTAAATAATA	0.238													6	3	---	---	---	---	
FLJ40330	645784	broad.mit.edu	37	2	89083951	89083951	+	Intron	DEL	A	-	-	rs111608027		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89083951delA	uc010fhf.2	+						FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						CTTTTTTTTCAGTGTATTTCT	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96593321	96593321	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96593321delT	uc002sva.1	-						uc010yug.1_Intron|uc002svc.1_5'Flank					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		AGAAATACACTGAAAAAAAAG	0.338													5	3	---	---	---	---	
PLEKHB2	55041	broad.mit.edu	37	2	131947551	131947553	+	Intron	DEL	CCA	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131947551_131947553delCCA	uc002tsh.2	+									Q96CS7	PKHB2_HUMAN	SubName: Full=Putative uncharacterized protein PLEKHB2;							membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		CACCTCACCCCCACACACACACC	0.389													9	4	---	---	---	---	
STAT1	6772	broad.mit.edu	37	2	191873942	191873942	+	Intron	DEL	T	-	-	rs13410645		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191873942delT	uc002usj.2	-						STAT1_uc010fse.1_Intron|STAT1_uc002usk.2_Intron|STAT1_uc002usl.2_Intron|STAT1_uc010fsf.1_Intron	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription						activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	aatttaaGTATTTTCTTAGGT	0.249													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	206708884	206708891	+	IGR	DEL	GAGAAAGG	-	-	rs71882224		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206708884_206708891delGAGAAAGG								NRP2 (46028 upstream) : INO80D (149555 downstream)																							aagaaagaaagagaaaggaaggaaggaa	0.000													4	2	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	242007466	242007466	+	Intron	DEL	C	-	-	rs67511252		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242007466delC	uc002wah.1	+						SNED1_uc002wai.1_Intron|SNED1_uc002waj.1_Intron|SNED1_uc002wak.2_Intron	NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GTGGACTGTACCACCTGCCGC	0.657													4	3	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21305653	21305654	+	Intron	INS	-	GAGAGAGAGA	GAGAGAGAGA	rs11271450		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21305653_21305654insGAGAGAGAGA	uc003gqh.1	-						KCNIP4_uc003gqf.1_5'Flank|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				GGAGAGCGTATgagagagagag	0.243													6	3	---	---	---	---	
CORIN	10699	broad.mit.edu	37	4	47746258	47746260	+	Intron	DEL	TGT	-	-	rs150197652		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47746258_47746260delTGT	uc003gxm.2	-						CORIN_uc011bzf.1_Intron|CORIN_uc011bzg.1_Intron|CORIN_uc011bzh.1_Intron|CORIN_uc011bzi.1_Intron|CORIN_uc003gxn.3_Intron	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						tttctggggatgttgttaatatt	0.000													4	5	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114135109	114135110	+	Intron	INS	-	TA	TA			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114135109_114135110insTA	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCTGttttatttattttttttt	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179874837	179874839	+	IGR	DEL	CAT	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179874837_179874839delCAT								LOC285501 (962934 upstream) : None (None downstream)																							ccaccatcaccatcaccaccatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8050569	8050570	+	IGR	INS	-	GAAAGGAAGGAAGGAAAG	GAAAGGAAGGAAGGAAAG	rs146426640	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8050569_8050570insGAAAGGAAGGAAGGAAAG								MTRR (149336 upstream) : SEMA5A (984568 downstream)																							ggaaaggaaaagaaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475785	90475786	+	IGR	INS	-	A	A	rs140241795	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475785_90475786insA								GPR98 (15753 upstream) : ARRDC3 (188755 downstream)																							aggaaggaaggaggaaggaagg	0.030													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	119067721	119067722	+	IGR	DEL	AC	-	-	rs72210247		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119067721_119067722delAC								FAM170A (96205 upstream) : PRR16 (732297 downstream)																							gaggggtgagacacacacacac	0.000													3	3	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	166854900	166854908	+	Intron	DEL	GGAAAGGAA	-	-	rs13185589		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166854900_166854908delGGAAAGGAA	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		aaggaaggacggaaaggaagggaaggaag	0.053													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	36377641	36377641	+	IGR	DEL	G	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36377641delG								PXT1 (9330 upstream) : KCTD20 (32903 downstream)																							gaaggaaggagaaagaaaaga	0.000													4	2	---	---	---	---	
GPR126	57211	broad.mit.edu	37	6	142630883	142630883	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142630883delT	uc010khc.2	+						GPR126_uc010khd.2_Intron|GPR126_uc010khe.2_Intron|GPR126_uc010khf.2_Intron|GPR126_uc003qix.2_Intron	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		ACTTACTGCCTTTTTTTTTTT	0.323													4	2	---	---	---	---	
LPAL2	80350	broad.mit.edu	37	6	160914198	160914198	+	Intron	DEL	T	-	-	rs146778738		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160914198delT	uc003qtj.2	-						LPAL2_uc011efy.1_Intron	NR_028093				Homo sapiens cDNA FLJ43922 fis, clone TESTI4012406.												0		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		AGATTTTAACTTTTTTTTTTA	0.348													5	4	---	---	---	---	
QKI	9444	broad.mit.edu	37	6	163991476	163991477	+	Intron	INS	-	T	T	rs67007203		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163991476_163991477insT	uc003qui.2	+						QKI_uc003quj.2_Intron	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		TTGTTAACCAGTTTTTTTTTTT	0.282													4	2	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89929478	89929479	+	Intron	INS	-	T	T	rs35447757		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89929478_89929479insT	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_Intron	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						TTTGTCTAAAGTTTTTTTTTTT	0.252													5	4	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103127001	103127001	+	Intron	DEL	A	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103127001delA	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		acaactttacaaaaaaaaaaa	0.124													4	2	---	---	---	---	
TBXAS1	6916	broad.mit.edu	37	7	139604857	139604858	+	Intron	DEL	TC	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139604857_139604858delTC	uc011kqv.1	+						TBXAS1_uc003vvh.2_Intron|TBXAS1_uc010lne.2_Intron|TBXAS1_uc011kqu.1_Intron|TBXAS1_uc003vvi.2_Intron|TBXAS1_uc003vvj.2_Intron|TBXAS1_uc011kqw.1_Intron|TBXAS1_uc011kqx.1_Intron	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					tttctttctttctctctctctc	0.000													5	3	---	---	---	---	
NDUFB2	4708	broad.mit.edu	37	7	140404902	140404902	+	Intron	DEL	T	-	-	rs72099907		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140404902delT	uc003vwa.2	+						NDUFB2_uc010lnl.2_Intron	NM_004546	NP_004537	O95178	NDUB2_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.00956)				NADH(DB00157)	CTGTATCTGCttttttttttt	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142013698	142013699	+	Intron	DEL	CT	-	-	rs36111580		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013698_142013699delCT	uc011kro.1	+						uc011krp.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CTGAGTGTGACTCTGCCCCGTC	0.307													3	4	---	---	---	---	
UBE3C	9690	broad.mit.edu	37	7	156991227	156991227	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156991227delT	uc010lqs.2	+						UBE3C_uc003wng.2_Intron	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TGTAtttgtcttttttttttt	0.308													3	3	---	---	---	---	
WHSC1L1	54904	broad.mit.edu	37	8	38195824	38195824	+	Intron	DEL	A	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38195824delA	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron|WHSC1L1_uc003xlj.2_Intron	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			tctcaaaaagaaaaaaaaaaa	0.139			T	NUP98	AML								4	2	---	---	---	---	
LACTB2	51110	broad.mit.edu	37	8	71550980	71550980	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71550980delT	uc011lfd.1	-						LACTB2_uc003xyp.2_Intron	NM_016027	NP_057111	Q53H82	LACB2_HUMAN	lactamase, beta 2								hydrolase activity|metal ion binding			ovary(1)	1	Breast(64;0.0716)		Epithelial(68;0.00319)|all cancers(69;0.0175)|OV - Ovarian serous cystadenocarcinoma(28;0.0628)|BRCA - Breast invasive adenocarcinoma(89;0.166)			CTTAAACACAttttttttttt	0.114													5	4	---	---	---	---	
FAM92A1	137392	broad.mit.edu	37	8	94731097	94731098	+	Intron	INS	-	T	T			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94731097_94731098insT	uc010maq.2	+						FAM92A1_uc003yfv.3_Intron|FAM92A1_uc003yfx.3_Intron|FAM92A1_uc003yfw.3_Intron|FAM92A1_uc010mar.2_Intron	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392												0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TGATTAATATCttttttttttt	0.149													4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139701401	139701402	+	Intron	INS	-	G	G	rs149093007	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139701401_139701402insG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCTGCTCTCCCGGGGGGGGGGC	0.545										HNSCC(7;0.00092)			4	2	---	---	---	---	
RPSAP9	653162	broad.mit.edu	37	9	79014569	79014570	+	3'UTR	INS	-	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79014569_79014570insA	uc011lsj.1	+	1						NR_026890				SubName: Full=Laminin receptor-like protein LAMRL5;												0						ATCAGTTTCTTAAAAAAAAAAA	0.342													4	2	---	---	---	---	
NCS1	23413	broad.mit.edu	37	9	132985259	132985259	+	Intron	DEL	C	-	-	rs68053432		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985259delC	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101	P62166	NCS1_HUMAN	frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0						AAGAGGGGGGCGGCCCTCATC	0.657													3	5	---	---	---	---	
SARDH	1757	broad.mit.edu	37	9	136550476	136550477	+	Intron	INS	-	G	G	rs9409845	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136550476_136550477insG	uc004cep.3	-						SARDH_uc004ceo.2_Intron|SARDH_uc011mdn.1_Intron|SARDH_uc011mdo.1_Intron|SARDH_uc004cen.2_Intron	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor						glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GGAAAGGCCCCGGGGACCTGCC	0.525													6	5	---	---	---	---	
BRD3	8019	broad.mit.edu	37	9	136910279	136910279	+	Intron	DEL	A	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136910279delA	uc004cew.2	-						BRD3_uc004cex.2_Intron	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3							nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		ggcactcgggaaaaaggtgtt	0.428			T	NUT|C15orf55	lethal midline carcinoma of young people								4	2	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72245966	72245966	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72245966delT	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						AGTCAATATCTTTTTTTTTTT	0.428													5	3	---	---	---	---	
NUP98	4928	broad.mit.edu	37	11	3723555	3723555	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3723555delT	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyg.2_Intron	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		tctctctctctctctctctct	0.214			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	41592764	41592765	+	IGR	DEL	AC	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41592764_41592765delAC								LRRC4C (111441 upstream) : None (None downstream)																							gtgtgtgtgtacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50060375	50060377	+	IGR	DEL	TAA	-	-	rs139365511		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50060375_50060377delTAA								OR4C12 (56338 upstream) : LOC441601 (178623 downstream)																							tttttttttttaaaaaaaaaaaa	0.320													4	2	---	---	---	---	
C12orf60	144608	broad.mit.edu	37	12	14959764	14959764	+	Intron	DEL	C	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14959764delC	uc001rcj.3	+						C12orf69_uc001rck.1_Intron	NM_175874	NP_787070	Q5U649	CL060_HUMAN	hypothetical protein LOC144608											ovary(1)|central_nervous_system(1)	2						TTCCTCAGAACACTCAACAAG	0.204													6	3	---	---	---	---	
MARS	4141	broad.mit.edu	37	12	57884564	57884569	+	Intron	DEL	TTTTTT	-	-	rs35674919		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57884564_57884569delTTTTTT	uc001sog.2	+						ARHGAP9_uc001sod.2_5'Flank|ARHGAP9_uc001soe.1_5'Flank|MARS_uc001sof.1_Intron|MARS_uc010srp.1_Intron|MARS_uc010srq.1_Intron	NM_004990	NP_004981	P56192	SYMC_HUMAN	methionyl-tRNA synthetase						methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CTTACATCTCtttttttttttttttt	0.228													4	2	---	---	---	---	
GPR81	27198	broad.mit.edu	37	12	123201446	123201447	+	Intron	DEL	AA	-	-	rs35024436		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123201446_123201447delAA	uc001ucw.1	-						GPR109B_uc001ucy.3_5'Flank	NM_032554		Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81						response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CGAAATCTCTAAAAAAAAAAAA	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	33144581	33144582	+	IGR	INS	-	C	C			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33144581_33144582insC								N4BP2L2 (31645 upstream) : PDS5B (16010 downstream)																							tgcctttctttccttccttcct	0.010													4	2	---	---	---	---	
TRPC4	7223	broad.mit.edu	37	13	38357626	38357627	+	Intron	INS	-	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38357626_38357627insG	uc001uws.2	-						TRPC4_uc010abv.2_5'Flank|TRPC4_uc001uwt.2_Intron|TRPC4_uc010tey.1_Intron|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Intron|TRPC4_uc010aby.2_Intron	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,						axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTAAGAGTTAAGGTTTTTTTTT	0.228													4	3	---	---	---	---	
ISM2	145501	broad.mit.edu	37	14	77948469	77948469	+	Intron	DEL	A	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77948469delA	uc001xtz.2	-						ISM2_uc001xua.2_Intron|ISM2_uc001xty.2_Intron|ISM2_uc010tvl.1_Intron	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1							extracellular region				skin(1)	1						ttaaaaaattaaaaaaaaaaa	0.174													3	3	---	---	---	---	
SNORD115-20	100033460	broad.mit.edu	37	15	25465467	25465469	+	Intron	DEL	GAA	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25465467_25465469delGAA	uc001yzq.1	+						uc001yzt.1_Intron|SNORD115-26_uc001yzw.1_Intron|HBII-52-27_uc010ayq.1_5'Flank|HBII-52-28_uc010ayr.1_5'Flank|SNORD115-11_uc001yzx.1_5'Flank	NR_003313				Homo sapiens small nucleolar RNA, C/D box 115-15 (SNORD115-15), non-coding RNA.												0						TGGTGAGACCGAAGAAGACTTGC	0.581													4	4	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	34119402	34119402	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34119402delT	uc001zhi.2	+	85	11318	c.11248delT	c.(11248-11250)TTTfs	p.F3750fs	RYR3_uc010bar.2_Frame_Shift_Del_p.F3745fs	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3750					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCTCTCAGACTTTCAGAACTT	0.557													4	2	---	---	---	---	
GATM	2628	broad.mit.edu	37	15	45668604	45668615	+	Intron	DEL	CTTCAGGAAGCT	-	-	rs138059319		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45668604_45668615delCTTCAGGAAGCT	uc001zvc.2	-						GATM_uc001zvb.2_Intron|GATM_uc010uev.1_Intron	NM_001482	NP_001473	P50440	GATM_HUMAN	L-arginine:glycine amidinotransferase precursor						creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding				0		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)	aagggaagagcttcaggaagctcttcaggaag	0.198													3	5	---	---	---	---	
ZNF609	23060	broad.mit.edu	37	15	64937180	64937181	+	Intron	INS	-	TC	TC	rs147608283	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64937180_64937181insTC	uc002ann.2	+							NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						ctttctttctttttctttcttt	0.104													4	2	---	---	---	---	
CPEB1	64506	broad.mit.edu	37	15	83221050	83221050	+	Intron	DEL	T	-	-	rs67298411		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83221050delT	uc002bit.2	-						CPEB1_uc002biq.2_Intron|CPEB1_uc002bir.2_Intron|CPEB1_uc002bis.2_Intron|CPEB1_uc010uod.1_Intron|CPEB1_uc010uoe.1_Intron|CPEB1_uc002biu.2_Intron|CPEB1_uc010uof.1_Intron|CPEB1_uc002biv.2_Intron|CPEB1_uc002bip.2_Intron	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			CAAAGGTTGCTTTTTTTTTTT	0.443													4	2	---	---	---	---	
NOS2	4843	broad.mit.edu	37	17	26090105	26090108	+	Intron	DEL	ATTC	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26090105_26090108delATTC	uc002gzu.2	-							NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	ACAACCCAGTattcattcattcat	0.279													4	2	---	---	---	---	
SNF8	11267	broad.mit.edu	37	17	47013376	47013376	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47013376delT	uc002ioj.2	-						SNF8_uc002iok.2_Intron	NM_007241	NP_009172	Q96H20	SNF8_HUMAN	EAP30 subunit of ELL complex						cellular membrane organization|endosome transport|protein transport|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytosol|late endosome membrane|transcription factor complex	transcription factor binding				0						ctatctcTTATTTTTTGTTTG	0.159													4	3	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025820	64025821	+	Intron	INS	-	TAAA	TAAA	rs144628903	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025820_64025821insTAAA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gaccctgtctctaaataaacaa	0.114													7	4	---	---	---	---	
NUP85	79902	broad.mit.edu	37	17	73204376	73204376	+	Intron	DEL	A	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73204376delA	uc002jng.1	+						NUP85_uc010dgd.1_Intron|NUP85_uc010wrv.1_Intron	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			actaaaaatgaaaaaaaaaaa	0.000													3	3	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3134954	3134954	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3134954delT	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TATTTTACGAttttttttttt	0.169													5	3	---	---	---	---	
TAF4B	6875	broad.mit.edu	37	18	23835568	23835568	+	Intron	DEL	A	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23835568delA	uc002kvu.3	+						TAF4B_uc002kvs.3_Intron|TAF4B_uc002kvt.3_Intron	NM_005640	NP_005631	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding						transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleolus|transcription factor TFIID complex	DNA binding|NF-kappaB binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)|skin(1)	3	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			ctctgtctccaaaaaaaaaaa	0.169													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	59620239	59620240	+	IGR	INS	-	G	G			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59620239_59620240insG								RNF152 (59935 upstream) : PIGN (91220 downstream)																							gaaggaaggaagagggaaggaa	0.005													4	2	---	---	---	---	
ARHGEF18	23370	broad.mit.edu	37	19	7511782	7511782	+	Intron	DEL	A	-	-	rs111788607		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7511782delA	uc002mgi.2	+						ARHGEF18_uc010xjm.1_Intron|ARHGEF18_uc002mgh.2_Intron|ARHGEF18_uc002mgj.1_5'Flank	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				atgctgtctcaaaaaaaaaaa	0.090													5	3	---	---	---	---	
PAK4	10298	broad.mit.edu	37	19	39614513	39614530	+	5'Flank	DEL	GAAGGAAAGAAAGAGAAA	-	-	rs72010258	by1000genomes	TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39614513_39614530delGAAGGAAAGAAAGAGAAA	uc002okj.1	+						PAK4_uc002okl.1_5'Flank|PAK4_uc002okn.1_5'Flank|PAK4_uc002okm.1_5'Flank|PAK4_uc002oko.1_5'Flank|PAK4_uc002okp.1_5'Flank	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			aggaaggaaggaaggaaagaaagagaaagaaagaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32711134	32711134	+	IGR	DEL	A	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32711134delA								EIF2S2 (11049 upstream) : ASIP (137037 downstream)																							ATTAAGCCTGAAAAAAAAAAA	0.313													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085940	11085942	+	Intron	DEL	CAC	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085940_11085942delCAC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccaccaccatcaccaccaccacc	0.158													5	4	---	---	---	---	
SON	6651	broad.mit.edu	37	21	34929320	34929320	+	Intron	DEL	T	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34929320delT	uc002yse.1	+						SON_uc002ysb.1_Intron|SON_uc002ysc.2_Intron|SON_uc002ysd.2_Intron|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Intron	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F						anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						AGTTTTTTCCTTTTTTTTTTT	0.338													5	3	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33376840	33376840	+	Intron	DEL	T	-	-	rs36093480		TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33376840delT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						TTTCTCAGTCttttttttttt	0.254													9	5	---	---	---	---	
FAM70A	55026	broad.mit.edu	37	X	119421088	119421088	+	Intron	DEL	A	-	-			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119421088delA	uc004eso.3	-						FAM70A_uc004esp.3_Intron|FAM70A_uc010nqo.2_Intron	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN	hypothetical protein LOC55026 isoform 1							integral to membrane				lung(1)|breast(1)	2						CTGAAAAGGGAAACACCAAAA	0.373													118	75	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128428284	128428285	+	IGR	INS	-	A	A			TCGA-BP-4999-01A-01D-1462-08	TCGA-BP-4999-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128428284_128428285insA								None (None upstream) : SMARCA1 (152195 downstream)																							aagaaagaaagaaagaaagaaa	0.000													4	2	---	---	---	---	
