Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MEMO1	51072	broad.mit.edu	37	2	32117195	32117195	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32117195T>G	uc002rnx.2	-	6	828	c.446A>C	c.(445-447)GAT>GCT	p.D149A	MEMO1_uc010ymu.1_Missense_Mutation_p.D126A|MEMO1_uc010ezq.2_Missense_Mutation_p.D149A|MEMO1_uc002rny.2_Intron|MEMO1_uc002rnz.2_RNA	NM_015955	NP_057039	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1 isoform 1	149					regulation of microtubule-based process	cytosol|nucleus				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					GGTAAACTCATCCTTATGGCT	0.328													35	134	---	---	---	---	PASS
CCDC75	253635	broad.mit.edu	37	2	37319307	37319307	+	Splice_Site	SNP	G	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37319307G>C	uc010ezz.2	+	6	583	c.438_splice	c.e6-1	p.R146_splice	CCDC75_uc002rpr.3_Splice_Site_p.R43_splice	NM_174931	NP_777591	Q8N954	CCD75_HUMAN	coiled-coil domain containing 75							intracellular	nucleic acid binding				0		all_hematologic(82;0.21)				CTTTCAATTAGAATGCGACTT	0.358													4	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	95558330	95558330	+	RNA	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95558330C>T	uc002stv.1	-	6		c.671G>A								Homo sapiens cDNA FLJ44118 fis, clone TESTI4047069.																		GGCTGCATTCCAAACAGCGGG	0.423													12	39	---	---	---	---	PASS
KIF5C	3800	broad.mit.edu	37	2	149793902	149793902	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149793902G>T	uc010zbu.1	+	4	764	c.396G>T	c.(394-396)AAG>AAT	p.K132N		NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	132	Kinesin-motor.				microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		TTCACATAAAGGTACGTATTA	0.443													6	8	---	---	---	---	PASS
TTC30A	92104	broad.mit.edu	37	2	178482340	178482340	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178482340C>T	uc002ulo.2	-	1	1355	c.1090G>A	c.(1090-1092)GCC>ACC	p.A364T		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	364					cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			GTGATCAGGGCATCTAAGAAG	0.473													46	153	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218713105	218713105	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218713105C>A	uc002vgt.2	-	17	2158	c.1760G>T	c.(1759-1761)GGT>GTT	p.G587V	TNS1_uc002vgr.2_Missense_Mutation_p.G587V|TNS1_uc002vgs.2_Missense_Mutation_p.G587V|TNS1_uc010zjv.1_Missense_Mutation_p.G587V|TNS1_uc010fvj.1_Missense_Mutation_p.G655V|TNS1_uc010fvk.1_Missense_Mutation_p.G712V|TNS1_uc010fvi.1_Missense_Mutation_p.G274V	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	587						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GCCAGCTAAACCCTCCTGTGC	0.667													9	42	---	---	---	---	PASS
GNAT1	2779	broad.mit.edu	37	3	50231595	50231595	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50231595A>G	uc003cym.2	+	6	765	c.649A>G	c.(649-651)ATC>GTC	p.I217V	GNAT1_uc003cyl.2_Missense_Mutation_p.I217V	NM_144499	NP_653082	P11488	GNAT1_HUMAN	rod-type transducin alpha subunit	217					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|negative regulation of cyclic-nucleotide phosphodiesterase activity|rhodopsin mediated phototransduction|sensory perception of umami taste	heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment membrane	acyl binding|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GDP binding|GTP binding|GTPase activity|protein kinase binding|signal transducer activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		CGTGACCTGCATCATCTTCAT	0.672													6	6	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97851579	97851579	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97851579T>C	uc011bgt.1	+	1	38	c.38T>C	c.(37-39)GTT>GCT	p.V13A		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	13	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						ACAGAGTTTGTTCTCACAGGA	0.398													6	186	---	---	---	---	PASS
C3orf37	56941	broad.mit.edu	37	3	129023468	129023468	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129023468C>T	uc003elt.2	+	7	953	c.865C>T	c.(865-867)CAG>TAG	p.Q289*	C3orf37_uc003elu.2_Nonsense_Mutation_p.Q247*|C3orf37_uc003elv.2_Nonsense_Mutation_p.Q289*|C3orf37_uc003elw.2_Nonsense_Mutation_p.Q289*	NM_020187	NP_064572	Q96FZ2	CC037_HUMAN	hypothetical protein LOC56941	289										ovary(1)	1						GAGGATGTTGCAGTGGTTGGC	0.483													64	183	---	---	---	---	PASS
DHX29	54505	broad.mit.edu	37	5	54585151	54585151	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54585151G>A	uc003jpx.2	-	8	1133	c.1013C>T	c.(1012-1014)GCA>GTA	p.A338V	DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	338							ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				AAAATTCAATGCACTTTCTCC	0.343													22	52	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140236546	140236546	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140236546G>A	uc003lhx.2	+	1	913	c.913G>A	c.(913-915)GAT>AAT	p.D305N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.D305N|PCDHA10_uc011dad.1_Missense_Mutation_p.D305N	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	305	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAAGTAAATGATGCTATTGA	0.383													70	82	---	---	---	---	PASS
SQSTM1	8878	broad.mit.edu	37	5	179264300	179264300	+	3'UTR	SNP	A	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179264300A>C	uc003mkw.3	+	8					SQSTM1_uc011dgr.1_3'UTR|SQSTM1_uc011dgs.1_3'UTR|SQSTM1_uc003mkx.2_3'UTR|C5orf45_uc003mky.2_Intron|C5orf45_uc011dgt.1_Intron|C5orf45_uc011dgu.1_Intron|C5orf45_uc003mla.2_3'UTR|C5orf45_uc003mlc.2_3'UTR|C5orf45_uc003mlb.2_3'UTR	NM_003900	NP_003891	Q13501	SQSTM_HUMAN	sequestosome 1 isoform 1						anti-apoptosis|apoptosis|cell differentiation|endosome transport|induction of apoptosis by extracellular signals|intracellular signal transduction|macroautophagy|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein localization|regulation of I-kappaB kinase/NF-kappaB cascade|ubiquitin-dependent protein catabolic process	cytosol|late endosome|nucleoplasm	protein kinase C binding|receptor tyrosine kinase binding|SH2 domain binding|ubiquitin binding|zinc ion binding		SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTTATTGTTAATGGTTCTTAC	0.373									Paget_Disease_of_Bone				44	120	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76570739	76570739	+	Splice_Site	SNP	G	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76570739G>C	uc003pih.1	+	15	1753	c.1474_splice	c.e15-1	p.E492_splice	MYO6_uc003pig.1_Splice_Site_p.E492_splice|MYO6_uc003pii.1_Splice_Site_p.E492_splice	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TTCATTTTTAGGAACAAGAAC	0.313													30	109	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168363200	168363200	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168363200C>T	uc003qwd.2	+	31	5072	c.4930C>T	c.(4930-4932)CGC>TGC	p.R1644C	MLLT4_uc003qwc.1_Missense_Mutation_p.R1632C|MLLT4_uc003qwg.1_Missense_Mutation_p.R943C	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1634	Potential.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AGAGGAAGAGCGCCGGCGGCA	0.547			T	MLL	AL								29	116	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6190120	6190120	+	Silent	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6190120C>T	uc011jwo.1	+	14	2307	c.2184C>T	c.(2182-2184)GGC>GGT	p.G728G	USP42_uc011jwp.1_Silent_p.G728G|USP42_uc011jwq.1_Silent_p.G535G|USP42_uc011jwr.1_Silent_p.G573G	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	728					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		AACTGAAAGGCTCGACGGATG	0.428													21	73	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42006052	42006052	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42006052G>T	uc011kbh.1	-	15	2710	c.2619C>A	c.(2617-2619)AGC>AGA	p.S873R	GLI3_uc011kbg.1_Missense_Mutation_p.S814R	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	873				S->A: Loss of proteolytic processing.	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						TGGAGCGGCGGCTGGAGAAGC	0.687									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				7	3	---	---	---	---	PASS
CCDC146	57639	broad.mit.edu	37	7	76916144	76916144	+	Silent	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76916144C>T	uc003uga.2	+	16	2305	c.2178C>T	c.(2176-2178)GAC>GAT	p.D726D	CCDC146_uc010ldp.2_Silent_p.D440D|CCDC146_uc003ugc.2_Silent_p.D63D	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	726	Potential.									ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GAATTAAAGACCTGGAGAAAC	0.368													58	111	---	---	---	---	PASS
RNF148	378925	broad.mit.edu	37	7	122342196	122342196	+	Silent	SNP	G	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122342196G>C	uc003vkk.1	-	1	826	c.609C>G	c.(607-609)GCC>GCG	p.A203A	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron|RNF133_uc003vkj.1_5'Flank|RNF148_uc010lkr.1_Intron	NM_198085	NP_932351	Q8N7C7	RN148_HUMAN	ring finger protein 148 precursor	203	Helical; (Potential).					integral to membrane	zinc ion binding				0						AGTAAAAGTAGGCAATTGTGG	0.438													43	129	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137623935	137623935	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137623935G>A	uc004cfe.2	+	9	1733	c.1351G>A	c.(1351-1353)GAG>AAG	p.E451K		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	451	Interrupted collagenous region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ACCTCGGGGCGAGAAAGGCCA	0.542													32	110	---	---	---	---	PASS
BEND7	222389	broad.mit.edu	37	10	13523079	13523079	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13523079A>G	uc001imm.2	-	6	1024	c.727T>C	c.(727-729)TCT>CCT	p.S243P	BEND7_uc001imn.2_Missense_Mutation_p.S4P|BEND7_uc001imo.3_Missense_Mutation_p.S256P	NM_152751	NP_689964	Q8N7W2	BEND7_HUMAN	BEN domain containing 7 isoform 1	295	BEN.						protein binding			ovary(1)|breast(1)	2						TCCAGCTGAGATTTAGGCATA	0.393													33	109	---	---	---	---	PASS
C10orf68	79741	broad.mit.edu	37	10	32863446	32863446	+	Intron	SNP	A	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32863446A>T	uc001iwn.3	+						CCDC7_uc001iwj.2_3'UTR|CCDC7_uc001iwk.2_3'UTR|CCDC7_uc009xlv.2_RNA|C10orf68_uc001iwl.1_5'UTR|C10orf68_uc001iwm.1_Intron	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68											skin(2)|ovary(1)	3						CCACCTGAGCAGATACATGGT	0.363													16	31	---	---	---	---	PASS
TNNT3	7140	broad.mit.edu	37	11	1955173	1955173	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1955173G>A	uc001luu.3	+	11	513	c.301G>A	c.(301-303)GCA>ACA	p.A101T	TNNT3_uc001lun.2_Intron|TNNT3_uc001luw.3_Missense_Mutation_p.A93T|TNNT3_uc001luo.3_Missense_Mutation_p.A93T|TNNT3_uc001lup.3_Missense_Mutation_p.A99T|TNNT3_uc001luq.3_Missense_Mutation_p.A93T|TNNT3_uc001lur.2_Missense_Mutation_p.A93T|TNNT3_uc010qxf.1_Missense_Mutation_p.A99T|TNNT3_uc010qxg.1_Missense_Mutation_p.A33T	NM_006757	NP_006748	P45378	TNNT3_HUMAN	troponin T3, skeletal, fast isoform 1	112					muscle filament sliding|regulation of ATPase activity|regulation of striated muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium-dependent protein binding|tropomyosin binding|troponin C binding|troponin I binding			ovary(1)	1		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		GAAGCGCCGTGCAGAGAGAGC	0.652													10	33	---	---	---	---	PASS
FADS2	9415	broad.mit.edu	37	11	61608124	61608124	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61608124A>C	uc001nsl.1	+	4	695	c.545A>C	c.(544-546)TAT>TCT	p.Y182S	FADS2_uc001nsj.2_Missense_Mutation_p.Y160S|FADS2_uc010rlo.1_Missense_Mutation_p.Y151S|FADS2_uc001nsk.2_Missense_Mutation_p.Y182S	NM_004265	NP_004256	O95864	FADS2_HUMAN	fatty acid desaturase 2	182	Cytoplasmic (Potential).|Histidine box-1.				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	heme binding			ovary(1)|pancreas(1)	2					Alpha-Linolenic Acid(DB00132)	CAACATGATTATGGCCACCTG	0.547													54	150	---	---	---	---	PASS
DEFB108B	245911	broad.mit.edu	37	11	71548458	71548458	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71548458C>G	uc010rqr.1	+	2	72	c.72C>G	c.(70-72)TTC>TTG	p.F24L		NM_001002035	NP_001002035	Q8NET1	D108B_HUMAN	beta-defensin 108B precursor	24					defense response to bacterium	extracellular region					0						GGGGCAAATTCAAGGAGATCT	0.428													74	153	---	---	---	---	PASS
UVRAG	7405	broad.mit.edu	37	11	75852292	75852292	+	Silent	SNP	A	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75852292A>T	uc001oxc.2	+	15	2176	c.1935A>T	c.(1933-1935)TCA>TCT	p.S645S	UVRAG_uc010rrw.1_Silent_p.S544S|UVRAG_uc001oxd.2_Silent_p.S273S|UVRAG_uc010rrx.1_Silent_p.S273S|UVRAG_uc010rry.1_Silent_p.S201S	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	645					DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						GTTTCGCCTCAGGTGATCAGC	0.517													17	73	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92085830	92085830	+	Silent	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92085830C>T	uc001pdj.3	+	1	569	c.552C>T	c.(550-552)GAC>GAT	p.D184D		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	184	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTGCAACAGACGCAGATATTG	0.423										TCGA Ovarian(4;0.039)			5	97	---	---	---	---	PASS
C12orf57	113246	broad.mit.edu	37	12	7053852	7053852	+	Intron	SNP	A	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7053852A>C	uc001qrz.2	+						C12orf57_uc009zfj.1_Missense_Mutation_p.K113T|PTPN6_uc001qsa.1_5'Flank|PTPN6_uc010sfr.1_5'Flank	NM_138425	NP_612434	Q99622	C10_HUMAN	C10 protein												0						AGACGCGGGAAGGCGGGAGTT	0.642											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	30	---	---	---	---	PASS
RPL13AP20	387841	broad.mit.edu	37	12	13028751	13028751	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13028751G>C	uc010sho.1	+	1	341	c.319G>C	c.(319-321)GGC>CGC	p.G107R		NR_003932				SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;												0						GGTGTTTGACGGCATCCCACC	0.612													3	11	---	---	---	---	PASS
DIP2B	57609	broad.mit.edu	37	12	51127944	51127944	+	Silent	SNP	T	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51127944T>C	uc001rwv.2	+	33	4164	c.4008T>C	c.(4006-4008)ACT>ACC	p.T1336T	DIP2B_uc009zlt.2_Silent_p.T766T	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	1336						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						ATCCGACTACTGTGTATGTGG	0.363													85	202	---	---	---	---	PASS
PIP4K2C	79837	broad.mit.edu	37	12	57985037	57985037	+	5'UTR	SNP	G	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57985037G>C	uc001sou.2	+	1					PIP4K2C_uc001sot.2_5'UTR|PIP4K2C_uc010srs.1_5'UTR|PIP4K2C_uc010srt.1_5'UTR	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type							cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					ATAGCTGCCGGCTCCGGCTTC	0.716													7	19	---	---	---	---	PASS
UNC119B	84747	broad.mit.edu	37	12	121154504	121154504	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121154504C>G	uc001tyz.2	+	3	879	c.432C>G	c.(430-432)TTC>TTG	p.F144L		NM_001080533	NP_001074002	A6NIH7	U119B_HUMAN	unc-119 homolog B	144										haematopoietic_and_lymphoid_tissue(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCTATCAGTTCACACCGGCAT	0.532													70	224	---	---	---	---	PASS
FAM70B	348013	broad.mit.edu	37	13	114469231	114469231	+	Splice_Site	SNP	G	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114469231G>T	uc001vuh.2	+	2	216	c.189_splice	c.e2+1	p.I63_splice	FAM70B_uc010tkh.1_Missense_Mutation_p.V64L	NM_182614	NP_872420	Q8WV15	FA70B_HUMAN	family with sequence similarity 70, member B							integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)			AGGGATCATTGTGAGTGCGCC	0.672													25	38	---	---	---	---	PASS
NUMB	8650	broad.mit.edu	37	14	73759584	73759584	+	Splice_Site	SNP	T	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73759584T>C	uc001xny.1	-	8	630	c.310_splice	c.e8-1	p.D104_splice	NUMB_uc010aro.1_Splice_Site_p.D104_splice|NUMB_uc010arp.1_Splice_Site_p.D93_splice|NUMB_uc010arq.1_Splice_Site_p.D104_splice|NUMB_uc010arr.1_Splice_Site_p.D93_splice|NUMB_uc001xoa.1_Splice_Site_p.D104_splice|NUMB_uc001xnz.1_Splice_Site_p.D93_splice|NUMB_uc001xob.1_Splice_Site_p.D93_splice|NUMB_uc001xod.1_Splice_Site_p.D104_splice|NUMB_uc001xoc.1_Splice_Site_p.D104_splice|NUMB_uc010ars.1_Splice_Site_p.D93_splice|NUMB_uc001xof.1_Splice_Site_p.D68_splice|NUMB_uc001xog.2_Splice_Site_p.D93_splice|NUMB_uc001xoh.1_Splice_Site_p.D93_splice	NM_001005743	NP_001005743	P49757	NUMB_HUMAN	numb homolog isoform 1						axon guidance|lateral ventricle development|neuroblast division in subventricular zone|positive regulation of neurogenesis	integral to plasma membrane				ovary(2)|central_nervous_system(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		TATGAGGTCCTAGAAAATACG	0.413													24	31	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42678049	42678049	+	Intron	SNP	G	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42678049G>T	uc001zpn.1	+						CAPN3_uc001zpk.1_5'UTR|CAPN3_uc001zpl.1_Intron|CAPN3_uc010udf.1_Intron|CAPN3_uc010udg.1_Intron|CAPN3_uc001zpo.1_Intron|CAPN3_uc001zpp.1_Intron	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a						muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		ACCCAGTTatgatcacctact	0.214											OREG0023085	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	33	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63030474	63030474	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63030474A>T	uc002alb.3	+	27	3629	c.3629A>T	c.(3628-3630)GAT>GTT	p.D1210V	TLN2_uc002alc.3_5'Flank	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1210					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GGGCAGAAGGATGTGGACGTG	0.507													49	82	---	---	---	---	PASS
SEPX1	51734	broad.mit.edu	37	16	1990864	1990864	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1990864C>G	uc010uvs.1	-	3	371	c.234G>C	c.(232-234)TTG>TTC	p.L78F		NM_016332	NP_057416	Q9NZV6	MSRB1_HUMAN	selenoprotein X, 1	78					protein repair	cytoplasm|nucleus	peptide-methionine-(S)-S-oxide reductase activity|zinc ion binding			ovary(1)	1					L-Methionine(DB00134)	ACTCGTGGCCCAACCCATTGC	0.567													19	41	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268158	70268158	+	RNA	SNP	A	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268158A>C	uc010cfp.1	-	3		c.257T>G								Homo sapiens cDNA, FLJ98908.																		TTCTTCATTAAAACAGCTACT	0.333													2	11	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1586888	1586888	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1586888T>G	uc002fte.2	-	3	322	c.208A>C	c.(208-210)ATT>CTT	p.I70L		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	70						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TGGTCTCGAATGATCTTCCTG	0.473													42	136	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904193	21904193	+	RNA	SNP	C	G	G	rs9904221	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904193C>G	uc002gza.2	+	1		c.132C>G				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						cagcctcaggcctgccaggac	0.000													3	42	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34185482	34185482	+	Silent	SNP	G	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34185482G>T	uc002hke.1	-	10	1136	c.987C>A	c.(985-987)GTC>GTA	p.V329V	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Silent_p.V289V|C17orf66_uc010wcm.1_Silent_p.V295V	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	329							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		TGGCCTTGATGACTGGGGCTG	0.572													27	46	---	---	---	---	PASS
PPP1R1B	84152	broad.mit.edu	37	17	37785438	37785438	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37785438C>G	uc002hrz.2	+	2	564	c.97C>G	c.(97-99)CCA>GCA	p.P33A	PPP1R1B_uc002hsa.2_Missense_Mutation_p.P33A|PPP1R1B_uc010cvx.2_Missense_Mutation_p.P33A|PPP1R1B_uc002hsb.2_5'UTR|PPP1R1B_uc002hsc.2_5'UTR	NM_032192	NP_115568	Q9UD71	PPR1B_HUMAN	protein phosphatase 1, regulatory (inhibitor)	33					signal transduction	cytosol	protein kinase inhibitor activity|protein phosphatase inhibitor activity				0	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCGCAGGAGACCAACGCCTGC	0.642													16	63	---	---	---	---	PASS
LRRC59	55379	broad.mit.edu	37	17	48470252	48470252	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48470252A>T	uc002iqt.2	-	3	326	c.172T>A	c.(172-174)TTC>ATC	p.F58I		NM_018509	NP_060979	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	58	Cytoplasmic (Potential).|LRR 2.					endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial nucleoid	protein binding			central_nervous_system(1)	1	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			AGGCCACAGAAATCCGACTAG	0.358													20	59	---	---	---	---	PASS
METTL4	64863	broad.mit.edu	37	18	2567241	2567241	+	5'UTR	SNP	G	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2567241G>A	uc002klh.3	-	2						NM_022840	NP_073751	Q8N3J2	METL4_HUMAN	methyltransferase like 4						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		methyltransferase activity|nucleic acid binding			kidney(1)|skin(1)	2						AAGCCTCTGGGAATTAGGAAC	0.343													22	77	---	---	---	---	PASS
SERPINB4	6318	broad.mit.edu	37	18	61310791	61310791	+	Silent	SNP	G	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61310791G>C	uc002ljf.2	-	2	107	c.21C>G	c.(19-21)GCC>GCG	p.A7A	SERPINB4_uc002lje.2_Silent_p.A7A|SERPINB4_uc002ljg.2_Intron	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade	7					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						ACTTGGTGTTGGCTTCACTGA	0.398													76	263	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9062883	9062883	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9062883G>A	uc002mkp.2	-	3	24767	c.24563C>T	c.(24562-24564)ACC>ATC	p.T8188I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8190	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TATGCTGGAGGTAGGGAGTCT	0.473													25	70	---	---	---	---	PASS
ZNF492	57615	broad.mit.edu	37	19	22836216	22836216	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22836216C>A	uc002nqw.3	+	2	259	c.15C>A	c.(13-15)TAC>TAA	p.Y5*		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	5	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				TAGAGAACTACAGAAACCTGG	0.378													50	257	---	---	---	---	PASS
LOC100101266	100101266	broad.mit.edu	37	19	24346194	24346194	+	RNA	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24346194C>T	uc010edb.1	-	1		c.56G>A				NR_003603				Homo sapiens hepatitis A virus cellular receptor 1 pseudogene (LOC100101266), non-coding RNA.												0						ACAGAATCTGCCAGATGTAGG	0.493													8	20	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54746128	54746128	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54746128G>C	uc010erh.1	-	3	253	c.129C>G	c.(127-129)AGC>AGG	p.S43R	LILRA6_uc002qew.1_Missense_Mutation_p.S43R|LILRB3_uc002qeh.1_Missense_Mutation_p.S43R|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.S43R|LILRA6_uc002qek.1_Missense_Mutation_p.S43R|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.S43R|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.S43R|LILRB3_uc002qep.1_Missense_Mutation_p.S43R|LILRB3_uc002qeq.1_Missense_Mutation_p.S43R|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.S43R|LILRA6_uc010yep.1_Missense_Mutation_p.S43R|LILRA6_uc010yeq.1_Missense_Mutation_p.S43R|LILRA6_uc002qet.3_RNA|LILRA6_uc002qeu.1_Missense_Mutation_p.S43R|LILRA6_uc002qev.1_5'Flank	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	43	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGTCACGGGGCTCCCCCAGC	0.602													24	161	---	---	---	---	PASS
EEF1A2	1917	broad.mit.edu	37	20	62122020	62122020	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62122020C>T	uc002yfd.1	-	5	942	c.841G>A	c.(841-843)GCG>ACG	p.A281T	EEF1A2_uc002yfe.1_Missense_Mutation_p.A281T|EEF1A2_uc010gkg.1_Missense_Mutation_p.A281T	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	281						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			TTCACTGGCGCAAAGGTCACC	0.637													19	54	---	---	---	---	PASS
CHAF1B	8208	broad.mit.edu	37	21	37783835	37783835	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37783835A>G	uc002yvj.2	+	11	1132	c.994A>G	c.(994-996)ACC>GCC	p.T332A		NM_005441	NP_005432	Q13112	CAF1B_HUMAN	chromatin assembly factor 1 subunit B	332	WD 6.				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|cytoplasm	chromatin binding|histone binding|unfolded protein binding			ovary(1)|skin(1)	2						TCTGTATGACACCCAGCAGTC	0.522													73	229	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72434219	72434219	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72434219G>A	uc004ebi.2	-	1	466	c.110C>T	c.(109-111)GCC>GTC	p.A37V	NAP1L2_uc011mqj.1_Intron	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	37					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					CCCAGCAGCGGCATCTTCACC	0.577													3	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	155255094	155255094	+	3'UTR	SNP	T	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155255094T>C	uc004fnx.3	+	9						NM_182905	NP_878908			WAS protein family homolog 1																		TGCTCTGACATGGACACAGCC	0.617													6	16	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3096	3096	+	5'Flank	SNP	T	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3096T>C	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		AATCCAGGTCGGTTTCTATCT	0.448													13	1	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	13164130	13164131	+	IGR	INS	-	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13164130_13164131insA								PRAMEF5 (46379 upstream) : LOC440563 (18830 downstream)																							TTTACTGTAACAAAAAAAAAAG	0.515													11	5	---	---	---	---	
PCSK9	255738	broad.mit.edu	37	1	55512343	55512343	+	Intron	DEL	C	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55512343delC	uc001cyf.1	+						PCSK9_uc010ool.1_Intron|PCSK9_uc010oom.1_Intron	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9						cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CTGTGCCCTGCCCCACCCCAT	0.632													32	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118236238	118236241	+	IGR	DEL	CTTT	-	-	rs71736170	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118236238_118236241delCTTT								FAM46C (65228 upstream) : GDAP2 (169867 downstream)																							ttctttcttcctttctttctttct	0.000													4	2	---	---	---	---	
GON4L	54856	broad.mit.edu	37	1	155774575	155774575	+	Intron	DEL	A	-	-	rs77957644		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155774575delA	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_Intron|GON4L_uc009wrj.1_Intron|GON4L_uc001fme.2_Intron|GON4L_uc001fmf.2_Intron	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ctgtctcaggaaaaaaaaaaa	0.104													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184081601	184081601	+	IGR	DEL	G	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184081601delG								TSEN15 (38260 upstream) : C1orf21 (274549 downstream)																							gaaggaaggaggggaggggag	0.119													4	2	---	---	---	---	
ZBTB41	360023	broad.mit.edu	37	1	197141236	197141237	+	Intron	DEL	TA	-	-	rs10572836		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197141236_197141237delTA	uc001gtx.1	-						ZBTB41_uc009wyz.1_Intron	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						CTGATTACACTATATATATCTC	0.267													5	3	---	---	---	---	
NID1	4811	broad.mit.edu	37	1	236180700	236180701	+	Intron	INS	-	C	C	rs143774517	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236180700_236180701insC	uc001hxo.2	-						NID1_uc009xgd.2_Intron	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	tttttttttttccgagatggag	0.104													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	74362459	74362460	+	IGR	INS	-	AGC	AGC	rs147112980	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74362459_74362460insAGC								TET3 (27159 upstream) : BOLA3 (68 downstream)																							TCTCTCTCTGTAGCAGGACAGA	0.421													4	3	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152417311	152417312	+	Intron	INS	-	C	C	rs150437657	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152417311_152417312insC	uc010fnx.2	-						NEB_uc002txr.2_Intron	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCTCACACACTCCCTACTAACT	0.411													4	2	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170038236	170038260	+	Intron	DEL	AGACTGCATTCTGAATTCTTTTCTG	-	-	rs61106961		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170038236_170038260delAGACTGCATTCTGAATTCTTTTCTG	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TCTGTAGAGCAGACTGCATTCTGAATTCTTTTCTGCATTCAGAAA	0.378													6	3	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225664783	225664785	+	Intron	DEL	AAA	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225664783_225664785delAAA	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATAAATAATTAAAAAAAACCATG	0.281													5	4	---	---	---	---	
NT5DC2	64943	broad.mit.edu	37	3	52559180	52559181	+	Intron	DEL	GT	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52559180_52559181delGT	uc003deo.2	-						NT5DC2_uc003dem.2_Intron|NT5DC2_uc003den.2_Intron|NT5DC2_uc010hmi.2_Intron|NT5DC2_uc010hmj.2_Intron	NM_022908	NP_075059	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2 isoform 2								hydrolase activity|metal ion binding				0				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		GGGGGGGGGGGTTTCCTGGCCC	0.703													4	2	---	---	---	---	
SFMBT1	51460	broad.mit.edu	37	3	52940142	52940142	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52940142delA	uc003dgf.2	-	21	3016	c.2447delT	c.(2446-2448)ATAfs	p.I816fs	SFMBT1_uc010hmr.2_Intron|SFMBT1_uc003dgg.2_Frame_Shift_Del_p.I816fs|SFMBT1_uc003dgh.2_Frame_Shift_Del_p.I816fs	NM_001005159	NP_001005159	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	816	SAM.				regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		GTCTAGGAATATTCTTGCTAA	0.383													81	39	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	63256743	63256744	+	IGR	INS	-	T	T	rs148523759	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63256743_63256744insT								LOC285401 (146008 upstream) : SYNPR (7170 downstream)																							TACCTTCTCTCTTTTAAGTGTT	0.188													4	2	---	---	---	---	
C3orf1	51300	broad.mit.edu	37	3	119217940	119217940	+	Intron	DEL	T	-	-	rs34000460		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119217940delT	uc003ecn.2	+						C3orf1_uc003eco.2_Intron|C3orf1_uc003ecp.2_Intron	NM_016589	NP_057673	Q9NPL8	TIDC1_HUMAN	hypothetical protein LOC51300							integral to membrane|mitochondrial inner membrane	protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.186)		tttttctttcttttttttttt	0.184													4	3	---	---	---	---	
DBR1	51163	broad.mit.edu	37	3	137888782	137888783	+	Intron	INS	-	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137888782_137888783insA	uc003erv.2	-						DBR1_uc003eru.2_Intron	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1							nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						ctcaaaaaaagaaaaaaaaaaG	0.149													4	2	---	---	---	---	
HLTF	6596	broad.mit.edu	37	3	148782854	148782854	+	Intron	DEL	A	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148782854delA	uc003ewq.1	-						HLTF_uc003ewr.1_Intron|HLTF_uc003ews.1_Intron|HLTF_uc010hve.1_Intron	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor						chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GGGTTATCTCaaaaaaaaaaa	0.308													4	2	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	40920719	40920726	+	Intron	DEL	CTTCCTTC	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40920719_40920726delCTTCCTTC	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						tttcggacgacttccttccttccttcct	0.168													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53661576	53661576	+	IGR	DEL	C	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53661576delC								KIAA0114 (81271 upstream) : RASL11B (66919 downstream)																							gagtcatgatcatgccactgc	0.000													4	2	---	---	---	---	
FAM13A	10144	broad.mit.edu	37	4	89834380	89834382	+	Intron	DEL	GAA	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89834380_89834382delGAA	uc003hse.1	-						FAM13A_uc003hsf.1_Intron|FAM13A_uc003hsh.1_Intron	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						agaggaagaggaagaagaggagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	99772033	99772040	+	IGR	DEL	AGGAAGGA	-	-	rs11946627	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99772033_99772040delAGGAAGGA								TSPAN5 (192306 upstream) : EIF4E (27567 downstream)																							ggaggaaggcaggaaggaaggaaggaag	0.000													6	4	---	---	---	---	
TBCK	93627	broad.mit.edu	37	4	107092559	107092560	+	Intron	INS	-	A	A	rs142249370	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107092559_107092560insA	uc010ilv.2	-						TBCK_uc003hyb.2_Intron|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						AAAATGTCAGTAAAAAAAACAA	0.233													4	2	---	---	---	---	
TIFA	92610	broad.mit.edu	37	4	113198880	113198885	+	3'UTR	DEL	AATGAT	-	-	rs3080382		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113198880_113198885delAATGAT	uc003ial.2	-	2						NM_052864	NP_443096	Q96CG3	TIFA_HUMAN	TRAF-interacting protein with a								protein binding			breast(1)	1		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00172)		CAGACTTCAAAATGATAATACTGAAT	0.306													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1192188	1192189	+	IGR	INS	-	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1192188_1192189insA								SLC12A7 (80016 upstream) : SLC6A19 (9521 downstream)																							ggctgaggagtgggggagaTGT	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29719988	29719997	+	IGR	DEL	ACACACACAC	-	-	rs71903962		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29719988_29719997delACACACACAC								None (None upstream) : None (None downstream)																							aaatatgccaacacacacacacacacacac	0.057													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475765	90475772	+	IGR	DEL	GAAGGAAG	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475765_90475772delGAAGGAAG								GPR98 (15733 upstream) : ARRDC3 (188769 downstream)																							aaggaaggaagaaggaaggaaggaagga	0.029													8	4	---	---	---	---	
FER	2241	broad.mit.edu	37	5	108133721	108133721	+	Intron	DEL	T	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108133721delT	uc003kop.1	+						FER_uc011cve.1_Intron|FER_uc011cvf.1_Intron|FER_uc003koq.2_Intron|FER_uc011cvg.1_Intron	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		ttcagtTGTGTTTTTTTTTTT	0.114													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144588487	144588490	+	IGR	DEL	AGAA	-	-	rs144645373		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144588487_144588490delAGAA								KCTD16 (731543 upstream) : PRELID2 (550092 downstream)																							agagagaaagagaaagaaagaagg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174357183	174357184	+	IGR	INS	-	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174357183_174357184insT								MSX2 (199282 upstream) : DRD1 (510492 downstream)																							ttccttccttcttttttttgat	0.000													11	6	---	---	---	---	
UIMC1	51720	broad.mit.edu	37	5	176332256	176332256	+	3'UTR	DEL	T	-	-	rs12422	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176332256delT	uc011dfp.1	-	15					UIMC1_uc003mfc.1_3'UTR|UIMC1_uc003mfd.1_3'UTR	NM_016290	NP_057374	Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1						double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding			ovary(3)|skin(1)	4	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTACTAATGGTTTTGTCAACT	0.468													70	53	---	---	---	---	
SLC2A12	154091	broad.mit.edu	37	6	134373388	134373389	+	Intron	INS	-	ACACACAC	ACACACAC	rs150064447		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134373388_134373389insACACACAC	uc003qem.1	-							NM_145176	NP_660159	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity			ovary(1)	1	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		CGCGCGCGcatacacacacaca	0.455													7	4	---	---	---	---	
CACNA2D1	781	broad.mit.edu	37	7	81603967	81603967	+	Intron	DEL	A	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81603967delA	uc003uhr.1	-							NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	tattagccacaagactttgca	0.095													6	3	---	---	---	---	
ASAH1	427	broad.mit.edu	37	8	17920980	17920980	+	Intron	DEL	T	-	-	rs71894904		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17920980delT	uc003wyl.2	-						ASAH1_uc010ltb.1_Intron|ASAH1_uc003wym.2_Intron|ASAH1_uc003wyn.2_Intron|ASAH1_uc003wyo.2_Intron	NM_177924	NP_808592	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		acctggctacttttttttttt	0.000													6	3	---	---	---	---	
C8orf86	389649	broad.mit.edu	37	8	38370213	38370224	+	Intron	DEL	ACACAGACAGAC	-	-	rs60641749		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38370213_38370224delACACAGACAGAC	uc003xlx.1	-							NM_207412	NP_997295	Q6ZUL3	CH086_HUMAN	hypothetical protein LOC389649												0						acacagacagacacagacagacacaCACACAC	0.255													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	42538759	42538760	+	IGR	INS	-	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42538759_42538760insA								C8orf40 (130620 upstream) : CHRNB3 (13802 downstream)																							gaaactccatcaaaaaaaaaaa	0.000													3	4	---	---	---	---	
STK3	6788	broad.mit.edu	37	8	99591839	99591842	+	Intron	DEL	ACAG	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99591839_99591842delACAG	uc003yip.2	-						STK3_uc003yio.2_Intron|STK3_uc010mbm.1_Intron	NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3						apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		TAACAGAATTACAGACAAATAACT	0.270													63	34	---	---	---	---	
EXT1	2131	broad.mit.edu	37	8	119108837	119108859	+	Intron	DEL	AGGAAGGAAGGAAGGAAGGAAGG	-	-	rs11276027		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119108837_119108859delAGGAAGGAAGGAAGGAAGGAAGG	uc003yok.1	-							NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			ccgtcaagaaaggaaggaaggaaggaaggaaggaggaaggaag	0.000			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94384662	94384663	+	Intron	INS	-	AGGA	AGGA			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94384662_94384663insAGGA	uc004ari.1	-							NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						gaaagaaaaagaggaaggaagg	0.050													8	5	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32329555	32329560	+	Intron	DEL	ACACAC	-	-	rs145271745		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32329555_32329560delACACAC	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				ACACCCTAAAacacacacacacacac	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42390479	42390479	+	IGR	DEL	G	-	-	rs72505278		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42390479delG								None (None upstream) : LOC441666 (436836 downstream)																							AAcatcgaatggaatcgaatg	0.040													6	4	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73405973	73405974	+	Intron	INS	-	A	A	rs143606744	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73405973_73405974insA	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jry.2_Intron|CDH23_uc001jrz.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CTCCCATCAGGAGCCTCTGCAA	0.564													3	3	---	---	---	---	
PCGF6	84108	broad.mit.edu	37	10	105063897	105063898	+	Intron	INS	-	T	T	rs113891054		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105063897_105063898insT	uc001kwt.2	-						PCGF6_uc001kwu.2_Intron|PCGF6_uc009xxk.2_Intron|PCGF6_uc009xxl.2_Intron|PCGF6_uc009xxm.2_Intron	NM_001011663	NP_001011663	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6 isoform a						negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		TGTGAATGTGCttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119607595	119607595	+	IGR	DEL	G	-	-	rs72080307		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119607595delG								EMX2 (298539 upstream) : RAB11FIP2 (156834 downstream)																							aagaaaggaagggaaggaagg	0.005													4	3	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14252331	14252334	+	Intron	DEL	TTCA	-	-	rs62745561		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14252331_14252334delTTCA	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		ccttccttccttcattttttcGTG	0.142													5	3	---	---	---	---	
SLC6A5	9152	broad.mit.edu	37	11	20676092	20676102	+	Intron	DEL	TTAATGAACGC	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20676092_20676102delTTAATGAACGC	uc001mqd.2	+						SLC6A5_uc009yic.2_Intron	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter						synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	GCCTAGTTAATTAATGAACGCTTATCTTCCT	0.441													11	6	---	---	---	---	
FOSL1	8061	broad.mit.edu	37	11	65661449	65661450	+	Intron	INS	-	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65661449_65661450insC	uc001ogg.1	-						FOSL1_uc010ros.1_Intron	NM_005438	NP_005429	P15407	FOSL1_HUMAN	FOS-like antigen 1						cellular defense response|chemotaxis|positive regulation of cell proliferation|response to virus|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				READ - Rectum adenocarcinoma(159;0.168)		GGAGACAGGGTCCCTCTGAGCT	0.619													4	2	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67829387	67829387	+	Intron	DEL	A	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67829387delA	uc001onj.2	-						CHKA_uc001onk.2_Intron|uc001onl.1_5'Flank	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	GAGTAGGAAGAAAAAAAAAAA	0.403													5	3	---	---	---	---	
EED	8726	broad.mit.edu	37	11	85975481	85975482	+	Intron	INS	-	TATT	TATT	rs138959322	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85975481_85975482insTATT	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron|EED_uc010rtn.1_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AGTAAAGACtatatttatttat	0.312													4	2	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89868965	89868965	+	Intron	DEL	T	-	-	rs34639551		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89868965delT	uc001pdf.3	+						NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pdd.2_Intron|NAALAD2_uc001pde.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AGTCATCAACTTTTTTTTTTT	0.308													4	2	---	---	---	---	
GRIA4	2893	broad.mit.edu	37	11	105505081	105505081	+	Intron	DEL	A	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105505081delA	uc001pix.2	+						GRIA4_uc001piu.1_Intron|GRIA4_uc001piw.2_Intron|GRIA4_uc001piv.2_Intron|GRIA4_uc009yxk.1_Intron	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	ctccgtctccaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127462186	127462187	+	IGR	INS	-	AGG	AGG	rs146290646	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127462186_127462187insAGG								KIRREL3 (588831 upstream) : ETS1 (866469 downstream)																							ggaaggaagaaagggagggaag	0.050													4	2	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178450	134178451	+	Intron	INS	-	CAC	CAC	rs140914654	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178450_134178451insCAC	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		accatcaccatcaccaccacca	0.000													4	2	---	---	---	---	
CACNA2D4	93589	broad.mit.edu	37	12	2016939	2016951	+	Intron	DEL	GCCTGGTGAGTAT	-	-	rs113797488		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2016939_2016951delGCCTGGTGAGTAT	uc001qjp.2	-						CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		TGGTGGGCCAGCCTGGTGAGTATGCCTGGTGGG	0.662													6	3	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	12150541	12150542	+	Intron	INS	-	GT	GT	rs142261610	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12150541_12150542insGT	uc001raa.1	+							NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				TGATATCCATCgtgtgtgtgtg	0.312			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								3	4	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48253630	48253649	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCT	-	-	rs60761635		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48253630_48253649delTTCCTTCCTTCCTTCCTTCT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	tttcccttccttccttccttccttccttctttccttcctt	0.036													6	3	---	---	---	---	
RHEBL1	121268	broad.mit.edu	37	12	49463350	49463351	+	Intron	INS	-	ACCTTTATTCCTCC	ACCTTTATTCCTCC	rs143672976	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49463350_49463351insACCTTTATTCCTCC	uc001rtc.1	-						RHEBL1_uc001rtd.1_Intron|RHEBL1_uc009zlc.1_Intron	NM_144593	NP_653194	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1 precursor						positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding			lung(1)|breast(1)	2						ACACACCACCAACTCTTCCAAT	0.554													2	4	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100774908	100774915	+	Intron	DEL	CATCTCAG	-	-	rs68046331		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774908_100774915delCATCTCAG	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TAGCTCCTCCcatctcagcatctcagca	0.221													4	2	---	---	---	---	
C1QTNF9	338872	broad.mit.edu	37	13	24889990	24889990	+	Intron	DEL	T	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24889990delT	uc001upj.2	+						C1QTNF9_uc001upe.2_Intron	NM_178540	NP_848635	P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9							collagen	hormone activity				0		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GAGCCTTCTGTCCAAGTTTGT	0.537													5	4	---	---	---	---	
FLT3	2322	broad.mit.edu	37	13	28642186	28642187	+	Intron	INS	-	TGTTTTGTTT	TGTTTTGTTT	rs150868508	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28642186_28642187insTGTTTTGTTT	uc001urw.2	-						FLT3_uc010aao.2_Intron|FLT3_uc010tdn.1_Intron	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	tgtttttattatgttttgtttt	0.332			Mis|O		AML|ALL								3	3	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	48939204	48939205	+	Intron	INS	-	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48939204_48939205insT	uc001vcb.2	+						RB1_uc010act.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TGTGTATCACATTTTTTTTTTG	0.287		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57659594	57659597	+	IGR	DEL	ACAC	-	-	rs71450324		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57659594_57659597delACAC								OTX2 (382410 upstream) : EXOC5 (9599 downstream)																							TGGGGGCTCTacacacacacacac	0.368													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	71328817	71328818	+	IGR	INS	-	AGGGAGGA	AGGGAGGA			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71328817_71328818insAGGGAGGA								MAP3K9 (52929 upstream) : PCNX (45304 downstream)																							gggagaaagggagggaggaagg	0.035													4	2	---	---	---	---	
TRIP11	9321	broad.mit.edu	37	14	92439370	92439370	+	Intron	DEL	T	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92439370delT	uc001xzy.2	-						TRIP11_uc010auf.1_Intron	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11						transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		ATACTGGCACttttttttttt	0.119			T	PDGFRB	AML								4	2	---	---	---	---	
WDR25	79446	broad.mit.edu	37	14	100947441	100947448	+	Intron	DEL	AAAAAAAA	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100947441_100947448delAAAAAAAA	uc010avx.2	+						WDR25_uc001yhm.2_Intron|WDR25_uc001yhn.2_Intron|WDR25_uc010avy.2_Intron|WDR25_uc001yho.2_Intron	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25												0		Melanoma(154;0.212)				AAAAAAGTGCaaaaaaaaaaaaaaaaaa	0.389													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22118395	22118396	+	IGR	DEL	AC	-	-	rs139043886		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22118395_22118396delAC								CXADRP2 (101517 upstream) : LOC727924 (159636 downstream)																							ATAAATTATAACATTCTTTTTG	0.342													9	4	---	---	---	---	
FMN1	342184	broad.mit.edu	37	15	33218589	33218590	+	Intron	INS	-	TCT	TCT	rs145798000	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33218589_33218590insTCT	uc001zhf.3	-							NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GCTGCATGCACTCTTTAAATAA	0.327													3	3	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40921694	40921706	+	Intron	DEL	TTTTTTTTTTTTT	-	-	rs71104709		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40921694_40921706delTTTTTTTTTTTTT	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ttgccttttcttttttttttttttttttttttt	0.103													5	3	---	---	---	---	
BLM	641	broad.mit.edu	37	15	91303187	91303187	+	Intron	DEL	T	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91303187delT	uc002bpr.2	+						BLM_uc010uqh.1_Intron|BLM_uc010uqi.1_Intron|BLM_uc010bnx.2_Intron|BLM_uc002bps.1_5'Flank	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein						double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ATCTTAAGACttttttttttt	0.040			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				5	3	---	---	---	---	
ABCA17P	650655	broad.mit.edu	37	16	2475097	2475098	+	Intron	DEL	TC	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2475097_2475098delTC	uc002cqc.1	+							NR_003574				Homo sapiens cDNA FLJ37881 fis, clone BRSTN2000367.												0						GGTAActctgtctctctctctc	0.465													5	4	---	---	---	---	
CCNF	899	broad.mit.edu	37	16	2495730	2495731	+	Intron	INS	-	TT	TT	rs28663296		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2495730_2495731insTT	uc002cqd.1	+						CCNF_uc002cqe.1_Intron	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F						cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				gttttgtgttgttttttttttt	0.277													8	4	---	---	---	---	
MBTPS1	8720	broad.mit.edu	37	16	84094451	84094451	+	Intron	DEL	T	-	-	rs71920773		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84094451delT	uc002fhi.2	-						MBTPS1_uc002fhh.2_Intron	NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1						cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						TAGGAAttccttttttttttt	0.254													5	3	---	---	---	---	
KIAA0182	23199	broad.mit.edu	37	16	85701572	85701573	+	Intron	INS	-	CGCTGGGTC	CGCTGGGTC	rs11268657		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85701572_85701573insCGCTGGGTC	uc002fix.2	+						KIAA0182_uc002fiw.2_Intron|KIAA0182_uc002fiy.2_Intron|KIAA0182_uc002fiz.2_Intron|KIAA0182_uc010cho.2_Intron	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1								protein binding			large_intestine(3)|ovary(1)|skin(1)	5						GGACTTTCTCAAGTGGCCCAGA	0.545													9	9	---	---	---	---	
RPAIN	84268	broad.mit.edu	37	17	5331251	5331251	+	Intron	DEL	G	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5331251delG	uc002gbq.2	+						RPAIN_uc010vsz.1_Intron|RPAIN_uc002gbp.1_Intron|RPAIN_uc010vta.1_Intron|RPAIN_uc010vtb.1_Intron|RPAIN_uc002gbs.2_Intron|RPAIN_uc002gbt.2_Intron|RPAIN_uc002gbu.2_Intron|RPAIN_uc002gbv.2_Intron|RPAIN_uc002gbr.2_Intron|RPAIN_uc002gbw.2_Intron|RPAIN_uc002gbx.1_5'Flank	NM_001033002	NP_001028174	Q86UA6	RIP_HUMAN	RPA interacting protein isoform b						DNA recombination|DNA repair|DNA-dependent DNA replication|protein import into nucleus|response to UV	cytoplasm|cytoplasm|nucleolus|PML body|PML body	metal ion binding|protein complex binding				0						GTACAGTCATGGGCCCGAGTG	0.274													38	18	---	---	---	---	
CCDC47	57003	broad.mit.edu	37	17	61841925	61841925	+	Intron	DEL	T	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61841925delT	uc002jbs.3	-						CCDC47_uc010ddx.2_Intron|CCDC47_uc002jbt.2_Intron	NM_020198	NP_064583	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47 precursor							integral to membrane	protein binding				0						TAGGTGTTGATTTTTTTTTTT	0.353													4	4	---	---	---	---	
BPTF	2186	broad.mit.edu	37	17	65882542	65882543	+	Intron	INS	-	T	T	rs150196546	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65882542_65882543insT	uc002jgf.2	+						BPTF_uc002jge.2_Intron|BPTF_uc010wqm.1_Intron	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			tTAGTTTTTAATTTTTTAAATG	0.252													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11610673	11610674	+	IGR	INS	-	C	C			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11610673_11610674insC								FAM38B (908694 upstream) : GNAL (78462 downstream)																							AAGACTGAAGACaaaaaaaaaa	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393845	77393850	+	IGR	DEL	ATGGCA	-	-	rs140454970	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393845_77393850delATGGCA								NFATC1 (104523 upstream) : CTDP1 (45951 downstream)																							ggtggtgatgatggcagtggtggtgg	0.000													4	2	---	---	---	---	
DIRAS1	148252	broad.mit.edu	37	19	2717063	2717064	+	3'UTR	INS	-	A	A			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2717063_2717064insA	uc002lwf.3	-	2						NM_145173	NP_660156	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1						small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGGCAGCGGAGGGGGGGGCG	0.668													3	5	---	---	---	---	
ACSBG2	81616	broad.mit.edu	37	19	6190824	6190833	+	Intron	DEL	ACACACACAC	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6190824_6190833delACACACACAC	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron|uc002mej.1_RNA	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						acacatacatacacacacacacacacacac	0.352													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8022273	8022274	+	IGR	INS	-	GAAGGAAGGAAG	GAAGGAAGGAAG	rs8111003	by1000genomes	TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8022273_8022274insGAAGGAAGGAAG								TIMM44 (13735 upstream) : ELAVL1 (1184 downstream)																							aaagaaagaaagaaggaaggaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	10055883	10055895	+	IGR	DEL	GGGAGGGAGGGAG	-	-	rs111802762		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10055883_10055895delGGGAGGGAGGGAG								OLFM2 (8813 upstream) : COL5A3 (14342 downstream)																							aaggaaggaagggagggagggagggaaggaagg	0.146													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107412	42107413	+	IGR	INS	-	GT	GT			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107412_42107413insGT								CEACAM21 (14216 upstream) : CEACAM4 (17931 downstream)																							AGGacacgcacgcacgcgcgcg	0.183													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47075921	47075924	+	Intron	DEL	AGAA	-	-	rs67738072		TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47075921_47075924delAGAA	uc002pev.1	-											SubName: Full=cDNA FLJ37185 fis, clone BRALZ2001743, moderately similar to Serine/threonine-protein phosphatase 5;          EC=3.1.3.16;																		aggaagaaagagaaagaaagaaag	0.000													4	3	---	---	---	---	
SERINC3	10955	broad.mit.edu	37	20	43130103	43130104	+	Intron	INS	-	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43130103_43130104insT	uc002xme.2	-						SERINC3_uc002xmf.1_Intron|SERINC3_uc010ggs.1_Intron|SERINC3_uc010zwp.1_Intron	NM_198941	NP_945179	Q13530	SERC3_HUMAN	tumor differentially expressed protein 1							integral to membrane|plasma membrane	protein binding			skin(3)	3		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			GCCTGTCATCATAAGACTGACG	0.347													7	6	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37649139	37649141	+	Intron	DEL	AAA	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37649139_37649141delAAA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						actccatctcaaaaaaaaaaaaa	0.172													3	3	---	---	---	---	
NR0B1	190	broad.mit.edu	37	X	30328902	30328903	+	5'Flank	INS	-	T	T			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30328902_30328903insT	uc004dcf.3	-							NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1						adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	tccttccttccttccttccttc	0.144													4	2	---	---	---	---	
GAGE10	643832	broad.mit.edu	37	X	49158062	49158062	+	5'Flank	DEL	T	-	-			TCGA-BP-5004-01A-01D-1462-08	TCGA-BP-5004-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49158062delT	uc010nir.1	+							NM_001098413	NP_001091883	A6NGK3	GAG10_HUMAN	G antigen 10												0	Ovarian(276;0.236)					acatcattccttttttttttt	0.000													4	2	---	---	---	---	
