Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AIM1L	55057	broad.mit.edu	37	1	26663759	26663759	+	Silent	SNP	G	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26663759G>A	uc001bmd.3	-	9	1051	c.621C>T	c.(619-621)CTC>CTT	p.L207L	AIM1L_uc001bmf.3_Silent_p.L98L	NM_001039775	NP_001034864	Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	207	Beta/gamma crystallin 'Greek key' 4.						sugar binding			pancreas(1)	1		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		GGATGACCCGGAGGGAGGTCA	0.592													31	102	---	---	---	---	PASS
CAP1	10487	broad.mit.edu	37	1	40537261	40537261	+	3'UTR	SNP	C	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40537261C>A	uc001cfa.3	+	13					CAP1_uc001cey.3_3'UTR|CAP1_uc001cez.3_3'UTR|CAP1_uc009vvz.2_3'UTR|CAP1_uc010oje.1_3'UTR	NM_006367	NP_006358	Q01518	CAP1_HUMAN	adenylyl cyclase-associated protein						activation of adenylate cyclase activity|axon guidance|establishment or maintenance of cell polarity|platelet activation|platelet degranulation|signal transduction	plasma membrane	actin binding			ovary(1)	1	Lung NSC(20;5.03e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;4.63e-18)|Epithelial(16;1.27e-16)|all cancers(16;2.3e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAATCTGTATCAAGACGGTTC	0.458													7	14	---	---	---	---	PASS
RWDD3	25950	broad.mit.edu	37	1	95710200	95710200	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95710200G>T	uc009wdu.2	+	2	595	c.519G>T	c.(517-519)ATG>ATT	p.M173I	RWDD3_uc001drd.3_3'UTR|RWDD3_uc010oty.1_Missense_Mutation_p.M158I|RWDD3_uc009wdt.2_Missense_Mutation_p.M173I|RWDD3_uc001drf.3_Missense_Mutation_p.M173I|RWDD3_uc001drh.3_Missense_Mutation_p.M158I|RWDD3_uc009wdv.2_RNA|RWDD3_uc001drg.3_RNA|RWDD3_uc001dri.3_Missense_Mutation_p.M173I	NM_015485	NP_056300	Q9Y3V2	RWDD3_HUMAN	RWD domain containing 3 isoform a	173						cytoplasm|nucleus	protein binding			ovary(1)	1		all_epithelial(167;5.99e-05)|all_lung(203;0.00168)|Lung NSC(277;0.00769)		all cancers(265;0.112)|Epithelial(280;0.229)		GAAGACTGATGTTCATGGGTA	0.368													9	141	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144930951	144930951	+	Intron	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144930951G>T	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Missense_Mutation_p.P253H|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTGTTGTGGAGGGCTAGCCTG	0.507			T	PDGFRB	MPD								21	208	---	---	---	---	PASS
C1orf198	84886	broad.mit.edu	37	1	230979640	230979640	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230979640A>T	uc001hub.2	-	3	431	c.387T>A	c.(385-387)AGT>AGA	p.S129R	C1orf198_uc009xfh.1_5'UTR|C1orf198_uc001huc.1_Intron|C1orf198_uc001hud.1_Missense_Mutation_p.S91R	NM_032800	NP_116189	Q9H425	CA198_HUMAN	hypothetical protein LOC84886 isoform 1	129											0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				ACTCCATCTGACTCTAGGGTG	0.572													34	178	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11361380	11361380	+	Silent	SNP	T	C	C			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11361380T>C	uc002rbd.1	-	9	1652	c.1203A>G	c.(1201-1203)AAA>AAG	p.K401K		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein	401	Interaction with NPM1.|AGC-kinase C-terminal.|Interaction with PPP1R12A.				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CAACAAAAGCTTTAGGAATTG	0.358													49	170	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43924441	43924441	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43924441A>C	uc010yny.1	+	7	717	c.634A>C	c.(634-636)ATG>CTG	p.M212L	PLEKHH2_uc002rte.3_Missense_Mutation_p.M212L|PLEKHH2_uc002rtf.3_Missense_Mutation_p.M211L	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	212						cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ATCTGAGGAAATGAGCAAGAT	0.408													21	101	---	---	---	---	PASS
DBI	1622	broad.mit.edu	37	2	120129819	120129819	+	Splice_Site	SNP	A	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120129819A>T	uc002tlv.2	+	4	315	c.191_splice	c.e4-2	p.G64_splice	DBI_uc010yyh.1_Splice_Site_p.G81_splice|DBI_uc010yyi.1_Splice_Site_p.G81_splice|DBI_uc010yyj.1_Splice_Site|DBI_uc010yyk.1_Splice_Site_p.G106_splice|DBI_uc010yyl.1_Splice_Site_p.G81_splice|DBI_uc010yym.1_Splice_Site_p.G74_splice|DBI_uc010yyn.1_Splice_Site_p.G81_splice|DBI_uc002tlw.2_Splice_Site_p.G81_splice|DBI_uc010yyo.1_Splice_Site|DBI_uc002tlx.2_Splice_Site_p.G65_splice	NM_001079862	NP_001073331	P07108	ACBP_HUMAN	diazepam binding inhibitor isoform 3						transport		benzodiazepine receptor binding|fatty-acyl-CoA binding				0						GATTCCTTACAGGGACTTCCA	0.473													27	120	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196837108	196837108	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196837108A>C	uc002utj.3	-	16	2017	c.1916T>G	c.(1915-1917)CTC>CGC	p.L639R		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	639	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ATACTCGATGAGGAAGGCGAG	0.393													37	165	---	---	---	---	PASS
KLHL24	54800	broad.mit.edu	37	3	183389006	183389006	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183389006A>T	uc003flv.2	+	6	1704	c.1409A>T	c.(1408-1410)GAT>GTT	p.D470V	KLHL24_uc003flw.2_Missense_Mutation_p.D470V|KLHL24_uc003flx.2_Missense_Mutation_p.D470V	NM_017644	NP_060114	Q6TFL4	KLH24_HUMAN	DRE1 protein	470	Kelch 4.					axon|cytoplasm|perikaryon				ovary(1)	1	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			ACTTGTTCTGATAAGGTAAGC	0.423													8	119	---	---	---	---	PASS
RASSF6	166824	broad.mit.edu	37	4	74459276	74459276	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74459276A>C	uc003hhd.1	-	4	398	c.275T>G	c.(274-276)CTG>CGG	p.L92R	RASSF6_uc003hhc.1_Missense_Mutation_p.L60R|RASSF6_uc010iik.1_Missense_Mutation_p.L60R|RASSF6_uc010iil.1_Missense_Mutation_p.L48R	NM_201431	NP_958834	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family 6	92					apoptosis|signal transduction		protein binding			pancreas(2)	2	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			GAAAATGTCCAGCATTCCTTC	0.353													27	155	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126389800	126389800	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126389800G>C	uc003ifj.3	+	11	12033	c.12033G>C	c.(12031-12033)TTG>TTC	p.L4011F	FAT4_uc011cgp.1_Missense_Mutation_p.L2274F|FAT4_uc003ifi.1_Missense_Mutation_p.L1489F	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4011	Laminin G-like 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						ATGCCTTATTGCTTTACAACT	0.388													28	97	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126389801	126389801	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126389801C>A	uc003ifj.3	+	11	12034	c.12034C>A	c.(12034-12036)CTT>ATT	p.L4012I	FAT4_uc011cgp.1_Missense_Mutation_p.L2275I|FAT4_uc003ifi.1_Missense_Mutation_p.L1490I	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4012	Laminin G-like 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TGCCTTATTGCTTTACAACTA	0.393													29	98	---	---	---	---	PASS
FBXO38	81545	broad.mit.edu	37	5	147781573	147781573	+	Silent	SNP	A	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147781573A>G	uc003lpf.1	+	4	411	c.291A>G	c.(289-291)CTA>CTG	p.L97L	FBXO38_uc003lpg.1_Silent_p.L97L|FBXO38_uc003lph.2_Silent_p.L97L	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	97	Interaction with KLF7 (By similarity).					cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTAACACTATTAAAGAAGA	0.428													37	185	---	---	---	---	PASS
ADAMTS2	9509	broad.mit.edu	37	5	178579193	178579193	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178579193T>G	uc003mjw.2	-	10	1579	c.1579A>C	c.(1579-1581)AAG>CAG	p.K527Q	ADAMTS2_uc011dgm.1_Missense_Mutation_p.K527Q	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	527	Disintegrin.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TTCTTGGTCTTGCAAAAGTAG	0.597													9	68	---	---	---	---	PASS
SCAND3	114821	broad.mit.edu	37	6	28542935	28542935	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28542935T>A	uc003nlo.2	-	3	2165	c.1547A>T	c.(1546-1548)CAG>CTG	p.Q516L		NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3	516	Integrase catalytic.				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ACATGGAGTCTGTTGCATGCT	0.418													16	198	---	---	---	---	PASS
PLEKHG1	57480	broad.mit.edu	37	6	151153138	151153138	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151153138T>C	uc003qny.1	+	16	3203	c.2891T>C	c.(2890-2892)CTG>CCG	p.L964P	PLEKHG1_uc011eel.1_Missense_Mutation_p.L1004P|PLEKHG1_uc011eem.1_Missense_Mutation_p.L1023P|PLEKHG1_uc003qnz.2_Missense_Mutation_p.L964P	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G	964					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		AACCCTGACCTGGGGATGGAG	0.483													61	235	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152488950	152488950	+	Intron	SNP	C	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152488950C>A	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTGTCTCAGCCTCTCTACTCT	0.428										HNSCC(10;0.0054)			12	56	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43400541	43400541	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43400541A>T	uc003tid.1	+	6	1122	c.517A>T	c.(517-519)ACC>TCC	p.T173S	HECW1_uc011kbi.1_Missense_Mutation_p.T173S|HECW1_uc003tie.1_Missense_Mutation_p.T205S	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	173					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CCTGCGAGCAACCACCCCCAG	0.458													21	107	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	65222986	65222986	+	Intron	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65222986G>T	uc003tud.1	-						CCT6P1_uc003tug.2_RNA|CCT6P1_uc003tuh.2_RNA|CCT6P1_uc003tui.2_RNA|uc003tuk.1_5'Flank					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		GAATTCTGGCGTTTTTTACAA	0.289													3	34	---	---	---	---	PASS
ZNF862	643641	broad.mit.edu	37	7	149544912	149544912	+	Silent	SNP	C	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149544912C>A	uc010lpn.2	+	4	522	c.330C>A	c.(328-330)GCC>GCA	p.A110A	ZNF862_uc003wgm.2_RNA	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862	110					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1						AGAAGAAAGCCTACCTTTCCC	0.542													4	22	---	---	---	---	PASS
RPL30	6156	broad.mit.edu	37	8	99054939	99054939	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99054939T>C	uc003yif.2	-	4	302	c.232A>G	c.(232-234)AAT>GAT	p.N78D	RPL30_uc010mbk.1_Intron|SNORA72_uc003yig.1_5'Flank	NM_000989	NP_000980	P62888	RL30_HUMAN	ribosomal protein L30	78					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			AGTTCAATATTATTGCCACTG	0.368													34	104	---	---	---	---	PASS
TYRP1	7306	broad.mit.edu	37	9	12693912	12693912	+	5'UTR	SNP	C	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12693912C>T	uc003zkv.3	+	2						NM_000550	NP_000541	P17643	TYRP1_HUMAN	tyrosinase-related protein 1 precursor						melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity			lung(1)	1		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		TCTTTTTCAGCTGGATTTTCC	0.388									Oculocutaneous_Albinism				10	104	---	---	---	---	PASS
IFNA5	3442	broad.mit.edu	37	9	21304871	21304871	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21304871C>G	uc011lnh.1	-	1	385	c.385G>C	c.(385-387)GTG>CTG	p.V129L		NM_002169	NP_002160	P01569	IFNA5_HUMAN	interferon, alpha 5 precursor	129					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding			ovary(1)	1				Lung(24;2.34e-24)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GTGTCTTCCACTCCAACCTCC	0.443													48	217	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84531485	84531485	+	3'UTR	SNP	A	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84531485A>T	uc011lst.1	+	4						NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						CAGCCCCCATATTCTAAGTGT	0.463													7	18	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107564349	107564349	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107564349G>T	uc004bcl.2	-	34	4997	c.4684C>A	c.(4684-4686)CTA>ATA	p.L1562I		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1562	Extracellular.				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	GCCAGCTTTAGGTGTTTCTTC	0.423													23	90	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	30986357	30986357	+	5'UTR	SNP	T	C	C	rs117915096	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30986357T>C	uc010qdx.1	+	3										SubName: Full=cDNA FLJ59642, highly similar to Supervillin;																		CGGCGCTCAATAGTGGGGACT	0.552													2	19	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832499	42832499	+	RNA	SNP	C	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832499C>G	uc010qey.1	-	3		c.1476G>C				NR_024380				Homo sapiens noncoding mRNA sequence.												0						TCTCCCCTATCAATTATGTTT	0.363													2	16	---	---	---	---	PASS
LOC642826	642826	broad.mit.edu	37	10	47207828	47207828	+	RNA	SNP	C	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47207828C>A	uc001jei.2	-	12		c.1571G>T			uc009xnf.2_Missense_Mutation_p.S127I					Homo sapiens cDNA, FLJ99065.												0						TGTACAGTTGCTTCTTCTTAT	0.264													3	47	---	---	---	---	PASS
SLC29A3	55315	broad.mit.edu	37	10	73111405	73111405	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73111405C>G	uc001jrr.3	+	4	527	c.470C>G	c.(469-471)ACT>AGT	p.T157S	SLC29A3_uc001jrs.3_Missense_Mutation_p.T157S|SLC29A3_uc010qjq.1_Missense_Mutation_p.T11S|SLC29A3_uc001jrt.3_Intron|SLC29A3_uc001jru.3_Intron	NM_018344	NP_060814	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (nucleoside	157	Extracellular (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|late endosome membrane|lysosomal membrane	nucleoside transmembrane transporter activity				0						AAGGTGGACACTTCCTCCTGG	0.577													21	83	---	---	---	---	PASS
MYST4	23522	broad.mit.edu	37	10	76789332	76789332	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76789332A>T	uc001jwn.1	+	18	5243	c.4750A>T	c.(4750-4752)ATT>TTT	p.I1584F	MYST4_uc001jwo.1_Missense_Mutation_p.I1292F|MYST4_uc001jwp.1_Missense_Mutation_p.I1401F	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	1584	Interaction with RUNX1 and RUNX2.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					AAGTCCACAGATTGCCACCAC	0.567			T	CREBBP	AML								5	88	---	---	---	---	PASS
BTAF1	9044	broad.mit.edu	37	10	93695500	93695500	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93695500A>T	uc001khr.2	+	2	199	c.101A>T	c.(100-102)AAG>ATG	p.K34M	BTAF1_uc009xua.1_RNA	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	34					negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				GAAGTGGTGAAGCTTCATCCC	0.358													27	102	---	---	---	---	PASS
LOXL4	84171	broad.mit.edu	37	10	100015482	100015482	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100015482C>G	uc001kpa.1	-	10	1594	c.1443G>C	c.(1441-1443)TGG>TGC	p.W481C		NM_032211	NP_115587	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4 precursor	481	SRCR 4.					extracellular space|membrane	copper ion binding|protein binding|scavenger receptor activity			ovary(3)|breast(1)|skin(1)	5		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GCGTCCCCGACCAGAACCAGG	0.488													15	65	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21353532	21353532	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21353532G>A	uc001req.3	+	9	1165	c.1061G>A	c.(1060-1062)GGT>GAT	p.G354D		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	354	Extracellular (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	AGCTATATTGGTGCTTTTACT	0.348													25	104	---	---	---	---	PASS
C12orf10	60314	broad.mit.edu	37	12	53700821	53700821	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53700821G>A	uc001scp.3	+	7	1071	c.1019G>A	c.(1018-1020)TGC>TAC	p.C340Y	C12orf10_uc009zmx.2_Missense_Mutation_p.C289Y|C12orf10_uc001scq.3_Missense_Mutation_p.C225Y	NM_021640	NP_067653	Q86UA3	Q86UA3_HUMAN	MYG1 protein precursor	340										ovary(2)	2						ATCCCTGGCTGCATCTTCGTC	0.662													25	160	---	---	---	---	PASS
C12orf10	60314	broad.mit.edu	37	12	53700822	53700822	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53700822C>A	uc001scp.3	+	7	1072	c.1020C>A	c.(1018-1020)TGC>TGA	p.C340*	C12orf10_uc009zmx.2_Nonsense_Mutation_p.C289*|C12orf10_uc001scq.3_Nonsense_Mutation_p.C225*	NM_021640	NP_067653	Q86UA3	Q86UA3_HUMAN	MYG1 protein precursor	340										ovary(2)	2						TCCCTGGCTGCATCTTCGTCC	0.662													25	157	---	---	---	---	PASS
CS	1431	broad.mit.edu	37	12	56669791	56669791	+	Silent	SNP	G	A	A	rs146737473		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56669791G>A	uc001sks.1	-	7	967	c.777C>T	c.(775-777)CTC>CTT	p.L259L	CS_uc010sql.1_Silent_p.L246L|CS_uc001skr.1_Silent_p.L193L|CS_uc001skt.1_Silent_p.L214L|CS_uc010sqm.1_Silent_p.L193L	NM_004077	NP_004068	O75390	CISY_HUMAN	citrate synthase precursor	259					cellular carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	citrate (Si)-synthase activity				0		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		TGTGGATGGTGAGGTACAGGC	0.463													9	37	---	---	---	---	PASS
BTBD11	121551	broad.mit.edu	37	12	107937769	107937769	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107937769G>A	uc001tmk.1	+	3	1864	c.1343G>A	c.(1342-1344)GGC>GAC	p.G448D	BTBD11_uc009zut.1_Missense_Mutation_p.G448D|BTBD11_uc001tmj.2_Missense_Mutation_p.G448D	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	448						integral to membrane	DNA binding			skin(2)|ovary(1)	3						AAGCACCACGGCAATGGCACC	0.577													3	39	---	---	---	---	PASS
DIAPH3	81624	broad.mit.edu	37	13	60584726	60584726	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60584726A>T	uc001vht.2	-	8	1068	c.849T>A	c.(847-849)AAT>AAA	p.N283K	DIAPH3_uc001vhu.2_Missense_Mutation_p.N20K|DIAPH3_uc001vhw.1_Missense_Mutation_p.N272K|DIAPH3_uc010aed.1_Missense_Mutation_p.N237K|DIAPH3_uc010aee.1_Missense_Mutation_p.N213K|uc001vhx.2_5'Flank|uc001vhy.2_5'Flank	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	283	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CTGTCATCATATTGGGGTGTC	0.378													11	45	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36133906	36133906	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36133906A>G	uc001wti.2	-	26	4143	c.3752T>C	c.(3751-3753)CTG>CCG	p.L1251P	RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Missense_Mutation_p.L1251P|RALGAPA1_uc010tpv.1_Missense_Mutation_p.L1264P|RALGAPA1_uc010tpw.1_Missense_Mutation_p.L1298P	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	1251					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						AAGAGAAGGCAGTTCACAATA	0.338													29	85	---	---	---	---	PASS
RPUSD2	27079	broad.mit.edu	37	15	40866065	40866065	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40866065C>G	uc001zmd.1	+	3	1243	c.1243C>G	c.(1243-1245)CTG>GTG	p.L415V		NM_152260	NP_689473	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing	415					pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding			skin(1)	1		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		GCTACGGGACCTGGTAGCAGA	0.587													5	87	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72192081	72192081	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72192081C>G	uc002atl.3	-	24	3890	c.3417G>C	c.(3415-3417)AGG>AGC	p.R1139S	MYO9A_uc010biq.2_Missense_Mutation_p.R759S|MYO9A_uc002atn.1_Missense_Mutation_p.R1120S|MYO9A_uc002atk.2_5'Flank|MYO9A_uc002atm.1_5'Flank	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	1139	IQ 5.|IQ 4.|Neck or regulatory domain.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						TAATTTTTTTCCTTTGTTCTT	0.323													6	145	---	---	---	---	PASS
HAGH	3029	broad.mit.edu	37	16	1866929	1866929	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1866929T>C	uc002cna.2	-	7	1119	c.712A>G	c.(712-714)AAT>GAT	p.N238D	HAGH_uc002cmz.2_Missense_Mutation_p.N190D|HAGH_uc010uvp.1_Silent_p.A201A|HAGH_uc002cnb.1_Missense_Mutation_p.N190D	NM_005326	NP_005317	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase isoform 1	238					glutathione biosynthetic process	cytoplasm|mitochondrial matrix|mitochondrial matrix	hydroxyacylglutathione hydrolase activity|zinc ion binding			ovary(1)	1		Hepatocellular(780;0.00335)			Glutathione(DB00143)	ATGGCGGCATTGCCGGGCTCC	0.642													5	29	---	---	---	---	PASS
ACSM3	6296	broad.mit.edu	37	16	20796410	20796410	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20796410G>T	uc002dhr.2	+	8	1311	c.1124G>T	c.(1123-1125)GGA>GTA	p.G375V	ACSM3_uc002dhq.2_Missense_Mutation_p.G375V|ACSM3_uc010vba.1_Missense_Mutation_p.G404V|ERI2_uc002dhs.2_Intron	NM_005622	NP_005613	Q53FZ2	ACSM3_HUMAN	SA hypertension-associated homolog isoform 1	375	ATP (By similarity).				regulation of blood pressure	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			ovary(1)	1						ATCTACGAAGGATATGGACAG	0.428													14	88	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587569	43587569	+	Intron	SNP	G	C	C	rs149697015	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587569G>C	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						aactccgtctgaaaagaaaag	0.144													3	35	---	---	---	---	PASS
FAM108A1	81926	broad.mit.edu	37	19	1881411	1881411	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1881411G>T	uc002lug.2	-	2	561	c.155C>A	c.(154-156)CCC>CAC	p.P52H	FAM108A1_uc002lud.2_Missense_Mutation_p.P52H|FAM108A1_uc002lue.2_Missense_Mutation_p.P52H|FAM108A1_uc002luf.2_Missense_Mutation_p.P52H	NM_001130111	NP_001123583	Q96GS6	F18A1_HUMAN	hypothetical protein LOC81926 isoform 2	52						extracellular region	hydrolase activity				0		Ovarian(11;0.000137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCCCCAAGGGGGCGGCCCC	0.746													4	16	---	---	---	---	PASS
ZNF700	90592	broad.mit.edu	37	19	12036011	12036011	+	5'UTR	SNP	T	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12036011T>A	uc002msu.2	+	1					ZNF700_uc010xme.1_5'UTR|ZNF763_uc010xmf.1_5'UTR	NM_144566	NP_653167	Q9H0M5	ZN700_HUMAN	zinc finger protein 700						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTTCTGTCGCTCTGTCGCCTG	0.637													11	53	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15562948	15562948	+	Intron	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15562948G>T	uc002nbe.2	-						WIZ_uc002nbb.3_5'Flank|RASAL3_uc002nbd.2_3'UTR|RASAL3_uc010eaa.1_Intron	NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						TGGGGCGAAGGGCAGAGGCTA	0.597													29	79	---	---	---	---	PASS
PRODH2	58510	broad.mit.edu	37	19	36304176	36304176	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36304176G>T	uc002obx.1	-	1	26	c.8C>A	c.(7-9)CCC>CAC	p.P3H		NM_021232	NP_067055	Q9UF12	PROD2_HUMAN	kidney and liver proline oxidase 1	3					glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			gactaccctgggcgacatagt	0.000													4	13	---	---	---	---	PASS
DHX35	60625	broad.mit.edu	37	20	37632409	37632409	+	Silent	SNP	T	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37632409T>A	uc002xjh.2	+	11	881	c.870T>A	c.(868-870)GTT>GTA	p.V290V	DHX35_uc010zwa.1_Silent_p.V135V|DHX35_uc010zwb.1_Silent_p.V135V|DHX35_uc010zwc.1_Silent_p.V259V	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	290	Helicase C-terminal.					catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TAGAAACTGTTGTGTCGATGC	0.448													33	134	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	18021869	18021869	+	Silent	SNP	C	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18021869C>T	uc010gqw.1	+	15	2097	c.1971C>T	c.(1969-1971)CTC>CTT	p.L657L	CECR2_uc010gqv.1_Silent_p.L516L|CECR2_uc002zml.2_Silent_p.L516L	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	699					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		TTAACAGCCTCCGAGGACCCA	0.547													3	22	---	---	---	---	PASS
HCCS	3052	broad.mit.edu	37	X	11130140	11130140	+	5'UTR	SNP	T	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11130140T>G	uc004cuk.2	+	2					uc004cui.1_5'Flank|HCCS_uc004cuj.2_5'UTR|HCCS_uc004cul.1_5'UTR	NM_005333	NP_005324	P53701	CCHL_HUMAN	holocytochrome c synthase						organ morphogenesis|oxidation-reduction process	mitochondrial inner membrane	holocytochrome-c synthase activity|metal ion binding				0						TTTTGGCAGGTGGAAATTTAA	0.448											OREG0019665	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	20	---	---	---	---	PASS
CLCN5	1184	broad.mit.edu	37	X	49840554	49840554	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49840554A>G	uc004dos.1	+	4	558	c.310A>G	c.(310-312)AAC>GAC	p.N104D	CLCN5_uc004dor.1_Missense_Mutation_p.N174D|CLCN5_uc004doq.1_Missense_Mutation_p.N174D|CLCN5_uc004dot.1_Missense_Mutation_p.N104D	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b	104					excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					TTGTTGCTGGAACTCTGAGCA	0.428													8	66	---	---	---	---	PASS
KLF8	11279	broad.mit.edu	37	X	56291625	56291625	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56291625G>T	uc004dur.2	+	3	1040	c.94G>T	c.(94-96)GTT>TTT	p.V32F	KLF8_uc010nkg.2_Missense_Mutation_p.V27F|KLF8_uc011mop.1_Missense_Mutation_p.V32F|KLF8_uc010nkh.2_RNA	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1	32					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CACTGCTTCTGTTCGGAACAG	0.398													3	22	---	---	---	---	PASS
KIAA1751	85452	broad.mit.edu	37	1	1900380	1900380	+	Intron	DEL	G	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1900380delG	uc001aim.1	-						KIAA1751_uc009vkz.1_Intron	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452											pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TGGGGGCTCCGGTCCTGCCCA	0.692													4	2	---	---	---	---	
CLCNKB	1188	broad.mit.edu	37	1	16372283	16372283	+	Intron	DEL	T	-	-	rs67016480		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16372283delT	uc001axw.3	+						FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGGGGGGGTGCTCTGGGTG	0.358													6	3	---	---	---	---	
PADI6	353238	broad.mit.edu	37	1	17723476	17723477	+	Intron	INS	-	CA	CA	rs144056968	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17723476_17723477insCA	uc001bak.1	+							NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AGGAATGCACCCAGGTGGCTGG	0.629													3	7	---	---	---	---	
USP48	84196	broad.mit.edu	37	1	22027858	22027859	+	Intron	INS	-	A	A	rs35780642		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22027858_22027859insA	uc001bfb.2	-						USP48_uc001bfa.2_Intron|USP48_uc010odq.1_Intron|USP48_uc009vqc.2_Intron|USP48_uc001bfc.2_Intron|USP48_uc001bfd.1_Intron	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a						ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		gactccatctcaaaaaaaaaaa	0.183													8	4	---	---	---	---	
GON4L	54856	broad.mit.edu	37	1	155790322	155790322	+	Intron	DEL	T	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155790322delT	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_Intron|GON4L_uc001fme.2_Intron|GON4L_uc001fmf.2_Intron	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTTTCCTATATTTTTCCCTAT	0.303													22	11	---	---	---	---	
SELE	6401	broad.mit.edu	37	1	169702508	169702509	+	Intron	INS	-	T	T	rs145734084	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169702508_169702509insT	uc001ggm.3	-						C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor						actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					gaaataggtcattatgatccac	0.045													3	3	---	---	---	---	
TARBP1	6894	broad.mit.edu	37	1	234608725	234608726	+	Intron	INS	-	T	T	rs141043621	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234608725_234608726insT	uc001hwd.2	-							NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1						regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCAGAGGGAGATTTTTTTTTGC	0.257													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10356283	10356284	+	IGR	INS	-	GGAA	GGAA			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10356283_10356284insGGAA								C2orf48 (4427 upstream) : HPCAL1 (86756 downstream)																							gaaaaggaaagggaaggaagga	0.139													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12607546	12607549	+	Intron	DEL	CTAT	-	-	rs7568368		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12607546_12607549delCTAT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		tccttccttcctatcttccttcct	0.093													3	3	---	---	---	---	
CENPA	1058	broad.mit.edu	37	2	27016302	27016303	+	Intron	INS	-	T	T	rs146173642	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27016302_27016303insT	uc002rhr.2	+						CENPA_uc002rht.2_Intron|CENPA_uc002rhs.2_Intron	NM_001809	NP_001800	P49450	CENPA_HUMAN	centromere protein A isoform a						CenH3-containing nucleosome assembly at centromere|establishment of mitotic spindle orientation|interspecies interaction between organisms|kinetochore assembly|mitotic prometaphase|protein localization to chromosome, centromeric region	condensed nuclear chromosome kinetochore|cytosol|nucleoplasm|nucleosome	chromatin binding|DNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTAGTAAAGGTTGATCTAGTT	0.406													5	7	---	---	---	---	
SPAST	6683	broad.mit.edu	37	2	32340026	32340027	+	Intron	INS	-	T	T	rs67016851		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32340026_32340027insT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ATAAAGTTAAAttttttttttt	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	78606241	78606242	+	IGR	INS	-	AAGG	AAGG			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78606241_78606242insAAGG								SNAR-H (424089 upstream) : REG3G (646584 downstream)																							aaaagaaaagaaaggaaggaag	0.000													4	2	---	---	---	---	
CIR1	9541	broad.mit.edu	37	2	175221331	175221332	+	Intron	INS	-	AGGA	AGGA	rs139033539	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175221331_175221332insAGGA	uc002uim.2	-						CIR1_uc002uin.2_Intron|CIR1_uc002uio.2_Intron|CIR1_uc002uip.2_Intron	NM_004882	NP_004873	Q86X95	CIR1_HUMAN	CBF1 interacting corepressor						mRNA processing|negative regulation of transcription, DNA-dependent|RNA splicing	nuclear speck	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			large_intestine(1)	1						gggagggagggaagaaggaagg	0.119													9	5	---	---	---	---	
USP37	57695	broad.mit.edu	37	2	219328252	219328253	+	Intron	DEL	AC	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219328252_219328253delAC	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		GAAGTTCtttactttttttttt	0.173													4	2	---	---	---	---	
KCNH8	131096	broad.mit.edu	37	3	19399694	19399699	+	Intron	DEL	TCTTTC	-	-	rs147021013		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19399694_19399699delTCTTTC	uc003cbk.1	+						KCNH8_uc011awe.1_Intron|KCNH8_uc010hex.1_Intron	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,							integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						ccttcttttttctttctctttctctt	0.000													7	7	---	---	---	---	
GBE1	2632	broad.mit.edu	37	3	81541828	81541829	+	Intron	INS	-	TTCTCCCT	TTCTCCCT	rs149554537	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541828_81541829insTTCTCCCT	uc003dqg.2	-							NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		cccttctcccattctccctttc	0.045									Glycogen_Storage_Disease_type_IV				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181901486	181901487	+	IGR	INS	-	TCCC	TCCC			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181901486_181901487insTCCC								SOX2OT (442483 upstream) : ATP11B (609804 downstream)																							ccttccttccttccttccttcc	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	19775868	19775871	+	IGR	DEL	AAGG	-	-	rs34193568		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19775868_19775871delAAGG								None (None upstream) : SLIT2 (479364 downstream)																							aaaaggaagaaaggaaggaaggaa	0.123													4	2	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39507525	39507525	+	Intron	DEL	A	-	-	rs35867925		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39507525delA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	CCTATGGATTAAAAAAAAAAA	0.229													6	5	---	---	---	---	
NHEDC1	150159	broad.mit.edu	37	4	103826510	103826511	+	Intron	DEL	CA	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103826510_103826511delCA	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN	Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)		cctgagtagccaggaCTGGTTA	0.119													18	12	---	---	---	---	
KLKB1	3818	broad.mit.edu	37	4	187149200	187149201	+	Intron	INS	-	A	A	rs138397648	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187149200_187149201insA	uc003iyy.2	+						KLKB1_uc011clc.1_Intron|KLKB1_uc011cld.1_Intron	NM_000892	NP_000883	P03952	KLKB1_HUMAN	plasma kallikrein B1 precursor						blood coagulation, intrinsic pathway|Factor XII activation|fibrinolysis|plasminogen activation|positive regulation of fibrinolysis	cytoplasm|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(1)	1		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		ACAAATGTACCAAAAAAAAACC	0.327													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	56615907	56615907	+	IGR	DEL	T	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56615907delT								GPBP1 (56497 upstream) : ACTBL2 (159937 downstream)																							TTCTTTAATCttttttttttt	0.224													11	6	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58287555	58287556	+	Intron	DEL	AC	-	-	rs148212719		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58287555_58287556delAC	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrt.2_Intron|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc003jrs.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	AAAAAAAAAAACCCCAATTAAT	0.317													9	5	---	---	---	---	
TRIM23	373	broad.mit.edu	37	5	64907242	64907243	+	Intron	INS	-	T	T			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64907242_64907243insT	uc003jty.2	-						TRIM23_uc003jtw.2_Intron|TRIM23_uc003jtx.2_Intron	NM_001656	NP_001647	P36406	TRI23_HUMAN	ADP-ribosylation factor domain protein 1 isoform						interspecies interaction between organisms|small GTPase mediated signal transduction	Golgi membrane|lysosomal membrane	enzyme activator activity|GDP binding|GTP binding|GTPase activity|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CCTCTTTGAAGTTTTTTTTTTT	0.317													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	130306978	130306989	+	IGR	DEL	GGAAGGAAGGAA	-	-	rs71982858	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130306978_130306989delGGAAGGAAGGAA								CHSY3 (784652 upstream) : HINT1 (187886 downstream)																							aaggaaggacggaaggaaggaaggaaggaagg	0.000													5	5	---	---	---	---	
FAM153B	202134	broad.mit.edu	37	5	175524559	175524560	+	Intron	INS	-	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175524559_175524560insA	uc003mdk.2	+						FAM153B_uc010jjy.1_Intron	NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134											ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		gatttcatctcaaaaaaaaaaa	0.178													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27410500	27410501	+	IGR	INS	-	GGAA	GGAA	rs139168670	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27410500_27410501insGGAA								ZNF391 (41273 upstream) : ZNF184 (8021 downstream)																							gaaagaaggacggaaggaagga	0.000													4	7	---	---	---	---	
C6orf126	389383	broad.mit.edu	37	6	35745086	35745087	+	Intron	INS	-	G	G	rs147993418	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35745086_35745087insG	uc010jvz.1	+						C6orf126_uc003olc.1_Intron	NM_207409	NP_997292	Q6UWE3	CF126_HUMAN	hypothetical protein LOC389383 precursor						digestion|lipid catabolic process	extracellular region	enzyme activator activity				0						GGGGTGGGGCTGGGGGGGGAAC	0.663													3	5	---	---	---	---	
LMBRD1	55788	broad.mit.edu	37	6	70484880	70484903	+	Intron	DEL	AGGGAGGGAGGGAGGGAGGGAGGG	-	-	rs71996428		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70484880_70484903delAGGGAGGGAGGGAGGGAGGGAGGG	uc003pfa.2	-						LMBRD1_uc003pez.2_Intron|LMBRD1_uc010kal.2_Intron|LMBRD1_uc003pfb.2_Intron	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein						interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						gaaggaaggaagggagggagggagggagggagggagggagggag	0.107													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	86411965	86411966	+	IGR	INS	-	CCTT	CCTT			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86411965_86411966insCCTT								SNHG5 (23514 upstream) : None (None downstream)																							ctccctcccccccttccttcct	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	87732556	87732557	+	IGR	INS	-	GGAA	GGAA	rs145161302	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87732556_87732557insGGAA								HTR1E (6166 upstream) : CGA (62665 downstream)																							gaaaaaaaaagggaaggaagga	0.000													5	3	---	---	---	---	
HOXA5	3202	broad.mit.edu	37	7	27185066	27185070	+	5'Flank	DEL	GTTTT	-	-	rs70994631		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27185066_27185070delGTTTT	uc003syn.1	-						uc003syp.1_5'Flank	NM_019102	NP_061975	P20719	HXA5_HUMAN	homeobox A5						negative regulation of angiogenesis|negative regulation of erythrocyte differentiation|positive regulation of apoptosis|positive regulation of myeloid cell differentiation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGTGTGTGAGgttttgttttgtttt	0.463													6	5	---	---	---	---	
DMTF1	9988	broad.mit.edu	37	7	86813978	86813979	+	Intron	INS	-	A	A			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86813978_86813979insA	uc003uih.2	+						DMTF1_uc003uii.2_Intron|DMTF1_uc003uij.2_Intron|DMTF1_uc011khb.1_Intron|DMTF1_uc003uik.2_Intron|DMTF1_uc003uil.2_Intron|DMTF1_uc003uin.2_Intron	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					AAAAGCAACTTAATTTCTGTGG	0.391													13	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	89548099	89548100	+	IGR	INS	-	GAAG	GAAG	rs34966035		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89548099_89548100insGAAG								ZNF804B (581755 upstream) : DPY19L2P4 (200614 downstream)																							aagagagaaaagaaggaaggaa	0.050													4	2	---	---	---	---	
SSPO	23145	broad.mit.edu	37	7	149515189	149515189	+	Splice_Site	DEL	A	-	-	rs112122477		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149515189delA	uc010lpk.2	+	81	11577	c.11577_splice	c.e81+2	p.E3859_splice		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GACCTCGAGTAACTGCCCCAG	0.562													2	5	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79843313	79843314	+	Intron	INS	-	T	T	rs142884554	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79843313_79843314insT	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						CAGGAAAAAGGTTTTTTTTTTA	0.292													4	2	---	---	---	---	
C9orf125	84302	broad.mit.edu	37	9	104239493	104239494	+	Intron	INS	-	AAACAAAC	AAACAAAC	rs67389871	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104239493_104239494insAAACAAAC	uc004bbm.2	-						uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302							integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				GTAACTTaaaaaaacaaacaaa	0.351													4	4	---	---	---	---	
NR6A1	2649	broad.mit.edu	37	9	127288844	127288844	+	Intron	DEL	A	-	-	rs111378093		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127288844delA	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						CAGTTTGAAGAAAAAAAAAAA	0.418													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133834291	133834293	+	IGR	DEL	TGT	-	-	rs151170497		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133834291_133834293delTGT								FIBCD1 (19836 upstream) : LAMC3 (50211 downstream)																							tcaccaccactgtcaccaccacc	0.000													4	2	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34550616	34550617	+	Intron	INS	-	AAAG	AAAG			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34550616_34550617insAAAG	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				gactctgtctcaaagaaagaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	67367503	67367504	+	IGR	INS	-	TTCCTTCC	TTCCTTCC			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67367503_67367504insTTCCTTCC								ANXA2P3 (780869 upstream) : CTNNA3 (312221 downstream)																							tcctctctcctttccttccttc	0.000													4	2	---	---	---	---	
RASSF9	9182	broad.mit.edu	37	12	86199850	86199851	+	Intron	INS	-	T	T	rs149030946	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199850_86199851insT	uc001taf.1	-							NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family						endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						TGAGAGAGGCATTTTTTTtctg	0.163													9	6	---	---	---	---	
KIAA0564	23078	broad.mit.edu	37	13	42357776	42357776	+	Intron	DEL	A	-	-	rs71735553		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42357776delA	uc001uyj.2	-						KIAA0564_uc001uyk.2_Intron	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		tgcatcacagaaaaaaaaaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112849952	112849953	+	IGR	INS	-	CCTT	CCTT	rs111430260		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112849952_112849953insCCTT								SOX1 (123932 upstream) : C13orf28 (180716 downstream)																							GTACCAATTGCccttccttcct	0.252													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	30677426	30677429	+	IGR	DEL	GGAG	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30677426_30677429delGGAG								PRKD1 (280527 upstream) : G2E3 (350900 downstream)																							TAGCAATAAAggagggagggaggg	0.230													4	5	---	---	---	---	
HEATR5A	25938	broad.mit.edu	37	14	31819967	31819970	+	Intron	DEL	TTTG	-	-	rs72055697		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31819967_31819970delTTTG	uc001wrf.3	-						HEATR5A_uc010ami.2_Intron|HEATR5A_uc001wrg.1_Intron|HEATR5A_uc010tpk.1_Intron	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A								binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TAGGTAAGTTtttgtttgtttgtt	0.176													3	4	---	---	---	---	
LRFN5	145581	broad.mit.edu	37	14	42277638	42277639	+	Intron	INS	-	GAGG	GAGG	rs142271830	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42277638_42277639insGAGG	uc001wvm.2	+						LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III							integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		aaggaagaatcgagggagggag	0.099										HNSCC(30;0.082)			6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	85919705	85919708	+	IGR	DEL	AGAG	-	-	rs67932926		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85919705_85919708delAGAG								None (None upstream) : FLRT2 (76780 downstream)																							aaagaaagaaagagagagagagag	0.025													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102989877	102989878	+	IGR	INS	-	AGAGAGAG	AGAGAGAG	rs149529753	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102989877_102989878insAGAGAGAG								ANKRD9 (13749 upstream) : RCOR1 (69355 downstream)																							ggaagaaagaaagAGAAAAAAA	0.272													6	6	---	---	---	---	
EMP2	2013	broad.mit.edu	37	16	10631618	10631619	+	Intron	DEL	CA	-	-	rs34790340		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10631618_10631619delCA	uc002czx.2	-							NM_001424	NP_001415	P54851	EMP2_HUMAN	epithelial membrane protein 2						cell proliferation	integral to membrane					0						TGCATGCGCCcacacacacaca	0.342													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21393228	21393228	+	IGR	DEL	T	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21393228delT								NCRNA00169 (63316 upstream) : NPIPL3 (20223 downstream)																							TGGGAGGttgttttttttttt	0.259													11	6	---	---	---	---	
SCNN1G	6340	broad.mit.edu	37	16	23224594	23224595	+	Intron	INS	-	TA	TA	rs149635780	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23224594_23224595insTA	uc002dlm.1	+							NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma						excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	tttttttttttatggagtctta	0.213													2	4	---	---	---	---	
SEZ6L2	26470	broad.mit.edu	37	16	29910431	29910431	+	5'UTR	DEL	G	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29910431delG	uc002duq.3	-	1					uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_5'UTR|SEZ6L2_uc002dur.3_5'UTR|SEZ6L2_uc002dus.3_5'UTR|SEZ6L2_uc010vec.1_5'UTR|SEZ6L2_uc010ved.1_5'UTR|ASPHD1_uc002dut.2_5'Flank|ASPHD1_uc002duu.3_5'Flank|ASPHD1_uc010bzi.2_5'Flank	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform							endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CCCTTTAATTGtttttttttt	0.483													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33395820	33395821	+	IGR	INS	-	CAG	CAG	rs144984499	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33395820_33395821insCAG								SLC6A10P (499357 upstream) : MIR1826 (569687 downstream)																							aataataataataataatTTTT	0.183													3	3	---	---	---	---	
SLC47A2	146802	broad.mit.edu	37	17	19608911	19608911	+	Intron	DEL	T	-	-	rs34629869		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19608911delT	uc002gwe.3	-						SLC47A2_uc002gwg.3_Intron|SLC47A2_uc002gwf.3_Intron|SLC47A2_uc002gwh.3_Intron|SLC47A2_uc002gwi.2_Intron|SLC47A2_uc010cqs.1_Intron|SLC47A2_uc010cqt.1_Intron	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN	solute carrier family 47, member 2 isoform 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)					ACTCAGGGGCttttttttttt	0.348													2	4	---	---	---	---	
TMEM132E	124842	broad.mit.edu	37	17	32965275	32965276	+	3'UTR	INS	-	C	C	rs71921875		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32965275_32965276insC	uc002hif.2	+	10						NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor							integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		AGTAGCAGGGACCCCCCCCCCC	0.644											OREG0024325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
TUBD1	51174	broad.mit.edu	37	17	57963684	57963684	+	Intron	DEL	A	-	-	rs113094238		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57963684delA	uc002ixw.1	-						TUBD1_uc010ddf.1_Intron|TUBD1_uc010ddg.1_Intron|TUBD1_uc010ddh.1_Intron|TUBD1_uc010wok.1_Intron|TUBD1_uc002ixx.1_Intron|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin						cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			GTCCAAATCCAAAAAAAAAAA	0.373													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	48817897	48817904	+	IGR	DEL	TTCCTTCC	-	-	rs3080557		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48817897_48817904delTTCCTTCC								MEX3C (94207 upstream) : None (None downstream)																							ccctcccattttccttccttccttcctt	0.082													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																							aaaaaaaaaacaaaaaaaaaa	0.348													3	3	---	---	---	---	
MARCH2	51257	broad.mit.edu	37	19	8495418	8495419	+	Intron	INS	-	A	A	rs74326673		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8495418_8495419insA	uc002mjv.2	+						MARCH2_uc002mjw.2_Intron|MARCH2_uc002mjx.2_Intron	NM_016496	NP_057580	Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2						endocytosis	cytoplasmic vesicle|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						gaatctgtctcaaaaaaaaaaa	0.248													9	4	---	---	---	---	
ZNF562	54811	broad.mit.edu	37	19	9764669	9764669	+	Intron	DEL	T	-	-	rs145922849		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9764669delT	uc010xks.1	-						ZNF562_uc002mly.2_Intron|ZNF562_uc002mlx.2_Intron|ZNF562_uc010xkt.1_Intron|ZNF562_uc010xku.1_Intron|ZNF562_uc010xkv.1_Intron|ZNF562_uc010xkw.1_Intron	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TAATGTTTAAttttttttttt	0.114													5	3	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	38994748	38994750	+	Intron	DEL	CCT	-	-	rs34529638		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38994748_38994750delCCT	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	ATAACCCACACCTCCTTCATAAT	0.443													3	3	---	---	---	---	
NTF4	4909	broad.mit.edu	37	19	49564500	49564500	+	3'UTR	DEL	A	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49564500delA	uc002pmf.3	-	2					CGB7_uc010yah.1_Intron	NM_006179	NP_006170	P34130	NTF4_HUMAN	neurotrophin 5 preproprotein						adult locomotory behavior|epidermis development|ganglion mother cell fate determination|long-term memory|sensory organ boundary specification	endoplasmic reticulum lumen|extracellular region	growth factor activity				0		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GATTGAGCTCAAAATCAGAGA	0.448													5	3	---	---	---	---	
SEC23B	10483	broad.mit.edu	37	20	18507968	18507972	+	Intron	DEL	GTGGA	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18507968_18507972delGTGGA	uc002wqz.1	+						SEC23B_uc002wra.1_Intron|SEC23B_uc002wrb.1_Intron|SEC23B_uc010zsb.1_Intron|SEC23B_uc002wrc.1_Intron	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B						ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						aacccgggaggtggagatcgcacca	0.039													3	3	---	---	---	---	
TCFL5	10732	broad.mit.edu	37	20	61473633	61473633	+	Intron	DEL	T	-	-	rs11475897		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61473633delT	uc002ydp.2	-						TCFL5_uc002ydo.2_Intron|DPH3B_uc011aan.1_5'Flank	NM_006602	NP_006593	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 protein						cell differentiation|multicellular organismal development|regulation of cell differentiation|regulation of cell proliferation|spermatogenesis|transcription from RNA polymerase II promoter		DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)	1	Breast(26;5.68e-08)					AGATTTTAACTTTTTTTTTTT	0.303													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11124318	11124326	+	IGR	DEL	TCTTCCTCC	-	-	rs62213862	by1000genomes	TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11124318_11124326delTCTTCCTCC								BAGE (25381 upstream) : None (None downstream)																							cccttccccttcttcctcctcctcctcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20316672	20316675	+	IGR	DEL	CACA	-	-	rs144870472		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20316672_20316675delCACA								TMPRSS15 (540702 upstream) : None (None downstream)																							TTTTGTTTCTcacacacacacaca	0.201													3	3	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						GTGTCTCtgtgtgcgtgcgtgcgt	0.270													5	3	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36744887	36744887	+	Intron	DEL	C	-	-	rs56147525		TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36744887delC	uc003apg.2	-						MYH9_uc003api.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GGAAGACCCGCCCCCCCCCCC	0.627			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				4	4	---	---	---	---	
SEPT3	55964	broad.mit.edu	37	22	42390888	42390889	+	Intron	DEL	TG	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42390888_42390889delTG	uc003bbr.3	+						WBP2NL_uc011ape.1_Intron|SEPT3_uc003bbs.3_3'UTR|SEPT3_uc010gyr.2_Intron|SEPT3_uc011apj.1_3'UTR|SEPT3_uc010gys.2_Intron	NM_145733	NP_663786	Q9UH03	SEPT3_HUMAN	septin 3 isoform A						cell cycle|cytokinesis	cell junction|septin complex	GTP binding				0						GCATCTtgtctgtgtgtgtgtg	0.411													9	4	---	---	---	---	
ATXN10	25814	broad.mit.edu	37	22	46136560	46136567	+	Intron	DEL	ACACACAC	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136560_46136567delACACACAC	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		ttatatgaatacacacacacacacacac	0.163													8	4	---	---	---	---	
HDAC6	10013	broad.mit.edu	37	X	48661516	48661516	+	Intron	DEL	T	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48661516delT	uc011mmi.1	+						HDAC6_uc004dkr.1_Intron|HDAC6_uc004dks.1_Intron|HDAC6_uc010nig.1_Intron|HDAC6_uc004dkt.1_Intron|HDAC6_uc004dku.3_Intron|HDAC6_uc011mmj.1_Intron|HDAC6_uc011mmk.1_Intron	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6						aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	CTGTGTCTCCTTTTTTTTTTC	0.502													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	14596387	14596387	+	IGR	DEL	T	-	-			TCGA-BP-5008-01A-01D-1462-08	TCGA-BP-5008-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:14596387delT								None (None upstream) : TTTY15 (177911 downstream)																							tTATACCACATTTTGCTTTCA	0.219													13	6	---	---	---	---	
