Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AURKAIP1	54998	broad.mit.edu	37	1	1309509	1309509	+	Silent	SNP	A	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1309509A>G	uc001afb.1	-	2	479	c.369T>C	c.(367-369)CCT>CCC	p.P123P	AURKAIP1_uc001afc.2_Silent_p.P123P|AURKAIP1_uc001afd.2_Silent_p.P123P|AURKAIP1_uc009vkb.1_Silent_p.P123P	NM_017900	NP_060370	Q9NWT8	AKIP_HUMAN	aurora kinase A interacting protein 1	123					negative regulation of mitosis|positive regulation of proteolysis	mitochondrion|nucleus	protein binding				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.82e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		ACTGAATTTGAGGCGCATCCG	0.617													3	178	---	---	---	---	PASS
SYF2	25949	broad.mit.edu	37	1	25549846	25549846	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25549846T>A	uc001bjt.1	-	7	698	c.643A>T	c.(643-645)AAT>TAT	p.N215Y	SYF2_uc001bju.1_Missense_Mutation_p.N173Y	NM_015484	NP_056299	O95926	SYF2_HUMAN	SYF2 homolog, RNA splicing factor isoform 1	215						catalytic step 2 spliceosome					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-26)|Colorectal(126;2.54e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000455)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00145)|GBM - Glioblastoma multiforme(114;0.00443)|READ - Rectum adenocarcinoma(331;0.0936)|Lung(427;0.201)		AATTTGGCATTCCTTTCATTA	0.358													128	275	---	---	---	---	PASS
CNKSR1	10256	broad.mit.edu	37	1	26514973	26514973	+	Silent	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26514973G>A	uc001bln.3	+	18	1648	c.1590G>A	c.(1588-1590)GAG>GAA	p.E530E	CNKSR1_uc001blm.3_Silent_p.E523E|CNKSR1_uc009vsd.2_Silent_p.E265E|CNKSR1_uc009vse.2_Silent_p.E265E|CNKSR1_uc001blo.2_Silent_p.E265E|CATSPER4_uc010oey.1_5'Flank|CATSPER4_uc010oez.1_5'Flank|CATSPER4_uc009vsf.2_5'Flank	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	530					Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			lung(1)|kidney(1)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		CGGACGATGAGGCTGGGTCCC	0.617													7	12	---	---	---	---	PASS
LRRC40	55631	broad.mit.edu	37	1	70611331	70611331	+	3'UTR	SNP	G	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70611331G>C	uc001der.1	-	15						NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40											ovary(1)	1						ATATGGCCCAGGCTAATTATA	0.308													4	6	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76254935	76254935	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76254935G>C	uc001dgy.1	+	3	274	c.203G>C	c.(202-204)AGA>ACA	p.R68T	RABGGTB_uc009wbt.1_RNA|RABGGTB_uc001dha.1_Missense_Mutation_p.R22T|SNORD45B_uc009wbv.1_5'Flank	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit	68	PFTB 2.				protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						CGCATGAATAGAGAAGAGATT	0.383													68	182	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142713407	142713407	+	Intron	SNP	C	T	T	rs142431664	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142713407C>T	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		CAGTAAGAAACTCATTCTTAT	0.318													6	22	---	---	---	---	PASS
NOS1AP	9722	broad.mit.edu	37	1	162324977	162324977	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162324977G>T	uc001gbv.2	+	7	983	c.596G>T	c.(595-597)GGC>GTC	p.G199V	NOS1AP_uc010pkr.1_Missense_Mutation_p.G194V|NOS1AP_uc010pks.1_RNA|NOS1AP_uc001gbw.2_Missense_Mutation_p.G194V	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor	199					regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			GTTCCTGCAGGCCGCCAGCTC	0.557													54	119	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186302399	186302399	+	Silent	SNP	T	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186302399T>C	uc001grv.2	-	37	5607	c.5310A>G	c.(5308-5310)ACA>ACG	p.T1770T		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1770					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CTGTAGCCTGTGTTTGTTGCT	0.423			T	NTRK1	papillary thyroid								71	159	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213349818	213349818	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213349818C>G	uc010ptr.1	+	8	1186	c.1027C>G	c.(1027-1029)CTT>GTT	p.L343V	RPS6KC1_uc001hkd.2_Missense_Mutation_p.L331V|RPS6KC1_uc010pts.1_Intron|RPS6KC1_uc010ptt.1_Intron|RPS6KC1_uc010ptu.1_Missense_Mutation_p.L162V|RPS6KC1_uc010ptv.1_5'UTR|RPS6KC1_uc001hke.2_Missense_Mutation_p.L162V	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	343					cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		CTTCAGAGTCCTTGGGGTGAT	0.448													63	128	---	---	---	---	PASS
ARF1	375	broad.mit.edu	37	1	228285075	228285075	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228285075A>C	uc001hrr.2	+	3	409	c.181A>C	c.(181-183)ATC>CTC	p.I61L	ARF1_uc001hrs.2_Missense_Mutation_p.I61L|ARF1_uc001hrt.2_Intron|ARF1_uc009xev.2_Intron|ARF1_uc001hru.2_Missense_Mutation_p.I61L|ARF1_uc001hrv.2_Missense_Mutation_p.I61L|ARF1_uc001hrw.2_Missense_Mutation_p.I61L	NM_001024226	NP_001019397	P84077	ARF1_HUMAN	ADP-ribosylation factor 1	61					cellular copper ion homeostasis|COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|protein transport|regulation of defense response to virus by virus|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction|viral reproduction	cytosol|Golgi membrane|perinuclear region of cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding|receptor signaling protein activity				0		Prostate(94;0.0405)				GTACAAGAACATCAGCTTCAC	0.547													47	114	---	---	---	---	PASS
XPO1	7514	broad.mit.edu	37	2	61709537	61709537	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61709537A>G	uc002sbj.2	-	23	3678	c.2950T>C	c.(2950-2952)TCG>CCG	p.S984P	XPO1_uc010fcl.2_Missense_Mutation_p.S980P|XPO1_uc010ypn.1_Missense_Mutation_p.S980P|XPO1_uc002sbk.2_Missense_Mutation_p.S545P|XPO1_uc002sbg.2_Missense_Mutation_p.S181P|XPO1_uc002sbh.2_Missense_Mutation_p.S631P	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1	984					intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			GGGAAGGCCGACTTAAGGAGA	0.269													52	181	---	---	---	---	PASS
HOXD11	3237	broad.mit.edu	37	2	176972132	176972132	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176972132C>T	uc002uki.2	+	1	49	c.49C>T	c.(49-51)CCG>TCG	p.P17S	HOXD11_uc010fqx.2_Intron	NM_021192	NP_067015	P31277	HXD11_HUMAN	homeobox D11	17						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		CATGTACCTGCCGGGCTGCGC	0.637			T	NUP98	AML								6	28	---	---	---	---	PASS
ABI2	10152	broad.mit.edu	37	2	204281636	204281636	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204281636G>T	uc002vaa.2	+	10	1433	c.1198G>T	c.(1198-1200)GAT>TAT	p.D400Y	ABI2_uc002uzz.2_Missense_Mutation_p.D362Y|ABI2_uc010zih.1_Missense_Mutation_p.D48Y|ABI2_uc010zii.1_Missense_Mutation_p.D394Y|ABI2_uc010zij.1_Missense_Mutation_p.D277Y|ABI2_uc002vab.2_Missense_Mutation_p.D288Y|ABI2_uc010zik.1_Missense_Mutation_p.D125Y|ABI2_uc010zil.1_Missense_Mutation_p.D264Y|ABI2_uc010zim.1_Splice_Site_p.N213_splice|ABI2_uc002vac.2_Missense_Mutation_p.D186Y|ABI2_uc010zin.1_Missense_Mutation_p.D77Y	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN	abl interactor 2	400	Pro-rich.				actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0						CTTAGTTTCAGATACACCACC	0.458													34	96	---	---	---	---	PASS
CAB39	51719	broad.mit.edu	37	2	231682474	231682474	+	Silent	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231682474C>T	uc002vqx.2	+	8	1131	c.699C>T	c.(697-699)CTC>CTT	p.L233L	CAB39_uc010fxr.2_Silent_p.L233L|CAB39_uc010fxq.2_Silent_p.L233L|CAB39_uc002vqy.2_5'UTR	NM_016289	NP_057373	Q9Y376	CAB39_HUMAN	calcium binding protein 39	233					cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding			central_nervous_system(1)	1		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		CTCAGCTTCTCGGTGAACTAC	0.289													54	143	---	---	---	---	PASS
CXCR7	57007	broad.mit.edu	37	2	237489349	237489349	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237489349T>A	uc010fyq.2	+	3	471	c.241T>A	c.(241-243)TGC>AGC	p.C81S	CXCR7_uc002vwd.2_Missense_Mutation_p.C81S	NM_020311	NP_064707	P25106	CXCR7_HUMAN	chemokine orphan receptor 1	81	Cytoplasmic (Potential).				interspecies interaction between organisms	integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3		Breast(86;0.000182)|Renal(207;0.00339)|all_hematologic(139;0.0048)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|all_lung(227;0.147)|all_neural(83;0.223)		Epithelial(121;8.35e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.09e-11)|Kidney(56;1.11e-07)|KIRC - Kidney renal clear cell carcinoma(57;3.03e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000176)|Lung(119;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.118)		TGACACGCACTGCTACATCTT	0.547													28	61	---	---	---	---	PASS
PPP1R2	5504	broad.mit.edu	37	3	195245886	195245886	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195245886T>A	uc003fup.2	-	5	876	c.500A>T	c.(499-501)GAT>GTT	p.D167V		NM_006241	NP_006232	P41236	IPP2_HUMAN	protein phosphatase 1, regulatory subunit 2	167					glycogen metabolic process|regulation of phosphoprotein phosphatase activity|regulation of signal transduction		protein binding|protein serine/threonine phosphatase inhibitor activity			urinary_tract(1)	1	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)		Epithelial(36;2.64e-22)|all cancers(36;2.69e-20)|OV - Ovarian serous cystadenocarcinoma(49;3.52e-19)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;9.55e-05)		TTCATCATCATCATGTAGGTC	0.348													17	381	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505763	195505763	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505763G>A	uc011bto.1	-	3	12764	c.12304C>T	c.(12304-12306)CTT>TTT	p.L4102F	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.582													3	21	---	---	---	---	PASS
LOC348926	348926	broad.mit.edu	37	4	3948610	3948610	+	RNA	SNP	T	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3948610T>C	uc011bvu.1	-	5		c.1725A>G			LOC348926_uc003ghn.2_Intron	NR_024253				Homo sapiens hypothetical protein LOC348926, mRNA (cDNA clone IMAGE:4546485), partial cds.												0						GGACCCCGACTAGCGACACGA	0.592													3	41	---	---	---	---	PASS
SH3TC1	54436	broad.mit.edu	37	4	8230168	8230168	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8230168C>T	uc003gkv.3	+	12	2848	c.2747C>T	c.(2746-2748)GCG>GTG	p.A916V	SH3TC1_uc003gkw.3_Missense_Mutation_p.A840V|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	916							binding			large_intestine(2)|pancreas(1)	3						TGCCTGCATGCGGGTGCCAGC	0.697													3	54	---	---	---	---	PASS
RAPGEF6	51735	broad.mit.edu	37	5	130841087	130841087	+	Silent	SNP	T	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130841087T>G	uc003kvn.1	-	10	1277	c.1071A>C	c.(1069-1071)GGA>GGC	p.G357G	RAPGEF6_uc003kvp.1_Silent_p.G407G|RAPGEF6_uc003kvo.1_Silent_p.G357G|RAPGEF6_uc010jdi.1_Silent_p.G357G|RAPGEF6_uc010jdj.1_Silent_p.G357G|RAPGEF6_uc003kvq.2_Silent_p.G74G|RAPGEF6_uc003kvr.2_Silent_p.G357G|RAPGEF6_uc011cxe.1_RNA|RAPGEF6_uc010jdk.2_Silent_p.G357G	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide	357	cNMP.				Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TCCTGACAATTCCATGCATGT	0.383													47	179	---	---	---	---	PASS
TCF7	6932	broad.mit.edu	37	5	133451702	133451702	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133451702A>C	uc003kyt.2	+	3	615	c.419A>C	c.(418-420)CAC>CCC	p.H140P	TCF7_uc003kyu.1_Missense_Mutation_p.H25P|TCF7_uc003kyv.2_Missense_Mutation_p.H25P|TCF7_uc003kyw.2_Missense_Mutation_p.H25P|TCF7_uc003kyx.2_5'UTR|TCF7_uc003kyy.2_Missense_Mutation_p.H25P|TCF7_uc003kyz.2_Missense_Mutation_p.H25P|TCF7_uc003kza.2_Missense_Mutation_p.H25P	NM_003202	NP_003193	P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific,	140					cellular response to interleukin-4|immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription regulatory region DNA binding				0		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCAGGGCAGCACCCCCAGCCG	0.652													7	27	---	---	---	---	PASS
TRERF1	55809	broad.mit.edu	37	6	42232448	42232448	+	Silent	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42232448G>A	uc003osd.2	-	7	2192	c.1629C>T	c.(1627-1629)CTC>CTT	p.L543L	TRERF1_uc011duq.1_Silent_p.L543L|TRERF1_uc003osb.2_Silent_p.L382L|TRERF1_uc003osc.2_Silent_p.L382L|TRERF1_uc003ose.2_Silent_p.L543L	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	543	Interacts with CREBBP.				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TAACCTGTTTGAGGTTGGGGG	0.582													34	71	---	---	---	---	PASS
VNN1	8876	broad.mit.edu	37	6	133015315	133015315	+	Silent	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133015315G>A	uc003qdo.2	-	3	368	c.348C>T	c.(346-348)GGC>GGT	p.G116G		NM_004666	NP_004657	O95497	VNN1_HUMAN	vanin 1 precursor	116	CN hydrolase.				acute inflammatory response|anti-apoptosis|cell-cell adhesion|cellular component movement|chronic inflammatory response|innate immune response|pantothenate metabolic process|positive regulation of T cell differentiation in thymus|response to oxidative stress	anchored to membrane|integral to membrane|plasma membrane	GPI anchor binding|pantetheine hydrolase activity			ovary(3)	3	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		CTGGGGTCTGGCCAAATCTGA	0.388													4	116	---	---	---	---	PASS
STXBP5	134957	broad.mit.edu	37	6	147685192	147685192	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147685192C>T	uc003qlz.2	+	25	3132	c.2971C>T	c.(2971-2973)CGG>TGG	p.R991W	STXBP5_uc010khz.1_Missense_Mutation_p.R955W|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.R646W	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	991					exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TACCAATATGCGGATAGCCAG	0.363													8	416	---	---	---	---	PASS
LOC168474	168474	broad.mit.edu	37	7	64313515	64313515	+	Silent	SNP	A	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64313515A>G	uc003ttj.1	-	1	664	c.112T>C	c.(112-114)TTG>CTG	p.L38L		NR_002789				SubName: Full=Selenophosphate synthetase 1; SubName: Full=Selenophosphate synthetase 1, isoform CRA_a;												0						CCGTGTCTCAAAGGAATGACA	0.443													53	98	---	---	---	---	PASS
WNT2	7472	broad.mit.edu	37	7	116955375	116955375	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116955375G>A	uc003viz.2	-	3	638	c.338C>T	c.(337-339)GCC>GTC	p.A113V	WNT2_uc003vja.2_Intron	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	113					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		TGAGGAGATGGCATAAACAAA	0.428													4	102	---	---	---	---	PASS
TAS2R40	259286	broad.mit.edu	37	7	142920102	142920102	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142920102C>A	uc011ksx.1	+	1	931	c.931C>A	c.(931-933)CAG>AAG	p.Q311K		NM_176882	NP_795363	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	311	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(1)	1	Melanoma(164;0.059)					GAAGCGGTTTCAGCACCAAGT	0.532													4	133	---	---	---	---	PASS
MCPH1	79648	broad.mit.edu	37	8	6302771	6302771	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6302771T>G	uc003wqi.2	+	8	1596	c.1528T>G	c.(1528-1530)TGT>GGT	p.C510G	MCPH1_uc003wqh.2_Missense_Mutation_p.C510G|MCPH1_uc011kwl.1_Missense_Mutation_p.C462G	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin	510						microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		CCTAAGGTGTTGTAGACAGGC	0.493													51	106	---	---	---	---	PASS
FLJ10661	286042	broad.mit.edu	37	8	8093750	8093750	+	RNA	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8093750C>T	uc011kwt.1	+	6		c.805C>T			FLJ10661_uc010lrq.2_Intron|FLJ10661_uc003wsf.3_RNA	NR_024362				Homo sapiens cDNA FLJ60033 complete cds, highly similar to Protein FAM86A.												0						GACAATGGCCCAGCGCTGGAC	0.567													6	37	---	---	---	---	PASS
CTSB	1508	broad.mit.edu	37	8	11710155	11710155	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11710155C>A	uc003wum.2	-	5	500	c.176G>T	c.(175-177)TGT>TTT	p.C59F	CTSB_uc011kxl.1_Intron|CTSB_uc003wun.2_Missense_Mutation_p.C59F|CTSB_uc003wuo.2_Missense_Mutation_p.C59F|CTSB_uc003wup.2_Missense_Mutation_p.C59F|CTSB_uc003wuq.2_Missense_Mutation_p.C59F|CTSB_uc010lsc.2_5'UTR|CTSB_uc003wur.2_Missense_Mutation_p.C59F|CTSB_uc003wus.1_Missense_Mutation_p.C59F|CTSB_uc003wut.1_Missense_Mutation_p.C59F|CTSB_uc003wuu.2_5'Flank	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein	59					proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		GAAGGTACCACATAGCCTCTT	0.597													20	49	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25167945	25167945	+	Silent	SNP	C	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25167945C>G	uc003xeg.2	+	13	1352	c.1215C>G	c.(1213-1215)CTC>CTG	p.L405L	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Silent_p.L119L|DOCK5_uc003xei.2_5'UTR	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	405						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CCTTGAAGCTCTTGCCCGGTG	0.403													48	114	---	---	---	---	PASS
AGPAT6	137964	broad.mit.edu	37	8	41456786	41456786	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41456786G>A	uc003xnz.2	+	2	1067	c.128G>A	c.(127-129)CGC>CAC	p.R43H		NM_178819	NP_848934	Q86UL3	GPAT4_HUMAN	lysophosphatidic acid acyltransferase zeta	43					acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			TTTGGTATCCGCAAACTCTAC	0.433													5	252	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113650949	113650949	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113650949C>A	uc003ynu.2	-	21	3661	c.3502G>T	c.(3502-3504)GAA>TAA	p.E1168*	CSMD3_uc003yns.2_Nonsense_Mutation_p.E440*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.E1128*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.E1064*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1168	Extracellular (Potential).|CUB 6.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTAAATCCTTCATATGATATT	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			25	84	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113841930	113841930	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113841930C>A	uc003ynu.2	-	12	2003	c.1844G>T	c.(1843-1845)AGG>ATG	p.R615M	CSMD3_uc003ynt.2_Missense_Mutation_p.R575M|CSMD3_uc011lhx.1_Missense_Mutation_p.R511M	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	615	Extracellular (Potential).|CUB 3.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GAGCACTGTCCTAGGATCTCC	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			6	126	---	---	---	---	PASS
FAM83A	84985	broad.mit.edu	37	8	124204063	124204063	+	Silent	SNP	T	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124204063T>C	uc003ypv.2	+	3	2515	c.501T>C	c.(499-501)GAT>GAC	p.D167D	FAM83A_uc003ypw.2_Silent_p.D167D|FAM83A_uc003ypy.2_Intron|FAM83A_uc003ypx.2_Silent_p.D167D|FAM83A_uc003ypz.2_Silent_p.D167D	NM_032899	NP_116288	Q86UY5	FA83A_HUMAN	hypothetical protein LOC84985 isoform a	167										ovary(3)|skin(1)	4	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TCCTGATGGATGTGTTCACGG	0.557													78	308	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139791754	139791754	+	Missense_Mutation	SNP	G	A	A	rs139654575	byFrequency	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139791754G>A	uc003yvd.2	-	14	2149	c.1702C>T	c.(1702-1704)CGG>TGG	p.R568W		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	568	Pro-rich.|Gly-rich.|Collagen-like 3.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ACACTCACCCGCATGCCGACC	0.592										HNSCC(7;0.00092)			4	153	---	---	---	---	PASS
POLR1E	64425	broad.mit.edu	37	9	37503236	37503236	+	3'UTR	SNP	A	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37503236A>C	uc003zzz.1	+	11					POLR1E_uc003zzy.1_3'UTR|POLR1E_uc011lqk.1_3'UTR|uc004aaa.2_5'Flank	NM_022490	NP_071935	Q9GZS1	RPA49_HUMAN	RNA polymerase I associated factor 53						rRNA transcription	cell junction|cytoplasm|nucleolus	DNA binding|DNA-directed RNA polymerase activity|protein binding				0				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		TGGCTGCATCACAGCCACTGG	0.408													10	16	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27294432	27294432	+	3'UTR	SNP	T	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27294432T>A	uc001ith.2	-	34					ANKRD26_uc001itg.2_3'UTR|ANKRD26_uc009xku.1_3'UTR	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						CAAAAATACGTTCCTTTAATA	0.234													27	69	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50833615	50833615	+	Silent	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50833615C>T	uc001jhz.2	+	6	1002	c.849C>T	c.(847-849)CCC>CCT	p.P283P	CHAT_uc001jhv.1_Silent_p.P165P|CHAT_uc001jhx.1_Silent_p.P165P|CHAT_uc001jhy.1_Silent_p.P165P|CHAT_uc001jia.2_Silent_p.P165P|CHAT_uc010qgs.1_Silent_p.P165P	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	283					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	ACCGGCTCCCCGGCCATACCC	0.587													13	30	---	---	---	---	PASS
CELF1	10658	broad.mit.edu	37	11	47493672	47493672	+	Intron	SNP	A	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47493672A>G	uc001nfl.2	-						CELF1_uc001nfk.1_5'Flank|CELF1_uc001nfm.2_Intron|CELF1_uc001nfn.2_Intron|CELF1_uc001nfo.1_Intron|CELF1_uc010rhm.1_Intron|CELF1_uc001nfp.2_Intron|CELF1_uc001nfq.1_Intron|CELF1_uc001nfr.1_3'UTR	NM_001025596	NP_001020767	Q92879	CELF1_HUMAN	CUG triplet repeat, RNA-binding protein 1						embryo development|mRNA splice site selection|regulation of RNA splicing|RNA interference	cytoplasm|nucleus|ribonucleoprotein complex	BRE binding|mRNA binding|nucleotide binding|translation repressor activity, nucleic acid binding			central_nervous_system(2)|ovary(1)	3						AGTGGCAGGGATCAGGGTCCA	0.562													10	96	---	---	---	---	PASS
MS4A3	932	broad.mit.edu	37	11	59837725	59837725	+	3'UTR	SNP	T	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59837725T>C	uc001nom.2	+	7					MS4A3_uc001non.2_3'UTR|MS4A3_uc001noo.2_3'UTR	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member							endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				ACCTCCTTAATTCTGAGAGCA	0.383													41	54	---	---	---	---	PASS
DAGLA	747	broad.mit.edu	37	11	61495685	61495685	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61495685C>T	uc001nsa.2	+	7	808	c.697C>T	c.(697-699)CCA>TCA	p.P233S		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	233	Cytoplasmic (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		TGACATTGTGCCATCCGACAT	0.632													4	177	---	---	---	---	PASS
CDK2AP2	10263	broad.mit.edu	37	11	67275233	67275233	+	Intron	SNP	A	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67275233A>T	uc001oma.2	-						PITPNM1_uc001oly.2_5'Flank|PITPNM1_uc001olz.2_5'Flank|CDK2AP2_uc009yry.2_Intron|CDK2AP2_uc001omb.2_Missense_Mutation_p.S13T	NM_005851	NP_005842	O75956	CDKA2_HUMAN	cyclin-dependent kinase 2 associated protein 2												0						CAAGCCCAGGACCGGGTTCGC	0.622													7	15	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	71513917	71513917	+	RNA	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71513917C>T	uc001oqx.1	-	3		c.683G>A								Homo sapiens cDNA clone IMAGE:5297769.																		TTGAAGTTCACAGCACACGCA	0.572													4	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	71513918	71513918	+	RNA	SNP	A	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71513918A>G	uc001oqx.1	-	3		c.682T>C								Homo sapiens cDNA clone IMAGE:5297769.																		TGAAGTTCACAGCACACGCAG	0.572													4	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	71513938	71513938	+	RNA	SNP	T	A	A	rs139766133	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71513938T>A	uc001oqx.1	-	3		c.662A>T								Homo sapiens cDNA clone IMAGE:5297769.																		GGCAAACAGCTCCTGAACATG	0.582													4	56	---	---	---	---	PASS
HNRNPA1	3178	broad.mit.edu	37	12	54676248	54676248	+	Silent	SNP	T	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54676248T>G	uc001sfl.2	+	5	665	c.561T>G	c.(559-561)GCT>GCG	p.A187A	CBX5_uc001sfk.3_5'Flank|CBX5_uc001sfi.3_5'Flank|HNRNPA1_uc001sfm.2_Silent_p.A187A|HNRNPA1_uc009zng.2_Silent_p.A187A|HNRNPA1_uc009znh.2_Silent_p.A187A|HNRNPA1_uc009zni.2_Silent_p.A187A|HNRNPA1_uc001sfn.2_Silent_p.A187A|HNRNPA1_uc001sfo.3_RNA|HNRNPA1_uc001sfp.1_Silent_p.A142A|HNRNPA1_uc009znj.1_Silent_p.A142A	NM_031157	NP_112420	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	187					interspecies interaction between organisms|mRNA transport|nuclear import	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|single-stranded DNA binding			skin(2)|ovary(1)	3						AAGAGATGGCTAGTGCTTCAT	0.353													5	112	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57111810	57111810	+	Intron	SNP	T	G	G	rs2926745		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57111810T>G	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Silent_p.P1168P|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Intron|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						GGGCCCCTTTTGGGGGTGGGG	0.627			T	BCL6	NHL								9	273	---	---	---	---	PASS
C12orf12	196477	broad.mit.edu	37	12	91347412	91347412	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91347412C>A	uc001tbj.2	-	1	1542	c.1108G>T	c.(1108-1110)GAG>TAG	p.E370*		NM_152638	NP_689851	Q8TC90	CL012_HUMAN	hypothetical protein LOC196477	370	Glu-rich.									central_nervous_system(1)|pancreas(1)	2						TCTTCAGCCTCTACGAAGATT	0.383													5	262	---	---	---	---	PASS
NEK3	4752	broad.mit.edu	37	13	52709999	52709999	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52709999C>T	uc001vgi.2	-	16	1410	c.1175G>A	c.(1174-1176)GGT>GAT	p.G392D	NEK3_uc001vgg.2_Missense_Mutation_p.G369D|NEK3_uc001vgh.2_Missense_Mutation_p.G396D|NEK3_uc010tgx.1_RNA|NEK3_uc010tgy.1_Missense_Mutation_p.G375D	NM_152720	NP_689933	P51956	NEK3_HUMAN	NIMA-related kinase 3 isoform a	392					cell division|mitosis	nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TACAGAACCACCTAGTTGCAA	0.353													58	159	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106234219	106234219	+	Intron	SNP	C	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106234219C>G	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						TGGTGATGGTCGTCCACAGCC	0.607													2	10	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107013080	107013080	+	RNA	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107013080C>T	uc010tyt.1	-	169		c.7977G>A								Parts of antibodies, mostly variable regions.												0						ATAAGCTTTGCTTCTAATGAA	0.493													54	55	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3777576	3777576	+	3'UTR	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3777576G>A	uc002cvv.2	-	31					CREBBP_uc002cvw.2_3'UTR	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a						cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TATATTCTTTGTATTGTTTCT	0.378			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				11	12	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20331781	20331781	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20331781G>A	uc002dgv.2	-	6	753	c.670C>T	c.(670-672)CAG>TAG	p.Q224*	GP2_uc002dgw.2_Nonsense_Mutation_p.Q221*|GP2_uc002dgx.2_Nonsense_Mutation_p.Q77*|GP2_uc002dgy.2_Nonsense_Mutation_p.Q74*	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	224	EGF-like.					anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						AGCTGAGGCTGCAAACTGTGG	0.532													23	39	---	---	---	---	PASS
POLR2A	5430	broad.mit.edu	37	17	7416113	7416113	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7416113G>A	uc002ghf.3	+	28	4861	c.4627G>A	c.(4627-4629)GCA>ACA	p.A1543T		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	1543					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				GACCCCAGGGGCAGCCGGCTT	0.637													64	152	---	---	---	---	PASS
POLR2A	5430	broad.mit.edu	37	17	7416181	7416181	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7416181G>A	uc002ghf.3	+	28	4929	c.4695G>A	c.(4693-4695)TGG>TGA	p.W1565*		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	1565					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				CCCCTGCCTGGTCTCCCACAC	0.632													61	138	---	---	---	---	PASS
KRBA2	124751	broad.mit.edu	37	17	8273274	8273274	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8273274T>A	uc002glf.1	-	2	663	c.657A>T	c.(655-657)AAA>AAT	p.K219N	KRBA2_uc002glg.1_Missense_Mutation_p.K136N	NM_213597	NP_998762	Q6ZNG9	KRBA2_HUMAN	KRAB-A domain containing 2	219					DNA integration|regulation of transcription, DNA-dependent	intracellular	DNA binding				0						CATTCCCATATTTTCCTTGCA	0.433													85	165	---	---	---	---	PASS
STX8	9482	broad.mit.edu	37	17	9153958	9153958	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9153958C>T	uc002glx.2	-	8	798	c.648G>A	c.(646-648)ATG>ATA	p.M216I		NM_004853	NP_004844	Q9UNK0	STX8_HUMAN	syntaxin 8	216	Helical; Anchor for type IV membrane protein; (Potential).				transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1						TCACCATGATCATCCCTGGAA	0.458													5	9	---	---	---	---	PASS
HNF1B	6928	broad.mit.edu	37	17	36093779	36093779	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36093779T>C	uc002hok.3	-	3	801	c.580A>G	c.(580-582)ACA>GCA	p.T194A	HNF1B_uc010wdi.1_Intron|HNF1B_uc010cve.1_Missense_Mutation_p.T2A	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1	194					endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CTTTTGTCTGTCATATTTCCA	0.448									Hereditary_Prostate_Cancer				4	135	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587576	43587576	+	Intron	SNP	A	G	G	rs2684618		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587576A>G	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						tctgaaaagaaaagaaaaaaa	0.154													3	63	---	---	---	---	PASS
UBE2O	63893	broad.mit.edu	37	17	74392558	74392558	+	Silent	SNP	G	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74392558G>T	uc002jrm.3	-	14	2525	c.2460C>A	c.(2458-2460)ATC>ATA	p.I820I	UBE2O_uc002jrn.3_Silent_p.I820I|UBE2O_uc002jrl.3_Silent_p.I424I	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	820	Potential.						ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						GGCTCTCCAGGATCTTGATGG	0.617													107	260	---	---	---	---	PASS
TUBB6	84617	broad.mit.edu	37	18	12325410	12325410	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12325410T>C	uc002kqw.2	+	4	667	c.622T>C	c.(622-624)TAT>CAT	p.Y208H	TUBB6_uc002kqv.2_Missense_Mutation_p.Y136H|TUBB6_uc010dld.2_RNA|TUBB6_uc002kqx.2_Missense_Mutation_p.Y171H|TUBB6_uc002kqy.2_Intron	NM_032525	NP_115914	Q9BUF5	TBB6_HUMAN	tubulin, beta 6	208					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0				READ - Rectum adenocarcinoma(1;0.0649)		CGAGGCGCTCTATGACATCTG	0.607													3	191	---	---	---	---	PASS
TMX3	54495	broad.mit.edu	37	18	66348333	66348333	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66348333G>A	uc002lkf.2	-	14	1055	c.920C>T	c.(919-921)CCA>CTA	p.P307L	TMX3_uc010xez.1_Missense_Mutation_p.P166L	NM_019022	NP_061895	Q96JJ7	TMX3_HUMAN	thioredoxin domain containing 10 precursor	307	Lumenal (Potential).				cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			skin(1)	1						AACTACAGTTGGGACTGTCAA	0.294													67	133	---	---	---	---	PASS
ZFR2	23217	broad.mit.edu	37	19	3813939	3813939	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3813939C>G	uc002lyw.2	-	14	2133	c.2121G>C	c.(2119-2121)GAG>GAC	p.E707D		NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1	707						intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		AGACCTCATACTCATCCTCGG	0.537													18	42	---	---	---	---	PASS
ZFR2	23217	broad.mit.edu	37	19	3813948	3813948	+	Silent	SNP	G	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3813948G>T	uc002lyw.2	-	14	2124	c.2112C>A	c.(2110-2112)ACC>ACA	p.T704T		NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1	704						intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		ACTCATCCTCGGTCACCATCT	0.507													15	38	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602352	10602352	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602352A>G	uc002moq.1	-	3	1382	c.1226T>C	c.(1225-1227)ATG>ACG	p.M409T	KEAP1_uc002mop.1_Missense_Mutation_p.M127T|KEAP1_uc002mor.1_Missense_Mutation_p.M409T	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	409	Kelch 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			GGGCACGCTCATGGGGGCGCA	0.662													8	12	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22270900	22270900	+	Silent	SNP	C	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22270900C>A	uc010ecx.2	+	4	517	c.348C>A	c.(346-348)GGC>GGA	p.G116G	ZNF257_uc010ecy.2_Silent_p.G84G	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	116					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				TAAGAAAGGGCTGTAAAAGTG	0.348													38	99	---	---	---	---	PASS
ZNF568	374900	broad.mit.edu	37	19	37428114	37428114	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37428114G>A	uc002ofc.2	+	6	843	c.328G>A	c.(328-330)GAG>AAG	p.E110K	ZNF568_uc010efg.2_Missense_Mutation_p.E96K|ZNF568_uc010xtn.1_Missense_Mutation_p.E34K|ZNF568_uc002ofd.2_Missense_Mutation_p.E34K|ZNF568_uc010efe.2_Missense_Mutation_p.E34K|ZNF568_uc010eff.1_Missense_Mutation_p.E96K	NM_198539	NP_940941	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	110	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGGGTGATGGAGGAAGAAAT	0.338													25	61	---	---	---	---	PASS
PSG1	5669	broad.mit.edu	37	19	43376181	43376181	+	Silent	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43376181G>A	uc002ovb.2	-	3	585	c.447C>T	c.(445-447)CCC>CCT	p.P149P	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Silent_p.P149P|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_RNA|PSG1_uc002our.1_Silent_p.P149P|PSG1_uc010eio.1_Silent_p.P149P|PSG1_uc002oux.1_Silent_p.P78P|PSG1_uc002ouy.1_Silent_p.P149P|PSG1_uc002ouz.1_Silent_p.P149P|PSG1_uc002ova.1_Intron|PSG1_uc002ovc.2_Intron|PSG1_uc002ovd.1_Silent_p.P149P	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	149	Ig-like C2-type 1.				female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				TGGAGATGGAGGGCTTAGGAG	0.512													111	192	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49797187	49797187	+	Silent	SNP	C	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49797187C>T	uc002pmz.2	-	9	1749	c.1515G>A	c.(1513-1515)TTG>TTA	p.L505L	SLC6A16_uc002pna.2_Silent_p.L505L	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	505	Helical; Name=8; (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		CCATGGCCAGCAACATCAGGA	0.498													67	156	---	---	---	---	PASS
NCOA3	8202	broad.mit.edu	37	20	46268421	46268421	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46268421C>G	uc002xtk.2	+	15	3013	c.2808C>G	c.(2806-2808)AAC>AAG	p.N936K	NCOA3_uc010ght.1_Missense_Mutation_p.N931K|NCOA3_uc002xtl.2_Missense_Mutation_p.N936K|NCOA3_uc002xtm.2_Missense_Mutation_p.N936K|NCOA3_uc002xtn.2_Missense_Mutation_p.N936K|NCOA3_uc010zyc.1_Missense_Mutation_p.N731K	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	936					androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						TGAATTCAAACTCCATGGGAA	0.493													109	244	---	---	---	---	PASS
SUMO1P1	391257	broad.mit.edu	37	20	52491953	52491953	+	RNA	SNP	C	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52491953C>A	uc010gik.2	-	1		c.296G>T				NR_002189				Homo sapiens SUMO1 pseudogene 1, mRNA (cDNA clone IMAGE:6619211).												0						AGTACGATTTCTTGAGTTTCT	0.388													9	25	---	---	---	---	PASS
DSCR6	53820	broad.mit.edu	37	21	38385914	38385914	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38385914G>C	uc002yvv.2	+	3	445	c.235G>C	c.(235-237)GTA>CTA	p.V79L	DSCR6_uc011aec.1_5'UTR|DSCR6_uc010gnd.2_Intron	NM_018962	NP_061835	P57055	DSCR6_HUMAN	Down syndrome critical region protein 6	79	Ripply homology domain.					nucleus				breast(1)	1		Myeloproliferative disorder(46;0.0632)				TCAGCATCCTGTAAGGTAATA	0.388													39	100	---	---	---	---	PASS
CECR1	51816	broad.mit.edu	37	22	17690279	17690279	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17690279G>A	uc002zmk.1	-	1	501	c.289C>T	c.(289-291)CAA>TAA	p.Q97*	CECR1_uc010gqu.1_Nonsense_Mutation_p.Q97*|CECR1_uc011agi.1_Nonsense_Mutation_p.Q55*|CECR1_uc011agj.1_Nonsense_Mutation_p.Q55*	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1	97	Dimerization.				adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				TTAAACACTTGACTTCTCTCA	0.483													40	69	---	---	---	---	PASS
SEPT3	55964	broad.mit.edu	37	22	42383654	42383654	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42383654G>T	uc003bbr.3	+	5	580	c.442G>T	c.(442-444)GAG>TAG	p.E148*	WBP2NL_uc011ape.1_Intron|SEPT3_uc003bbs.3_Nonsense_Mutation_p.E148*|SEPT3_uc010gyr.2_Nonsense_Mutation_p.E84*|SEPT3_uc011apj.1_Nonsense_Mutation_p.E84*|SEPT3_uc010gys.2_5'UTR	NM_145733	NP_663786	Q9UH03	SEPT3_HUMAN	septin 3 isoform A	148					cell cycle|cytokinesis	cell junction|septin complex	GTP binding				0						GTACATCAATGAGCAGTACGA	0.507													55	113	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9575	9575	+	RNA	SNP	G	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9575G>A	uc011mfi.1	+	1		c.913G>A			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		GGCATCACCCCGCTAAATCCC	0.498													5	3	---	---	---	---	PASS
NECAP2	55707	broad.mit.edu	37	1	16782519	16782520	+	Intron	INS	-	T	T	rs139186833		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16782519_16782520insT	uc001ayo.2	+						NECAP2_uc001ayp.3_Intron|NECAP2_uc010ocd.1_Intron|NECAP2_uc001ayq.2_Intron	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1						endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		Gttttcttttcttttttttttt	0.218													6	3	---	---	---	---	
RLF	6018	broad.mit.edu	37	1	40661122	40661122	+	Intron	DEL	A	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40661122delA	uc001cfc.3	+							NM_012421	NP_036553	Q13129	RLF_HUMAN	rearranged L-myc fusion						chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			ovary(2)|pancreas(1)	3	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			ttctgtctttaaaaaaaaaaa	0.144													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57498866	57498867	+	Intron	INS	-	AT	AT	rs1342436		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57498866_57498867insAT	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						cacacacacacgtgtacataca	0.312													7	4	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62613787	62613788	+	Intron	DEL	TG	-	-	rs66743140		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62613787_62613788delTG	uc001dab.2	+						INADL_uc001dac.2_Intron|INADL_uc009wag.2_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						agtgagacactgtctttaaaaa	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	64203951	64203951	+	IGR	DEL	C	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64203951delC								PGM1 (78037 upstream) : ROR1 (35739 downstream)																							ttccttccttctttctttctt	0.000													4	2	---	---	---	---	
SGIP1	84251	broad.mit.edu	37	1	67132966	67132967	+	Intron	INS	-	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67132966_67132967insA	uc001dcr.2	+						SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|uc010ope.1_Intron	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting						positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TACACATAACTAAAACTTACAT	0.371													8	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	78241853	78241854	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs12140321	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78241853_78241854insGAAGGAAG								USP33 (16316 upstream) : FAM73A (3455 downstream)																							aaagaaagaaagaaggaaggaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	92066062	92066062	+	IGR	DEL	A	-	-	rs144829580		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92066062delA								CDC7 (74742 upstream) : HSP90B3P (34506 downstream)																							CCTTTCATTTAAAAAAAAAAA	0.294													9	6	---	---	---	---	
GSTM4	2948	broad.mit.edu	37	1	110196902	110196903	+	5'Flank	INS	-	G	G			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110196902_110196903insG	uc001dyf.2	+						GSTM4_uc009wfi.2_5'Flank|GSTM4_uc001dyg.2_5'Flank|GSTM4_uc009wfj.2_5'Flank|GSTM4_uc001dyh.2_5'Flank|GSTM2_uc001dyi.2_5'Flank	NM_000850	NP_000841	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4 isoform 1						xenobiotic metabolic process	endoplasmic reticulum membrane	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	gaaggaaggaaggaaggaagga	0.139													3	3	---	---	---	---	
C1orf9	51430	broad.mit.edu	37	1	172502728	172502728	+	Intron	DEL	A	-	-	rs55696309		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172502728delA	uc001giq.3	+						C1orf9_uc010pmm.1_Intron|C1orf9_uc009wwd.2_Intron|C1orf9_uc010pmn.1_Intron|C1orf9_uc010pmo.1_Intron	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein						multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		TTTGGCTTTTAGGGTCCGGGT	0.572													3	3	---	---	---	---	
RAB3GAP2	25782	broad.mit.edu	37	1	220387087	220387087	+	Intron	DEL	A	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220387087delA	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron|RAB3GAP2_uc010pum.1_Intron	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		ggggggggggagagagagAGA	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	222986696	222986699	+	IGR	DEL	CACA	-	-	rs72212579		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222986696_222986699delCACA								FAM177B (62695 upstream) : DISP1 (115084 downstream)																							CCAGCGTGGGcacacacacacaca	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293343	12293351	+	Intron	DEL	TTCCTTCCC	-	-	rs112549370		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293343_12293351delTTCCTTCCC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		cttcattcctttccttcccttccttccct	0.000													8	6	---	---	---	---	
DTNB	1838	broad.mit.edu	37	2	25650050	25650053	+	Intron	DEL	ACAC	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25650050_25650053delACAC	uc002rgh.2	-						DTNB_uc002rgg.2_Intron|DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgr.1_Intron|DTNB_uc002rgp.1_Intron	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ccatctcaaaacacacacacacac	0.059													4	2	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113127938	113127939	+	Intron	DEL	TC	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113127938_113127939delTC	uc002ths.1	-						RGPD8_uc010fkk.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						GGGGGGGGGTTCtttttttttt	0.173													6	3	---	---	---	---	
UGGT1	56886	broad.mit.edu	37	2	128896088	128896089	+	Intron	INS	-	A	A	rs112766490		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128896088_128896089insA	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						aaactctgtctaaaaaaaaaaa	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216429208	216429211	+	IGR	DEL	TGTG	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216429208_216429211delTGTG								FN1 (128417 upstream) : MREG (378104 downstream)																							aaatcatatttgtgtgtgtgtgtg	0.088													3	3	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071889	220071889	+	Intron	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071889delT	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGGGGGGTGGTCAGCGGC	0.627													4	2	---	---	---	---	
SERPINE2	5270	broad.mit.edu	37	2	224866712	224866716	+	Intron	DEL	CAGAT	-	-	rs145573218	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866712_224866716delCAGAT	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ttttttcccccagatagagactcgt	0.132													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	234699319	234699319	+	IGR	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234699319delT								UGT1A10 (17370 upstream) : HJURP (46168 downstream)																							cctccctccctcccttccttc	0.000													6	3	---	---	---	---	
SH3BP4	23677	broad.mit.edu	37	2	235949909	235949910	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235949909_235949910delCA	uc002vvp.2	+	4	889_890	c.496_497delCA	c.(496-498)CAGfs	p.Q166fs	SH3BP4_uc010fym.2_Frame_Shift_Del_p.Q166fs|SH3BP4_uc002vvq.2_Frame_Shift_Del_p.Q166fs	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	166					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GAATGGGGTCCAGACCAATCCA	0.505													152	71	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237220341	237220342	+	IGR	DEL	GT	-	-	rs34544704		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237220341_237220342delGT								ASB18 (47353 upstream) : IQCA1 (12452 downstream)																							GATGGGgtgcgtgtgtgtgtgt	0.426													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188248	10188248	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188248delA	uc003bvc.2	+	2	604	c.391delA	c.(391-393)AACfs	p.N131fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	131	Involved in binding to CCT complex.		N -> T (in VHLD; type I).|N -> K (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.N131fs*28(4)|p.N131fs*27(2)|p.N131K(2)|p.N131fs*2(2)|p.N131fs*10(1)|p.N131*(1)|p.?fs(1)|p.N131Y(1)|p.V130fs*28(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GCTTCTGGTTAACCAAACTGA	0.418		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				127	113	---	---	---	---	
SATB1	6304	broad.mit.edu	37	3	18457303	18457304	+	Intron	INS	-	T	T	rs112868614	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18457303_18457304insT	uc003cbh.2	-						SATB1_uc003cbi.2_Intron|SATB1_uc003cbj.2_Intron	NM_002971	NP_002962	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1						cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						TTGTGTGTGTGGGGGGGGGGAT	0.347													2	7	---	---	---	---	
ITGA9	3680	broad.mit.edu	37	3	37821430	37821442	+	Frame_Shift_Del	DEL	ACTGTAACTTTAG	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37821430_37821442delACTGTAACTTTAG	uc003chd.2	+	25	2758_2770	c.2705_2717delACTGTAACTTTAG	c.(2704-2718)CACTGTAACTTTAGTfs	p.H902fs		NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	902_906	Extracellular (Potential).				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		CTAACAGCACACTGTAACTTTAGTGCTCTTGCT	0.371													131	75	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52651382	52651383	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52651382_52651383insA	uc003des.2	-	14	1725_1726	c.1713_1714insT	c.(1711-1716)ATTGAGfs	p.I571fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Ins_p.I571fs|PBRM1_uc003der.2_Frame_Shift_Ins_p.I539fs|PBRM1_uc003det.2_Frame_Shift_Ins_p.I586fs|PBRM1_uc003deu.2_Frame_Shift_Ins_p.I586fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Ins_p.I571fs|PBRM1_uc010hmk.1_Frame_Shift_Ins_p.I571fs|PBRM1_uc003dey.2_Frame_Shift_Ins_p.I571fs|PBRM1_uc003dez.1_Frame_Shift_Ins_p.I571fs|PBRM1_uc003dfb.1_Frame_Shift_Ins_p.I484fs|PBRM1_uc003dfc.2_5'Flank	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	571_572	Bromo 4.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.I571fs*2(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATGTTATGCTCAATTATTTTCA	0.401			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								92	55	---	---	---	---	
ARL13B	200894	broad.mit.edu	37	3	93699571	93699572	+	Intron	DEL	GT	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93699571_93699572delGT	uc003drc.2	+						ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1								GTP binding				0						TTGTTAAAAAgtgtgtgtgtgt	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57554288	57554290	+	IGR	DEL	AGG	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57554288_57554290delAGG								HOPX (6416 upstream) : SPINK2 (121744 downstream)																							gaaggaaaaaaggagggagggag	0.000													2	4	---	---	---	---	
SHROOM3	57619	broad.mit.edu	37	4	77669967	77669968	+	Intron	INS	-	T	T	rs34047499		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77669967_77669968insT	uc011cbx.1	+						SHROOM3_uc003hkg.2_Intron	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			tctgactctgcttttttttttt	0.327													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	133762964	133762965	+	IGR	INS	-	C	C	rs61507474	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133762964_133762965insC								None (None upstream) : PCDH10 (307505 downstream)																							ccttccttcctccctccctccc	0.000													4	2	---	---	---	---	
CEP72	55722	broad.mit.edu	37	5	620050	620051	+	Intron	INS	-	TGGTAAT	TGGTAAT	rs144222017	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:620050_620051insTGGTAAT	uc003jbf.2	+						CEP72_uc011clz.1_Intron	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			CATTTTTCTACTTTTCCTGGTA	0.406													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2681753	2681754	+	IGR	INS	-	GGAA	GGAA	rs10687039		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2681753_2681754insGGAA								IRX4 (798873 upstream) : IRX2 (64527 downstream)																							gaaggaaggaagaaaaggaaag	0.005													6	4	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21344860	21344871	+	Intron	DEL	CCTCCCTCCCTT	-	-	rs62348353		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21344860_21344871delCCTCCCTCCCTT	uc011cnn.1	+											Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						tccttccttccctccctcccttcctccctccc	0.000													4	2	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37292320	37292321	+	Intron	DEL	TT	-	-	rs34382591		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37292320_37292321delTT	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CATTTGAAGAtttttttttttt	0.168													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	58184883	58184906	+	IGR	DEL	AAGAAAGGAAGGAAGGAAGGAAGG	-	-	rs58863015	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58184883_58184906delAAGAAAGGAAGGAAGGAAGGAAGG								RAB3C (37478 upstream) : PDE4D (79960 downstream)																							gaaagaaagaaagaaaggaaggaaggaaggaaggaaggaaggaa	0.071													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	85703790	85703793	+	IGR	DEL	AAGG	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85703790_85703793delAAGG								NBPF22P (110428 upstream) : COX7C (209991 downstream)																							gggagggagaaaggaaggaaggaa	0.137													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99681345	99681346	+	IGR	INS	-	AGGAAGGG	AGGAAGGG	rs811252		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99681345_99681346insAGGAAGGG								None (None upstream) : LOC100133050 (33863 downstream)																							ggaaggaaggaagggagggagg	0.074													5	4	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131306104	131306105	+	Intron	INS	-	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131306104_131306105insT	uc010jdo.1	-						ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Intron|ACSL6_uc003kvy.1_Intron|ACSL6_uc003kwb.2_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Intron|ACSL6_uc003kvw.1_Intron|ACSL6_uc010jdn.1_Intron	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGAAGTGCTAttttttttttt	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180651908	180651909	+	5'UTR	INS	-	AAC	AAC			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180651908_180651909insAAC	uc003mnb.1	-	2					TRIM41_uc003mnc.1_Intron|TRIM41_uc003mnd.1_Intron|TRIM41_uc003mne.1_Intron|TRIM41_uc003mnf.1_Intron					Homo sapiens cDNA FLJ36305 fis, clone THYMU2004677.																		ACCCACCAAAGAACCTCATGGT	0.470													28	17	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51854697	51854699	+	Intron	DEL	GGG	-	-	rs72417168	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51854697_51854699delGGG	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					gaaggaaggagggaggaaggaag	0.123													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	63903575	63903581	+	IGR	DEL	AAGGAGC	-	-	rs70996279		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63903575_63903581delAAGGAGC								KHDRBS2 (907475 upstream) : LGSN (82276 downstream)																							GAGATTCCAGAAGGAGCAAGGAGCAGG	0.391													6	3	---	---	---	---	
SNX14	57231	broad.mit.edu	37	6	86282278	86282279	+	Intron	INS	-	AAATACC	AAATACC	rs144690652	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86282278_86282279insAAATACC	uc003pkr.2	-						SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		ATCAGAGAAAAAAATACCACAT	0.252													6	3	---	---	---	---	
LAMA4	3910	broad.mit.edu	37	6	112463694	112463695	+	Intron	INS	-	A	A	rs141758766	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112463694_112463695insA	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TGAAAGAAAGCAAAAAAAAAGT	0.391													6	4	---	---	---	---	
MYB	4602	broad.mit.edu	37	6	135518643	135518646	+	Intron	DEL	CTAA	-	-	rs72408435		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135518643_135518646delCTAA	uc003qfc.2	+						MYB_uc003qfh.2_Intron|MYB_uc003qfi.2_Intron|MYB_uc010kgi.2_Intron|MYB_uc003qfq.2_Intron|MYB_uc010kgj.2_Intron|MYB_uc003qfo.2_Intron|MYB_uc003qfu.2_Intron|MYB_uc003qfl.2_Intron|MYB_uc003qfv.2_Intron|MYB_uc003qfz.2_Intron|MYB_uc003qfx.2_Intron|MYB_uc003qga.2_Intron|MYB_uc003qgb.2_Intron|MYB_uc010kgk.2_Intron|MYB_uc003qfd.2_Intron|MYB_uc003qfe.2_Intron|MYB_uc003qfg.2_Intron|MYB_uc003qff.2_Intron|MYB_uc003qfj.2_Intron|MYB_uc003qfm.2_Intron|MYB_uc003qfp.2_Intron|MYB_uc003qfn.2_Intron|MYB_uc003qfk.2_Intron|MYB_uc003qfr.2_Intron|MYB_uc003qfs.2_Intron|MYB_uc003qft.2_Intron|MYB_uc003qfw.2_Intron|MYB_uc003qfy.2_Intron|MYB_uc003qgc.2_Intron|MYB_uc003qfb.1_Intron	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog						blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TGTCTGCAGGCTAACTGTTGATTT	0.377			T	NFIB	adenoid cystic carcinoma								3	7	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	6825810	6825811	+	Intron	DEL	TT	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6825810_6825811delTT	uc003sqw.1	+						RSPH10B2_uc010ktk.1_Intron|RSPH10B2_uc011jxc.1_Intron|RSPH10B2_uc010ktl.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						TCACTGATGCtttttttttttt	0.183													4	2	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6840334	6840334	+	Intron	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6840334delT	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		TATAAAGTCATTTTTTTTTTT	0.204													8	4	---	---	---	---	
SPDYE6	729597	broad.mit.edu	37	7	101992395	101992395	+	Intron	DEL	G	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101992395delG	uc011kkp.1	-						SPDYE6_uc003uzb.2_Intron	NM_001146210	NP_001139682	P0CI01	SPDE6_HUMAN	speedy homolog E6												0						aaaaaaaaaagaCTGTAGGAG	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	127248065	127248066	+	IGR	DEL	AG	-	-	rs138526136		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127248065_127248066delAG								FSCN3 (6222 upstream) : PAX4 (2280 downstream)																							acacacacacagacacacacac	0.168													4	2	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144380279	144380279	+	Intron	DEL	T	-	-	rs137896700		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144380279delT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	tttctgcatcttttttttttt	0.129													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148375038	148375045	+	IGR	DEL	AAGGAAGG	-	-	rs75124216		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148375038_148375045delAAGGAAGG								C7orf33 (62087 upstream) : CUL1 (19961 downstream)																							aaaagaaagaaaggaaggaaggaaggaa	0.000													3	3	---	---	---	---	
GIMAP2	26157	broad.mit.edu	37	7	150384350	150384351	+	Intron	INS	-	TTTG	TTTG	rs146938233	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150384350_150384351insTTTG	uc003who.2	+						GIMAP1_uc003whp.2_Intron	NM_015660	NP_056475	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2							integral to membrane	GTP binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTTTTGTtttctttgtttgttt	0.213													5	3	---	---	---	---	
GALNTL5	168391	broad.mit.edu	37	7	151678630	151678633	+	Intron	DEL	CCTT	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151678630_151678633delCCTT	uc003wkp.2	+						GALNTL5_uc003wkq.2_Intron|GALNTL5_uc003wkr.2_Intron|GALNTL5_uc003wks.2_Intron|GALNTL5_uc010lqf.2_Intron	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		ATCTCtcttcccttccttccttcc	0.216													4	2	---	---	---	---	
GPR124	25960	broad.mit.edu	37	8	37674110	37674111	+	Intron	DEL	AA	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37674110_37674111delAA	uc003xkj.2	+						GPR124_uc003xki.2_Intron|GPR124_uc010lvy.2_Intron	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor						central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			actccgtctcaaacacacacac	0.000													4	2	---	---	---	---	
LYN	4067	broad.mit.edu	37	8	56888886	56888886	+	Intron	DEL	A	-	-	rs35717306		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56888886delA	uc003xsk.3	+						LYN_uc003xsl.3_Intron	NM_002350	NP_002341	P07948	LYN_HUMAN	Yamaguchi sarcoma viral (v-yes-1) oncogene						erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)			actccatctcaaaaaaaaaaa	0.104													7	4	---	---	---	---	
UQCRB	7381	broad.mit.edu	37	8	97243937	97243937	+	Intron	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97243937delT	uc003yhq.3	-						UQCRB_uc011lgt.1_Intron|UQCRB_uc010mbc.2_Intron	NM_006294	NP_006285	P14927	QCR7_HUMAN	ubiquinol-cytochrome c reductase binding						aerobic respiration|mitochondrial electron transport, ubiquinol to cytochrome c	mitochondrial respiratory chain	ubiquinol-cytochrome-c reductase activity			ovary(1)	1	Breast(36;5.16e-05)					AATGAACATGTTTCTCTTGTT	0.279													59	26	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1188772	1188773	+	IGR	INS	-	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1188772_1188773insT								DMRT2 (131219 upstream) : SMARCA2 (826569 downstream)																							cttccttcttcctttctttctg	0.030													4	2	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14748627	14748627	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14748627delA	uc003zlm.2	-	31	6158	c.5568delT	c.(5566-5568)CATfs	p.H1856fs	FREM1_uc010mic.2_RNA|FREM1_uc003zlk.2_Intron|FREM1_uc003zll.2_Frame_Shift_Del_p.H392fs	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1856					cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		AATATGAAGGATGGCATTGTC	0.507													121	120	---	---	---	---	
SIT1	27240	broad.mit.edu	37	9	35650085	35650089	+	Intron	DEL	ATGCA	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35650085_35650089delATGCA	uc003zxe.1	-						SIT1_uc003zxf.1_Intron	NM_014450	NP_055265	Q9Y3P8	SIT1_HUMAN	SHP2-interacting transmembrane adaptor protein						regulation of T cell activation|signal transduction	integral to plasma membrane	kinase binding|SH2 domain binding				0			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAGCCTGGAGATGCAAGGCTGTTAG	0.610													15	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44084401	44084402	+	IGR	INS	-	ATCTT	ATCTT			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44084401_44084402insATCTT								FAM75A6 (453671 upstream) : FAM27C (905834 downstream)																							TAAAGACTATATATAAAAATAA	0.277													11	9	---	---	---	---	
ZNF169	169841	broad.mit.edu	37	9	97054922	97054923	+	Intron	INS	-	GC	GC	rs74578608	byFrequency	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97054922_97054923insGC	uc004aum.1	+						ZNF169_uc004aun.2_Intron|ZNF169_uc004auo.2_Intron	NM_194320	NP_919301	Q14929	ZN169_HUMAN	zinc finger protein 169							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				tgtgtgtgtgtgcgcgtgCACA	0.396													4	2	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113243811	113243817	+	Intron	DEL	CTGTCTA	-	-	rs3841727		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113243811_113243817delCTGTCTA	uc010mtz.2	-						SVEP1_uc010mua.1_Intron|SVEP1_uc004beu.2_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						AGGACTCCTCCTGTCTATCGCTATTTC	0.348													4	6	---	---	---	---	
C9orf114	51490	broad.mit.edu	37	9	131587330	131587330	+	Splice_Site	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131587330delT	uc004bwd.2	-	8	666	c.640_splice	c.e8-1	p.E214_splice	C9orf114_uc004bwe.2_Splice_Site_p.E214_splice|C9orf114_uc010mym.2_Intron	NM_016390	NP_057474	Q5T280	CI114_HUMAN	hypothetical protein LOC51490												0						CTTCACCTCCTGGGGAGAAGC	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19414238	19414239	+	IGR	INS	-	CATCCATG	CATCCATG			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19414238_19414239insCATCCATG								ARL5B (447298 upstream) : PLXDC2 (691133 downstream)																							ttccttccttccttccttcctt	0.040													4	2	---	---	---	---	
FAM190B	54462	broad.mit.edu	37	10	86215029	86215039	+	Intron	DEL	TTTTCTTTTTC	-	-	rs144269568	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86215029_86215039delTTTTCTTTTTC	uc001kdh.1	+						FAM190B_uc010qmd.1_Intron|FAM190B_uc001kdi.1_Intron|FAM190B_uc010qme.1_Intron	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14											ovary(3)|skin(1)	4						ttctttttctttttctttttctttttttttt	0.118													11	5	---	---	---	---	
BTRC	8945	broad.mit.edu	37	10	103292507	103292508	+	Intron	INS	-	TGTG	TGTG			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103292507_103292508insTGTG	uc001kta.2	+						BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CTGAAGCTATAtgtgtgtgtgt	0.317													6	4	---	---	---	---	
VWA2	340706	broad.mit.edu	37	10	116038497	116038497	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116038497delC	uc001lbl.1	+	8	1041	c.720delC	c.(718-720)CACfs	p.H240fs	VWA2_uc001lbk.1_Frame_Shift_Del_p.H240fs|VWA2_uc009xyf.1_5'UTR	NM_198496	NP_940898	Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	240						extracellular region				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5				Epithelial(162;0.036)|all cancers(201;0.0793)		TCGAGGCTCACCCCTGTGAGC	0.647													96	47	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	23325920	23325921	+	IGR	INS	-	CA	CA	rs141275596	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23325920_23325921insCA								SVIP (474538 upstream) : None (None downstream)																							acacacacacgcacacacacCC	0.089													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45609370	45609371	+	IGR	DEL	GA	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45609370_45609371delGA								SYT13 (301486 upstream) : CHST1 (61056 downstream)																							gggagggagggagagagagaga	0.094													4	2	---	---	---	---	
LRP5	4041	broad.mit.edu	37	11	68181463	68181474	+	In_Frame_Del	DEL	GCAGCCGCAACT	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68181463_68181474delGCAGCCGCAACT	uc001ont.2	+	12	2885_2896	c.2810_2821delGCAGCCGCAACT	c.(2809-2823)AGCAGCCGCAACTGC>AGC	p.SRNC938del	LRP5_uc009ysg.2_In_Frame_Del_p.SRNC348del	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	938_941	EGF-like 3.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						CTGGACCCCAGCAGCCGCAACTGCAGCCGTAA	0.627													16	8	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73068480	73068480	+	Intron	DEL	T	-	-	rs112090619		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73068480delT	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						GCTTTTCCACTTTTGGGCCTC	0.577													5	4	---	---	---	---	
MMP12	4321	broad.mit.edu	37	11	102745470	102745473	+	Intron	DEL	CAAA	-	-	rs28360358		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102745470_102745473delCAAA	uc001phk.2	-							NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein						positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	TACGTAAaagcaaacaaacaaaca	0.279													6	3	---	---	---	---	
SLC4A8	9498	broad.mit.edu	37	12	51885524	51885525	+	Intron	INS	-	AC	AC	rs4761977		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51885524_51885525insAC	uc001rys.1	+						SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryr.2_Intron	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		GGGATGGGCAGacacacacaca	0.312													1	6	---	---	---	---	
TMEM194A	23306	broad.mit.edu	37	12	57473733	57473735	+	5'Flank	DEL	TTG	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57473733_57473735delTTG	uc001smy.2	-						TMEM194A_uc001smx.2_5'Flank|TMEM194A_uc010sra.1_5'Flank	NM_001130963	NP_001124435	O14524	T194A_HUMAN	transmembrane protein 194A isoform a							integral to membrane					0						gtttgtttcattgttgttgttgt	0.000													3	3	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94641435	94641435	+	Intron	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94641435delT	uc001tdc.2	+							NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						aactagcatgttttgagtgct	0.179													4	2	---	---	---	---	
BRCA2	675	broad.mit.edu	37	13	32950658	32950659	+	Intron	INS	-	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32950658_32950659insA	uc001uub.1	+							NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset						cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		gaccctgtctcaaaaaaaaaaa	0.124			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	34753325	34753328	+	IGR	DEL	ACAC	-	-	rs145882230		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34753325_34753328delACAC								RFC3 (212631 upstream) : NBEA (763128 downstream)																							CACAGGAGATacacacacacacac	0.368													3	3	---	---	---	---	
CLDN10	9071	broad.mit.edu	37	13	96086287	96086287	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96086287delT	uc001vmg.2	+	1	435	c.200delT	c.(199-201)ATCfs	p.I67fs	CLDN10_uc010tii.1_Intron	NM_182848	NP_878268	P78369	CLD10_HUMAN	claudin 10 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			CATTTTACTATCTTCAAAGTA	0.488													78	35	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57292956	57292957	+	Intron	INS	-	AAGGAAGG	AAGGAAGG	rs11271907		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57292956_57292957insAAGGAAGG	uc001xcr.1	+											Homo sapiens cDNA clone IMAGE:5492202, partial cds.																		AAAGAAaaggaaaggaaggaag	0.287													5	3	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	69151658	69151659	+	Intron	INS	-	CCTTCCTTCCTT	CCTTCCTTCCTT	rs35395138		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69151658_69151659insCCTTCCTTCCTT	uc001xkg.1	+							NM_133510	NP_598194	O15315	RA51B_HUMAN	RAD51-like 1 isoform 2						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		GACAACCTTTCccttccttcct	0.317			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					5	5	---	---	---	---	
HERC2P2	400322	broad.mit.edu	37	15	23312380	23312380	+	Intron	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23312380delT	uc001yvr.2	-						HERC2P2_uc001yvq.2_5'Flank|HERC2P2_uc001yvo.3_5'Flank|HERC2P2_uc001yvp.3_Intron					RecName: Full=Putative HERC2-like protein 3;												0						TGTTAttttcttttttttttt	0.139													6	3	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28473276	28473276	+	Intron	DEL	A	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28473276delA	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		aaaaAGCTTTAaaaaaaaaaa	0.179													4	3	---	---	---	---	
ZSCAN29	146050	broad.mit.edu	37	15	43661548	43661549	+	Intron	INS	-	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43661548_43661549insA	uc001zrk.1	-						ZSCAN29_uc001zrj.1_5'Flank|ZSCAN29_uc010bdf.1_Intron|ZSCAN29_uc001zrl.1_Intron|ZSCAN29_uc010bdg.1_Intron|ZSCAN29_uc001zrm.2_Intron|TUBGCP4_uc001zrn.2_5'Flank|TUBGCP4_uc001zro.2_5'Flank	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		CCTTCAGGCTGAAAAAAAAAAA	0.411													4	2	---	---	---	---	
SLC28A2	9153	broad.mit.edu	37	15	45563775	45563776	+	Intron	INS	-	AAGGAAGG	AAGGAAGG	rs145309707	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45563775_45563776insAAGGAAGG	uc001zva.2	+							NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		aaaaagaagaaaaggaaggaag	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63763040	63763047	+	IGR	DEL	AAGCAAGC	-	-	rs62011269		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63763040_63763047delAAGCAAGC								CA12 (88965 upstream) : USP3 (33763 downstream)																							ggaaggaaggaagcaagcaagCcagcca	0.014													4	2	---	---	---	---	
CPEB1	64506	broad.mit.edu	37	15	83221050	83221050	+	Intron	DEL	T	-	-	rs67298411		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83221050delT	uc002bit.2	-						CPEB1_uc002biq.2_Intron|CPEB1_uc002bir.2_Intron|CPEB1_uc002bis.2_Intron|CPEB1_uc010uod.1_Intron|CPEB1_uc010uoe.1_Intron|CPEB1_uc002biu.2_Intron|CPEB1_uc010uof.1_Intron|CPEB1_uc002biv.2_Intron|CPEB1_uc002bip.2_Intron	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			CAAAGGTTGCTTTTTTTTTTT	0.443													4	2	---	---	---	---	
SLCO3A1	28232	broad.mit.edu	37	15	92694019	92694020	+	Intron	INS	-	A	A			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92694019_92694020insA	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			ACTTTAGGCAGAAAAAAAAAAA	0.337													4	2	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18938713	18938714	+	5'Flank	INS	-	AAGG	AAGG	rs144186636	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18938713_18938714insAAGG	uc002dfm.2	-							NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						Gagggaagaaaaaggaaggaag	0.040													1	5	---	---	---	---	
ITGAM	3684	broad.mit.edu	37	16	31281406	31281408	+	Intron	DEL	CTT	-	-	rs66864485		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31281406_31281408delCTT	uc002ebq.2	+						ITGAM_uc002ebr.2_Intron	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						GAATCTACTCCTTTTGTATATCT	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85421898	85421899	+	IGR	INS	-	TGGA	TGGA			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85421898_85421899insTGGA								FAM92B (275784 upstream) : KIAA0182 (223130 downstream)																							ggatgggtgggtggatggatgg	0.000													4	2	---	---	---	---	
ANKRD11	29123	broad.mit.edu	37	16	89502204	89502205	+	Intron	INS	-	CA	CA	rs139190903	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89502204_89502205insCA	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron|uc002fnh.1_Intron	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CACCAGCTCTTcacacacacac	0.416													4	2	---	---	---	---	
ALOX12B	242	broad.mit.edu	37	17	7980190	7980200	+	Intron	DEL	CCCCAGATGCC	-	-	rs72152877		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7980190_7980200delCCCCAGATGCC	uc002gjy.1	-						uc010cnq.1_5'Flank	NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type						epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						CTCTTGTGGTCCCCAGATGCCCCCCAGGCTG	0.616										Multiple Myeloma(8;0.094)			5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16785934	16785934	+	IGR	DEL	G	-	-	rs112615622		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16785934delG								LOC162632 (78115 upstream) : TNFRSF13B (46915 downstream)																							CATCAGGCAAGGGGGGGTTCC	0.632													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	27355054	27355055	+	IGR	DEL	AC	-	-	rs147653637		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27355054_27355055delAC								SEZ6 (21596 upstream) : PIPOX (14863 downstream)																							GGGAAAGGAGacacacacacac	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	45865385	45865385	+	IGR	DEL	G	-	-	rs150890359	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45865385delG								TBX21 (41900 upstream) : OSBPL7 (19348 downstream)																							aaggaaggaaggaaggaagga	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48378238	48378318	+	IGR	DEL	GAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAAGAAGGAAGGAAGGAAAGGAAGGAAA	-	-	rs71146978	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48378238_48378318delGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAAGAAGGAAGGAAGGAAAGGAAGGAAA								TMEM92 (19394 upstream) : XYLT2 (45075 downstream)																							agaaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaagaaggaaggaaggaaaggaaggaaagaaggaagga	0.064													4	2	---	---	---	---	
SCN4A	6329	broad.mit.edu	37	17	62024783	62024783	+	Intron	DEL	G	-	-	rs74413932		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62024783delG	uc002jds.1	-							NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha						muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	CGACTCCTTCGGGGAGGCCTG	0.413													3	3	---	---	---	---	
NOL11	25926	broad.mit.edu	37	17	65718652	65718657	+	Intron	DEL	GTGATT	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65718652_65718657delGTGATT	uc002jgd.1	+						NOL11_uc010wql.1_Intron|NOL11_uc010deu.1_Intron	NM_015462	NP_056277	Q9H8H0	NOL11_HUMAN	nucleolar protein 11							nucleolus					0	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTCCCAGCTGGTGATTTTTGCATCCT	0.277													31	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65957400	65957403	+	IGR	DEL	TGTG	-	-	rs72069959		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65957400_65957403delTGTG								DSEL (773433 upstream) : TMX3 (383524 downstream)																							ATAATGCATAtgtgtgtgtgtgtg	0.260													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																							aaaaaaaaaacaaaaaaaaaa	0.348													4	4	---	---	---	---	
LRRC8E	80131	broad.mit.edu	37	19	7965904	7965905	+	3'UTR	INS	-	G	G	rs147400269	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7965904_7965905insG	uc002mir.2	+	3					MAP2K7_uc002mis.1_5'Flank|MAP2K7_uc002miv.2_5'Flank|MAP2K7_uc010xka.1_5'Flank|MAP2K7_uc002mit.2_5'Flank|MAP2K7_uc010xkb.1_5'Flank|MAP2K7_uc010dvv.2_5'Flank	NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member							integral to membrane				lung(1)|pancreas(1)	2						GGCCAGGAGATGGGGGGGGCGG	0.579													9	4	---	---	---	---	
ZNF266	10781	broad.mit.edu	37	19	9525150	9525150	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9525150delT	uc002mll.2	-	4	717	c.451delA	c.(451-453)ACAfs	p.T151fs	ZNF266_uc002mlm.2_Frame_Shift_Del_p.T151fs|ZNF266_uc002mln.2_Frame_Shift_Del_p.T151fs|ZNF266_uc002mlo.2_Frame_Shift_Del_p.T151fs|ZNF266_uc010dwp.2_Frame_Shift_Del_p.T151fs|ZNF266_uc010dwq.2_Frame_Shift_Del_p.T151fs	NM_198058	NP_932175	Q14584	ZN266_HUMAN	zinc finger protein 266	151					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTCTCTCCTGTGCACGTTCTC	0.438													217	101	---	---	---	---	
TSPAN16	26526	broad.mit.edu	37	19	11408630	11408631	+	Intron	INS	-	T	T	rs146250346	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11408630_11408631insT	uc002mqv.1	+						TSPAN16_uc002mqu.1_Intron	NM_012466	NP_036598	Q9UKR8	TSN16_HUMAN	transmembrane 4 superfamily member 16							integral to membrane				skin(1)	1						actactggctattttttttttg	0.000													3	4	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	38994748	38994750	+	Intron	DEL	CCT	-	-	rs34529638		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38994748_38994750delCCT	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	ATAACCCACACCTCCTTCATAAT	0.443													4	2	---	---	---	---	
FLT3LG	2323	broad.mit.edu	37	19	49982452	49982452	+	Intron	DEL	T	-	-	rs33951493		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49982452delT	uc010yau.1	+						FLT3LG_uc002pnv.2_Intron|FLT3LG_uc002pnw.2_Intron|FLT3LG_uc002pnu.2_Intron|FLT3LG_uc002pnx.2_Intron|FLT3LG_uc010yav.1_Intron	NM_001459	NP_001450	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand precursor						positive regulation of cell proliferation|signal transduction	extracellular space|integral to membrane|plasma membrane|soluble fraction	cytokine activity				0		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		AGTTTACCAAttttttttttt	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54841975	54841976	+	IGR	INS	-	T	T	rs67642841		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54841975_54841976insT								LILRA5 (17566 upstream) : LILRA4 (2717 downstream)																							GAGCTTCCCTCttttttttttt	0.262													4	3	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8731631	8731632	+	Intron	INS	-	GAGTGCA	GAGTGCA			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8731631_8731632insGAGTGCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						tgcccaggctggagtgcagagg	0.114													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23961024	23961025	+	IGR	INS	-	AC	AC	rs146633246	by1000genomes	TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23961024_23961025insAC								CST5 (100644 upstream) : GGTLC1 (4666 downstream)																							cactcacacatacacacacaaa	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21270950	21270951	+	IGR	DEL	TA	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21270950_21270951delTA								None (None upstream) : C21orf131 (843963 downstream)																							gaatacagggtaTATATATATA	0.104													4	2	---	---	---	---	
ITSN1	6453	broad.mit.edu	37	21	35254745	35254745	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35254745delA	uc002yta.1	+	35	4808	c.4540delA	c.(4540-4542)AAAfs	p.K1514fs	DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Frame_Shift_Del_p.K1509fs|ITSN1_uc002ytj.2_Frame_Shift_Del_p.K1453fs|ITSN1_uc010gmm.1_RNA|ITSN1_uc010gmn.1_Intron|ITSN1_uc002ytk.1_Intron	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	1514	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						CCTGCAGTATAAAATGTATAA	0.433													81	47	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774827	2774829	+	Intron	DEL	ATC	-	-	rs55951939		TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774827_2774829delATC	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ctatctatctatcatctatctat	0.182													6	4	---	---	---	---	
CFP	5199	broad.mit.edu	37	X	47483959	47483960	+	Intron	INS	-	T	T			TCGA-BP-5183-01A-01D-1429-08	TCGA-BP-5183-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47483959_47483960insT	uc004dig.3	-						CFP_uc004dih.2_Intron|CFP_uc004dii.1_3'UTR|CFP_uc010nhu.2_3'UTR	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor						complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						tttttttttccttttttttttt	0.094													4	3	---	---	---	---	
