Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PHACTR4	65979	broad.mit.edu	37	1	28764918	28764918	+	Intron	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28764918G>T	uc001bpw.2	+						PHACTR4_uc001bpu.2_Intron|PHACTR4_uc001bpv.1_Intron|PHACTR4_uc001bpx.2_Intron|PHACTR4_uc001bpy.2_Missense_Mutation_p.R8I	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1								actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		GATGTCTCCAGACCGGTAAAT	0.393													93	136	---	---	---	---	PASS
DDX20	11218	broad.mit.edu	37	1	112309100	112309100	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112309100C>A	uc001ebs.2	+	11	2411	c.2054C>A	c.(2053-2055)TCT>TAT	p.S685Y	DDX20_uc010owf.1_Missense_Mutation_p.S447Y|DDX20_uc001ebt.2_Missense_Mutation_p.S293Y	NM_007204	NP_009135	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	685					assembly of spliceosomal tri-snRNP|ncRNA metabolic process	Cajal body|cytoskeleton|cytosol|spliceosomal complex	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding			lung(1)|kidney(1)	2		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGAAAGACTCTGAATCTACG	0.433													7	59	---	---	---	---	PASS
MUC1	4582	broad.mit.edu	37	1	155160211	155160211	+	Silent	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155160211G>T	uc010pfj.1	-	4	1099	c.693C>A	c.(691-693)ATC>ATA	p.I231I	RAG1AP1_uc010pey.1_Intron|MUC1_uc001fhy.2_Silent_p.I61I|MUC1_uc001fhz.2_Silent_p.I61I|MUC1_uc010pfb.1_Silent_p.I61I|MUC1_uc010pfc.1_RNA|MUC1_uc009wph.2_Silent_p.I61I|MUC1_uc010pfd.1_Intron|MUC1_uc010pfe.1_RNA|MUC1_uc010pff.1_Intron|MUC1_uc009wpi.2_Silent_p.I61I|MUC1_uc010pfg.1_Intron|MUC1_uc010pfh.1_Silent_p.I207I|MUC1_uc010pfi.1_Silent_p.I207I|MUC1_uc010pfk.1_RNA|MUC1_uc010pfl.1_RNA|MUC1_uc001fin.2_Intron|MUC1_uc009wpk.2_Silent_p.I83I|MUC1_uc001fip.2_Intron|MUC1_uc009wqg.2_Silent_p.I92I|MUC1_uc009wpo.2_Silent_p.I98I|MUC1_uc009wps.2_Silent_p.I119I|MUC1_uc009wpt.2_Silent_p.I122I|MUC1_uc001fic.2_Silent_p.I110I|MUC1_uc009wpu.2_Intron|MUC1_uc009wpq.2_Silent_p.I124I|MUC1_uc009wpv.2_Intron|MUC1_uc001fim.2_Intron|MUC1_uc001fib.2_Intron|MUC1_uc009wpw.2_Intron|MUC1_uc001fie.2_Intron|MUC1_uc009wpr.2_Intron|MUC1_uc001fig.2_Intron|MUC1_uc001fif.2_Intron|MUC1_uc009wpx.2_Silent_p.I120I|MUC1_uc001fid.2_Silent_p.I111I|MUC1_uc009wpj.2_Intron|MUC1_uc001fij.2_Silent_p.I145I|MUC1_uc009wpy.2_Intron|MUC1_uc010pfm.1_Silent_p.I61I|MUC1_uc001fiq.2_Silent_p.I61I|MUC1_uc009wpz.2_Silent_p.I163I|MUC1_uc010pfn.1_Silent_p.I136I|MUC1_uc009wqa.2_Silent_p.I219I|MUC1_uc010pfo.1_Intron|MUC1_uc010pfp.1_Intron|MUC1_uc001fii.2_Intron|MUC1_uc001fih.2_Intron|MUC1_uc001fia.2_Silent_p.I136I|MUC1_uc009wqc.2_Silent_p.I133I|MUC1_uc009wqd.2_Silent_p.I157I|MUC1_uc009wqb.2_Silent_p.I61I|MUC1_uc010pfq.1_Silent_p.I133I|MUC1_uc010pfr.1_Intron|MUC1_uc001fit.2_Silent_p.I61I|MUC1_uc009wqe.2_Intron|MUC1_uc001fil.2_Intron|MUC1_uc009wpm.2_Silent_p.I154I|MUC1_uc009wpp.2_Intron|MUC1_uc010pfs.1_RNA|MUC1_uc001fik.2_Silent_p.I154I|MUC1_uc001fio.2_Intron|MUC1_uc009wqf.2_Intron|MUC1_uc009wpl.2_Intron|MUC1_uc009wpn.2_Silent_p.I145I|MUC1_uc001fis.1_Intron			P15941	MUC1_HUMAN	SubName: Full=Mucin 1, cell surface associated;	1136	Extracellular (Potential).|SEA.					apical plasma membrane|cell surface|cytoplasm|extracellular region|integral to plasma membrane|nucleus	protein binding			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGACGTCTGAGATCGTCAGGT	0.562			T	IGH@	B-NHL								25	33	---	---	---	---	PASS
LRRC52	440699	broad.mit.edu	37	1	165513950	165513950	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165513950A>T	uc001gde.2	+	1	473	c.417A>T	c.(415-417)TTA>TTT	p.L139F	LOC400794_uc001gdc.2_Intron|LOC400794_uc001gdd.2_Intron|LOC400794_uc009wvd.2_Intron	NM_001005214	NP_001005214	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52 precursor	139	LRR 4.|Extracellular (Potential).					integral to membrane				ovary(1)	1	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					CTCACCTGTTATCGCTTCACA	0.522													48	185	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097025	167097025	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097025A>T	uc001geb.1	+	5	2657	c.2657A>T	c.(2656-2658)GAT>GTT	p.D886V		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	886					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						GGTGATGGGGATGAGGACACT	0.498													88	129	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564493	176564493	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564493A>G	uc001gkz.2	+	3	2917	c.1753A>G	c.(1753-1755)AAC>GAC	p.N585D	PAPPA2_uc001gky.1_Missense_Mutation_p.N585D|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	585	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TGTGCTTGTGAACTGTGAGCC	0.602													5	120	---	---	---	---	PASS
EFCAB2	84288	broad.mit.edu	37	1	245250798	245250798	+	Intron	SNP	T	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245250798T>C	uc001ibd.2	+						EFCAB2_uc001ibc.2_3'UTR|EFCAB2_uc010pyo.1_3'UTR|EFCAB2_uc010pyp.1_Intron|EFCAB2_uc001ibe.2_Intron	NR_026586		Q5VUJ9	EFCB2_HUMAN	RecName: Full=EF-hand calcium-binding domain-containing protein 2;								calcium ion binding				0	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)			ACACTTTGTTTTTAAAGATGA	0.239													6	16	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11738892	11738892	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11738892C>A	uc002rbk.1	+	15	2539	c.2239C>A	c.(2239-2241)CAG>AAG	p.Q747K	GREB1_uc002rbo.1_Missense_Mutation_p.Q381K	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	747						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CACGGAGGCACAGACAAAATT	0.468													82	249	---	---	---	---	PASS
CCDC148	130940	broad.mit.edu	37	2	159196824	159196824	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159196824T>C	uc002tzq.2	-	5	679	c.416A>G	c.(415-417)TAC>TGC	p.Y139C	CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Missense_Mutation_p.Y86C|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Missense_Mutation_p.Y53C|CCDC148_uc002tzs.1_Missense_Mutation_p.Y139C	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	139										ovary(2)	2						ATGCTGTCTGTATTTTAGATC	0.353													157	424	---	---	---	---	PASS
HSPE1	3336	broad.mit.edu	37	2	198368050	198368050	+	3'UTR	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198368050G>A	uc002uul.2	+	4						NM_002157	NP_002148	P61604	CH10_HUMAN	heat shock 10kDa protein 1						activation of caspase activity|protein folding|response to unfolded protein	mitochondrial matrix	ATP binding|chaperone binding|unfolded protein binding				0			Epithelial(96;0.225)			GAAATCTTTCGTCATGTAAAT	0.328													7	180	---	---	---	---	PASS
HSPE1	3336	broad.mit.edu	37	2	198368085	198368085	+	3'UTR	SNP	T	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198368085T>C	uc002uul.2	+	4						NM_002157	NP_002148	P61604	CH10_HUMAN	heat shock 10kDa protein 1						activation of caspase activity|protein folding|response to unfolded protein	mitochondrial matrix	ATP binding|chaperone binding|unfolded protein binding				0			Epithelial(96;0.225)			TCTTTTATAATAAACTAATGA	0.299													7	67	---	---	---	---	PASS
CASP10	843	broad.mit.edu	37	2	202082403	202082403	+	Intron	SNP	C	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202082403C>A	uc002uxl.1	+						CASP10_uc002uxj.1_Missense_Mutation_p.P503H|CASP10_uc002uxk.1_Missense_Mutation_p.P460H|CASP10_uc010fta.1_Missense_Mutation_p.P436H|CASP10_uc002uxm.1_Intron|CASP10_uc010ftb.1_RNA	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein						apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6						ATGCCCCAGCCTGCTTTCACA	0.438													43	158	---	---	---	---	PASS
INO80D	54891	broad.mit.edu	37	2	206870035	206870035	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206870035C>G	uc002vaz.3	-	11	2546	c.2141G>C	c.(2140-2142)GGG>GCG	p.G714A		NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	714					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						CAATAGCTCCCCTAGGTCTGT	0.488													50	157	---	---	---	---	PASS
GADL1	339896	broad.mit.edu	37	3	30885886	30885886	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30885886C>G	uc003cep.2	-	7	771	c.724G>C	c.(724-726)GAT>CAT	p.D242H	GADL1_uc003ceq.1_Missense_Mutation_p.D242H	NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	242					carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	TACCTTCCATCTGTTTCCACA	0.413													6	231	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47164730	47164730	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47164730T>A	uc003cqs.2	-	3	1449	c.1396A>T	c.(1396-1398)AAG>TAG	p.K466*	SETD2_uc003cqv.2_Nonsense_Mutation_p.K455*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	466					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TATGTCTTCTTATACTCTTCT	0.458			N|F|S|Mis		clear cell renal carcinoma								91	147	---	---	---	---	PASS
NR1I2	8856	broad.mit.edu	37	3	119528962	119528962	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119528962C>A	uc003edj.2	+	3	2091	c.252C>A	c.(250-252)TGC>TGA	p.C84*	NR1I2_uc003edi.2_Nonsense_Mutation_p.C84*|NR1I2_uc003edk.2_Nonsense_Mutation_p.C123*|NR1I2_uc003edl.2_5'Flank	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	84	Nuclear receptor.|Bipartite nuclear localization signal.|NR C4-type.				drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	AGGGCGCCTGCGAGATCACCC	0.632													5	6	---	---	---	---	PASS
UBA5	79876	broad.mit.edu	37	3	132387762	132387762	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132387762A>G	uc003epa.3	+	4	640	c.398A>G	c.(397-399)CAT>CGT	p.H133R	NPHP3_uc003eoz.1_Intron|UBA5_uc010htr.2_Missense_Mutation_p.H77R|UBA5_uc010htt.2_Missense_Mutation_p.H133R|UBA5_uc003epb.3_Missense_Mutation_p.H77R	NM_024818	NP_079094	Q9GZZ9	UBA5_HUMAN	ubiquitin-activating enzyme 5 isoform 1	133					protein ufmylation	aggresome|cytoplasm|cytoplasm|nucleus	ATP binding|cofactor binding|metal ion binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding|UFM1 activating enzyme activity			kidney(1)	1						GCAGCAGAACATACTCTGAGG	0.318													99	252	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180321060	180321060	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180321060G>C	uc003fkk.2	+	3	567	c.435G>C	c.(433-435)TTG>TTC	p.L145F	TTC14_uc003fkl.2_Missense_Mutation_p.L145F|TTC14_uc003fkm.2_Missense_Mutation_p.L145F	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	145	S1 motif.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TCATGGTGTTGATCTGTTTAG	0.373													34	597	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	9250368	9250368	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9250368T>C	uc011bwp.1	+	1	13	c.13T>C	c.(13-15)TCA>CCA	p.S5P		NM_001105662	NP_001099132			ubiquitin specific peptidase 17																		GGAGGACGACTCACTCTACTT	0.507													4	14	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47788855	47788855	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47788855G>T	uc003gxm.2	-	3	389	c.296C>A	c.(295-297)ACA>AAA	p.T99K	CORIN_uc011bzf.1_5'UTR|CORIN_uc011bzg.1_Intron|CORIN_uc011bzh.1_Missense_Mutation_p.T99K|CORIN_uc011bzi.1_Missense_Mutation_p.T99K|CORIN_uc003gxn.3_Missense_Mutation_p.T99K	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	99	Extracellular (Potential).				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						AATTGTATTTGTAAGAATAAC	0.433													47	168	---	---	---	---	PASS
C4orf33	132321	broad.mit.edu	37	4	130023911	130023911	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130023911C>G	uc003igu.3	+	2	510	c.146C>G	c.(145-147)CCA>CGA	p.P49R	C4orf33_uc010ioc.1_Missense_Mutation_p.P49R|C4orf33_uc010iod.2_Missense_Mutation_p.P49R	NM_173487	NP_775758	Q8N1A6	CD033_HUMAN	hypothetical protein LOC132321	49										upper_aerodigestive_tract(1)	1						CTTGGAGAACCAGGAAAACCT	0.413													88	207	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	256624	256624	+	3'UTR	SNP	G	A	A	rs79810985	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:256624G>A	uc003jao.3	+	15					SDHA_uc011clw.1_3'UTR|SDHA_uc003jap.3_3'UTR|SDHA_uc003jaq.3_3'UTR|SDHA_uc003jar.3_3'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GTCTTCATACGCTTCTGCACT	0.488									Familial_Paragangliomas				3	17	---	---	---	---	PASS
CARD6	84674	broad.mit.edu	37	5	40843790	40843790	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40843790G>A	uc003jmg.2	+	2	895	c.820G>A	c.(820-822)GAA>AAA	p.E274K		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	274	Asp/Glu-rich.				apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						ATTGGAGGAGGAACAGGAGAA	0.398													54	142	---	---	---	---	PASS
NLN	57486	broad.mit.edu	37	5	65088498	65088498	+	Intron	SNP	C	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65088498C>T	uc003juf.2	+						NLN_uc003jue.2_Missense_Mutation_p.P515S|NLN_uc003jug.2_Intron|NLN_uc010iww.2_Intron	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor						proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		TTTTTTTTTTCCCCCAGTAAA	0.428													5	210	---	---	---	---	PASS
ABLIM3	22885	broad.mit.edu	37	5	148629402	148629402	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148629402A>C	uc003lpy.2	+	19	1975	c.1724A>C	c.(1723-1725)GAC>GCC	p.D575A	ABLIM3_uc003lpz.1_Missense_Mutation_p.D575A|ABLIM3_uc003lqa.1_Missense_Mutation_p.D472A|ABLIM3_uc003lqb.2_Missense_Mutation_p.D464A|ABLIM3_uc003lqc.1_Missense_Mutation_p.D542A|ABLIM3_uc003lqd.1_Missense_Mutation_p.D480A|ABLIM3_uc003lqf.2_Missense_Mutation_p.D464A|ABLIM3_uc003lqe.1_Missense_Mutation_p.D464A	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	575					axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACCTGGCTGACAGTGGTAAG	0.498													57	180	---	---	---	---	PASS
PWWP2A	114825	broad.mit.edu	37	5	159505150	159505150	+	3'UTR	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159505150A>G	uc003lxv.3	-	4					PWWP2A_uc011dec.1_3'UTR	NM_052927	NP_443159	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A isoform a												0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTCCATGAAACCAGCAGCCT	0.373													7	299	---	---	---	---	PASS
RASGEF1C	255426	broad.mit.edu	37	5	179538533	179538533	+	Silent	SNP	T	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179538533T>C	uc003mlq.2	-	11	1524	c.1227A>G	c.(1225-1227)AAA>AAG	p.K409K	RASGEF1C_uc003mlr.2_Silent_p.K409K|RASGEF1C_uc003mlp.3_Silent_p.K258K	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	409	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACTCCACTTGTTTCCAGGTGA	0.587													22	101	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7583787	7583787	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7583787G>T	uc003mxp.1	+	24	6571	c.6292G>T	c.(6292-6294)GAT>TAT	p.D2098Y	DSP_uc003mxq.1_Missense_Mutation_p.D1499Y	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2098	Globular 2.|Plectin 3.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TGGTTTTGATGATCCATTTTC	0.453													5	54	---	---	---	---	PASS
ZKSCAN3	80317	broad.mit.edu	37	6	28333631	28333631	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28333631A>G	uc003nle.3	+	6	1402	c.1186A>G	c.(1186-1188)AAG>GAG	p.K396E	ZKSCAN3_uc010jrc.2_Missense_Mutation_p.K396E|ZKSCAN3_uc003nlf.3_Missense_Mutation_p.K248E|uc010jrd.2_5'Flank	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	396					positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						CACTGGGGAGAAGCCCTATGA	0.512													22	77	---	---	---	---	PASS
PRICKLE4	29964	broad.mit.edu	37	6	41752690	41752690	+	Silent	SNP	C	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41752690C>T	uc011duf.1	+	5	506	c.258C>T	c.(256-258)GCC>GCT	p.A86A	PRICKLE4_uc003ord.2_RNA|TOMM6_uc003org.2_5'Flank|TOMM6_uc011dug.1_5'Flank	NM_013397	NP_037529	Q2TBC4	PRIC4_HUMAN	over-expressed breast tumor protein	46	PET.					nucleus	zinc ion binding				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ACTGCCTGGCCCTTGGGGAGG	0.597													27	55	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49574615	49574615	+	Silent	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49574615A>G	uc003ozk.3	-	9	1220	c.1158T>C	c.(1156-1158)CCT>CCC	p.P386P	RHAG_uc010jzl.2_Intron|RHAG_uc010jzm.2_Missense_Mutation_p.S346P	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	386	Cytoplasmic (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					GTCCCCAGAGAGGCAACTTTA	0.388													6	241	---	---	---	---	PASS
ZNF451	26036	broad.mit.edu	37	6	57013144	57013144	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57013144G>A	uc003pdm.1	+	10	2485	c.2261G>A	c.(2260-2262)CGC>CAC	p.R754H	ZNF451_uc003pdl.2_Missense_Mutation_p.R754H|ZNF451_uc003pdn.1_Missense_Mutation_p.R754H|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Missense_Mutation_p.R754H	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1	754	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CTGTGGTTTCGCTGCAGTTTA	0.413													38	95	---	---	---	---	PASS
C6orf58	352999	broad.mit.edu	37	6	127902329	127902329	+	Nonsense_Mutation	SNP	T	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127902329T>G	uc003qbh.2	+	4	588	c.576T>G	c.(574-576)TAT>TAG	p.Y192*		NM_001010905	NP_001010905	Q6P5S2	CF058_HUMAN	hypothetical protein LOC352999 precursor	192						extracellular region					0				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		TACCTTAGTATTTGCAGTCAC	0.323													130	326	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146720336	146720336	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146720336G>T	uc010khw.1	+	8	2631	c.2161G>T	c.(2161-2163)GTG>TTG	p.V721L	GRM1_uc010khv.1_Missense_Mutation_p.V721L|GRM1_uc003qll.2_Missense_Mutation_p.V721L|GRM1_uc011edz.1_Missense_Mutation_p.V721L|GRM1_uc011eea.1_Missense_Mutation_p.V721L	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	721	Helical; Name=4; (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	ACTAACCCTGGTGGTAACCCT	0.507													51	116	---	---	---	---	PASS
ESR1	2099	broad.mit.edu	37	6	152382174	152382174	+	Silent	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152382174G>T	uc003qom.3	+	8	1654	c.1284G>T	c.(1282-1284)CTG>CTT	p.L428L	ESR1_uc010kin.2_Silent_p.L428L|ESR1_uc010kio.2_Silent_p.L430L|ESR1_uc010kip.2_Silent_p.L427L|ESR1_uc003qon.3_Silent_p.L428L|ESR1_uc003qoo.3_Silent_p.L428L|ESR1_uc010kiq.2_Silent_p.L26L|ESR1_uc010kir.2_Silent_p.L167L|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_RNA|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Silent_p.L97L|ESR1_uc011eex.1_Intron|ESR1_uc010kit.1_3'UTR|ESR1_uc011eey.1_Silent_p.L165L	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	428	Steroid-binding.|Interaction with AKAP13.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	TCGACATGCTGCTGGCTACAT	0.373													100	235	---	---	---	---	PASS
LOC407835	407835	broad.mit.edu	37	7	128767412	128767412	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128767412C>A	uc003voo.2	+	1	1088	c.841C>A	c.(841-843)CCC>ACC	p.P281T		NR_002144				SubName: Full=cDNA FLJ35806 fis, clone TESTI2005987, highly similar to Dual specificity mitogen-activated protein kinase kinase 2 (EC 2.7.12.2); SubName: Full=Mitogen-activated protein kinase kinase 2, isoform CRA_d;												0						CTTTGGCCAGCCCGTGGTCGA	0.667													3	7	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151962258	151962258	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151962258G>C	uc003wla.2	-	8	1268	c.1049C>G	c.(1048-1050)CCG>CGG	p.P350R		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	350	PHD-type 1.|RING-type.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GAGGTCTCCCGGGCTGTCGCA	0.398			N		medulloblastoma								48	308	---	---	---	---	PASS
PPP2CB	5516	broad.mit.edu	37	8	30651536	30651536	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30651536G>T	uc003xik.2	-	6	870	c.635C>A	c.(634-636)TCA>TAA	p.S212*		NM_004156	NP_004147	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta	212					protein dephosphorylation	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex|spindle pole	metal ion binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	ACCACGTGGTGAAATACCCCA	0.443													30	93	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103297526	103297526	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103297526A>G	uc003ykr.1	-	40	5558	c.5525T>C	c.(5524-5526)ATG>ACG	p.M1842T	UBR5_uc003yks.1_Missense_Mutation_p.M1842T	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1842					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AATACTGACCATCCAGTTCCA	0.378													72	196	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7683956	7683956	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7683956G>A	uc001ijq.2	-	3	312	c.233C>T	c.(232-234)TCT>TTT	p.S78F	ITIH5_uc001ijr.1_Missense_Mutation_p.S78F	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	78	VIT.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						CTGGTCTTCAGAAGCTCTGTT	0.453													56	164	---	---	---	---	PASS
PPP2R2D	55844	broad.mit.edu	37	10	133748061	133748061	+	Splice_Site	SNP	T	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133748061T>G	uc001lks.2	+	1	342	c.99_splice	c.e1+2	p.E33_splice	PPP2R2D_uc001lkr.2_Splice_Site|PPP2R2D_uc001lkt.2_Splice_Site	NM_018461	NP_060931	Q66LE6	2ABD_HUMAN	protein phosphatase 2, regulatory subunit B,						cell division|exit from mitosis|mitosis|signal transduction	cytoplasm|protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			skin(1)	1		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)		GAACAAGAGGTCAGTAATTTT	0.383													91	209	---	---	---	---	PASS
CYP2E1	1571	broad.mit.edu	37	10	135369641	135369641	+	3'UTR	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135369641A>G	uc001lnl.1	+	6					SYCE1_uc001lnm.2_Intron|SYCE1_uc009ybn.2_Intron|SYCE1_uc001lnn.2_Intron|SYCE1_uc001lno.2_Intron			P05181	CP2E1_HUMAN	SubName: Full=Cytochrome P450, family 2, subfamily E, polypeptide 1 variant; Flags: Fragment;						drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	atacttactcactatgcctca	0.209									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				3	10	---	---	---	---	PASS
PDDC1	347862	broad.mit.edu	37	11	771046	771046	+	Silent	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:771046A>G	uc001lrc.2	-	7	628	c.603T>C	c.(601-603)AAT>AAC	p.N201N	PDDC1_uc010qwm.1_Silent_p.N151N|PDDC1_uc001lrd.2_Intron|PDDC1_uc001lrf.1_3'UTR|PDDC1_uc001lrg.1_RNA|PDDC1_uc009ycg.2_3'UTR|PDDC1_uc010qwn.1_RNA|PDDC1_uc010qwo.1_RNA|PDDC1_uc010qwp.1_Silent_p.N165N|PDDC1_uc010qwq.1_Silent_p.N115N|PDDC1_uc010qwr.1_Silent_p.N201N|PDDC1_uc010qws.1_Silent_p.N151N	NM_182612	NP_872418	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1	201						extracellular region					0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGAGCTGGCATTCTGGCCTG	0.652													5	30	---	---	---	---	PASS
C11orf46	120534	broad.mit.edu	37	11	30358438	30358438	+	3'UTR	SNP	A	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30358438A>C	uc001mso.1	+	4					C11orf46_uc001msp.2_5'Flank	NM_152316	NP_689529	Q8N8R7	CK046_HUMAN	hypothetical protein LOC120534												0						TATGACAAAGATTTTAAAACC	0.318													12	20	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003264	50003264	+	Silent	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003264G>T	uc010ria.1	-	1	774	c.774C>A	c.(772-774)CGC>CGA	p.R258R		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	258	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TGGTCACTGAGCGCAGATACA	0.438													50	172	---	---	---	---	PASS
CEP57	9702	broad.mit.edu	37	11	95523745	95523745	+	5'UTR	SNP	T	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95523745T>G	uc001pfp.1	+	1					CEP57_uc001pfo.1_5'UTR|CEP57_uc010ruh.1_5'UTR|CEP57_uc010rui.1_5'UTR|CEP57_uc009ywn.1_5'UTR|CEP57_uc001pfq.1_5'UTR|CEP57_uc001pfr.1_5'UTR|FAM76B_uc001pfn.2_5'Flank|FAM76B_uc001pfm.2_5'Flank	NM_014679	NP_055494	Q86XR8	CEP57_HUMAN	translokin						fibroblast growth factor receptor signaling pathway|G2/M transition of mitotic cell cycle|protein import into nucleus, translocation|spermatid development	centrosome|cytosol|Golgi apparatus|microtubule|nucleus	fibroblast growth factor binding|protein homodimerization activity			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACCCTTGCCCTTTTCCATCAG	0.632									Mosaic_Variegated_Aneuploidy_Syndrome				5	14	---	---	---	---	PASS
GLB1L3	112937	broad.mit.edu	37	11	134188593	134188593	+	Silent	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134188593G>A	uc009zdf.2	+	19	2208	c.1848G>A	c.(1846-1848)CAG>CAA	p.Q616Q	GLB1L3_uc001qho.3_RNA	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3	616					carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		TTGGGCCTCAGAAAACACTGT	0.413													110	338	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40702341	40702341	+	Silent	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40702341G>A	uc001rmg.3	+	29	4153	c.4032G>A	c.(4030-4032)GGG>GGA	p.G1344G	LRRK2_uc009zjw.2_Silent_p.G182G|LRRK2_uc001rmi.2_Silent_p.G177G	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1344	Roc.|GTP (Potential).				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GAAATACTGGGAGTGGTAAAA	0.358													10	223	---	---	---	---	PASS
PRKAB1	5564	broad.mit.edu	37	12	120119280	120119280	+	3'UTR	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120119280G>A	uc009zwu.2	+	8					PRKAB1_uc001txg.2_3'UTR	NM_006253	NP_006244	Q9Y478	AAKB1_HUMAN	AMP-activated protein kinase beta 1						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol					0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Adenosine monophosphate(DB00131)|Metformin(DB00331)	CTTTGCTCCTGGTGGGAGAGG	0.512													6	4	---	---	---	---	PASS
LOC647288	647288	broad.mit.edu	37	13	75812076	75812076	+	3'UTR	SNP	C	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75812076C>T	uc010ths.1	-	1						NR_027466				Homo sapiens mRNA; cDNA DKFZp434F0327 (from clone DKFZp434F0327).												0						AAAATATTGTCAGGTTTCTTG	0.378													26	68	---	---	---	---	PASS
ZFP106	64397	broad.mit.edu	37	15	42742412	42742412	+	Silent	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42742412G>A	uc001zpw.2	-	2	2324	c.1989C>T	c.(1987-1989)CAC>CAT	p.H663H	ZFP106_uc001zpu.2_5'Flank|ZFP106_uc001zpv.2_Intron|ZFP106_uc001zpx.2_Intron|ZFP106_uc010udh.1_Silent_p.H446H|ZFP106_uc001zpy.1_Silent_p.H686H	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog	663						nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		ATAAGCCAGGGTGTGGACTGG	0.423													76	194	---	---	---	---	PASS
TBC1D2B	23102	broad.mit.edu	37	15	78301405	78301405	+	Silent	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78301405A>G	uc002bcy.3	-	10	2322	c.2322T>C	c.(2320-2322)TGT>TGC	p.C774C	TBC1D2B_uc010bla.2_Silent_p.C774C|TBC1D2B_uc002bda.2_Silent_p.C226C	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a	774	Rab-GAP TBC.					intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						TGGTAACGAGACACCAGAAAG	0.468													5	145	---	---	---	---	PASS
UNKL	64718	broad.mit.edu	37	16	1417749	1417749	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1417749T>C	uc010brn.1	-	7	835	c.817A>G	c.(817-819)AAC>GAC	p.N273D	UNKL_uc002cln.2_Missense_Mutation_p.N65D|UNKL_uc002clo.2_Missense_Mutation_p.N62D|UNKL_uc002clp.2_Missense_Mutation_p.N65D			Q9H9P5	UNKL_HUMAN	SubName: Full=Putative ubiquitin-protein ligase;          EC=6.3.2.19; Flags: Fragment;	563	Potential.					cytoplasm|nucleus	ligase activity|nucleic acid binding|zinc ion binding				0		Hepatocellular(780;0.0893)				TCAGCTCCGTTTGGACTTGCA	0.652													11	47	---	---	---	---	PASS
C16orf93	90835	broad.mit.edu	37	16	30768957	30768957	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30768957C>T	uc002dzm.2	-	9	1167	c.836G>A	c.(835-837)CGA>CAA	p.R279Q	C16orf93_uc002dzn.2_Missense_Mutation_p.R344Q|C16orf93_uc002dzo.2_Missense_Mutation_p.R242Q	NM_001014979	NP_001014979	A1A4V9	CP093_HUMAN	hypothetical protein LOC90835	279											0						GATGTAGGCTCGGAGGACGTG	0.607													14	35	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70030117	70030117	+	Intron	SNP	C	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70030117C>G	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						AGGGGCTCATCATGAGTGCCA	0.423													5	109	---	---	---	---	PASS
PITPNM3	83394	broad.mit.edu	37	17	6386854	6386854	+	Silent	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6386854A>G	uc002gdd.3	-	6	721	c.570T>C	c.(568-570)GCT>GCC	p.A190A	PITPNM3_uc010cln.2_Silent_p.A154A|PITPNM3_uc002gdc.3_5'Flank	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1	190					phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CAAGCGAGAAAGCCTCAGAGC	0.587													5	109	---	---	---	---	PASS
TRIM16	10626	broad.mit.edu	37	17	15498178	15498178	+	Silent	SNP	C	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15498178C>T	uc002gor.1	-	16	2998	c.2661G>A	c.(2659-2661)GTG>GTA	p.V887V	CDRT1_uc010vvy.1_Intron|CDRT1_uc010vvz.1_Intron|CDRT1_uc002gov.3_Silent_p.V577V|CDRT1_uc002gou.2_Intron|CDRT1_uc010cos.1_Silent_p.V77V			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;	Error:Variant_position_missing_in_O95361_after_alignment					histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		ACAGGCATTTCACAGCTCCCT	0.537													29	117	---	---	---	---	PASS
SUZ12P	440423	broad.mit.edu	37	17	29061651	29061651	+	Intron	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29061651G>T	uc002hfn.1	+						SUZ12P_uc002hfo.2_Intron|SUZ12P_uc002hfp.2_Intron|SUZ12P_uc002hfq.2_RNA					Homo sapiens cDNA clone IMAGE:5299523, containing frame-shift errors.												0						AACTATCTTAGAAAGGCTTAA	0.303													2	0	---	---	---	---	PASS
SNRPD1	6632	broad.mit.edu	37	18	19209129	19209129	+	3'UTR	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19209129A>G	uc002ktj.1	+	4						NM_006938	NP_008869	P62314	SMD1_HUMAN	small nuclear ribonucleoprotein D1 polypeptide						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding|RNA binding				0						GTCATATGAGATTTGGGATAT	0.219													5	177	---	---	---	---	PASS
SLC14A1	6563	broad.mit.edu	37	18	43319604	43319604	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43319604C>A	uc010xcn.1	+	9	1242	c.923C>A	c.(922-924)ACC>AAC	p.T308N	SLC14A1_uc010dnk.2_Missense_Mutation_p.T364N|SLC14A1_uc002lbf.3_Missense_Mutation_p.T308N|SLC14A1_uc002lbg.3_RNA|SLC14A1_uc010xco.1_Missense_Mutation_p.T203N|SLC14A1_uc002lbh.3_Missense_Mutation_p.T200N|SLC14A1_uc002lbi.3_Missense_Mutation_p.T176N|SLC14A1_uc002lbj.3_Missense_Mutation_p.T364N|SLC14A1_uc002lbk.3_Missense_Mutation_p.T308N	NM_001146036	NP_001139508	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter),	308						integral to plasma membrane	urea transmembrane transporter activity			central_nervous_system(1)|pancreas(1)	2						ACCTGGCAAACCCACCTCCTG	0.502													6	167	---	---	---	---	PASS
SPPL2B	56928	broad.mit.edu	37	19	2353056	2353056	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2353056C>G	uc002lvs.2	+	16	1708	c.1628C>G	c.(1627-1629)TCC>TGC	p.S543C	SPPL2B_uc002lvr.2_3'UTR	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2	543	Pro-rich.					Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGCCACATCCCCCTGGCCT	0.697													8	15	---	---	---	---	PASS
EMR4P	326342	broad.mit.edu	37	19	6984836	6984836	+	5'UTR	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6984836G>A	uc010xjk.1	-	4					EMR4P_uc010dve.1_RNA	NR_024075				RecName: Full=Putative EGF-like module-containing mucin-like hormone receptor-like 4; AltName: Full=G-protein coupled receptor 127; AltName: Full=G-protein coupled receptor PGR16; Flags: Precursor;												0						CACTTTGCCAGCCCGGTTTCA	0.343													100	247	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7809904	7809904	+	Silent	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7809904G>T	uc002mht.2	-	5	890	c.823C>A	c.(823-825)CGG>AGG	p.R275R	CD209_uc010xju.1_Silent_p.R114R|CD209_uc010dvp.2_Silent_p.R251R|CD209_uc002mhr.2_Silent_p.R251R|CD209_uc002mhs.2_Silent_p.R205R|CD209_uc002mhu.2_Silent_p.R183R|CD209_uc010dvq.2_Silent_p.R275R|CD209_uc002mhq.2_Silent_p.R275R|CD209_uc002mhv.2_Silent_p.R251R|CD209_uc002mhx.2_Silent_p.R231R|CD209_uc002mhw.2_Silent_p.R139R|CD209_uc010dvr.2_Intron	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	275	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						TGCCAGTTCCGCTGGGAGTTA	0.587													33	88	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38924363	38924363	+	5'UTR	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38924363G>A	uc002oit.2	+	1					RYR1_uc002oiu.2_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TGCCTCTGGTGTCTCCAGAGG	0.697													5	15	---	---	---	---	PASS
FPR1	2357	broad.mit.edu	37	19	52249500	52249500	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52249500A>G	uc002pxq.2	-	2	843	c.748T>C	c.(748-750)TTT>CTT	p.F250L		NM_002029	NP_002020	P21462	FPR1_HUMAN	formyl peptide receptor 1	250	Helical; Name=6; (Potential).				activation of MAPK activity|cellular component movement|chemotaxis|G-protein signaling, coupled to cAMP nucleotide second messenger|nitric oxide mediated signal transduction	endosome|integral to membrane|plasma membrane	N-formyl peptide receptor activity			ovary(1)|lung(1)|skin(1)	3		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	CAGAGAAAAAAGGCTGCTGCG	0.488													5	85	---	---	---	---	PASS
ZNF83	55769	broad.mit.edu	37	19	53117760	53117760	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53117760T>A	uc002pzu.3	-	2	1302	c.58A>T	c.(58-60)AAC>TAC	p.N20Y	ZNF83_uc002pzv.3_Missense_Mutation_p.N20Y|ZNF83_uc010eps.2_Missense_Mutation_p.N20Y|ZNF83_uc010ept.2_Missense_Mutation_p.N20Y|ZNF83_uc010epu.2_Missense_Mutation_p.N20Y|ZNF83_uc010epv.2_Missense_Mutation_p.N20Y|ZNF83_uc010epw.2_Missense_Mutation_p.N20Y|ZNF83_uc010epx.2_Missense_Mutation_p.N20Y|ZNF83_uc010epy.2_Missense_Mutation_p.N20Y|ZNF83_uc010epz.2_Missense_Mutation_p.N20Y|ZNF83_uc010eqb.1_Missense_Mutation_p.N20Y	NM_018300	NP_060770	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform a	20						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		GACTGCGGGTTTAATCCAAGC	0.398													23	44	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53912922	53912922	+	3'UTR	SNP	A	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53912922A>G	uc010ydx.1	+	6					ZNF765_uc002qbm.2_3'UTR|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		CTTACACGCCATCGTAGACTT	0.403													5	31	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55489152	55489152	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55489152G>A	uc002qij.2	+	4	444	c.358G>A	c.(358-360)GTG>ATG	p.V120M	NLRP2_uc010yfp.1_Missense_Mutation_p.V97M|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Missense_Mutation_p.V120M|NLRP2_uc010esp.2_Missense_Mutation_p.V120M	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	120					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		ACCTCTAGACGTGGACGAAAT	0.542													24	68	---	---	---	---	PASS
ZHX3	23051	broad.mit.edu	37	20	39831542	39831542	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39831542G>C	uc002xjs.1	-	3	2393	c.2015C>G	c.(2014-2016)ACC>AGC	p.T672S	ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Missense_Mutation_p.T672S|ZHX3_uc002xjt.1_Missense_Mutation_p.T672S|ZHX3_uc002xju.1_Missense_Mutation_p.T672S|ZHX3_uc002xjv.1_Missense_Mutation_p.T672S|ZHX3_uc002xjw.1_Missense_Mutation_p.T672S|ZHX3_uc010ggg.1_Missense_Mutation_p.T672S	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	672					negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Myeloproliferative disorder(115;0.00425)				AGCCTTCTTGGTCTCCTCAGC	0.507													60	152	---	---	---	---	PASS
ZHX3	23051	broad.mit.edu	37	20	39831543	39831543	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39831543T>C	uc002xjs.1	-	3	2392	c.2014A>G	c.(2014-2016)ACC>GCC	p.T672A	ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Missense_Mutation_p.T672A|ZHX3_uc002xjt.1_Missense_Mutation_p.T672A|ZHX3_uc002xju.1_Missense_Mutation_p.T672A|ZHX3_uc002xjv.1_Missense_Mutation_p.T672A|ZHX3_uc002xjw.1_Missense_Mutation_p.T672A|ZHX3_uc010ggg.1_Missense_Mutation_p.T672A	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	672					negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Myeloproliferative disorder(115;0.00425)				GCCTTCTTGGTCTCCTCAGCA	0.507													64	153	---	---	---	---	PASS
TP53TG5	27296	broad.mit.edu	37	20	44004124	44004124	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44004124T>C	uc002xny.2	-	4	404	c.323A>G	c.(322-324)AAG>AGG	p.K108R	SYS1_uc002xnw.1_3'UTR|SYS1-DBNDD2_uc002xnx.2_Intron	NM_014477	NP_055292	Q9Y2B4	T53G5_HUMAN	TP53-target gene 5 protein	108					intracellular signal transduction|negative regulation of cell growth	cytoplasm|nucleus				central_nervous_system(1)	1						CTTGAGTTCCTTCTCGGAGCA	0.488													41	155	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	20	56064058	56064058	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56064058G>A	uc010zzl.1	-	1	26	c.26C>T	c.(25-27)CCG>CTG	p.P9L	CTCFL_uc010giu.2_RNA|CTCFL_uc010giv.2_RNA	NM_001008735	NP_001008735			high-mobility group box 1-like 1																		TTTGCCTCTCGGCTTCTTAGG	0.483													4	27	---	---	---	---	PASS
SLC37A1	54020	broad.mit.edu	37	21	43982273	43982273	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43982273A>C	uc002zbi.2	+	13	1479	c.1067A>C	c.(1066-1068)AAT>ACT	p.N356T	SLC37A1_uc002zbj.2_Missense_Mutation_p.N356T	NM_018964	NP_061837	P57057	GLPT_HUMAN	solute carrier family 37 member 1	356					carbohydrate transport|transmembrane transport	integral to membrane					0						TACATCACGAATGTGGGTGAG	0.483													9	357	---	---	---	---	PASS
DACH2	117154	broad.mit.edu	37	X	86069820	86069820	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86069820G>T	uc004eew.2	+	10	1837	c.1667G>T	c.(1666-1668)GGC>GTC	p.G556V	DACH2_uc004eex.2_Missense_Mutation_p.G543V|DACH2_uc010nmq.2_Missense_Mutation_p.G422V|DACH2_uc011mra.1_Missense_Mutation_p.G389V|DACH2_uc010nmr.2_Missense_Mutation_p.G337V|DACH2_uc004eey.2_Missense_Mutation_p.G249V|DACH2_uc004eez.2_Missense_Mutation_p.G239V	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	556					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						AGTGACAGTGGCCTGAGGATG	0.363													7	84	---	---	---	---	PASS
DDX3Y	8653	broad.mit.edu	37	Y	15024911	15024911	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15024911T>A	uc004fsu.1	+	7	783	c.474T>A	c.(472-474)TTT>TTA	p.F158L	DDX3Y_uc010nwv.1_Missense_Mutation_p.F158L|DDX3Y_uc011naq.1_Missense_Mutation_p.F158L|DDX3Y_uc004fsv.2_Missense_Mutation_p.F158L|DDX3Y_uc010nww.1_Intron|DDX3Y_uc011nar.1_Missense_Mutation_p.F155L	NM_001122665	NP_001116137	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 3,	158						cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|RNA binding				0						GGATTAACTTTGAGAAATATG	0.313													160	98	---	---	---	---	PASS
PRDM16	63976	broad.mit.edu	37	1	3220868	3220868	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3220868delT	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGCCAAGCCCTGCAGTCCTGG	0.562			T	EVI1	MDS|AML								4	2	---	---	---	---	
DFFB	1677	broad.mit.edu	37	1	3785114	3785115	+	Intron	INS	-	T	T	rs137990902	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3785114_3785115insT	uc001alc.2	+						DFFB_uc001ale.2_Intron|DFFB_uc009vlp.2_Intron|DFFB_uc001alb.2_Intron|DFFB_uc010nzn.1_Intron|DFFB_uc009vlq.2_Intron|DFFB_uc009vlr.2_Intron|DFFB_uc001ald.2_Intron	NM_004402	NP_004393	O76075	DFFB_HUMAN	DNA fragmentation factor, 40 kD, beta						apoptotic chromosome condensation|DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction	cytosol|nucleoplasm	deoxyribonuclease activity|enzyme binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TCCACCCCATCGAATGTGGATT	0.371													3	3	---	---	---	---	
AJAP1	55966	broad.mit.edu	37	1	4799784	4799784	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4799784delT	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943	Q9UKB5	AJAP1_HUMAN	adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		ttggttgttgtttttttttct	0.338													4	2	---	---	---	---	
FHAD1	114827	broad.mit.edu	37	1	15709499	15709500	+	Intron	DEL	CA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15709499_15709500delCA	uc001awb.2	+						FHAD1_uc001awd.1_Intron|FHAD1_uc010obl.1_Intron|FHAD1_uc001awe.1_Intron|FHAD1_uc001awg.2_Intron	NM_052929	NP_443161	B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding											skin(1)	1						CCCCTCCCACCACACACACACA	0.421													4	2	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16936039	16936040	+	Intron	INS	-	TTCA	TTCA	rs147837394		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16936039_16936040insTTCA	uc009vos.1	-						NBPF1_uc001aza.3_Intron|NBPF1_uc001azb.1_Intron|NBPF1_uc001azc.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GTATTAGTATGTTCATTCattc	0.129													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	27845070	27845071	+	IGR	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27845070_27845071insT								WASF2 (28401 upstream) : AHDC1 (15723 downstream)																							ACTCAGAGGTGTTTTTTTTTTC	0.550													4	2	---	---	---	---	
PSMB2	5690	broad.mit.edu	37	1	36036188	36036188	+	3'UTR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36036188delA	uc001bzd.1	-	7					TFAP2E_uc010ohy.1_5'Flank	NM_002794	NP_002785	P49721	PSB2_HUMAN	proteasome beta 2 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)			Bortezomib(DB00188)	tttgaacttgaaaaagggtgg	0.000													4	2	---	---	---	---	
MUTYH	4595	broad.mit.edu	37	1	45800526	45800526	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45800526delT	uc001cnm.2	-						MUTYH_uc009vxn.2_5'Flank|MUTYH_uc001cnf.2_Intron|MUTYH_uc009vxo.2_Intron|MUTYH_uc001cng.2_Intron|MUTYH_uc001cnj.2_Intron|MUTYH_uc001cni.2_Intron|MUTYH_uc001cnh.2_Intron|MUTYH_uc001cno.2_Intron|MUTYH_uc001cnk.2_Intron|MUTYH_uc010oll.1_Intron|MUTYH_uc001cnl.2_Intron|MUTYH_uc009vxp.2_Intron|MUTYH_uc001cnn.2_Intron	NM_012222	NP_036354	Q9UIF7	MUTYH_HUMAN	mutY homolog isoform 1						depurination|mismatch repair	nucleoplasm	4 iron, 4 sulfur cluster binding|DNA N-glycosylase activity|endonuclease activity|metal ion binding|MutSalpha complex binding				0	Acute lymphoblastic leukemia(166;0.155)					ATAGGGGTTGTTTAGGTGTGT	0.378			Mis			colorectal		BER_DNA_glycosylases	MUTYH-associated_polyposis				4	2	---	---	---	---	
KIAA1107	23285	broad.mit.edu	37	1	92637186	92637186	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92637186delA	uc010otd.1	+						KIAA1107_uc001dop.2_Intron	NM_015237	NP_056052	Q9UPP5	K1107_HUMAN	hypothetical protein LOC23285												0						TAAATGTTTTAAAGTGAATTT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	113869071	113869071	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113869071delC								LRIG2 (201729 upstream) : MAGI3 (64404 downstream)																							tctctgccttccccatgcctc	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142540151	142540151	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142540151delT								None (None upstream) : None (None downstream)																							tggaatggaattggaatggaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142561242	142561243	+	IGR	INS	-	A	A	rs148304868		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142561242_142561243insA								None (None upstream) : None (None downstream)																							aagcctccaagaaatatgggac	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143544118	143544119	+	IGR	DEL	AA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143544118_143544119delAA								None (None upstream) : LOC100286793 (103520 downstream)																							ATAGCTTGACAAAAAAAAAAAG	0.282													2	6	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145051754	145051754	+	Intron	DEL	T	-	-	rs59039178		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145051754delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						tgctaaaaactatcaataaat	0.000													4	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145085808	145085809	+	Intron	INS	-	T	T	rs146743627		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145085808_145085809insT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						atgcatgtgtcttttggtataa	0.000													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145237179	145237179	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145237179delA	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGCCTTTATCAAAGACAATGT	0.348													2	6	---	---	---	---	
ITGA10	8515	broad.mit.edu	37	1	145540091	145540091	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145540091delT	uc001eoa.2	+						NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Intron|ITGA10_uc009wiw.2_Intron|ITGA10_uc010oyw.1_Intron	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor						cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGACCATTACTTTTTTTTTTC	0.219													5	3	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148001285	148001286	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148001285_148001286insA	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						CATCATTTTTGAAAAGAGTATT	0.277													5	8	---	---	---	---	
LOC645166	645166	broad.mit.edu	37	1	148940446	148940447	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148940446_148940447insA	uc010pbc.1	+						LOC645166_uc010pbd.1_Intron|LOC645166_uc009wkw.1_Intron	NR_027355				Homo sapiens cDNA, FLJ18771.												0						gactccatctcaaaaaaataaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149030431	149030432	+	IGR	INS	-	A	A	rs147782894		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149030431_149030432insA								LOC645166 (77377 upstream) : LOC388692 (249044 downstream)																							aagcaacagatttttttttcac	0.069													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157693543	157693543	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157693543delA								FCRL3 (22768 upstream) : FCRL2 (21980 downstream)																							GAGATTTATCATGATACCTAG	0.303													3	4	---	---	---	---	
ATF6	22926	broad.mit.edu	37	1	161838446	161838446	+	Intron	DEL	T	-	-	rs113508615		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161838446delT	uc001gbr.2	+							NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			ATTTAAAAGGTTTTTTTTTTT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	165036100	165036100	+	IGR	DEL	G	-	-	rs56071197		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165036100delG								PBX1 (181800 upstream) : LMX1A (135005 downstream)																							taaattgaacgtatttccctg	0.000													4	2	---	---	---	---	
POU2F1	5451	broad.mit.edu	37	1	167365924	167365925	+	Intron	DEL	AC	-	-	rs34119749		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167365924_167365925delAC	uc001gec.2	+						POU2F1_uc001ged.2_Intron|POU2F1_uc001gee.2_Intron|POU2F1_uc010plh.1_Intron|POU2F1_uc001gef.2_Intron|POU2F1_uc001geg.2_Intron|POU2F1_uc009wvg.1_5'Flank	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						AGGATTAGGAacacacacacac	0.267													3	4	---	---	---	---	
SLC9A11	284525	broad.mit.edu	37	1	173490617	173490622	+	Intron	DEL	TATATA	-	-	rs146332693		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173490617_173490622delTATATA	uc001giz.2	-						SLC9A11_uc009wwe.2_Intron	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11						sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						AAATATTTTCtatatatatatatata	0.218													17	8	---	---	---	---	
TNN	63923	broad.mit.edu	37	1	175045312	175045313	+	Intron	INS	-	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175045312_175045313insG	uc001gkl.1	+						TNN_uc010pmx.1_5'Flank	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGGGGGCACAAGGGGAAATGGC	0.530													4	2	---	---	---	---	
KIAA1614	57710	broad.mit.edu	37	1	180913303	180913303	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180913303delA	uc001gok.2	+						KIAA1614_uc001gol.1_Intron|KIAA1614_uc001gom.1_Intron|STX6_uc009wxo.1_RNA	NM_020950	NP_066001	Q5VZ46	K1614_HUMAN	hypothetical protein LOC57710											ovary(3)|skin(1)	4						TATTTCAGCTAAAAAGCAAAA	0.348													4	2	---	---	---	---	
MR1	3140	broad.mit.edu	37	1	181004473	181004473	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181004473delA	uc001goq.1	+						MR1_uc001gop.2_Intron|MR1_uc001gor.1_Intron|MR1_uc001gos.1_Intron|MR1_uc010pns.1_Intron	NM_001531	NP_001522	Q95460	HMR1_HUMAN	major histocompatibility complex, class						antigen processing and presentation of peptide antigen via MHC class I|immune response	endoplasmic reticulum|extracellular region|integral to membrane|MHC class I protein complex	MHC class I receptor activity			skin(1)	1						actccatctcaaaaaaaaaaa	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	190689303	190689303	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190689303delA								FAM5C (242544 upstream) : None (None downstream)																							gagtttcaagaaaaaaaaggt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	197819682	197819682	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197819682delT								DENND1B (75059 upstream) : C1orf53 (52000 downstream)																							AATTTAGGTATTTGAGTTGAC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200694835	200694835	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200694835delA								DDX59 (55709 upstream) : CAMSAP1L1 (13851 downstream)																							aaacaaaaacaaaaaaaaaac	0.114													4	2	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202173487	202173488	+	Intron	DEL	CA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202173487_202173488delCA	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						cacacacctccacacacacaca	0.000													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205100247	205100247	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205100247delT								RBBP5 (9116 upstream) : DSTYK (11385 downstream)																							ttatttaaaatttttttttca	0.119													4	2	---	---	---	---	
SLC26A9	115019	broad.mit.edu	37	1	205909565	205909566	+	Intron	INS	-	A	A	rs138178577	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205909565_205909566insA	uc001hdq.2	-						SLC26A9_uc001hdp.2_Intron	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a							integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			GGCTCAGGCAGAGACAGTGCCC	0.342													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	209562633	209562634	+	IGR	DEL	AC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209562633_209562634delAC								None (None upstream) : LOC642587 (39534 downstream)																							CACCACCTTAACACACACACAC	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212410063	212410063	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212410063delA								DTL (131877 upstream) : PPP2R5A (48816 downstream)																							AGAAGAAAAGAAAAAAAAAAT	0.373													4	3	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	216465939	216465939	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216465939delT	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		gaaaatgatctttttttttct	0.055										HNSCC(13;0.011)			4	2	---	---	---	---	
SPATA17	128153	broad.mit.edu	37	1	217891652	217891652	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217891652delA	uc001hlh.1	+						SPATA17_uc009xdr.1_Intron|SPATA17_uc001hli.2_Intron	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		gagcaggaggaaaaaaaaaaa	0.000													3	4	---	---	---	---	
SLC30A10	55532	broad.mit.edu	37	1	219918730	219918730	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219918730delT	uc001hlu.1	-									Q6XR72	ZNT10_HUMAN	Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		TCAACCACACTTTTTTTTTCA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	220487531	220487531	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220487531delA								RAB3GAP2 (41688 upstream) : MARK1 (214037 downstream)																							GAAGTTCCTTAAACTTATCCA	0.448													48	51	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221785600	221785600	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221785600delG								LOC400804 (275962 upstream) : DUSP10 (89166 downstream)																							GCACTGCCCAGGGACTTTAAA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	225084357	225084358	+	IGR	INS	-	C	C	rs143953937	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225084357_225084358insC								CNIH3 (156108 upstream) : DNAH14 (32998 downstream)																							CAGGGAAGGAACAAACAGGCAG	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	225632831	225632831	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225632831delG								LBR (16312 upstream) : ENAH (41703 downstream)																							TTATCTTGCAGGAGGCTGATG	0.512													4	2	---	---	---	---	
CDC42BPA	8476	broad.mit.edu	37	1	227365171	227365171	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227365171delT	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				gatcattccatttttttttcc	0.000													4	2	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239709745	239709745	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239709745delG	uc001hyo.1	+									P20309	ACM3_HUMAN	Homo sapiens clone N10 NTera2D1 teratocarcinoma, m3 muscarinic acetylcholine receptor mRNA, partial cds.						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	tgttgtCTGTGGTCAACTAAC	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242974774	242974775	+	IGR	DEL	TG	-	-	rs111912887		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242974774_242974775delTG								PLD5 (286776 upstream) : CEP170 (312956 downstream)																							ctcatgactctgtgtgtgtgtg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	244930079	244930080	+	IGR	DEL	TC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244930079_244930080delTC								PPPDE1 (57747 upstream) : FAM36A (68559 downstream)																							ttctaccccatctctctctctc	0.000													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245705078	245705078	+	Intron	DEL	G	-	-	rs11346321		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245705078delG	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron|KIF26B_uc001ibg.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TCTTGCTGAAGCTCCGGAGCA	0.527													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245705081	245705083	+	Intron	DEL	CCG	-	-	rs10570149		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245705081_245705083delCCG	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron|KIF26B_uc001ibg.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TGCTGAAGCTCCGGAGCAACTAC	0.537													4	2	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246082516	246082517	+	Intron	DEL	AT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246082516_246082517delAT	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron|SMYD3_uc001ibi.2_Intron|SMYD3_uc001ibj.2_Intron	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		atttctctacataaaaacttgc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	246693899	246693900	+	IGR	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246693899_246693900delGT								SMYD3 (23285 upstream) : TFB2M (9968 downstream)																							ggtcacacaagtctaagaagtc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248866271	248866271	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248866271delC								OR14I1 (20666 upstream) : LOC646627 (36447 downstream)																							tccttactctccttactcatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	940556	940556	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:940556delG								TMEM18 (263117 upstream) : SNTG2 (5999 downstream)																							ccaataccatgctgttttagt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2817474	2817474	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2817474delT								MYT1L (482429 upstream) : TSSC1 (375267 downstream)																							agtgctgggattacaggcgtg	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5932895	5932895	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5932895delA								SOX11 (91379 upstream) : LOC150622 (139924 downstream)																							GTCTTAGCGGAAAAAAAAAAT	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	9158510	9158510	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9158510delT								MBOAT2 (14634 upstream) : ASAP2 (188384 downstream)																							GTGATGACTCTTTTTTTTCCT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	9201271	9201271	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9201271delT								MBOAT2 (57395 upstream) : ASAP2 (145623 downstream)																							GACTGGGTTGTTTTTTTTTTC	0.453													4	2	---	---	---	---	
WDR35	57539	broad.mit.edu	37	2	20166298	20166298	+	Intron	DEL	A	-	-	rs76964256		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20166298delA	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCTTGAAGAAAAAAAAAAT	0.353													6	3	---	---	---	---	
DNMT3A	1788	broad.mit.edu	37	2	25482176	25482176	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25482176delG	uc002rgc.2	-						DNMT3A_uc002rgd.2_Intron|DNMT3A_uc010eyi.2_Intron	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform						regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCAGGGCAGGGGTGGGAGA	0.602			Mis|F|N|S		AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42327061	42327061	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42327061delC								PKDCC (41395 upstream) : EML4 (69429 downstream)																							tggcacctctccccccatgct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	43152549	43152554	+	IGR	DEL	GAGAGT	-	-	rs4953693	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43152549_43152554delGAGAGT								HAAO (132798 upstream) : ZFP36L2 (296988 downstream)																							gagagagagagagagTGTGTGTGGAC	0.432													4	2	---	---	---	---	
ASB3	51130	broad.mit.edu	37	2	53967554	53967554	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53967554delT	uc002rxg.1	-						ASB3_uc002rxh.1_Intron|ASB3_uc002rxi.3_Intron|ASB3_uc010yoo.1_Intron	NM_016115	NP_057199	Q9Y575	ASB3_HUMAN	ankyrin repeat and SOCS box-containing protein 3						intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GACAAAGGAATTTTTTTTTCC	0.348													4	2	---	---	---	---	
PNPT1	87178	broad.mit.edu	37	2	55915184	55915184	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55915184delT	uc002rzf.2	-						PNPT1_uc002rzg.2_Intron	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1						mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ttttcttttcttttttttttt	0.169													3	3	---	---	---	---	
CCDC85A	114800	broad.mit.edu	37	2	56459914	56459914	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56459914delT	uc002rzn.2	+							NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			tccatctttattataactacc	0.025													4	2	---	---	---	---	
CCDC85A	114800	broad.mit.edu	37	2	56569124	56569125	+	Intron	INS	-	T	T	rs112673904		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56569124_56569125insT	uc002rzn.2	+							NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TTTATTTTCTGTTTTTTTTTTT	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	59093691	59093691	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59093691delT	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																		GATTTCGGGCTTTTTTTCCCC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67730048	67730048	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67730048delT								ETAA1 (92515 upstream) : C1D (539285 downstream)																							TTTGTCTTCATTTGGCAAACA	0.423													4	2	---	---	---	---	
ANTXR1	84168	broad.mit.edu	37	2	69384857	69384860	+	Intron	DEL	GAAT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69384857_69384860delGAAT	uc002sfg.2	+						ANTXR1_uc002sff.2_Intron	NM_032208	NP_115584	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1 isoform 1 precursor						actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)|skin(2)	4						aatatttgtggaatgaatgaatGG	0.250									Familial_Infantile_Hemangioma				4	2	---	---	---	---	
ANTXR1	84168	broad.mit.edu	37	2	69430876	69430878	+	Intron	DEL	CTT	-	-	rs7601927	byFrequency	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69430876_69430878delCTT	uc002sfg.2	+							NM_032208	NP_115584	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1 isoform 1 precursor						actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)|skin(2)	4						CCTCCTCCTCCTTattatcacca	0.296									Familial_Infantile_Hemangioma				3	5	---	---	---	---	
PAIP2B	400961	broad.mit.edu	37	2	71452841	71452841	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71452841delC	uc002shu.2	-							NM_020459	NP_065192	Q9ULR5	PAI2B_HUMAN	poly(A) binding protein interacting protein 2B						negative regulation of translational initiation		protein binding|translation repressor activity, nucleic acid binding				0						ATTAGCTTTTCCCCATAAAAT	0.333													4	2	---	---	---	---	
POLR1A	25885	broad.mit.edu	37	2	86328219	86328219	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86328219delA	uc002sqs.2	-						POLR1A_uc002sqv.2_Intron	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A						termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						GTCAAACCTTAAAAAAGGTTT	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91801333	91801334	+	IGR	INS	-	C	C	rs147402585		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91801333_91801334insC								None (None upstream) : LOC654342 (3858 downstream)																							gttcatgactaccattagctcc	0.000													2	5	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	116551751	116551752	+	Intron	INS	-	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116551751_116551752insG	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						GTGATTTTGGTGTCAGTACTTT	0.317													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127263398	127263398	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127263398delC								None (None upstream) : GYPC (150286 downstream)																							tagcttcccactataaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	128825103	128825103	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128825103delA								SAP130 (39470 upstream) : UGGT1 (23651 downstream)																							tgtctctatgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129832636	129832637	+	IGR	DEL	TT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129832636_129832637delTT								HS6ST1 (756465 upstream) : LOC389033 (847798 downstream)																							cttaattctctttactgaatct	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130572547	130572547	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130572547delA								None (None upstream) : LOC389033 (107888 downstream)																							gaatttgggtaagataaaaaa	0.000													4	2	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	138222820	138222821	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138222820_138222821insA	uc002tva.1	+						THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TCCCCATTCATAAAAAAAAAAA	0.401													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	149364793	149364794	+	IGR	INS	-	CATT	CATT	rs138914564	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149364793_149364794insCATT								MBD5 (93751 upstream) : EPC2 (37766 downstream)																							CACAAGGAGTGCATTCattcat	0.277													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	151184043	151184043	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151184043delA								MMADHC (739713 upstream) : RND3 (140669 downstream)																							TTGTTTGGTCAAAAAAAAAAG	0.289													4	2	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152565767	152565767	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152565767delG	uc010fnx.2	-						NEB_uc010fny.1_5'Flank	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCCTCTTCCTGGGGGGAGAAG	0.383													4	2	---	---	---	---	
SLC4A10	57282	broad.mit.edu	37	2	162840664	162840664	+	3'UTR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162840664delG	uc002ubx.3	+	27					SLC4A10_uc002uby.3_3'UTR|SLC4A10_uc010zcs.1_3'UTR	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						ATGTTCTCATGTTAGACCAAC	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	163779098	163779098	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163779098delA								KCNH7 (83858 upstream) : FIGN (685020 downstream)																							aagatggaggaaaagccagtg	0.060													4	2	---	---	---	---	
XIRP2	129446	broad.mit.edu	37	2	167804348	167804348	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167804348delA	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						catatttgccaaaacttggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	175636869	175636869	+	Intron	DEL	T	-	-	rs113296040		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175636869delT	uc002uiw.2	+											Homo sapiens cDNA FLJ11228 fis, clone PLACE1008329.																		GTTTCTTCTGTTTTTTTTTTC	0.443											OREG0015080	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	6	---	---	---	---	
TTC30B	150737	broad.mit.edu	37	2	178415367	178415367	+	3'UTR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178415367delT	uc002uln.2	-	1					TTC30B_uc010zfc.1_3'UTR	NM_152517	NP_689730	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B						cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			TTTTAGCTACTTTTTTTTTTA	0.294													11	6	---	---	---	---	
PLCL1	5334	broad.mit.edu	37	2	198743354	198743355	+	Intron	DEL	TG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198743354_198743355delTG	uc010fsp.2	+						PLCL1_uc002uuv.3_Intron	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	TGTGGAAAACtgtgtgtgtgtg	0.312													4	2	---	---	---	---	
AOX1	316	broad.mit.edu	37	2	201460419	201460419	+	Intron	DEL	A	-	-	rs113325589		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201460419delA	uc002uvx.2	+							NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1						inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	tgtctctaagaaaaaaaaaaa	0.204													4	2	---	---	---	---	
ADAM23	8745	broad.mit.edu	37	2	207452304	207452305	+	Intron	INS	-	A	A	rs117434816		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207452304_207452305insA	uc002vbq.2	+						ADAM23_uc010ziv.1_Intron	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein						cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CAGATTAAGAGAAAAAAAAAAA	0.322													10	5	---	---	---	---	
EPHA4	2043	broad.mit.edu	37	2	222321744	222321744	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222321744delT	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CCTCCTACTCTTTTTTTTTGA	0.338													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	223714948	223714948	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223714948delA								MOGAT1 (140299 upstream) : ACSL3 (10784 downstream)																							tgttgtgttgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	228460111	228460111	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228460111delT								AGFG1 (34173 upstream) : C2orf83 (14696 downstream)																							TAGAGGGAGGTTTTTTTTTGT	0.279													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	234520683	234520683	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234520683delT								USP40 (45255 upstream) : UGT1A8 (5608 downstream)																							gCCACATGCATTTTTTTTTTC	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239485092	239485093	+	IGR	DEL	TC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239485092_239485093delTC								ASB1 (124202 upstream) : TWIST2 (271580 downstream)																							ccttggctcttctctgctccag	0.000													4	2	---	---	---	---	
HRH1	3269	broad.mit.edu	37	3	11219961	11219962	+	Intron	DEL	AC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11219961_11219962delAC	uc010hdr.2	+						HRH1_uc010hds.2_Intron	NM_001098213	NP_001091683	P35367	HRH1_HUMAN	histamine receptor H1						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|inflammatory response	cytoplasm|integral to plasma membrane|nucleus	histamine receptor activity			large_intestine(1)|ovary(1)	2					Aceprometazine(DB01615)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzquinamide(DB00767)|Bepotastine(DB04890)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlophedianol(DB04837)|Chlorpheniramine(DB01114)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clemastine(DB00283)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Maprotiline(DB00934)|Meclizine(DB00737)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nedocromil(DB00716)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Pemirolast(DB00885)|Phenindamine(DB01619)|Pheniramine(DB01620)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Terfenadine(DB00342)|Thiethylperazine(DB00372)|Trazodone(DB00656)|Trimeprazine(DB01246)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)	CTCCTCTGTGACACACACATTG	0.530													4	2	---	---	---	---	
STT3B	201595	broad.mit.edu	37	3	31658789	31658789	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31658789delA	uc011axe.1	+						STT3B_uc010hft.1_Intron|STT3B_uc003cer.1_Intron|STT3B_uc003cet.2_Intron	NM_178862	NP_849193	Q8TCJ2	STT3B_HUMAN	source of immunodominant MHC-associated						protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0						CTATAAAAAGAAAAAAAAAAT	0.353													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	37016012	37016013	+	IGR	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37016012_37016013insT								TRANK1 (113601 upstream) : EPM2AIP1 (11345 downstream)																							GCCTTCAACAAttttttttttt	0.158													4	3	---	---	---	---	
SHISA5	51246	broad.mit.edu	37	3	48514907	48514907	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48514907delG	uc003ctp.1	-						SHISA5_uc003ctn.1_5'Flank|SHISA5_uc003ctm.1_5'Flank|SHISA5_uc011bbk.1_5'UTR|SHISA5_uc003cto.1_Intron|SHISA5_uc003ctq.1_Intron|SHISA5_uc003ctr.1_Intron|SHISA5_uc003cts.1_Intron|SHISA5_uc003ctt.2_5'Flank|SHISA5_uc003ctu.1_5'Flank|SHISA5_uc011bbl.1_Intron	NM_016479	NP_057563	Q8N114	SHSA5_HUMAN	scotin precursor						apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	signal transducer activity|WW domain binding				0						GGGCGACCCTGGGGCCCTGGC	0.622											OREG0015558	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52620517	52620518	+	Frame_Shift_Ins	INS	-	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52620517_52620518insC	uc003des.2	-	20	3322_3323	c.3310_3311insG	c.(3310-3312)GCAfs	p.A1104fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Ins_p.A1104fs|PBRM1_uc003der.2_Frame_Shift_Ins_p.A1072fs|PBRM1_uc003det.2_Frame_Shift_Ins_p.A1119fs|PBRM1_uc003deu.2_Frame_Shift_Ins_p.A1119fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Ins_p.A1104fs|PBRM1_uc010hmk.1_Frame_Shift_Ins_p.A1079fs|PBRM1_uc003dey.2_Frame_Shift_Ins_p.A1079fs|PBRM1_uc003dez.1_Frame_Shift_Ins_p.A1103fs|PBRM1_uc003dfb.1_Frame_Shift_Ins_p.A1016fs|PBRM1_uc003dfa.1_Frame_Shift_Ins_p.A450fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1104					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ACCTTTATCTGCATTTGCAAAT	0.450			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								191	118	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	53175325	53175326	+	IGR	INS	-	TCAT	TCAT	rs148746245	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53175325_53175326insTCAT								RFT1 (10855 upstream) : PRKCD (19897 downstream)																							CTCCCTGGCCGtcattcattca	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	55397413	55397415	+	IGR	DEL	CTC	-	-	rs77129474		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55397413_55397415delCTC								CACNA2D3 (288831 upstream) : WNT5A (102329 downstream)																							acatacaattctcctattccctg	0.148													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	65125739	65125739	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65125739delA								ADAMTS9 (452374 upstream) : MAGI1 (214168 downstream)																							ATATCACCACAAAAACTTCCT	0.388													4	2	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65989001	65989001	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65989001delG	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		ACAGAGTAATGGAGAGTGGAG	0.393													4	2	---	---	---	---	
SLC25A26	115286	broad.mit.edu	37	3	66395440	66395441	+	Intron	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66395440_66395441delGT	uc011bfq.1	+						SLC25A26_uc011bfs.1_Intron|SLC25A26_uc011bft.1_Intron|SLC25A26_uc011bfr.1_Intron|SLC25A26_uc003dmt.2_Intron	NM_173471	NP_775742	Q70HW3	SAMC_HUMAN	solute carrier family 25, member 26 isoform a							integral to membrane|mitochondrial inner membrane|nucleus	S-adenosylmethionine transmembrane transporter activity			pancreas(1)	1		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		tgaggattcagtgaaataaagc	0.089													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	88333940	88333940	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88333940delT								C3orf38 (126827 upstream) : EPHA3 (822734 downstream)																							TATTTGTGCCTTTTTTGGCTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107118657	107118657	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107118657delT								CCDC54 (21176 upstream) : BBX (123126 downstream)																							TAAAGAGAGATTAGGGAATGA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	113828433	113828433	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113828433delT								QTRTD1 (21167 upstream) : DRD3 (19124 downstream)																							ATGGCTTTTCTTTTTTTTTTT	0.383													6	3	---	---	---	---	
PLA1A	51365	broad.mit.edu	37	3	119339884	119339884	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119339884delC	uc003ecu.2	+						PLA1A_uc003ecv.2_Intron|PLA1A_uc003ecw.2_Intron|PLA1A_uc011bjc.1_Intron	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN	phospholipase A1 member A precursor						lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						GTCAGCGCCACCCCATCTGAG	0.463													4	2	---	---	---	---	
GMPS	8833	broad.mit.edu	37	3	155652357	155652357	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155652357delT	uc003faq.2	+						GMPS_uc011bom.1_Intron	NM_003875	NP_003866	P49915	GUAA_HUMAN	guanine monophosphate synthetase						glutamine metabolic process|purine base biosynthetic process	cytosol	ATP binding|GMP synthase (glutamine-hydrolyzing) activity|GMP synthase activity			ovary(2)|lung(1)	3			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	gcaaagaccctttttcTCCCC	0.189			T	MLL	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156357554	156357554	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156357554delT								SSR3 (84619 upstream) : LOC100287227 (33410 downstream)																							ctttcttttcttttctttctt	0.040													4	2	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	158993899	158993900	+	Intron	INS	-	T	T	rs137888956	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158993899_158993900insT	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			GATTTTAACCCTTTTGGCACTA	0.396													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181565545	181565546	+	IGR	INS	-	A	A	rs138922661	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181565545_181565546insA								SOX2OT (106542 upstream) : ATP11B (945745 downstream)																							GGGCTCTAGGGAGATCAGCGTA	0.515													4	4	---	---	---	---	
ATP11B	23200	broad.mit.edu	37	3	182619831	182619831	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182619831delT	uc003flb.2	+						ATP11B_uc003flc.2_Intron|ATP11B_uc010hxg.2_Intron|ATP11B_uc010hxh.1_Intron	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B						aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TTTCCTTTCCTTTTTTTTGCT	0.388													4	2	---	---	---	---	
SENP2	59343	broad.mit.edu	37	3	185337428	185337428	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185337428delT	uc003fpn.2	+						SENP2_uc011brv.1_Intron|SENP2_uc011brw.1_Intron	NM_021627	NP_067640	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific protease 2						mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CTCTTTTTAGTTTTTTTTTTA	0.234													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187360977	187360977	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187360977delC								RTP4 (271610 upstream) : SST (25719 downstream)																							cccagctcttcctttctctag	0.104													4	2	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	68700	68700	+	Intron	DEL	T	-	-	rs5855664		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68700delT	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		attaaattgcttttgactata	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	1551726	1551727	+	IGR	INS	-	G	G	rs138759695	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1551726_1551727insG								CRIPAK (161944 upstream) : FAM53A (89882 downstream)																							cactgcccagtggtgactctga	0.302													6	3	---	---	---	---	
STK32B	55351	broad.mit.edu	37	4	5059697	5059698	+	Intron	DEL	AC	-	-	rs149972258		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5059697_5059698delAC	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						GAAGAGAAAAACACACTCTATT	0.411													4	3	---	---	---	---	
LOC84740	84740	broad.mit.edu	37	4	7759196	7759197	+	Intron	INS	-	A	A	rs149960760	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7759196_7759197insA	uc003gkd.3	+							NR_026892				Homo sapiens hypothetical LOC84740, mRNA (cDNA clone IMAGE:3636109).												0						aaagcatcaggaaAAAAAGATG	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9741002	9741002	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9741002delT								MIR548I2 (183065 upstream) : DRD5 (42256 downstream)																							TTATTCTCCATTTTTTAAATC	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	11907411	11907414	+	IGR	DEL	AACA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11907411_11907414delAACA								HS3ST1 (476874 upstream) : None (None downstream)																							gcaaaaaaggaacaaacaaacaaa	0.216													3	4	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21497917	21497917	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21497917delA	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				GTCAACAAAGAAAAAAAATAG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26173637	26173637	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26173637delA								C4orf52 (242137 upstream) : RBPJ (147695 downstream)																							GCTGGAGGTTAAAATCGCCCC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	29102694	29102694	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29102694delT								None (None upstream) : None (None downstream)																							gggatttttgttttttttttc	0.060													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	36847486	36847487	+	IGR	INS	-	AA	AA	rs140857461	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36847486_36847487insAA								MIR1255B-1 (419436 upstream) : KIAA1239 (399203 downstream)																							TAGTGTGCAGTAGTTGACCATA	0.386													2	4	---	---	---	---	
PGM2	55276	broad.mit.edu	37	4	37831492	37831493	+	Intron	INS	-	TT	TT			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37831492_37831493insTT	uc011byb.1	+						PGM2_uc011bya.1_Intron|PGM2_uc011byc.1_Intron	NM_018290	NP_060760	Q96G03	PGM2_HUMAN	phosphoglucomutase 2						glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity			ovary(1)	1						acatatatatatatTTTCTATA	0.233													4	2	---	---	---	---	
TMEM156	80008	broad.mit.edu	37	4	38986097	38986098	+	Intron	INS	-	AC	AC	rs144811328	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38986097_38986098insAC	uc003gto.2	-						TMEM156_uc010ifj.2_Intron	NM_024943	NP_079219	Q8N614	TM156_HUMAN	transmembrane protein 156							integral to membrane				skin(1)	1						TGCTGAATGTGACACAGTCACC	0.406													6	3	---	---	---	---	
CWH43	80157	broad.mit.edu	37	4	49051723	49051723	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49051723delC	uc003gyv.2	+						CWH43_uc011bzl.1_Intron	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog						GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						ggttccccttccctaaacacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49221644	49221644	+	IGR	DEL	T	-	-	rs111396806		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49221644delT								CWH43 (157551 upstream) : None (None downstream)																							cacctgtgacttttgcggggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49275069	49275069	+	IGR	DEL	G	-	-	rs71253582		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49275069delG								CWH43 (210976 upstream) : None (None downstream)																							agccatctatgacaaacccac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49533889	49533889	+	IGR	DEL	T	-	-	rs56205126	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49533889delT								CWH43 (469796 upstream) : None (None downstream)																							gaaaaaaaaattagcgggtgt	0.000													4	2	---	---	---	---	
USO1	8615	broad.mit.edu	37	4	76649083	76649084	+	5'Flank	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76649083_76649084insA	uc003hiu.2	+						uc010iiy.2_RNA	NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTTTTCATGTTAAAAAAAAAAA	0.351													4	3	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83801742	83801742	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83801742delA	uc003hnf.2	-						SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				attctgtctcaaaaaaaaaaa	0.109													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	86037815	86037815	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86037815delC								C4orf12 (109647 upstream) : ARHGAP24 (358469 downstream)																							tgtctactgaccccaccacgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	88504828	88504828	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88504828delG								SPARCL1 (54173 upstream) : DSPP (24853 downstream)																							TGGGTGTGCTGGGTGGTAGTA	0.478													4	2	---	---	---	---	
FAM13A	10144	broad.mit.edu	37	4	89943118	89943119	+	Intron	DEL	AC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89943118_89943119delAC	uc003hse.1	-						FAM13A_uc003hsf.1_Intron|FAM13A_uc003hsh.1_Intron|FAM13A_uc003hsi.2_Intron|FAM13A_uc003hsj.2_Intron	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						TTAGTGTGCTACACACCATGTA	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	95120433	95120433	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95120433delT								ATOH1 (369291 upstream) : SMARCAD1 (8326 downstream)																							gcatatgtagttttttttgga	0.144													4	2	---	---	---	---	
UNC5C	8633	broad.mit.edu	37	4	96166485	96166485	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96166485delA	uc003htp.1	-						UNC5C_uc010ilc.1_Intron|UNC5C_uc003htq.2_Intron	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		atagacagagaaaAAAAAAAG	0.194													4	2	---	---	---	---	
DAPP1	27071	broad.mit.edu	37	4	100767303	100767304	+	Intron	DEL	CT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100767303_100767304delCT	uc003hvf.3	+						DAPP1_uc011cek.1_Intron|DAPP1_uc010ilh.2_Intron	NM_014395	NP_055210	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		GAAGCAAAAACTCACATCTCCT	0.213													9	6	---	---	---	---	
NHEDC2	133308	broad.mit.edu	37	4	103988147	103988147	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103988147delA	uc003hwx.3	-						NHEDC2_uc003hwy.2_Intron|NHEDC2_uc011cew.1_Intron|NHEDC2_uc011cex.1_Intron|NHEDC2_uc011cey.1_Intron	NM_178833	NP_849155	Q86UD5	NHDC2_HUMAN	Na+/H+ exchanger domain containing 2						sodium ion transport	integral to membrane|mitochondrial membrane	solute:hydrogen antiporter activity				0				OV - Ovarian serous cystadenocarcinoma(123;2.3e-08)		tgcaaatattaaaaaaaaaaa	0.045													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	121052380	121052381	+	IGR	INS	-	C	C	rs28704009		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121052380_121052381insC								MAD2L1 (64367 upstream) : PRDM5 (563549 downstream)																							GAGTGTACAGTCTTATTTTTAC	0.322													4	3	---	---	---	---	
SPATA5	166378	broad.mit.edu	37	4	124228528	124228529	+	Intron	INS	-	AT	AT			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124228528_124228529insAT	uc003iez.3	+							NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						GTTCAGTGTAGATacacacaca	0.252													4	2	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143426712	143426714	+	Intron	DEL	CAA	-	-	rs144335495		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143426712_143426714delCAA	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011cho.1_Intron	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					aaataaaatgcaacaatgtaatt	0.044													3	3	---	---	---	---	
C4orf45	152940	broad.mit.edu	37	4	159943009	159943009	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159943009delG	uc003iqf.1	-						C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756	Q96LM5	CD045_HUMAN	hypothetical protein LOC152940												0						TGCATATCCTGGTGAGGGGTG	0.438													4	2	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	165253771	165253772	+	Intron	INS	-	A	A	rs146740727	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165253771_165253772insA	uc003iqs.1	-							NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TACTGCATTTCAAATTTACTTT	0.446													2	4	---	---	---	---	
CLCN3	1182	broad.mit.edu	37	4	170604019	170604019	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170604019delA	uc003isi.2	+						CLCN3_uc003ish.2_Intron|CLCN3_uc011cjz.1_Intron|CLCN3_uc011cka.1_Intron|CLCN3_uc003isj.1_Intron	NM_001829	NP_001820	P51790	CLCN3_HUMAN	chloride channel 3 isoform b						endosomal lumen acidification	cell surface|early endosome membrane|Golgi membrane|integral to membrane|late endosome membrane|transport vesicle membrane	antiporter activity|ATP binding|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|voltage-gated chloride channel activity			breast(2)|ovary(1)	3		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		cattttcagtaaaaatgtcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	171312220	171312221	+	IGR	INS	-	TAAT	TAAT	rs139016621	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171312220_171312221insTAAT								AADAT (300848 upstream) : None (None downstream)																							CAAAATATTCCTAGAGAATAAA	0.342													4	3	---	---	---	---	
GPM6A	2823	broad.mit.edu	37	4	176886418	176886418	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176886418delA	uc003iug.2	-						GPM6A_uc003iuh.2_Intron	NM_005277	NP_005268	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 1							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		agaaagctaTAAATCGTAAAG	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190614159	190614160	+	IGR	INS	-	AGT	AGT	rs5865271		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190614159_190614160insAGT								None (None upstream) : FRG1 (247814 downstream)																							ATGGCAGTATAAGCATGTTAAG	0.431													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190658847	190658847	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190658847delT								None (None upstream) : FRG1 (203127 downstream)																							TGGTTCcttcttaagacaaag	0.214													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190670617	190670617	+	IGR	DEL	C	-	-	rs10708489		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190670617delC								None (None upstream) : FRG1 (191357 downstream)																							attttacattcccaccagcag	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2612775	2612775	+	IGR	DEL	A	-	-	rs73735834	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2612775delA								IRX4 (729895 upstream) : IRX2 (133506 downstream)																							CCAACAAGGGAAAAAAAAAAA	0.463													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3203046	3203047	+	IGR	INS	-	TCC	TCC	rs141732035	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3203046_3203047insTCC								C5orf38 (447534 upstream) : IRX1 (393121 downstream)																							GTGTTCCTCATTCCTGGAAATT	0.500													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10809830	10809830	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10809830delT								DAP (48443 upstream) : CTNND2 (162122 downstream)																							TACAGAtttcttttttttttc	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18781734	18781734	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18781734delT								None (None upstream) : CDH18 (691423 downstream)																							CTTGTGAAGGTTTTTTTTTCC	0.299													4	2	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21553290	21553291	+	Intron	INS	-	C	C	rs146167836		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21553290_21553291insC	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						gattttattttcccccattgaa	0.000													4	3	---	---	---	---	
HCN1	348980	broad.mit.edu	37	5	45458608	45458609	+	Intron	INS	-	ATCA	ATCA			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45458608_45458609insATCA	uc003jok.2	-							NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic							integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TCTCACAAAAGATCAATCTTGC	0.366													4	2	---	---	---	---	
ANKRD55	79722	broad.mit.edu	37	5	55416289	55416289	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55416289delA	uc003jqu.2	-							NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				ggaatattgcaaagtcaggaa	0.000													4	2	---	---	---	---	
DEPDC1B	55789	broad.mit.edu	37	5	59979837	59979837	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59979837delA	uc003jsh.2	-						DEPDC1B_uc011cqm.1_Intron|DEPDC1B_uc011cqn.1_Intron	NM_018369	NP_060839	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)	1		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				tactagctacaaaaaaaaaat	0.000													3	3	---	---	---	---	
CWC27	10283	broad.mit.edu	37	5	64139958	64139958	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64139958delT	uc003jtn.1	+						CWC27_uc003jtm.2_Intron|CWC27_uc010iwt.1_Intron	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0						cagatggagatttttttccct	0.000													4	2	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64693314	64693315	+	Intron	INS	-	ATA	ATA	rs145312770	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64693314_64693315insATA	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		tgctgcctctcataaattttgg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	66953795	66953796	+	IGR	INS	-	TC	TC	rs150217627	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66953795_66953796insTC								CD180 (461178 upstream) : PIK3R1 (557808 downstream)																							CAAGAAATCTATGTTTAAATTG	0.322													3	6	---	---	---	---	
TMEM171	134285	broad.mit.edu	37	5	72424584	72424587	+	Intron	DEL	ATCT	-	-	rs139783612		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72424584_72424587delATCT	uc003kcm.2	+						TMEM171_uc003kcn.3_Intron	NM_173490	NP_775761	Q8WVE6	TM171_HUMAN	transmembrane protein 171 isoform 1							integral to membrane					0		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		TACTCCAGGCATCTATCTTTATGT	0.230													3	4	---	---	---	---	
THBS4	7060	broad.mit.edu	37	5	79356049	79356049	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79356049delC	uc003kgh.2	+							NM_003248	NP_003239	P35443	TSP4_HUMAN	thrombospondin 4 precursor						endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity				0		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		TTTTGTTTTTCCCCCACTTTT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	82192876	82192876	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82192876delC								ATP6AP1L (578730 upstream) : TMEM167A (155791 downstream)																							CCCTGTCCTGCCCCAGGCCAA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	89406842	89406842	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89406842delA								None (None upstream) : CETN3 (282689 downstream)																							gtagggacggaaaaaaaatca	0.000													4	2	---	---	---	---	
NR2F1	7025	broad.mit.edu	37	5	92924483	92924484	+	Intron	DEL	GC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92924483_92924484delGC	uc003kkj.2	+							NM_005654	NP_005645	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1						negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			urinary_tract(1)|ovary(1)|lung(1)	3		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		CCGTCTGGCTGCGCGCGCGCGC	0.470													4	2	---	---	---	---	
FAM172A	83989	broad.mit.edu	37	5	93127648	93127648	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93127648delA	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0						AAAGAAAAGGAAAAAAAAAAG	0.413													5	3	---	---	---	---	
SLCO6A1	133482	broad.mit.edu	37	5	101726973	101726975	+	Intron	DEL	AAG	-	-	rs10609240		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101726973_101726975delAAG	uc003knn.2	-						SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Intron|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AGTCTTCCCAAAGAAGAAGGTTT	0.433													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	106040188	106040188	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106040188delT								None (None upstream) : EFNA5 (672403 downstream)																							TTGGATTgggtctaatgtgcc	0.224													4	2	---	---	---	---	
EFNA5	1946	broad.mit.edu	37	5	106880114	106880114	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106880114delT	uc003kol.2	-						EFNA5_uc010jbr.1_Intron	NM_001962	NP_001953	P52803	EFNA5_HUMAN	ephrin-A5 precursor						cell-cell signaling	anchored to plasma membrane|caveola|extracellular space	ephrin receptor binding				0		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		CAAGGATGCATTTTTTTTTGT	0.448													4	4	---	---	---	---	
MAN2A1	4124	broad.mit.edu	37	5	109080204	109080205	+	Intron	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109080204_109080205delGT	uc003kou.1	+							NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		ggcagcgagggtgtgtgtgtag	0.005													4	2	---	---	---	---	
MCC	4163	broad.mit.edu	37	5	112511591	112511591	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112511591delA	uc003kqj.3	-						MCC_uc003kqk.3_Intron|MCC_uc003kql.3_Intron|MCC_uc011cwb.1_Intron|MCC_uc010jcd.1_Intron	NM_002387	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GATCTAGATTAAAAAAAAAAA	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	115952007	115952008	+	IGR	INS	-	AGAA	AGAA			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115952007_115952008insAGAA								SEMA6A (41456 upstream) : None (None downstream)																							GCTCCCCTTCTCATACTCCTCC	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	121836843	121836843	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121836843delT								SNCAIP (37049 upstream) : SNX2 (273907 downstream)																							tcttTCCCCATTTTTTTTTTC	0.254													4	2	---	---	---	---	
SNX2	6643	broad.mit.edu	37	5	122114599	122114599	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122114599delA	uc003kte.2	+						SNX2_uc011cwn.1_Intron	NM_003100	NP_003091	O60749	SNX2_HUMAN	sorting nexin 2						cell communication|endocytosis|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding|protein transporter activity			kidney(1)	1		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		ACTGTGAAACAAAAAAGGGAT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123057184	123057184	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123057184delC								CSNK1G3 (104722 upstream) : ZNF608 (915426 downstream)																							GTCCTTGGAGCCCACAGGAAG	0.448													4	2	---	---	---	---	
MEGF10	84466	broad.mit.edu	37	5	126736066	126736067	+	Intron	DEL	TT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126736066_126736067delTT	uc003kuh.3	+						MEGF10_uc010jdc.1_Intron|MEGF10_uc010jdd.1_Intron|MEGF10_uc003kui.3_Intron	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TGATAATaaatttaataaatcc	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	130004886	130004887	+	IGR	INS	-	G	G	rs139754520	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130004886_130004887insG								CHSY3 (482560 upstream) : HINT1 (489988 downstream)																							catgtcttgttgtgcacattct	0.020													2	4	---	---	---	---	
FSTL4	23105	broad.mit.edu	37	5	132861197	132861197	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132861197delG	uc003kyn.1	-							NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GATGGTGAGTGGGGGGAGTTT	0.483													4	2	---	---	---	---	
C5orf24	134553	broad.mit.edu	37	5	134190545	134190546	+	Intron	DEL	TG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134190545_134190546delTG	uc003kzx.2	+						C5orf24_uc003kzy.3_Intron|C5orf24_uc003kzz.2_Intron	NM_152409	NP_689622	Q7Z6I8	CE024_HUMAN	hypothetical protein LOC134553												0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGTATGTATTTGTGTGTGTGTA	0.411													4	2	---	---	---	---	
SIL1	64374	broad.mit.edu	37	5	138356658	138356658	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138356658delG	uc003ldm.2	-						SIL1_uc003ldn.2_Intron|SIL1_uc003ldo.2_Intron|SIL1_uc003ldp.2_Intron|SIL1_uc003ldq.1_Intron	NM_022464	NP_071909	Q9H173	SIL1_HUMAN	SIL1 protein precursor						intracellular protein transport|protein folding|transmembrane transport	endoplasmic reticulum lumen	unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CACATAAGATGGGGGAACAGA	0.353									Marinesco-Sj_gren_syndrome				4	2	---	---	---	---	
C5orf32	84418	broad.mit.edu	37	5	139582568	139582569	+	Intron	INS	-	A	A	rs138142149	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139582568_139582569insA	uc003lfd.2	+						C5orf32_uc010jfi.2_Intron	NM_032412	NP_115788	Q9H1C7	CE032_HUMAN	hypothetical protein LOC84418												0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATCCAAAAAGAAAAAAAAATC	0.401													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	145712306	145712309	+	IGR	DEL	AGTG	-	-	rs72278951		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145712306_145712309delAGTG								RBM27 (43524 upstream) : POU4F3 (6278 downstream)																							agaggaggtcagtgagtatttgat	0.221													3	3	---	---	---	---	
SPINK14	408187	broad.mit.edu	37	5	147549507	147549508	+	Intron	INS	-	AT	AT	rs141153879	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147549507_147549508insAT	uc003loz.1	+							NM_001001325	NP_001001325	Q6IE38	ISK14_HUMAN	Kazal type serine protease inhibitor 5-like 2							extracellular region	serine-type endopeptidase inhibitor activity				0						tatccattgacgtgttgcagag	0.213													2	7	---	---	---	---	
HTR4	3360	broad.mit.edu	37	5	147974972	147974972	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147974972delA	uc003lpn.2	-						HTR4_uc010jgu.1_Intron|HTR4_uc003lpi.1_Intron|HTR4_uc003lpj.1_Intron|HTR4_uc003lpk.2_Intron|HTR4_uc011dby.1_Intron|HTR4_uc003lpl.2_Intron|HTR4_uc003lpm.2_Intron|HTR4_uc010jgv.2_Intron|HTR4_uc003lpo.1_Intron|SH3TC2_uc003lpp.1_Intron	NM_000870	NP_000861	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform b						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	ACTGCCTCCCAAAAATTACAA	0.378													4	2	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155383120	155383120	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155383120delT	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCTCTTCTTGTTTTTTTTTTT	0.423													4	2	---	---	---	---	
THG1L	54974	broad.mit.edu	37	5	157166726	157166726	+	3'UTR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157166726delT	uc003lxd.2	+	6					THG1L_uc011ddu.1_3'UTR	NM_017872	NP_060342	Q9NWX6	THG1_HUMAN	interphase cytoplasmic foci protein 45						protein homotetramerization|tRNA modification	mitochondrion	GTP binding|metal ion binding|tRNA guanylyltransferase activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCAGAAGTGCTTTTTTTTTAA	0.383													3	3	---	---	---	---	
GABRG2	2566	broad.mit.edu	37	5	161521256	161521256	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161521256delA	uc003lyz.3	+						GABRG2_uc010jjc.2_Intron|GABRG2_uc003lyy.3_Intron|GABRG2_uc011dej.1_Intron	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		AAGCTGTAGGAAAAAAAAAAC	0.299													4	3	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	166766608	166766609	+	Intron	INS	-	T	T	rs144229621		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166766608_166766609insT	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		ttttcaattcattttttttttt	0.000													5	3	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167332941	167332941	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167332941delA	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		AGTGTTTTTTAAAAAAAGGAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173058772	173058772	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173058772delA								BOD1 (15106 upstream) : CPEB4 (256559 downstream)																							TCCTCCTTTTAAAATCAATCC	0.234													4	2	---	---	---	---	
CLTB	1212	broad.mit.edu	37	5	175820172	175820173	+	Intron	DEL	AG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175820172_175820173delAG	uc003meh.2	-						CLTB_uc003mei.2_Intron|CLTB_uc011dfn.1_Intron	NM_007097	NP_009028	P09497	CLCB_HUMAN	clathrin, light polypeptide isoform b						intracellular protein transport|vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle	protein binding|structural molecule activity				0	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		cgcttctcccagacctgttcct	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178942112	178942112	+	IGR	DEL	G	-	-	rs35591388		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178942112delG								ADAMTS2 (169783 upstream) : RUFY1 (35459 downstream)																							TGGGAAAACTGTCTTCATCAT	0.473													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	1150720	1150720	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1150720delC								LOC285768 (49153 upstream) : FOXQ1 (161955 downstream)																							GCCAGCAGCACACAACCTGAA	0.428													4	2	---	---	---	---	
RNF182	221687	broad.mit.edu	37	6	13970032	13970032	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13970032delA	uc003nbe.2	+						RNF182_uc003nbf.2_Intron|RNF182_uc003nbg.2_Intron	NM_152737	NP_689950	Q8N6D2	RN182_HUMAN	ring finger protein 182							cytoplasm|integral to membrane|intracellular membrane-bounded organelle	protein binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			GATGACTTATAAAAGGATGAA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25882690	25882691	+	IGR	INS	-	AC	AC	rs112704851		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25882690_25882691insAC								SLC17A3 (8219 upstream) : SLC17A2 (30300 downstream)																							CTATATCCCTTacacacacaca	0.431													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	31210137	31210138	+	IGR	INS	-	AG	AG	rs145951711	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31210137_31210138insAG								HCG27 (38393 upstream) : HLA-C (26392 downstream)																							GGGAAAGTGACAGAGCATTCTT	0.460													4	4	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34038661	34038662	+	Intron	DEL	CA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34038661_34038662delCA	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	GTTTCACGGTCACACACGCTCA	0.426													5	4	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34041246	34041252	+	Intron	DEL	CACCATA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34041246_34041252delCACCATA	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	atccacacatcaccatacacagtcaga	0.058													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	35762333	35762334	+	IGR	INS	-	TG	TG	rs145259340	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35762333_35762334insTG								C6orf127 (6493 upstream) : CLPS (426 downstream)																							TGTCAGCTAGCTGTCATATTTG	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40721950	40721952	+	IGR	DEL	ATG	-	-	rs138201909		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40721950_40721952delATG								LRFN2 (166824 upstream) : UNC5CL (272820 downstream)																							taaatAAataatgatgatgatga	0.099													3	3	---	---	---	---	
CCND3	896	broad.mit.edu	37	6	41904610	41904610	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41904610delC	uc003orn.2	-						CCND3_uc003orp.2_Intron|CCND3_uc011duk.1_Intron|CCND3_uc011dum.1_3'UTR|CCND3_uc003orm.2_Intron|CCND3_uc003oro.2_Intron|CCND3_uc011dul.1_3'UTR	NM_001760	NP_001751	P30281	CCND3_HUMAN	cyclin D3 isoform 2						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GAAAGAGTATCTTTCCTAGAG	0.423			T	IGH@	MM						OREG0017437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57284785	57284786	+	Intron	INS	-	T	T	rs11442279		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57284785_57284786insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CTTCATCGAGCTTTTGTGTTTG	0.366													3	6	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57323077	57323077	+	Intron	DEL	G	-	-	rs67240761		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57323077delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		aagcattgcaggaaaaaaaca	0.000													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57391940	57391941	+	Intron	INS	-	T	T	rs139175265		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57391940_57391941insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GGGCGCGTCTCTTCCCTGGCTA	0.411													2	6	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57440798	57440799	+	Intron	INS	-	A	A	rs146617443		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57440798_57440799insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ctgaacaactcacgatcagaac	0.079													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57489445	57489446	+	Intron	DEL	CT	-	-	rs75214338		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57489445_57489446delCT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GTTTTTAAAACTCTCTTTTTAT	0.238													3	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57509599	57509599	+	Intron	DEL	A	-	-	rs75735115		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57509599delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		aactctttttatttacattca	0.005													1	5	---	---	---	---	
GUSBL2	375513	broad.mit.edu	37	6	58287238	58287239	+	Intron	INS	-	TAAC	TAAC			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58287238_58287239insTAAC	uc011dxq.1	-						GUSBL2_uc011dxp.1_Intron|GUSBL2_uc003peb.3_Intron|GUSBL2_uc003pec.3_Intron|GUSBL2_uc003ped.3_Intron|GUSBL2_uc003pee.3_Intron					SubName: Full=Putative uncharacterized protein ENSP00000348869; Flags: Fragment;												0						CAGGACTCTCATAACTGTCACC	0.381													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	66719470	66719470	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66719470delG								MCART3P (220095 upstream) : None (None downstream)																							tggcagtgttgggacaggcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	74586119	74586121	+	IGR	DEL	ACA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74586119_74586121delACA								CD109 (48079 upstream) : None (None downstream)																							atttacagtgACAACAACAACAA	0.123													4	2	---	---	---	---	
COL12A1	1303	broad.mit.edu	37	6	75798716	75798717	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75798716_75798717insA	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						gactccgtctcaaaaacaaaaa	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	80797121	80797122	+	IGR	INS	-	AC	AC	rs72170184		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80797121_80797122insAC								TTK (44884 upstream) : BCKDHB (19222 downstream)																							CTTATAACAATacacacacaca	0.307													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	93465922	93465922	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93465922delT								None (None upstream) : EPHA7 (483820 downstream)																							AATGTCCCCATTTTTTGCAGG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	105170097	105170098	+	IGR	DEL	AG	-	-	rs71824188		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105170097_105170098delAG								None (None upstream) : HACE1 (5870 downstream)																							CTAGGAAAACAGAAATATTATA	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	107339338	107339339	+	IGR	DEL	TT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107339338_107339339delTT								MIR587 (107243 upstream) : C6orf203 (10068 downstream)																							TGGGTTCTGAtttttttttttt	0.208													3	3	---	---	---	---	
AKD1	221264	broad.mit.edu	37	6	109902106	109902106	+	Intron	DEL	G	-	-	rs77669972		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109902106delG	uc003ptn.2	-							NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						cagatatcgtggttttttttt	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	111810943	111810944	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111810943_111810944insT	uc003pvb.2	+											Homo sapiens cDNA clone IMAGE:5274708.																		TAGCAAACTGATTCGTTGGCAA	0.168													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	122094222	122094222	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122094222delC								GJA1 (323350 upstream) : HSF2 (626474 downstream)																							AGGGAAAAGGCCAGACCGTCA	0.428													4	2	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123694157	123694157	+	Intron	DEL	C	-	-	rs11329657		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123694157delC	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010kem.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		CCACACCACACCCTGACACAT	0.418													1	5	---	---	---	---	
TRMT11	60487	broad.mit.edu	37	6	126321006	126321006	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126321006delT	uc003qam.2	+						TRMT11_uc003qan.2_Intron|TRMT11_uc010kev.2_Intron	NM_001031712	NP_001026882	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11						tRNA processing		methyltransferase activity|nucleic acid binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0356)		ATCCATCTAATTTTTTTGTAG	0.318													4	2	---	---	---	---	
TRMT11	60487	broad.mit.edu	37	6	126335907	126335907	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126335907delT	uc003qam.2	+						TRMT11_uc003qan.2_Intron|TRMT11_uc010kev.2_Intron	NM_001031712	NP_001026882	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11						tRNA processing		methyltransferase activity|nucleic acid binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0356)		TAACACTGAGTTTTTTTTTGT	0.194													4	2	---	---	---	---	
AKAP7	9465	broad.mit.edu	37	6	131603070	131603071	+	3'UTR	INS	-	TTAAT	TTAAT			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131603070_131603071insTTAAT	uc003qcm.1	+	3					AKAP7_uc003qck.2_3'UTR|AKAP7_uc011ebz.1_3'UTR|AKAP7_uc003qcl.1_Intron|AKAP7_uc003qcn.1_3'UTR	NM_138633	NP_619539	O43687	AKA7A_HUMAN	A-kinase anchor protein 7 isoform beta						intracellular signal transduction|ion transport	apical plasma membrane|intracellular|lateral plasma membrane	protein kinase A binding			ovary(2)	2	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		GGCAGAGGAAATTAATTGATGA	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134660907	134660910	+	IGR	DEL	CATC	-	-	rs140386345		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134660907_134660910delCATC								SGK1 (21711 upstream) : ALDH8A1 (577619 downstream)																							CTTCAGTGATcatccatccatcca	0.206													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	143059373	143059374	+	IGR	INS	-	CTG	CTG	rs141043123	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143059373_143059374insCTG								LOC153910 (100347 upstream) : HIVEP2 (13231 downstream)																							tgccccagagtctgctaaaact	0.000													6	4	---	---	---	---	
PPIL4	85313	broad.mit.edu	37	6	149862454	149862457	+	Intron	DEL	TAAA	-	-	rs71817814		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149862454_149862457delTAAA	uc003qmo.1	-						PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Intron	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		AGGTTAAaagtaaataaataaata	0.289													9	12	---	---	---	---	
ESR1	2099	broad.mit.edu	37	6	152193629	152193630	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152193629_152193630insT	uc003qom.3	+						ESR1_uc010kin.2_Intron|ESR1_uc010kio.2_Intron|ESR1_uc010kip.2_Intron|ESR1_uc003qon.3_Intron|ESR1_uc003qoo.3_Intron|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	TTTTGGTATGATTTTTTTTCCT	0.327													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152473119	152473120	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152473119_152473120delAC	uc010kiw.2	-	134	24888_24889	c.24286_24287delGT	c.(24286-24288)GTCfs	p.V8096fs	SYNE1_uc010kiv.2_Frame_Shift_Del_p.V2620fs|SYNE1_uc003qos.3_Frame_Shift_Del_p.V2620fs|SYNE1_uc003qot.3_Frame_Shift_Del_p.V8025fs|SYNE1_uc003qou.3_Frame_Shift_Del_p.V8096fs|SYNE1_uc003qop.3_Frame_Shift_Del_p.V258fs|SYNE1_uc011eez.1_Frame_Shift_Del_p.V298fs|SYNE1_uc003qoq.3_Frame_Shift_Del_p.V298fs|SYNE1_uc003qor.3_Frame_Shift_Del_p.V996fs	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8096	Spectrin 29.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GATGGAGGTGACACGCTTTTGC	0.525										HNSCC(10;0.0054)			154	77	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	154112647	154112648	+	IGR	INS	-	CTC	CTC	rs143812850	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154112647_154112648insCTC								RGS17 (660258 upstream) : OPRM1 (218988 downstream)																							CCAGGATTTCTCTGCCAGGAAG	0.262													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	161755228	161755229	+	IGR	DEL	TT	-	-	rs34906229		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161755228_161755229delTT								AGPAT4 (60121 upstream) : PARK2 (13362 downstream)																							agattgactcttaataaaatta	0.000													2	4	---	---	---	---	
RPS6KA2	6196	broad.mit.edu	37	6	166837946	166837947	+	Intron	INS	-	TT	TT	rs140273746	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166837946_166837947insTT	uc003qvb.1	-						RPS6KA2_uc011ego.1_Intron|RPS6KA2_uc010kkl.1_Intron|RPS6KA2_uc003qvc.1_Intron|RPS6KA2_uc003qvd.1_Intron|RPS6KA2_uc010kkk.1_5'Flank	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CTAAGACAGTATTTCCTGCTTC	0.510													2	4	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4080094	4080096	+	Intron	DEL	ACG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4080094_4080096delACG	uc003smx.2	+						SDK1_uc010kso.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ttgttgtctcacgctgacgaaat	0.000													2	5	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5352533	5352533	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5352533delG	uc003soi.3	-	27	8338	c.7989delC	c.(7987-7989)TCCfs	p.S2663fs		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2663	Ser-rich.						DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aggaagaggaggaggaggagg	0.269													4	2	---	---	---	---	
RNF216	54476	broad.mit.edu	37	7	5755053	5755053	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5755053delG	uc003soy.1	-						RNF216_uc010ksz.1_Intron|RNF216_uc010kta.1_Intron|RNF216_uc011jwj.1_Intron|RNF216_uc003sox.1_Intron	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b						apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TTTTTTTTCTGGTATTCTTTA	0.313													4	2	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	6819605	6819606	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6819605_6819606insT	uc003sqw.1	+						RSPH10B2_uc010ktk.1_Intron|RSPH10B2_uc011jxc.1_Intron|RSPH10B2_uc010ktl.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						tgcctggctaattttttttttt	0.000													4	2	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14551692	14551693	+	Intron	INS	-	A	A	rs150990731	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14551692_14551693insA	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	aaaagtgacagaaacataaagt	0.000													3	3	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18642987	18642988	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18642987_18642988insA	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc011jya.1_Intron|HDAC9_uc003sua.1_Intron|HDAC9_uc011jyb.1_Intron|HDAC9_uc003sud.1_Intron|HDAC9_uc011jyc.1_Intron|HDAC9_uc003suf.1_Intron|HDAC9_uc010kud.1_Intron|HDAC9_uc011jye.1_Intron|HDAC9_uc011jyf.1_Intron|HDAC9_uc010kue.1_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	tttacttttttaaaaaaatatt	0.000													4	2	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21723128	21723129	+	Intron	INS	-	T	T	rs141018177	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21723128_21723129insT	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GATTTATCTAATCCCCTGGGGT	0.302									Kartagener_syndrome				5	3	---	---	---	---	
OSBPL3	26031	broad.mit.edu	37	7	24986430	24986435	+	Intron	DEL	GAGAAA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24986430_24986435delGAGAAA	uc003sxf.2	-						OSBPL3_uc003sxg.2_Intron|OSBPL3_uc003sxh.2_Intron|OSBPL3_uc003sxi.2_Intron	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform						lipid transport		lipid binding|protein binding			skin(1)	1						GGATGTGTGGGAGAAAGAGAAAGAGG	0.291													4	2	---	---	---	---	
TBX20	57057	broad.mit.edu	37	7	35243847	35243847	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35243847delA	uc011kas.1	-							NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN	T-box transcription factor TBX20							nucleus	DNA binding			central_nervous_system(1)	1						tctttcACTTAAAAAAAAAAC	0.219													3	3	---	---	---	---	
NUDCD3	23386	broad.mit.edu	37	7	44454933	44454934	+	Intron	DEL	AG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44454933_44454934delAG	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						GGTACACTGAAGAGAGAGAGAG	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46314499	46314499	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46314499delT								IGFBP3 (353628 upstream) : None (None downstream)																							TCCTCTATGATTTTTTTTTTA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47089785	47089785	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47089785delA								None (None upstream) : TNS3 (224968 downstream)																							AAAACATTTCAATGACAATTC	0.234													4	2	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48278659	48278659	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48278659delT	uc003toq.2	+						ABCA13_uc010kyr.2_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						AAAATATAACTTTTTTTTTTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	49171765	49171767	+	IGR	DEL	AGG	-	-	rs141158061		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49171765_49171767delAGG								CDC14C (204716 upstream) : VWC2 (641490 downstream)																							TCCACTATTTAGGAGGAGTCTGG	0.438													5	6	---	---	---	---	
C7orf72	100130988	broad.mit.edu	37	7	50144059	50144060	+	Intron	INS	-	TA	TA	rs146114368	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50144059_50144060insTA	uc011kcj.1	+							NM_001161834	NP_001155306			hypothetical protein LOC100130988											ovary(1)	1						tttcattgtattatatatatat	0.188													26	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52818092	52818092	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52818092delT								None (None upstream) : POM121L12 (285257 downstream)																							AATCAAATCCTTTTTCTCCAG	0.363													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53223525	53223525	+	IGR	DEL	G	-	-	rs76861704		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53223525delG								POM121L12 (118908 upstream) : None (None downstream)																							aggaagaaatggggaagtatt	0.000													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61763050	61763050	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61763050delA								None (None upstream) : LOC643955 (988622 downstream)																							CTTTCAAGTGAAAAAAAAACA	0.204													5	3	---	---	---	---	
PCLO	27445	broad.mit.edu	37	7	82514129	82514129	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82514129delT	uc003uhx.2	-						PCLO_uc003uhv.2_Intron|PCLO_uc003uhu.1_Intron	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AAGAAAATTCTTTTTTTTTTT	0.338													4	2	---	---	---	---	
AKAP9	10142	broad.mit.edu	37	7	91694513	91694513	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91694513delT	uc003ulg.2	+						AKAP9_uc003ulf.2_Intron|AKAP9_uc003uli.2_Intron	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTAATTGTGATTTAATTCAGT	0.264			T	BRAF	papillary thyroid								90	45	---	---	---	---	
CDK6	1021	broad.mit.edu	37	7	92281070	92281070	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92281070delT	uc011khw.1	-						CDK6_uc010lez.2_Intron	NM_001259	NP_001250	Q00534	CDK6_HUMAN	cyclin-dependent kinase 6						cell dedifferentiation|cell division|G1 phase of mitotic cell cycle|gliogenesis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|negative regulation of osteoblast differentiation|positive regulation of cell-matrix adhesion|positive regulation of fibroblast proliferation|regulation of erythrocyte differentiation|regulation of gene expression|response to virus	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleus|ruffle	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			central_nervous_system(1)|skin(1)	2	all_cancers(62;8.72e-12)|all_epithelial(64;3.65e-10)|Breast(17;0.000675)|all_lung(186;0.0392)|Lung NSC(181;0.053)|all_neural(327;0.219)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;1.2e-06)|all cancers(6;3.1e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			ACTAAAAAACTTTTTTTTTTT	0.219			T	MLLT10	ALL								4	4	---	---	---	---	
CASD1	64921	broad.mit.edu	37	7	94162254	94162254	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94162254delT	uc003uni.3	+						CASD1_uc003unh.2_Intron|CASD1_uc003unj.3_Intron	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor							integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TCAGTGGTGCTTTTTTTTAAG	0.328													3	3	---	---	---	---	
AP1S1	1174	broad.mit.edu	37	7	100800193	100800193	+	Intron	DEL	T	-	-	rs112445157		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100800193delT	uc003uxv.3	+							NM_001283	NP_001274	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1						intracellular protein transport|post-Golgi vesicle-mediated transport|receptor-mediated endocytosis|regulation of defense response to virus by virus|response to virus|viral reproduction	AP-1 adaptor complex|coated pit|cytosol|lysosomal membrane	protein binding|protein transporter activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)					GTCAGCTTCCTTTTTTTTTTT	0.453													5	3	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103419100	103419100	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103419100delC	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACACTGTTTTCCCCATTACTC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	106184355	106184355	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106184355delA	uc003vds.2	-											Homo sapiens full length insert cDNA clone ZC44D09.																		GTAAAAATTCAAAAAaaaaag	0.199													0	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	106499999	106500000	+	IGR	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106499999_106500000delGT								FLJ36031 (198408 upstream) : PIK3CG (5723 downstream)																							CAGGATCATGGTGTGTGTGTGA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	106663307	106663307	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106663307delA								PIK3CG (115722 upstream) : PRKAR2B (21871 downstream)																							gaagtggttcacccaaaatca	0.090													4	2	---	---	---	---	
COG5	10466	broad.mit.edu	37	7	107056316	107056317	+	Intron	DEL	TG	-	-	rs147717920	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107056316_107056317delTG	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						cacgtatgtatgtatgtgtgTG	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	108613221	108613221	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108613221delA								C7orf66 (88584 upstream) : EIF3IP1 (986063 downstream)																							CTGCATTGAGAAGGCTAAAGC	0.303													4	2	---	---	---	---	
C7orf60	154743	broad.mit.edu	37	7	112551506	112551506	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112551506delA	uc003vgo.1	-						C7orf60_uc011kms.1_Intron	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743											ovary(2)|skin(1)	3						ctttcagagcaaaaaaagcat	0.000													4	2	---	---	---	---	
TFEC	22797	broad.mit.edu	37	7	115797438	115797441	+	Intron	DEL	TAAG	-	-	rs67235427		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115797438_115797441delTAAG	uc011kmw.1	-									O14948	TFEC_HUMAN	SubName: Full=cDNA FLJ55256, highly similar to Homo sapiens transcription factor EC (TFEC), transcript variant 1, mRNA;							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			AAAAAATAAATAAGTAAGCACAAA	0.201													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131585842	131585842	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131585842delG								PODXL (344466 upstream) : PLXNA4 (222250 downstream)																							TGATAGGGATGGGGAGTGGAG	0.488													4	2	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144527937	144527938	+	Intron	DEL	CT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144527937_144527938delCT	uc003weq.2	-						TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	CCTGGCCACACTCTCTCTCTCT	0.490													4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	148081007	148081008	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148081007_148081008insT	uc003weu.1	+						CNTNAP2_uc003wev.1_Intron	NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			cctcaggcaggttgcttcattt	0.312										HNSCC(39;0.1)			5	4	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151971456	151971456	+	Intron	DEL	C	-	-	rs76767630	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151971456delC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CAGAAAAAAACACAAAACTAC	0.294			N		medulloblastoma								6	5	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154539365	154539365	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154539365delA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CATATGTTAGAAAAAAAAAAT	0.294													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155990614	155990614	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155990614delC								SHH (385647 upstream) : C7orf4 (342571 downstream)																							gcctgtgtttccccatctgta	0.254													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158017816	158017816	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158017816delT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		tttttttttcttttttactgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	15328635	15328636	+	IGR	INS	-	TTC	TTC	rs149332172	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15328635_15328636insTTC								SGCZ (232843 upstream) : TUSC3 (69094 downstream)																							ggtgcaaacatttctttgattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	16521254	16521254	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16521254delA								MSR1 (470954 upstream) : FGF20 (329080 downstream)																							AAAGAATGATAAATGTTTAAA	0.313													4	2	---	---	---	---	
FGL1	2267	broad.mit.edu	37	8	17723864	17723865	+	Intron	INS	-	G	G	rs139486955	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17723864_17723865insG	uc003wxx.2	-						FGL1_uc003wxy.2_Intron|FGL1_uc003wxz.2_Intron|FGL1_uc003wya.2_Intron|FGL1_uc003wyb.2_Intron|FGL1_uc003wyc.2_Intron|FGL1_uc003wyd.2_Intron|FGL1_uc003wye.2_Intron|FGL1_uc003wyf.2_Intron	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor						signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		ATGTGGAAAAAAACATTTTATA	0.361													0	9	---	---	---	---	
SLC39A14	23516	broad.mit.edu	37	8	22273946	22273947	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22273946_22273947insT	uc003xbq.3	+						SLC39A14_uc011kzg.1_Intron|SLC39A14_uc003xbp.3_Intron|SLC39A14_uc011kzh.1_Intron	NM_001128431	NP_001121903	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter),							endoplasmic reticulum|Golgi apparatus|integral to membrane|lamellipodium|plasma membrane	zinc ion transmembrane transporter activity				0				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		CCCTAATCACCttttttttgga	0.248													4	2	---	---	---	---	
BIN3	55909	broad.mit.edu	37	8	22528515	22528515	+	5'Flank	DEL	T	-	-	rs78805297		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22528515delT	uc003xcl.2	-						BIN3_uc010ltw.2_5'Flank	NM_018688	NP_061158	Q9NQY0	BIN3_HUMAN	bridging integrator 3						actin filament organization|barrier septum formation|cell cycle|protein localization|unidimensional cell growth	cytoplasm|cytoskeleton	cytoskeletal adaptor activity				0		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		ctatttccagttcaacctttg	0.149													2	6	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	26054545	26054545	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26054545delA	uc003xek.2	+							NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		tttacagatgaaaaaaataga	0.015													4	2	---	---	---	---	
LSM1	27257	broad.mit.edu	37	8	38021013	38021013	+	3'UTR	DEL	A	-	-	rs1845		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38021013delA	uc003xkw.2	-	4					LSM1_uc003xkx.2_RNA	NM_014462	NP_055277	O15116	LSM1_HUMAN	Lsm1 protein						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|mRNA processing|RNA splicing, via transesterification reactions	cytosol|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0	Colorectal(12;0.000442)					TTTTGTTATTAAAAAAAAAAC	0.323													4	3	---	---	---	---	
RNF170	81790	broad.mit.edu	37	8	42708204	42708204	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42708204delG	uc011lcx.1	-							NM_001160224	NP_001153696	Q96K19	RN170_HUMAN	ring finger protein 170 isoform b							integral to membrane	zinc ion binding				0	all_lung(13;1.25e-11)|Lung NSC(13;3.55e-10)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00645)|Lung NSC(58;0.0176)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			aggaattcgaggctgcagtca	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	46855385	46855386	+	IGR	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:46855385_46855386insT								None (None upstream) : BEYLA (897122 downstream)																							tatgctgaaaaaggaaatatct	0.000													10	5	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48709159	48709161	+	Intron	DEL	TTG	-	-	rs113677503		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48709159_48709161delTTG	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				Atttttttttttgttgttgttgt	0.148								NHEJ					6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52164093	52164094	+	IGR	DEL	CA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52164093_52164094delCA								SNTG1 (458666 upstream) : PXDNL (68050 downstream)																							TAACAACCATCACACATTTAGC	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57648060	57648062	+	IGR	DEL	GGT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57648060_57648062delGGT								PENK (288778 upstream) : IMPAD1 (222429 downstream)																							gagatagtggggtgggaacactt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60059645	60059645	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60059645delT								TOX (27878 upstream) : None (None downstream)																							GTCAAAGCCCTTTGTGAACTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	82248488	82248488	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82248488delA								FABP5 (51480 upstream) : PMP2 (104076 downstream)																							ctctgtgtccaggtttccctt	0.000													2	6	---	---	---	---	
E2F5	1875	broad.mit.edu	37	8	86109507	86109507	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86109507delT	uc003ycz.3	+						E2F5_uc003yda.3_Intron|E2F5_uc010mab.2_Intron	NM_001951	NP_001942	Q15329	E2F5_HUMAN	E2F transcription factor 5 isoform 1						G1 phase of mitotic cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1						GATATTAGCCTTTTTAATACA	0.368													4	2	---	---	---	---	
CNBD1	168975	broad.mit.edu	37	8	87984846	87984847	+	Intron	DEL	AC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87984846_87984847delAC	uc003ydy.2	+							NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1											ovary(3)	3						AGATACACAGACACACACACAC	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93883723	93883723	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93883723delC	uc003yfj.1	-											Homo sapiens cDNA FLJ46284 fis, clone TESTI4031818.																		GAGGCACAGACCccagagaaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	95626172	95626172	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95626172delA								KIAA1429 (60484 upstream) : ESRP1 (27192 downstream)																							tctctgtctcaaaaaaaaaag	0.134													4	2	---	---	---	---	
SDC2	6383	broad.mit.edu	37	8	97538890	97538890	+	Intron	DEL	T	-	-	rs111255113		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97538890delT	uc003yhv.1	+							NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor							integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)	AGGCCTTTGGTTTTTTTTTTT	0.398													4	2	---	---	---	---	
FBXO43	286151	broad.mit.edu	37	8	101154521	101154521	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101154521delA	uc003yjd.2	-						FBXO43_uc003yje.2_Intron|FBXO43_uc010mbp.1_Intron	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b						meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			TTGAAAAGTTACTTTAAAAAA	0.299													4	2	---	---	---	---	
SPAG1	6674	broad.mit.edu	37	8	101178486	101178486	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101178486delT	uc003yjh.1	+						SPAG1_uc003yjg.1_Intron|SPAG1_uc003yji.1_Intron	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1						single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		ttatttgtaattttttttctt	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	110238218	110238218	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110238218delT								TRHR (106408 upstream) : NUDCD1 (14931 downstream)																							TACAGCAGTATTTTTTTCATT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	110861197	110861198	+	IGR	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110861197_110861198delGT								SYBU (157177 upstream) : KCNV1 (118037 downstream)																							cttgttcagagtgtgtgtgtgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	112391618	112391618	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112391618delT								None (None upstream) : CSMD3 (843543 downstream)																							ttattttggcttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	114670522	114670523	+	IGR	DEL	TG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114670522_114670523delTG								CSMD3 (221280 upstream) : None (None downstream)																							caatcgctgctgtgatgatgtt	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122240139	122240140	+	IGR	INS	-	T	T	rs141905171	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122240139_122240140insT								SNTB1 (415830 upstream) : HAS2 (385131 downstream)																							GTTGATGGCTGTTTTTTAAATT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	130718530	130718530	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130718530delA								None (None upstream) : GSDMC (41913 downstream)																							tattaccactaattcaattat	0.000													4	2	---	---	---	---	
TG	7038	broad.mit.edu	37	8	134042643	134042645	+	Intron	DEL	TGA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134042643_134042645delTGA	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TACGTGAGGCtgatgatgatggt	0.232													4	2	---	---	---	---	
ST3GAL1	6482	broad.mit.edu	37	8	134557149	134557151	+	Intron	DEL	CTT	-	-	rs141039403		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134557149_134557151delCTT	uc003yuk.2	-						ST3GAL1_uc003yum.2_Intron	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			ATCAGCCTTCCTTCTTCTTCTGC	0.448													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135285900	135285900	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135285900delT								ST3GAL1 (701717 upstream) : ZFAT (204133 downstream)																							aaaaacagagtggtctgttct	0.000													4	2	---	---	---	---	
ZFAT	57623	broad.mit.edu	37	8	135603008	135603010	+	Intron	DEL	CAC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135603008_135603010delCAC	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			caacagtcatcaccaccaccaca	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138761517	138761517	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138761517delT								None (None upstream) : FAM135B (380751 downstream)																							TGCTACAAGATTTTTTTTTTT	0.214													3	3	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331411	8331414	+	Intron	DEL	TTTC	-	-	rs10976963		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331411_8331414delTTTC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CTCTGATTATTTTCACTTATTTTC	0.279										TSP Lung(15;0.13)			4	3	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331416	8331421	+	Intron	DEL	CTTATT	-	-	rs3830408		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331416_8331421delCTTATT	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ATTATTTTCACTTATTTTCACTTTAT	0.272										TSP Lung(15;0.13)			3	3	---	---	---	---	
SNAPC3	6619	broad.mit.edu	37	9	15457212	15457212	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15457212delA	uc003zlt.2	+						SNAPC3_uc003zlu.2_Intron	NM_001039697	NP_001034786	Q92966	SNPC3_HUMAN	small nuclear RNA activating complex,						regulation of transcription, DNA-dependent|snRNA transcription|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|protein binding				0				GBM - Glioblastoma multiforme(50;2.15e-06)		AGGAGACATTAAAAAAACAAG	0.289													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44802091	44802092	+	IGR	INS	-	C	C	rs151029219		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44802091_44802092insC								None (None upstream) : FAM27C (188144 downstream)																							GAACTTGTTGACTTATCTCTCC	0.302													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44861697	44861697	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44861697delG								None (None upstream) : FAM27C (128539 downstream)																							CACTACTGGAGGTATCTGCCT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66473147	66473148	+	IGR	INS	-	A	A	rs75438927	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66473147_66473148insA								FAM74A4 (978761 upstream) : LOC442421 (23322 downstream)																							tatagaattttaaaaatagcct	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66510122	66510122	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66510122delT								LOC442421 (7095 upstream) : AQP7P1 (744145 downstream)																							aatttcctgattttggcaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66510466	66510467	+	IGR	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66510466_66510467insA								LOC442421 (7439 upstream) : AQP7P1 (743800 downstream)																							GTTCCCCACTTTTTTGTGGCTG	0.228													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68382514	68382515	+	IGR	INS	-	TT	TT	rs79878908		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68382514_68382515insTT								FAM27B (588325 upstream) : MIR1299 (619724 downstream)																							gattgtttttgtttttttgttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68407436	68407437	+	5'Flank	INS	-	A	A	rs146708055		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68407436_68407437insA	uc004aew.1	+											Homo sapiens cDNA, FLJ98602.																		atagctgtatttaaaaaaaaac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68431239	68431242	+	IGR	DEL	GTAA	-	-	rs145348306		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68431239_68431242delGTAA								FAM27B (637050 upstream) : MIR1299 (570997 downstream)																							CAATCTTTGTGTAAGTATCTTTGT	0.309													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68493575	68493576	+	IGR	INS	-	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68493575_68493576insC								FAM27B (699386 upstream) : MIR1299 (508663 downstream)																							CTTTGCTTTAACAAATGTTTGC	0.371													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68493578	68493579	+	IGR	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68493578_68493579insT								FAM27B (699389 upstream) : MIR1299 (508660 downstream)																							TGCTTTAACAAATGTTTGCTTT	0.366													5	4	---	---	---	---	
DAPK1	1612	broad.mit.edu	37	9	90134470	90134470	+	Intron	DEL	G	-	-	rs34166575		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90134470delG	uc004apc.2	+						DAPK1_uc004ape.2_Intron|DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						CTGGTGGATTGGGGCTGTCAC	0.532									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93040219	93040219	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93040219delA								LOC100129066 (705545 upstream) : DIRAS2 (331895 downstream)																							gtgcaaagagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	97247317	97247317	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97247317delT								HIATL1 (24116 upstream) : FBP2 (73688 downstream)																							CAGCAGAAGgttttttttgtt	0.254													4	2	---	---	---	---	
C9orf3	84909	broad.mit.edu	37	9	97828368	97828368	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97828368delT	uc004ava.2	+						C9orf3_uc004auy.2_Intron|C9orf3_uc004auz.1_Intron|C9orf3_uc004avc.2_Intron|C9orf3_uc011luj.1_Intron|C9orf3_uc011luk.1_Intron|C9orf3_uc004avd.2_Intron	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		CACCATCTGCTTTTTATGATA	0.294													4	2	---	---	---	---	
HSD17B3	3293	broad.mit.edu	37	9	99027489	99027489	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99027489delA	uc004awa.1	-						HSD17B3_uc010msc.1_Intron	NM_000197	NP_000188	P37058	DHB3_HUMAN	estradiol 17 beta-dehydrogenase 3						androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)	gctgacctccaggtgacatgg	0.204													3	3	---	---	---	---	
TEX10	54881	broad.mit.edu	37	9	103111942	103111942	+	Intron	DEL	T	-	-	rs35135513		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103111942delT	uc004bas.2	-						TEX10_uc011lvf.1_5'Flank|TEX10_uc011lvg.1_Intron|TEX10_uc011lvh.1_Intron|TEX10_uc004bat.2_Intron	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1							integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		CTGAAATGTGTTTTTTTTTTG	0.428													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	103416858	103416858	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103416858delA								MURC (66687 upstream) : LPPR1 (374173 downstream)																							AGGGTTTAGGAGAATGGAATA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110640097	110640097	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110640097delA								KLF4 (388050 upstream) : ACTL7B (976774 downstream)																							attacatgagaaaaggggcag	0.085													4	2	---	---	---	---	
RGS3	5998	broad.mit.edu	37	9	116352837	116352838	+	Intron	INS	-	ATCC	ATCC			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116352837_116352838insATCC	uc004bhq.2	+						RGS3_uc004bhs.2_Intron|RGS3_uc004bht.2_Intron|RGS3_uc010muy.2_Intron|RGS3_uc004bhv.2_Intron|RGS3_uc010muz.1_Intron|RGS3_uc004bhw.2_Intron|RGS3_uc011lxh.1_Intron|RGS3_uc004bhx.2_Intron|RGS3_uc004bhy.1_Intron|RGS3_uc004bhz.2_Intron	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6						inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						cctatccacatatccatccatc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120286983	120286983	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120286983delA								ASTN2 (109666 upstream) : TLR4 (179477 downstream)																							CATTTTGCATAAAAATAATAT	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120916879	120916879	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120916879delG								TLR4 (437115 upstream) : None (None downstream)																							tccattttgtggatgtgccag	0.000													4	2	---	---	---	---	
C9orf119	375757	broad.mit.edu	37	9	131042676	131042676	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131042676delA	uc004bup.2	+						C9orf119_uc010mxx.1_Intron	NM_001040011	NP_001035100	Q1ZZU3	SWI5_HUMAN	hypothetical protein LOC375757						double-strand break repair via homologous recombination	Swi5-Sfr1 complex	protein binding				0						CCAGGACCACAAAACCAACTC	0.517													4	2	---	---	---	---	
SET	6418	broad.mit.edu	37	9	131455513	131455513	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131455513delA	uc004bvt.3	+						SET_uc004bvu.3_Intron|SET_uc010myg.2_Intron|SET_uc011mbj.1_Intron	NM_001122821	NP_001116293	Q01105	SET_HUMAN	SET translocation (myeloid leukemia-associated)						DNA replication|mRNA metabolic process|negative regulation of histone acetylation|negative regulation of neuron apoptosis|negative regulation of transcription, DNA-dependent|nucleocytoplasmic transport|nucleosome assembly|nucleosome disassembly	cytosol|endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm|protein complex	histone binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity				0		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		tccaaaaaacaaaaaaaaaGA	0.224			T	NUP214	AML								4	4	---	---	---	---	
UBAC1	10422	broad.mit.edu	37	9	138824581	138824582	+	Intron	INS	-	C	C	rs145697296	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138824581_138824582insC	uc004cgs.1	-							NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1							Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		GGCGGAGGCAGCCGTGCTTGGG	0.455													5	5	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140681665	140681665	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140681665delA	uc011mfc.1	+						EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ATCTCTCATTAAAAAAAAATG	0.478													4	2	---	---	---	---	
IL2RA	3559	broad.mit.edu	37	10	6087554	6087554	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6087554delA	uc001iiz.1	-						IL2RA_uc009xih.1_Intron	NM_000417	NP_000408	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha chain precursor						cell proliferation	integral to membrane	interleukin-2 receptor activity			ovary(1)|skin(1)	2					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	TATCAGATTTAAAAGGGGGAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10606238	10606238	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10606238delC								None (None upstream) : SFTA1P (220164 downstream)																							CACATGACATCCCCTGCAGCT	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	15225227	15225227	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15225227delA								NMT2 (14532 upstream) : FAM171A1 (28420 downstream)																							CCAGTGGAGGAAAAAAACTAA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30258020	30258021	+	IGR	DEL	TA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30258020_30258021delTA								SVIL (232156 upstream) : KIAA1462 (43708 downstream)																							tgtgtatgtgtatgttagtgtg	0.030													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	37269843	37269843	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37269843delT								None (None upstream) : ANKRD30A (144942 downstream)																							AGAGTGGTAATTTTTTTTTTC	0.378													4	2	---	---	---	---	
RASGEF1A	221002	broad.mit.edu	37	10	43690529	43690530	+	3'UTR	INS	-	AG	AG	rs150354243	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43690529_43690530insAG	uc001jap.1	-	13					RASGEF1A_uc001jao.1_3'UTR	NM_145313	NP_660356	Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A						cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						ACTGGGAATGCAGAGGGACAAG	0.584													3	3	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47090315	47090316	+	Intron	INS	-	A	A	rs112966378		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47090315_47090316insA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						ccagaatttgcatgataacatc	0.000													2	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47106845	47106846	+	Intron	INS	-	GTC	GTC	rs142357475		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47106845_47106846insGTC	uc001jed.3	-						uc001jef.2_Intron			P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						CCACTATGTTTATCAGTGAAGC	0.436													4	2	---	---	---	---	
FRMPD2	143162	broad.mit.edu	37	10	49462106	49462106	+	Intron	DEL	A	-	-	rs74648477		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49462106delA	uc001jgi.2	-						FRMPD2_uc001jgh.2_5'Flank|FRMPD2_uc001jgj.2_Intron	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		CCTTTCAATTAAAAAAAAAAA	0.408													6	3	---	---	---	---	
ZNF365	22891	broad.mit.edu	37	10	64419907	64419908	+	Intron	DEL	TG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64419907_64419908delTG	uc001jmd.1	+						ZNF365_uc001jmc.2_Intron|ZNF365_uc001jme.1_Intron|ZNF365_uc001jmf.1_Intron|ZNF365_uc009xpg.1_Intron	NM_199452	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform D											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					agtggaagcatgtgtgtgtgtg	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	64811127	64811128	+	IGR	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64811127_64811128insA								EGR2 (232200 upstream) : NRBF2 (81879 downstream)																							ACAAAACAAACAAAAAAAAATT	0.074													3	4	---	---	---	---	
AIFM2	84883	broad.mit.edu	37	10	71877434	71877434	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71877434delC	uc010qjg.1	-						AIFM2_uc001jqp.1_Intron	NM_032797	NP_116186	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor (AIF)-like						apoptotic mitochondrial changes|chromosome condensation|induction of apoptosis	cytosol|integral to membrane|mitochondrial outer membrane	DNA binding|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding			central_nervous_system(1)	1						TCATGCTCCACCCCAGGACAC	0.607													4	2	---	---	---	---	
NODAL	4838	broad.mit.edu	37	10	72193683	72193684	+	Intron	INS	-	AA	AA	rs138991712	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72193683_72193684insAA	uc001jrc.2	-							NM_018055	NP_060525	Q96S42	NODAL_HUMAN	nodal precursor						growth	extracellular space	cytokine activity|growth factor activity			large_intestine(1)|kidney(1)	2						ATCAGAGTGTCAGAGTTGGCAG	0.530													3	5	---	---	---	---	
ADK	132	broad.mit.edu	37	10	76180897	76180897	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76180897delG	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron	NM_006721	NP_006712	P55263	ADK_HUMAN	adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)	ctgaatgggtgggggaaaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	78442137	78442137	+	IGR	DEL	G	-	-	rs66768648		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78442137delG								C10orf11 (125013 upstream) : KCNMA1 (187222 downstream)																							ATTTTTATCAGGAACAAGGTT	0.368													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	78527506	78527506	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78527506delG								C10orf11 (210382 upstream) : KCNMA1 (101853 downstream)																							attgcactgagggaagagact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86701838	86701838	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86701838delT								FAM190B (423562 upstream) : GRID1 (657474 downstream)																							caagggttaatttttttggct	0.000													4	3	---	---	---	---	
OPN4	94233	broad.mit.edu	37	10	88420872	88420872	+	Intron	DEL	A	-	-	rs72462066		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88420872delA	uc001kdq.2	+						OPN4_uc001kdp.2_Intron|OPN4_uc010qmk.1_Intron|OPN4_uc009xsx.1_Intron	NM_033282	NP_150598	Q9UHM6	OPN4_HUMAN	opsin 4 isoform 1						phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity			ovary(1)	1						gcgacagagcaaaaaaaaaaa	0.239													5	5	---	---	---	---	
RPP30	10556	broad.mit.edu	37	10	92633963	92633963	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92633963delT	uc009xtx.2	+						RPP30_uc001khd.2_Intron|RPP30_uc010qnj.1_Intron	NM_006413	NP_006404	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit isoform b						tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity				0						ATGATTTAGATTTTTTTTTGG	0.239													4	2	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97117125	97117126	+	Intron	DEL	AA	-	-	rs4918915	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97117125_97117126delAA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		agagagagagaaagagagaaag	0.297													4	2	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97170103	97170103	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97170103delT	uc001kkp.2	-						SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TCCTTTCTCCTTTTTTTTGGT	0.343													4	2	---	---	---	---	
CRTAC1	55118	broad.mit.edu	37	10	99788917	99788917	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99788917delC	uc001kou.1	-							NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CTCCACCTCTCCCCCATGGCT	0.502													4	2	---	---	---	---	
CNNM2	54805	broad.mit.edu	37	10	104682888	104682888	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104682888delT	uc001kwm.2	+						CNNM2_uc001kwn.2_Intron|CNNM2_uc001kwl.2_Intron	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1						ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		ttcttcttccttttttttttc	0.234													4	2	---	---	---	---	
SORCS1	114815	broad.mit.edu	37	10	108369350	108369350	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108369350delG	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ACTGCTTCTTGGGATTGGGTG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113115806	113115806	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113115806delT								ADRA2A (275146 upstream) : GPAM (793816 downstream)																							TTGTTTTTTGTTTTTTTTTTC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113417974	113417974	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113417974delA								ADRA2A (577314 upstream) : GPAM (491648 downstream)																							tcaaaggctcaaagtggggaa	0.030													4	2	---	---	---	---	
CPXM2	119587	broad.mit.edu	37	10	125662009	125662010	+	Intron	INS	-	AG	AG	rs139755465	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125662009_125662010insAG	uc001lhj.2	-									Q8N436	CPXM2_HUMAN	Homo sapiens cDNA FLJ56000 complete cds, highly similar to Carboxypeptidase-like protein X2 precursor.						cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		atactatagacgggggcctata	0.000													3	4	---	---	---	---	
MGMT	4255	broad.mit.edu	37	10	131382118	131382118	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131382118delT	uc001lkh.2	+							NM_002412	NP_002403	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase											ovary(1)|breast(1)	2		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)		TTTCGTTTTGTTTTTTTTGGT	0.483								Direct_reversal_of_damage					4	2	---	---	---	---	
BNIP3	664	broad.mit.edu	37	10	133785883	133785883	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133785883delA	uc001lkv.1	-						BNIP3_uc001lku.1_5'Flank|BNIP3_uc010qut.1_Intron	NM_004052	NP_004043	Q12983	BNIP3_HUMAN	BCL2/adenovirus E1B 19kD-interacting protein 3						cellular response to cobalt ion|cellular response to hypoxia|cellular response to mechanical stimulus|chromatin remodeling|defense response to virus|DNA fragmentation involved in apoptotic nuclear change|induction of apoptosis|interspecies interaction between organisms|mitochondrial fragmentation involved in apoptosis|negative regulation of membrane potential|negative regulation of mitochondrial fusion|negative regulation of survival gene product expression|neuron apoptosis|positive regulation of mitochondrial fission|positive regulation of protein complex disassembly|positive regulation of release of cytochrome c from mitochondria|reactive oxygen species metabolic process|regulation of mitochondrial membrane permeability	dendrite|integral to mitochondrial outer membrane|nuclear envelope|nucleoplasm	GTPase binding|protein heterodimerization activity|protein homodimerization activity			lung(1)|skin(1)	2		all_cancers(35;4e-11)|all_epithelial(44;5.07e-08)|Ovarian(717;2.61e-05)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Breast(234;0.023)|all_neural(114;0.0299)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)		Epithelial(32;1.59e-12)|all cancers(32;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(35;2.57e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ccgtctctacaaaaaaAACTT	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134825137	134825138	+	IGR	DEL	TG	-	-	rs146580658		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134825137_134825138delTG								C10orf93 (69073 upstream) : GPR123 (59295 downstream)																							gcttgtgtgatgtgttttcgtg	0.000													6	4	---	---	---	---	
RNH1	6050	broad.mit.edu	37	11	497746	497749	+	Intron	DEL	CTCA	-	-	rs71462088		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:497746_497749delCTCA	uc001lpk.1	-						RNH1_uc001lpl.1_Intron|RNH1_uc001lpm.1_Intron|RNH1_uc001lpn.1_Intron|RNH1_uc001lpo.1_Intron|RNH1_uc009ybw.1_Intron|RNH1_uc001lpp.1_Intron|RNH1_uc001lpt.1_Intron|RNH1_uc001lpq.1_Intron|RNH1_uc001lpr.1_Intron|RNH1_uc001lps.1_Intron	NM_203389	NP_976323	P13489	RINI_HUMAN	ribonuclease/angiogenin inhibitor						mRNA catabolic process|regulation of angiogenesis	angiogenin-PRI complex|cytoplasm	protein binding|ribonuclease inhibitor activity				0		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		gaccctcgtgctcactcacgtgct	0.064													2	5	---	---	---	---	
TSPAN32	10077	broad.mit.edu	37	11	2327238	2327239	+	Intron	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2327238_2327239delGT	uc001lvy.1	+						TSPAN32_uc001lvx.1_Intron|TSPAN32_uc009ydk.1_Intron|TSPAN32_uc010qxk.1_Intron|TSPAN32_uc009ydl.1_Intron|TSPAN32_uc001lvz.1_Intron|TSPAN32_uc001lwb.1_Intron|TSPAN32_uc001lwc.1_Intron	NM_139022	NP_620591	Q96QS1	TSN32_HUMAN	tumor-suppressing subtransferable candidate 6						cell-cell signaling	integral to membrane				central_nervous_system(1)	1		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		atgtgcatgagtgtgtgtgtgc	0.287													4	2	---	---	---	---	
OSBPL5	114879	broad.mit.edu	37	11	3152611	3152612	+	Intron	INS	-	CATC	CATC	rs141516164	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3152611_3152612insCATC	uc001lxk.2	-						OSBPL5_uc009ydw.2_Intron|OSBPL5_uc001lxl.2_Intron|OSBPL5_uc009ydx.2_Intron|OSBPL5_uc001lxm.1_5'Flank	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform						cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		acccacccattcatccatccat	0.158													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	7809285	7809285	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7809285delT								OVCH2 (81344 upstream) : OR5P2 (8236 downstream)																							atcactgaactttacacttaa	0.035													4	2	---	---	---	---	
SBF2	81846	broad.mit.edu	37	11	9817705	9817706	+	Intron	DEL	TT	-	-	rs72243966		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9817705_9817706delTT	uc001mib.2	-						uc001mhz.1_Intron|SBF2_uc001mid.2_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		cagacgagggtttttttttttt	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	24299415	24299415	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24299415delA								None (None upstream) : LUZP2 (219141 downstream)																							agagatttctaaagcaattaa	0.000													4	2	---	---	---	---	
SLC5A12	159963	broad.mit.edu	37	11	26743355	26743359	+	5'UTR	DEL	GAGAG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26743355_26743359delGAGAG	uc001mra.2	-	1					SLC5A12_uc001mrb.2_Intron|SLC5A12_uc001mrc.3_5'UTR	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose						sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						ATGCTTTGCTGAGAGGAGAGACTGT	0.424													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27926644	27926645	+	IGR	INS	-	G	G	rs143365472	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27926644_27926645insG								BDNF (183039 upstream) : KIF18A (115518 downstream)																							AGTTGCCATCAGCACAAAGCCT	0.238													2	4	---	---	---	---	
MPPED2	744	broad.mit.edu	37	11	30481638	30481648	+	Intron	DEL	CTAAAAGGAAG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30481638_30481648delCTAAAAGGAAG	uc001msr.2	-						MPPED2_uc001msq.3_Intron|MPPED2_uc009yji.2_Intron	NM_001584	NP_001575	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2						nervous system development		hydrolase activity|metal ion binding			skin(1)	1						CAGGTACACCCTAAAAGGAAGCAGCAATGGA	0.479													3	4	---	---	---	---	
EIF3M	10480	broad.mit.edu	37	11	32617220	32617220	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32617220delA	uc001mtu.2	+						EIF3M_uc010ref.1_Intron	NM_006360	NP_006351	Q7L2H7	EIF3M_HUMAN	eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)					AACATTTTTCAAATGCAAGTA	0.303													4	2	---	---	---	---	
LRRC4C	57689	broad.mit.edu	37	11	40584497	40584497	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40584497delT	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				tttttttttcttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44484152	44484152	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44484152delT								ALX4 (152436 upstream) : CD82 (102989 downstream)																							tagactgagcttttatgtggc	0.065													4	2	---	---	---	---	
INTS5	80789	broad.mit.edu	37	11	62414351	62414351	+	3'UTR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62414351delA	uc001nud.2	-	2					GANAB_uc001nua.2_5'Flank|GANAB_uc001nub.2_5'Flank|GANAB_uc001nuc.2_5'Flank|GANAB_uc010rma.1_5'Flank|GANAB_uc010rmb.1_5'Flank	NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5						snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2						TTTTATTTAGAAAAAAAAAAG	0.493													4	2	---	---	---	---	
GAL	51083	broad.mit.edu	37	11	68458593	68458593	+	3'UTR	DEL	T	-	-	rs75147512		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68458593delT	uc001oob.2	+	6						NM_015973	NP_057057	P22466	GALA_HUMAN	galanin preproprotein						growth hormone secretion|insulin secretion|neuropeptide signaling pathway|smooth muscle contraction	extracellular region	neuropeptide hormone activity				0	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		TCATTTAAGATTTTTTTTTTT	0.358													9	4	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68838582	68838582	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68838582delA	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_5'Flank	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ATCCCCCACCAACAGCTTCAC	0.642													3	3	---	---	---	---	
MAP6	4135	broad.mit.edu	37	11	75377962	75377962	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75377962delG	uc001owu.2	-						MAP6_uc001owv.2_Intron	NM_033063	NP_149052	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6 isoform 1							Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding				0	Ovarian(111;0.11)					GGTGGAAGGTGGGGGGTAATT	0.323													4	2	---	---	---	---	
GRM5	2915	broad.mit.edu	37	11	88260320	88260320	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88260320delT	uc001pcq.2	-						GRM5_uc009yvm.2_Intron	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	GTGAATTGGATTGCTCAAGCA	0.328													4	2	---	---	---	---	
NOX4	50507	broad.mit.edu	37	11	89177585	89177586	+	Intron	INS	-	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89177585_89177586insG	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron|NOX4_uc009yvs.1_Intron	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AGTTTACCAAATTTTCAAAGGC	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	91682748	91682748	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91682748delT								None (None upstream) : FAT3 (402514 downstream)																							GGACTAGGGCTTTTTTTTTTC	0.393													3	3	---	---	---	---	
PDGFD	80310	broad.mit.edu	37	11	103924904	103924904	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103924904delG	uc001phq.2	-						PDGFD_uc001php.2_Intron	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1						positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		TTTGACTACTGGGAAGCGATT	0.373													4	2	---	---	---	---	
ARCN1	372	broad.mit.edu	37	11	118473069	118473069	+	3'UTR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118473069delG	uc001ptq.2	+	10					ARCN1_uc009zah.2_3'UTR|ARCN1_uc010ryg.1_3'UTR|ARCN1_uc009zag.2_3'UTR	NM_001655	NP_001646	P48444	COPD_HUMAN	archain isoform 1						COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	clathrin adaptor complex|COPI vesicle coat|cytosol					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		GCTCAGCCTTGGCTTTTAACT	0.488													257	114	---	---	---	---	
SLC37A4	2542	broad.mit.edu	37	11	118899433	118899433	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118899433delG	uc010rys.1	-						SLC37A4_uc009zam.2_Intron|SLC37A4_uc009zan.2_Intron|SLC37A4_uc010ryr.1_Intron|SLC37A4_uc010ryt.1_Intron|SLC37A4_uc001pus.2_Intron	NM_001164277	NP_001157749	O43826	G6PT1_HUMAN	solute carrier family 37 (glucose-6-phosphate						glucose homeostasis|glucose metabolic process	endoplasmic reticulum membrane|integral to endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphate transmembrane transporter activity|glucose-6-phosphate transmembrane transporter activity			large_intestine(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		ATTTGCATATGGGATTTCCCA	0.572									Glycogen_Storage_Disease_type_Ib				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	126879621	126879626	+	IGR	DEL	GCAAAA	-	-	rs112199631		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126879621_126879626delGCAAAA								KIRREL3 (6266 upstream) : None (None downstream)																							TGAGACCCTGGCAAAATAATGTATGC	0.316													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	129400317	129400318	+	IGR	INS	-	G	G	rs149927545	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129400317_129400318insG								BARX2 (78144 upstream) : TMEM45B (285423 downstream)																							CAAGAGCTGGAGGGGGGAGAGG	0.594													4	3	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	12038463	12038463	+	Intron	DEL	A	-	-	rs78779450		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12038463delA	uc001qzz.2	+						ETV6_uc001raa.1_Intron	NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				TCATTGCAACAAAAAAAAAGA	0.443			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	18807528	18807528	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18807528delA								PIK3C2G (6177 upstream) : PLCZ1 (28588 downstream)																							TTCCCTGAGGAAAAATATTTG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	18960982	18960982	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18960982delT								CAPZA3 (68861 upstream) : PLEKHA5 (321666 downstream)																							TTTTATTTGATTTTTTTTTTA	0.378													4	2	---	---	---	---	
IPO8	10526	broad.mit.edu	37	12	30813897	30813898	+	Intron	INS	-	TACT	TACT	rs145520545	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30813897_30813898insTACT	uc001rjd.2	-						IPO8_uc001rje.1_Intron|IPO8_uc010sjt.1_Intron	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8						intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					atgatgtaatattataatGTTA	0.198													4	2	---	---	---	---	
LOC283404	283404	broad.mit.edu	37	12	52610415	52610416	+	Intron	DEL	AC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52610415_52610416delAC	uc010snp.1	+							NR_027358				Homo sapiens hypothetical protein LOC283404, mRNA (cDNA clone IMAGE:4828118).												0						CAGTGCGGGAacacacacacac	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	58931682	58931683	+	IGR	DEL	TC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58931682_58931683delTC								XRCC6BP1 (580631 upstream) : LRIG3 (334255 downstream)																							TAATCTTATTTCTCTCTCTCAG	0.376													4	2	---	---	---	---	
SLC16A7	9194	broad.mit.edu	37	12	60092405	60092405	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60092405delG	uc001sqs.2	+						SLC16A7_uc001sqt.2_Intron|SLC16A7_uc001squ.2_Intron|SLC16A7_uc009zqi.2_Intron|SLC16A7_uc010ssi.1_Intron	NM_004731	NP_004722	O60669	MOT2_HUMAN	solute carrier family 16, member 7							integral to plasma membrane|membrane fraction	pyruvate secondary active transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(3;0.0303)	Pyruvic acid(DB00119)	attagaggaaggaatataagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	61613877	61613877	+	IGR	DEL	T	-	-	rs66788171		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61613877delT								None (None upstream) : FAM19A2 (488166 downstream)																							TGTATTAAAATAAAAAAGTCC	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	61802060	61802060	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61802060delA								None (None upstream) : FAM19A2 (299983 downstream)																							TTTCCGAGTTAAAAAAAAATC	0.318													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	67404758	67404758	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67404758delC								GRIP1 (206864 upstream) : CAND1 (258303 downstream)																							gtactcgtctccctaggcaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	72214215	72214215	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72214215delT								RAB21 (33066 upstream) : TBC1D15 (19272 downstream)																							tggcatattcttTTTTTTTTT	0.149													4	2	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72290219	72290235	+	Intron	DEL	CTGTAGTCTACTGTATT	-	-	rs113858751		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72290219_72290235delCTGTAGTCTACTGTATT	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						TGTCTGTCTGCTGTAGTCTACTGTATTCTGTAGTCTA	0.406													2	7	---	---	---	---	
TRHDE	29953	broad.mit.edu	37	12	73057100	73057100	+	3'UTR	DEL	T	-	-	rs77607591		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73057100delT	uc001sxa.2	+	19						NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme						cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GTGGGAGGAATTTTTTTTTTA	0.333													4	3	---	---	---	---	
ANO4	121601	broad.mit.edu	37	12	101208787	101208788	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101208787_101208788insT	uc010svm.1	+						ANO4_uc010svl.1_Intron|ANO4_uc001thw.2_Intron	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4							chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CTCTGGGATCATTTTAACTTTG	0.520										HNSCC(74;0.22)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	103018245	103018246	+	IGR	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103018245_103018246insT								IGF1 (143867 upstream) : PAH (213858 downstream)																							GAACCATTTGATTTTTTTTTTT	0.347													4	2	---	---	---	---	
TCP11L2	255394	broad.mit.edu	37	12	106722855	106722855	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106722855delA	uc001tln.2	+						TCP11L2_uc001tlm.2_Intron	NM_152772	NP_689985	Q8N4U5	T11L2_HUMAN	t-complex 11 (mouse) like 2											ovary(3)	3						GTTGCCAGGCAAAAAAAAAAG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	109706850	109706851	+	IGR	DEL	AG	-	-	rs35265898		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109706850_109706851delAG								ACACB (822 upstream) : FOXN4 (8933 downstream)																							gcccagagatagagggggagat	0.149													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116351034	116351037	+	IGR	DEL	CACA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116351034_116351037delCACA								None (None upstream) : MED13L (45346 downstream)																							TCCACCCCACCACACACACACACA	0.333													4	2	---	---	---	---	
FBXO21	23014	broad.mit.edu	37	12	117612801	117612801	+	Intron	DEL	A	-	-	rs138433024		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117612801delA	uc001twk.2	-						FBXO21_uc001twj.2_Intron|FBXO21_uc009zwq.2_Intron	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		CTTTAACTTTAAAAAAAAAAA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	117885796	117885800	+	IGR	DEL	GTCAG	-	-	rs112928664		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117885796_117885800delGTCAG								NOS1 (86214 upstream) : KSR2 (5017 downstream)																							TAATGTTAATGTCAGGTCAGGTGAG	0.561													5	3	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118517627	118517630	+	Intron	DEL	TTTC	-	-	rs66686401		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118517627_118517630delTTTC	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						CACCTTTGCAtttctttctttctt	0.221													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	125252084	125252084	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125252084delG								NCOR2 (200074 upstream) : SCARB1 (10091 downstream)																							AGCATCAAAAGGGGCTGCTGT	0.552											OREG0022245	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133299144	133299145	+	IGR	DEL	AT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133299144_133299145delAT								PGAM5 (1229 upstream) : ANKLE2 (3109 downstream)																							AGGGATTAAAATATTCAAACAT	0.173													3	4	---	---	---	---	
ZNF268	10795	broad.mit.edu	37	12	133737003	133737003	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133737003delA	uc010tbv.1	+									Q14587	ZN268_HUMAN	RecName: Full=Zinc finger protein 268; AltName: Full=Zinc finger protein 3; AltName: Full=HZF3;							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		ttaggttttgaaggaaaggtg	0.000													4	2	---	---	---	---	
ZMYM2	7750	broad.mit.edu	37	13	20542962	20542962	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20542962delT	uc001umr.2	+						ZMYM2_uc001umq.2_Intron|ZMYM2_uc001ums.2_Intron|ZMYM2_uc001umt.2_Intron|ZMYM2_uc009zzn.1_Intron	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198						regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TTAAAAACCCTTTTAAAAAGA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	25731722	25731723	+	IGR	INS	-	T	T	rs140970503	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25731722_25731723insT								PABPC3 (59020 upstream) : FAM123A (10950 downstream)																							GCCAAGTACAGTGTCATCTTTT	0.416													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27281788	27281788	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27281788delG								WASF3 (18708 upstream) : GPR12 (47553 downstream)																							tcatggccctgggtaggtcgc	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27514503	27514503	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27514503delT								GPR12 (179581 upstream) : USP12 (127935 downstream)																							AGGCTTCAGCTTCCACTGTTT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	32001373	32001373	+	IGR	DEL	A	-	-	rs34093560		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32001373delA								B3GALTL (94964 upstream) : RXFP2 (312306 downstream)																							acagtgtgtcaaaaacagaag	0.144													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	47944433	47944434	+	IGR	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47944433_47944434insT								HTR2A (473383 upstream) : SUCLA2 (572358 downstream)																							ttaattagaagtttttttttct	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	60765917	60765918	+	IGR	DEL	CA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60765917_60765918delCA								DIAPH3 (27798 upstream) : TDRD3 (204673 downstream)																							GTGTTGTATTCAGCTCTCTCTT	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79172210	79172211	+	Intron	INS	-	T	T	rs67261109		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79172210_79172211insT	uc001vku.1	+											Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																		AAAGCAAAGCATTTTTTTTTGT	0.287													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79763567	79763568	+	IGR	INS	-	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79763567_79763568insC								RNF219 (528867 upstream) : RBM26 (130532 downstream)																							TAGAGCCACCACTTTTGTTTAT	0.307													4	2	---	---	---	---	
GPC5	2262	broad.mit.edu	37	13	92880336	92880337	+	Intron	INS	-	GAG	GAG			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92880336_92880337insGAG	uc010tif.1	+							NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ttgagtaggctgaggaggagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	93699890	93699893	+	IGR	DEL	ATTG	-	-	rs139110980		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93699890_93699893delATTG								GPC5 (180405 upstream) : GPC6 (179185 downstream)																							caaggttaatattgattgatatgt	0.000													2	4	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96485564	96485564	+	Intron	DEL	A	-	-	rs11329248		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96485564delA	uc001vmt.2	-						UGGT2_uc001vms.2_Intron	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						TAAGTCTGTCAAAAAAAAATT	0.274													4	2	---	---	---	---	
HS6ST3	266722	broad.mit.edu	37	13	97134287	97134287	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97134287delA	uc001vmw.2	+							NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					ATAAAAGAATAAAAAGGGAGA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	105887441	105887442	+	IGR	DEL	AG	-	-	rs149655995	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105887441_105887442delAG								None (None upstream) : DAOA (230774 downstream)																							acatacacacagagagagagag	0.025													4	2	---	---	---	---	
CHD8	57680	broad.mit.edu	37	14	21876281	21876281	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21876281delA	uc001was.1	-						CHD8_uc001war.1_Intron|CHD8_uc001wav.1_Intron	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8						ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TCTACTAGGTAAAAAAAATAG	0.299													4	2	---	---	---	---	
AKAP6	9472	broad.mit.edu	37	14	32928947	32928948	+	Intron	INS	-	T	T	rs35453540		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32928947_32928948insT	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ttgtcaactgattttttttttt	0.000													4	2	---	---	---	---	
C14orf101	54916	broad.mit.edu	37	14	57116193	57116193	+	3'UTR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57116193delA	uc001xcm.2	+	16					C14orf101_uc001xcj.2_RNA|C14orf101_uc001xcn.2_RNA|C14orf101_uc010trf.1_3'UTR|C14orf101_uc001xco.2_3'UTR	NM_017799	NP_060269	Q9NX78	CN101_HUMAN	hypothetical protein LOC54916							integral to membrane				breast(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(311;0.226)		TCTTTTCTTTAAAAAAAAAAG	0.299													4	2	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64568488	64568488	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64568488delA	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc010apz.1_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TATAGTTAGTAAAAAAAATAC	0.393													4	2	---	---	---	---	
MLH3	27030	broad.mit.edu	37	14	75489488	75489488	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75489488delT	uc001xrd.1	-						MLH3_uc001xre.1_Intron	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1						mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TGCAGAGGTGTTTGATCACTG	0.507								MMR					50	41	---	---	---	---	
ESRRB	2103	broad.mit.edu	37	14	76953435	76953436	+	Intron	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76953435_76953436delGT	uc001xsq.1	+						ESRRB_uc001xsr.2_Intron|ESRRB_uc001xso.2_Intron	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		ACTGTGTGAGGTGTGTGTGTGG	0.441													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79463093	79463093	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79463093delC	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CAGCATAGCTCCATGATAACC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95291015	95291015	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95291015delT								GSC (54516 upstream) : DICER1 (261550 downstream)																							gttaagtatcttgaattttgt	0.000													4	2	---	---	---	---	
VRK1	7443	broad.mit.edu	37	14	97293314	97293314	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97293314delA	uc001yft.2	+							NM_003384	NP_003375	Q99986	VRK1_HUMAN	vaccinia related kinase 1							cytoplasm|nucleolus	ATP binding|protein binding|protein serine/threonine kinase activity			large_intestine(1)|stomach(1)	2		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)		gaggatgctgaaagggaacct	0.000													4	2	---	---	---	---	
EVL	51466	broad.mit.edu	37	14	100508965	100508965	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100508965delT	uc001ygt.2	+						EVL_uc001ygv.2_Intron	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				GTTCATATGCTTTTTTTGGTA	0.343													5	3	---	---	---	---	
EVL	51466	broad.mit.edu	37	14	100599303	100599303	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100599303delC	uc001ygt.2	+						EVL_uc001ygv.2_Intron|EVL_uc001ygu.2_Intron|EVL_uc010avu.2_Intron	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				CAGCAGCAGGCCTGCCCTCAC	0.682													5	4	---	---	---	---	
PACS2	23241	broad.mit.edu	37	14	105862722	105862722	+	3'UTR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105862722delC	uc001yqt.2	+	24					PACS2_uc001yqs.2_3'UTR|PACS2_uc001yqv.2_3'UTR|PACS2_uc001yqu.2_3'UTR|uc010axk.1_5'Flank	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2						apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		AGGGTGTGAGCCCCGGGCTGA	0.637													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20128297	20128298	+	IGR	INS	-	AA	AA			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20128297_20128298insAA								None (None upstream) : GOLGA6L6 (608796 downstream)																							ATAGGTCTGTGAAAAAAATGCG	0.302													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26475396	26475396	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26475396delA								ATP10A (365079 upstream) : GABRB3 (313299 downstream)																							CCCTGCATTTAAAAAAAAATC	0.423													4	2	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27261936	27261936	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27261936delT	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		tgcttcactcttttttttgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	34664440	34664441	+	IGR	INS	-	T	T	rs144707348	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34664440_34664441insT								LPCAT4 (5045 upstream) : GOLGA8A (6831 downstream)																							TTAATATTGTATTTTTTTAATG	0.317													2	4	---	---	---	---	
RASGRP1	10125	broad.mit.edu	37	15	38792549	38792549	+	Intron	DEL	G	-	-	rs12904148	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38792549delG	uc001zke.3	-						RASGRP1_uc010bbe.2_Intron|RASGRP1_uc010bbf.2_Intron|RASGRP1_uc010bbg.2_Intron|RASGRP1_uc001zkd.3_Intron	NM_005739	NP_005730	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 isoform a						cell differentiation|platelet activation|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|lipid binding|protein binding			large_intestine(1)|ovary(1)	2		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		GGttttttttgttttgttttt	0.179													6	3	---	---	---	---	
INO80	54617	broad.mit.edu	37	15	41362202	41362202	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41362202delT	uc001zni.2	-						INO80_uc010ucu.1_Intron	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1						cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						GAGCTTTTGCTTTTTTTTCAg	0.169													4	2	---	---	---	---	
ZSCAN29	146050	broad.mit.edu	37	15	43652976	43652976	+	3'UTR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43652976delT	uc001zrk.1	-	5					ZSCAN29_uc001zrj.1_3'UTR|ZSCAN29_uc010bdf.1_3'UTR|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_3'UTR	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		ATAGGATCTATTACCTTGTCC	0.388													4	2	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	47681626	47681626	+	Intron	DEL	A	-	-	rs68012491		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47681626delA	uc001zvw.2	+							NM_020858	NP_065909	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AACTCTGGAGAAAAAAAAAAG	0.338													3	3	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48055862	48055862	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48055862delT	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AAAGTGGCTCTTTTTTCCCCA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	50116943	50116944	+	IGR	DEL	GA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50116943_50116944delGA								DTWD1 (179611 upstream) : ATP8B4 (33492 downstream)																							GTTCTATACTGAGAGAGACATA	0.381													4	2	---	---	---	---	
ATP8B4	79895	broad.mit.edu	37	15	50283355	50283355	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50283355delA	uc001zxu.2	-						ATP8B4_uc010ber.2_Intron|ATP8B4_uc010ufd.1_Intron|ATP8B4_uc010ufe.1_Intron	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TCTGGTAAGCAAAAAAACTCA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	58139874	58139874	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58139874delT								GCOM1 (130122 upstream) : ALDH1A2 (105754 downstream)																							TCCATTGCTCTTTTTTTTTTG	0.408													4	2	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	61491632	61491632	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61491632delA	uc002agx.2	-							NM_134261	NP_599023	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TCTGTATCCCAAAAAACCCAC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	61941430	61941431	+	IGR	DEL	AC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61941430_61941431delAC								RORA (419928 upstream) : VPS13C (203161 downstream)																							ATGACCAAAGACACTCCCACGC	0.426													0	6	---	---	---	---	
IQCH	64799	broad.mit.edu	37	15	67555218	67555218	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67555218delA	uc002aqo.1	+						IQCH_uc010ujv.1_Intron|IQCH_uc002aqn.1_Intron|IQCH_uc002aqq.1_Intron|IQCH_uc002aqp.1_Intron|IQCH_uc002aqm.2_Intron	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1											skin(3)|ovary(1)	4				Colorectal(3;0.0856)		agaccctactaaaaaaaaaac	0.179													4	2	---	---	---	---	
PARP6	56965	broad.mit.edu	37	15	72560098	72560099	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72560098_72560099insT	uc002auc.2	-						PARP6_uc002aua.2_5'Flank|PARP6_uc002aub.2_5'Flank|PARP6_uc002aud.3_Intron|PARP6_uc002auf.1_5'Flank|CELF6_uc010biv.1_Intron	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6								NAD+ ADP-ribosyltransferase activity				0						tatcaatacacttttttttttt	0.134													4	3	---	---	---	---	
SCAPER	49855	broad.mit.edu	37	15	76994382	76994383	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76994382_76994383insA	uc002bby.2	-						SCAPER_uc010bkr.2_Intron|SCAPER_uc002bbx.2_Intron|SCAPER_uc002bbz.1_Intron|SCAPER_uc002bca.1_Intron	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						GGCAAATGGTTAAAAAAAAAGa	0.163													4	2	---	---	---	---	
WHAMM	123720	broad.mit.edu	37	15	83501064	83501064	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83501064delT	uc002bje.2	+							NM_001080435	NP_001073904	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi							cytoplasmic vesicle membrane|ER-Golgi intermediate compartment|Golgi apparatus	actin binding				0						AAGGTATAAGTTTAAATCCAA	0.373													4	2	---	---	---	---	
PDE8A	5151	broad.mit.edu	37	15	85669755	85669755	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85669755delT	uc002blh.2	+						PDE8A_uc002bli.2_Intron|PDE8A_uc010bnc.2_Intron|PDE8A_uc010bnd.2_Intron|PDE8A_uc002blj.2_Intron|PDE8A_uc002blk.2_Intron|PDE8A_uc002bll.2_Intron	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			tggtaacaaattttttttttc	0.075													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1083458	1083459	+	IGR	INS	-	CCAT	CCAT			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1083458_1083459insCCAT								SOX8 (46480 upstream) : LOC146336 (30625 downstream)																							catccatccaaccatccatcca	0.000													4	2	---	---	---	---	
IFT140	9742	broad.mit.edu	37	16	1633603	1633603	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1633603delT	uc002cmb.2	-						IFT140_uc002clz.2_Intron	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140											ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				ttcttttctgttttttttttt	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5546660	5546660	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5546660delG	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																		GGGAGAGTGAGGAGGAGACGT	0.473													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6311351	6311352	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6311351_6311352insT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		GAGGAAGGTTGTTTTTTTCTCT	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9423943	9423945	+	IGR	DEL	CTC	-	-	rs145722271		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9423943_9423945delCTC								C16orf72 (210398 upstream) : GRIN2A (423322 downstream)																							CCTCTTGCTTCTCCTCTTGCACA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10707140	10707140	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10707140delT								EMP2 (32601 upstream) : TEKT5 (14221 downstream)																							AGAACCTCAATTTTTTTGGTT	0.453													4	2	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14696780	14696780	+	Intron	DEL	T	-	-	rs72304259		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14696780delT	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						atctcgtatctttttttttta	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	18083434	18083435	+	IGR	DEL	AC	-	-	rs10582421		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18083434_18083435delAC								XYLT1 (518696 upstream) : NOMO2 (427748 downstream)																							CACCTGTGGTACACACACACAC	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26386144	26386147	+	IGR	DEL	TGGA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26386144_26386147delTGGA								HS3ST4 (237136 upstream) : C16orf82 (692072 downstream)																							GGTAgatggttggatggatggatg	0.103													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26529492	26529493	+	IGR	INS	-	AGC	AGC	rs145432798	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26529492_26529493insAGC								HS3ST4 (380484 upstream) : C16orf82 (548726 downstream)																							TTCATATTAGTAGCAGCAGCAG	0.208													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29006587	29006588	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29006587_29006588insA	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		gactccatctcaaaaaaaaaaa	0.208													2	5	---	---	---	---	
ITGAD	3681	broad.mit.edu	37	16	31436100	31436103	+	Intron	DEL	AGTA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31436100_31436103delAGTA	uc002ebv.1	+						ITGAD_uc010cap.1_Intron	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor						cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						ttgtatttttagtagagatggagt	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33052524	33052524	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33052524delC								SLC6A10P (156061 upstream) : MIR1826 (912984 downstream)																							aacctgtgtactacattacta	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33986317	33986317	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33986317delA								MIR1826 (20725 upstream) : UBE2MP1 (417485 downstream)																							tgtttctcagaaaccttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	47795105	47795105	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47795105delT								PHKB (59672 upstream) : ABCC12 (321779 downstream)																							tctttctttcttttttttttt	0.055													4	2	---	---	---	---	
ZNF423	23090	broad.mit.edu	37	16	49794826	49794827	+	Intron	INS	-	AC	AC	rs146463417	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49794826_49794827insAC	uc002efs.2	-							NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				ACCTCCCTCCAacacacacaca	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51700334	51700334	+	IGR	DEL	A	-	-	rs56373440		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51700334delA								SALL1 (515151 upstream) : TOX3 (771584 downstream)																							TTTAGATTGGaaaaaaaaaca	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	63536619	63536619	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63536619delA								None (None upstream) : None (None downstream)																							ATGGGCAAACAAAAAAATACT	0.299													4	2	---	---	---	---	
GFOD2	81577	broad.mit.edu	37	16	67749309	67749310	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67749309_67749310insT	uc002eub.2	-						GFOD2_uc002euc.2_Intron|GFOD2_uc010cen.2_Intron	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain							proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		ATGAGAGAAAATTTTTTTTTGT	0.257													4	2	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78654589	78654590	+	Intron	INS	-	T	T	rs148009224	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78654589_78654590insT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		AGGAAATATGGTTTTTTTTTCC	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85560460	85560460	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85560460delG								FAM92B (414346 upstream) : KIAA0182 (84569 downstream)																							ATTTGTTCCAGGGAGCTGCTA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	4974534	4974534	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4974534delG								GPR172B (19230 upstream) : ZFP3 (7220 downstream)																							CTCATATGCTGGGATGCAGCT	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6574739	6574739	+	IGR	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6574739delC								C17orf100 (18122 upstream) : SLC13A5 (13302 downstream)																							TCGATTGGATCCAGTGATTCT	0.567													4	2	---	---	---	---	
ASGR1	432	broad.mit.edu	37	17	7079706	7079707	+	Intron	DEL	CT	-	-	rs61339710		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7079706_7079707delCT	uc002ges.3	-						ASGR1_uc010clx.1_Intron	NM_001671	NP_001662	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1						receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding			breast(1)|central_nervous_system(1)	2						tacactcagactcacacacacc	0.000													4	2	---	---	---	---	
ASGR1	432	broad.mit.edu	37	17	7079790	7079791	+	Intron	DEL	TG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7079790_7079791delTG	uc002ges.3	-						ASGR1_uc010clx.1_Intron	NM_001671	NP_001662	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1						receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding			breast(1)|central_nervous_system(1)	2						tcccacagactgtctcacacac	0.000													4	2	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7646597	7646597	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7646597delT	uc002giu.1	+						DNAH2_uc002git.2_Frame_Shift_Del_p.F763fs|DNAH2_uc010vuk.1_Frame_Shift_Del_p.F681fs	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GTCATTTTACTTTTTTTTTTC	0.338													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14390427	14390428	+	IGR	INS	-	AGAG	AGAG	rs113459625		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14390427_14390428insAGAG								HS3ST3B1 (140935 upstream) : PMP22 (742669 downstream)																							aaaaaaaagacagagcgataag	0.000													4	2	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15555330	15555331	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15555330_15555331insT	uc002gox.2	-						TRIM16_uc002gor.1_5'Flank|TRIM16_uc002goy.2_Intron	NM_006470	NP_006461	O95361	TRI16_HUMAN	tripartite motif-containing 16						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		GACAAGCGACATTTTTTTTTGT	0.436													4	2	---	---	---	---	
RAI1	10743	broad.mit.edu	37	17	17626654	17626655	+	Intron	DEL	CC	-	-	rs68086114		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17626654_17626655delCC	uc002grm.2	+							NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		TGTATCCAGACCCCCCCCCCCA	0.530													5	3	---	---	---	---	
LRRC48	83450	broad.mit.edu	37	17	17901155	17901155	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17901155delC	uc010vxd.1	+						LRRC48_uc002gsa.2_Intron|LRRC48_uc010vxc.1_Intron|LRRC48_uc002gsb.2_Intron|LRRC48_uc010vxe.1_Intron	NM_001130090	NP_001123562	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48 isoform a							cytoplasm				pancreas(1)	1	all_neural(463;0.228)					AACCACAGCTCCCCACTGCTT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18988562	18988563	+	IGR	DEL	TT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18988562_18988563delTT								GRAP (38226 upstream) : GRAPL (42219 downstream)																							CTGATGTGTGTTTTTTTTTTTA	0.277													4	2	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21312637	21312638	+	Intron	INS	-	TGT	TGT	rs143247012		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21312637_21312638insTGT	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	aggagACTTGGTGTGGGGCATC	0.312										Prostate(3;0.18)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518287	21518288	+	IGR	DEL	TA	-	-	rs113480383		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518287_21518288delTA								C17orf51 (40556 upstream) : FAM27L (307082 downstream)																							ttccattgtgtattttcttctc	0.173													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25279439	25279439	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25279439delA								None (None upstream) : WSB1 (341667 downstream)																							agtgagaaagaaagaaaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25328379	25328379	+	IGR	DEL	A	-	-	rs113272930		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25328379delA								None (None upstream) : WSB1 (292727 downstream)																							gcatgaaaacaacattaatct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25678866	25678867	+	IGR	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25678866_25678867delGT								WSB1 (38221 upstream) : KSR1 (120169 downstream)																							ATTTCATACAGTGTGTTTCTCC	0.347													7	5	---	---	---	---	
SSH2	85464	broad.mit.edu	37	17	27953391	27953391	+	3'UTR	DEL	G	-	-	rs35612174		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27953391delG	uc002heo.1	-	15					SSH2_uc010wbh.1_3'UTR	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						ATTTCCCTGTGGGCTTACTGA	0.368													4	5	---	---	---	---	
AP2B1	163	broad.mit.edu	37	17	33999442	33999443	+	Intron	INS	-	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33999442_33999443insG	uc002hjr.2	+						AP2B1_uc002hjq.2_Intron|AP2B1_uc010wci.1_Intron|AP2B1_uc002hjs.2_Intron|AP2B1_uc002hjt.2_Intron|AP2B1_uc010ctv.2_Intron|AP2B1_uc010wcj.1_Intron	NM_001282	NP_001273	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		GAAGTTCAAGAGGGGAAACTCC	0.431													4	2	---	---	---	---	
GRB7	2886	broad.mit.edu	37	17	37902897	37902906	+	Intron	DEL	AAGAAAAAAG	-	-	rs61372705		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37902897_37902906delAAGAAAAAAG	uc002hsr.2	+						GRB7_uc002hss.2_Intron|GRB7_uc010cwc.2_Intron|GRB7_uc002hst.2_Intron	NM_005310	NP_005301	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7						blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			gaaaaagaaaaagaaaaaagaaaagaataa	0.276													4	2	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39831152	39831152	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39831152delT	uc010wfs.1	-							NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TGCAACCCTCTTTTTTTTTCC	0.353													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42109902	42109903	+	IGR	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42109902_42109903delGT								TMEM101 (17487 upstream) : LSM12 (2101 downstream)																							GGGTATAGAGGTGTGTGTGTGT	0.455													4	2	---	---	---	---	
EFTUD2	9343	broad.mit.edu	37	17	42966300	42966301	+	Intron	INS	-	ATAA	ATAA	rs149690543	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42966300_42966301insATAA	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				tctgagtcgtcataaagttatt	0.000													5	3	---	---	---	---	
LOC100128977	100128977	broad.mit.edu	37	17	43928518	43928518	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43928518delC	uc010wjz.1	-							NR_024559				Homo sapiens cDNA clone IMAGE:4819956.												0						acttcacacacccccacaccc	0.169													4	2	---	---	---	---	
LRRC37A2	474170	broad.mit.edu	37	17	44597373	44597374	+	Intron	DEL	GT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44597373_44597374delGT	uc002ikn.1	+						ARL17A_uc002iko.3_Intron	NM_001006607	NP_001006608	A6NM11	L37A2_HUMAN	c114 SLIT-like testicular protein precursor							integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		GTGTGCTTGAGTGTGTGTGTGT	0.436													6	3	---	---	---	---	
WNT3	7473	broad.mit.edu	37	17	44884489	44884489	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44884489delA	uc002ikv.2	-							NM_030753	NP_110380	P56703	WNT3_HUMAN	wingless-type MMTV integration site family,						canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|cellular response to retinoic acid|dorsal/ventral axis specification|embryonic forelimb morphogenesis|embryonic hindlimb morphogenesis|embryonic pattern specification|head morphogenesis|hemopoietic stem cell proliferation|inner ear morphogenesis|limb bud formation|mammary gland epithelium development|mesoderm formation|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|positive regulation of cell proliferation|Spemann organizer formation at the anterior end of the primitive streak|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane fraction|membrane raft|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|signal transducer activity			lung(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.0257)			ATCATGGAGGAAAAAAAAGAG	0.408													4	2	---	---	---	---	
PRR15L	79170	broad.mit.edu	37	17	46035808	46035808	+	5'Flank	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46035808delA	uc002imp.2	-							NM_024320	NP_077296	Q9BU68	PR15L_HUMAN	ATPase family, AAA domain containing 4											ovary(1)	1						CCCTAGGGAGAAAAAAAAAAA	0.537													2	4	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	50161494	50161494	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50161494delA	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			TTGCAGCAGGAAAAAAACTGA	0.443													4	2	---	---	---	---	
C17orf67	339210	broad.mit.edu	37	17	54873949	54873949	+	Intron	DEL	C	-	-	rs56823246		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54873949delC	uc010dci.2	-						C17orf67_uc002iuq.2_Intron	NM_001085430	NP_001078899	Q0P5P2	CQ067_HUMAN	hypothetical protein LOC339210 precursor							extracellular region					0	Breast(9;2.49e-06)					TCTCCATCTACTCAGGAACCC	0.483													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	55938512	55938514	+	IGR	DEL	GGA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55938512_55938514delGGA								MRPS23 (11113 upstream) : CUEDC1 (1823 downstream)																							ctgctgagctggaggaggaggag	0.089													4	2	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60023568	60023568	+	3'UTR	DEL	A	-	-	rs71727113		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60023568delA	uc002izo.2	-	30						NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						CTGTGACTGGAAAAAAAAAAG	0.318													2	6	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64522849	64522849	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64522849delA	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	aagtcatatgaaaaaaaaggt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71949318	71949335	+	IGR	DEL	TACACGCACGCACACATT	-	-	rs112145377	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71949318_71949335delTACACGCACGCACACATT								C17orf54 (124642 upstream) : RPL38 (250460 downstream)																							Gcacacaccctacacgcacgcacacatttacacacacg	0.289													8	4	---	---	---	---	
GRIN2C	2905	broad.mit.edu	37	17	72842695	72842698	+	Intron	DEL	TTGA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72842695_72842698delTTGA	uc002jlt.1	-						GRIN2C_uc010wrh.1_Intron|GRIN2C_uc002jlu.1_Intron	NM_000835	NP_000826	Q14957	NMDE3_HUMAN	N-methyl-D-aspartate receptor subunit 2C						glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)	AGGCTGAACTTTGATTGGCACCAC	0.564													4	2	---	---	---	---	
ICT1	3396	broad.mit.edu	37	17	73013403	73013403	+	Intron	DEL	A	-	-	rs113430634		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73013403delA	uc002jmm.2	+							NM_001545	NP_001536	Q14197	ICT1_HUMAN	immature colon carcinoma transcript 1 precursor						mitochondrial translational termination	mitochondrial large ribosomal subunit	aminoacyl-tRNA hydrolase activity|translation release factor activity, codon nonspecific			ovary(1)|central_nervous_system(1)	2	all_lung(278;0.226)					attaaaaattaaaaaaaaaaa	0.025													4	2	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78576291	78576291	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78576291delT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						TTTTCTTTTCTTTTTTTTTGG	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79468635	79468635	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79468635delA								BAHCC1 (35277 upstream) : ACTG1 (8364 downstream)																							ccaaaaaaagaaaaaaaaaaa	0.040													3	3	---	---	---	---	
USP14	9097	broad.mit.edu	37	18	167091	167091	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:167091delA	uc002kkf.1	+						USP14_uc002kkg.1_Intron|USP14_uc010wyr.1_Intron	NM_005151	NP_005142	P54578	UBP14_HUMAN	ubiquitin specific protease 14 isoform a						regulation of chemotaxis|regulation of proteasomal protein catabolic process|ubiquitin-dependent protein catabolic process	cell surface|cytoplasmic membrane-bounded vesicle|plasma membrane|proteasome complex	cysteine-type endopeptidase activity|endopeptidase inhibitor activity|proteasome binding|tRNA guanylyltransferase activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				aaaagccttgaaaAaaaaatt	0.000													4	2	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	7758959	7758960	+	Intron	INS	-	CT	CT	rs149422400	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7758959_7758960insCT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				GGATGAAGTAACTGTCGGAGGG	0.470													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10432171	10432172	+	IGR	INS	-	GTGT	GTGT	rs148895517	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10432171_10432172insGTGT								VAPA (472154 upstream) : APCDD1 (22453 downstream)																							TATTACAAAGGGTGTGTCCTAC	0.485													3	4	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13522753	13522754	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13522753_13522754insT	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		TTTAAATGAACCTAACACTTAA	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14225639	14225639	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14225639delA								ZNF519 (93210 upstream) : LOC284233 (111783 downstream)																							aataaacattaaaaaaaaaaG	0.144													2	4	---	---	---	---	
GREB1L	80000	broad.mit.edu	37	18	19065308	19065309	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19065308_19065309insA	uc010xam.1	+						GREB1L_uc010dlp.1_Intron|GREB1L_uc010xan.1_Intron|GREB1L_uc010dlr.1_Intron	NM_001142966	NP_001136438	Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast							integral to membrane					0						TGTATCCCAACAAAAAAAAAAG	0.381													5	3	---	---	---	---	
KIAA1632	57724	broad.mit.edu	37	18	43475409	43475410	+	Intron	INS	-	A	A	rs148276387	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43475409_43475410insA	uc002lbm.2	-						KIAA1632_uc010xcq.1_Intron|KIAA1632_uc010xcr.1_Intron|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Intron	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						ACActctccagaaaaaaaaatt	0.139													4	2	---	---	---	---	
KIAA1632	57724	broad.mit.edu	37	18	43486620	43486621	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43486620_43486621insT	uc002lbm.2	-						KIAA1632_uc010xcq.1_Intron|KIAA1632_uc010xcr.1_Intron|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Intron	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						cactctcgtaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	44750992	44750992	+	IGR	DEL	T	-	-	rs33921091		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44750992delT								IER3IP1 (48247 upstream) : SMAD2 (608475 downstream)																							ACCATTGAACttttttttttt	0.179													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50059083	50059084	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50059083_50059084insT	uc002lfe.1	+							NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCTATAAACTGTTTTTTTTTCT	0.361													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	51668878	51668878	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51668878delA								DCC (611096 upstream) : MBD2 (11697 downstream)																							AAGATTCATTAAAAAAAAAAT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	51962805	51962805	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51962805delT								C18orf54 (54402 upstream) : C18orf26 (292183 downstream)																							TGAATACTTCTTTGTATGTTA	0.328													4	2	---	---	---	---	
WDR7	23335	broad.mit.edu	37	18	54353576	54353576	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54353576delA	uc002lgk.1	+						WDR7_uc010dpk.1_Intron|WDR7_uc002lgl.1_Intron	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		GACTCAAAGGAAAAAAAAATA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	64907670	64907670	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64907670delT								CDH19 (636454 upstream) : DSEL (266149 downstream)																							TTTTGACACCTTTTTTTTTGC	0.318													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	70027979	70027979	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70027979delA								None (None upstream) : CBLN2 (175936 downstream)																							aaatacatacaaaaactgaag	0.000													4	4	---	---	---	---	
MBP	4155	broad.mit.edu	37	18	74732043	74732043	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74732043delG	uc010xfd.1	-						MBP_uc002lml.2_5'Flank|MBP_uc002lmn.2_5'Flank|MBP_uc002lmp.2_5'Flank|MBP_uc010xfe.1_5'Flank|MBP_uc002lmr.2_Intron	NM_001025101	NP_001020272	P02686	MBP_HUMAN	Golli-mbp isoform 1						central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)		AGCGGGGCCTGGGGAGGGAAG	0.592													4	2	---	---	---	---	
PQLC1	80148	broad.mit.edu	37	18	77694208	77694208	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77694208delT	uc002lnl.2	-						PQLC1_uc010dre.2_Intron|PQLC1_uc002lnk.2_Intron|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1							integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		TTCTGAACTATTTTTCTGCAA	0.303													4	2	---	---	---	---	
PARD6G	84552	broad.mit.edu	37	18	77923962	77923962	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77923962delA	uc002lny.2	-						LOC100130522_uc002lnx.2_Intron|LOC100130522_uc010xfn.1_Intron|LOC100130522_uc010xfo.1_Intron	NM_032510	NP_115899	Q9BYG4	PAR6G_HUMAN	PAR-6 gamma protein						cell cycle|cell division|tight junction assembly	cytosol|tight junction	protein binding				0		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		actccatctcaaaaaaaaaaa	0.164													2	4	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7259301	7259302	+	Intron	INS	-	C	C	rs139702207	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7259301_7259302insC	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	tgagccagaatccccagcttca	0.252													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7433816	7433818	+	IGR	DEL	GAG	-	-	rs141018638		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7433816_7433818delGAG								INSR (139805 upstream) : ARHGEF18 (13902 downstream)																							AGAGGACGCAGAGGAGGAGTCAG	0.537													9	8	---	---	---	---	
HNRNPM	4670	broad.mit.edu	37	19	8520106	8520106	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8520106delC	uc010dwe.2	+						HNRNPM_uc010dwc.1_Intron|HNRNPM_uc010xke.1_Intron|HNRNPM_uc010dwd.2_Intron	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						ctcaaatgatccccccttctt	0.065													4	2	---	---	---	---	
ZNF561	93134	broad.mit.edu	37	19	9727575	9727575	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9727575delT	uc002mlu.2	-						ZNF561_uc010dwu.2_Intron|ZNF561_uc010xkr.1_Intron	NM_152289	NP_689502	Q8N587	ZN561_HUMAN	zinc finger protein 561						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						cggccTAGAAtttttttttta	0.005													9	4	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11493966	11493967	+	3'UTR	INS	-	C	C	rs140186158	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11493966_11493967insC	uc002mrn.2	-	19					EPOR_uc002mrh.2_5'Flank|EPOR_uc002mri.2_Intron|EPOR_uc002mrk.1_Intron|EPOR_uc002mrl.1_Intron|EPOR_uc002mrj.1_Intron|EPOR_uc010xlx.1_Intron|EPOR_uc010xly.1_Intron|RGL3_uc002mrm.2_3'UTR			Q3MIN7	RGL3_HUMAN	SubName: Full=FLJ00153 protein; Flags: Fragment;						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						TCGGGAGACAGCCCCCTCCTCT	0.673													6	3	---	---	---	---	
CYP4F8	11283	broad.mit.edu	37	19	15727751	15727751	+	Intron	DEL	G	-	-	rs34865325		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15727751delG	uc002nbi.2	+						CYP4F8_uc010xoi.1_Intron|CYP4F8_uc010xoj.1_Intron	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,						prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						ATGTGCAAAAGGTGCTCCCTG	0.547													1	5	---	---	---	---	
EPS15L1	58513	broad.mit.edu	37	19	16507512	16507513	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16507512_16507513insA	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpe.1_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						TTCTAAGTCAGAAAAAAATAAT	0.089													4	2	---	---	---	---	
MED26	9441	broad.mit.edu	37	19	16728781	16728782	+	Intron	INS	-	C	C			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16728781_16728782insC	uc002nen.1	-						MED26_uc002nee.2_Intron	NM_004831	NP_004822	O95402	MED26_HUMAN	mediator complex subunit 26						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|RNA polymerase II transcription cofactor activity|transcription coactivator activity			ovary(2)	2						CTTACTGAGAGCCCCCCCAGAA	0.545													4	2	---	---	---	---	
JAK3	3718	broad.mit.edu	37	19	17947791	17947794	+	Intron	DEL	ATAA	-	-	rs3212757		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17947791_17947794delATAA	uc002nhn.3	-						JAK3_uc010ebh.2_RNA|JAK3_uc002nho.2_Intron	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3						B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						ATGGAGAGACATAAATAAAGGGTA	0.426		2	Mis		acute megakaryocytic leukemia|								2	4	---	---	---	---	
ARRDC2	27106	broad.mit.edu	37	19	18121628	18121628	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18121628delT	uc002nhv.2	+						ARRDC2_uc002nhu.2_Intron	NM_015683	NP_056498	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 1											pancreas(1)	1						Gttttttttgtttttttgttt	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27870563	27870563	+	IGR	DEL	T	-	-	rs111794544		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27870563delT								None (None upstream) : LOC148189 (410839 downstream)																							ggaaacactctttttgtagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28369536	28369536	+	IGR	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28369536delG								LOC148189 (84688 upstream) : None (None downstream)																							gggagactcaggccaattttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28535127	28535131	+	IGR	DEL	AAAGA	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28535127_28535131delAAAGA								LOC148189 (250279 upstream) : LOC148145 (920909 downstream)																							CAGAATTCACAAAGAAAAGGGAAAA	0.395													2	4	---	---	---	---	
RHPN2	85415	broad.mit.edu	37	19	33546283	33546283	+	Intron	DEL	G	-	-	rs2003950	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33546283delG	uc002nuf.2	-						RHPN2_uc010xro.1_Intron	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					aaaaaaaaaaGCTGTTTTAGA	0.274													4	2	---	---	---	---	
SIRT2	22933	broad.mit.edu	37	19	39372335	39372335	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39372335delT	uc002ojt.1	-						SIRT2_uc010egh.1_Intron|SIRT2_uc010egi.1_Intron|SIRT2_uc002ojs.1_Intron|SIRT2_uc002oju.1_Intron|SIRT2_uc010egj.1_Intron|SIRT2_uc002ojv.1_Intron	NM_012237	NP_036369	Q8IXJ6	SIRT2_HUMAN	sirtuin 2 isoform 1						cell division|chromatin silencing at rDNA|chromatin silencing at telomere|mitosis|negative regulation of striated muscle tissue development|protein ADP-ribosylation|regulation of exit from mitosis|regulation of phosphorylation|response to redox state	chromatin silencing complex|cytoplasm|microtubule	histone acetyltransferase binding|histone deacetylase binding|NAD+ binding|NAD-dependent histone deacetylase activity|transcription factor binding|tubulin deacetylase activity|ubiquitin binding|zinc ion binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			tttttctttcttttttttttt	0.199													6	3	---	---	---	---	
PAK4	10298	broad.mit.edu	37	19	39668116	39668116	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39668116delG	uc002okj.1	+						PAK4_uc002okl.1_Intron|PAK4_uc002okn.1_Intron|PAK4_uc002okm.1_Intron|PAK4_uc002oko.1_Intron|PAK4_uc002okp.1_Intron	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GGTGGGTGCTGGGGGGGCAGC	0.642													4	2	---	---	---	---	
DLL3	10683	broad.mit.edu	37	19	39991639	39991640	+	Intron	INS	-	T	T			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39991639_39991640insT	uc002olx.2	+						DLL3_uc010egq.2_Intron|DLL3_uc002olw.2_Intron	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TTTATGTGAAGttttttttttt	0.223													4	2	---	---	---	---	
CEACAM16	388551	broad.mit.edu	37	19	45207029	45207029	+	Intron	DEL	T	-	-	rs66470244		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45207029delT	uc010xxd.1	+						CEACAM16_uc002ozq.2_Intron	NM_001039213	NP_001034302	A7LI12	A7LI12_HUMAN	carcinoembryonic antigen-related cell adhesion											ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				TCAATCCTTCttttttttaaa	0.478													7	4	---	---	---	---	
DHX34	9704	broad.mit.edu	37	19	47879024	47879024	+	Intron	DEL	G	-	-	rs11452607		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47879024delG	uc010xyn.1	+						DHX34_uc010xyo.1_5'Flank	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34							intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GGCCTCTCCTGGGGGGGTCCC	0.677													4	6	---	---	---	---	
ZNF331	55422	broad.mit.edu	37	19	54052857	54052857	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54052857delG	uc002qbx.1	+						ZNF331_uc002qby.1_Intron|ZNF331_uc002qbz.1_Intron|ZNF331_uc002qca.1_Intron|ZNF331_uc010eqr.1_Intron|ZNF331_uc002qcb.1_Intron	NM_018555	NP_061025	Q9NQX6	ZN331_HUMAN	zinc finger protein 331						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)		actggaatttgggacctgaga	0.025			T	?	follicular thyroid adenoma								4	2	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54400980	54400980	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54400980delA	uc002qcq.1	+						PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		taagctatctaaaAAAAAAAA	0.169													4	2	---	---	---	---	
AURKC	6795	broad.mit.edu	37	19	57742240	57742240	+	5'Flank	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57742240delT	uc002qoe.2	+						AURKC_uc002qoc.2_5'Flank|AURKC_uc002qod.2_5'Flank|AURKC_uc010etv.2_5'Flank	NM_001015878	NP_001015878	Q9UQB9	AURKC_HUMAN	aurora kinase C isoform 1						cell cycle|cytokinesis	condensed chromosome|cytoplasm|midbody|spindle midzone	ATP binding|protein serine/threonine kinase activity			lung(4)|ovary(2)	6		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		TGGCCCTCGCTTTCAGTGCCC	0.637													4	2	---	---	---	---	
SNPH	9751	broad.mit.edu	37	20	1244711	1244711	+	5'Flank	DEL	A	-	-	rs112846522		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1244711delA	uc002wes.2	+						SNPH_uc002wet.2_5'Flank	NM_014723	NP_055538	O15079	SNPH_HUMAN	syntaphilin						synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding			ovary(2)	2						AGTACCAAGCAAAAAAAAAAA	0.358													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	5613325	5613326	+	IGR	INS	-	AG	AG			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5613325_5613326insAG								GPCPD1 (21653 upstream) : C20orf196 (117717 downstream)																							TAGAGGGAAGCAGAGAGAGAAC	0.436													4	2	---	---	---	---	
FERMT1	55612	broad.mit.edu	37	20	6089992	6089993	+	Intron	INS	-	G	G			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6089992_6089993insG	uc002wmr.2	-						FERMT1_uc010gbt.2_Intron|FERMT1_uc002wms.2_Intron|FERMT1_uc002wmt.2_5'Flank	NM_017671	NP_060141	Q9BQL6	FERM1_HUMAN	kindlin-1						cell adhesion|establishment of epithelial cell polarity|keratinocyte migration|keratinocyte proliferation	cytosol|focal adhesion|ruffle membrane	binding			ovary(1)|pancreas(1)|skin(1)	3						CAGTTGGTAAAGGGGAATGGTC	0.559													4	2	---	---	---	---	
C20orf94	128710	broad.mit.edu	37	20	10504573	10504573	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10504573delA	uc010zre.1	+							NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710								protein binding				0						TATCATTTTTAAAAAATGAAT	0.393													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15829011	15829012	+	Intron	INS	-	G	G	rs59314578		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15829011_15829012insG	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AGCCAGGGGGAGGGGGGGGTCA	0.450													4	2	---	---	---	---	
C20orf26	26074	broad.mit.edu	37	20	20197440	20197440	+	Intron	DEL	T	-	-	rs113092632		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20197440delT	uc002wru.2	+						C20orf26_uc010zse.1_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		TCTATACCAATTTTTTTTTTT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23446888	23446888	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23446888delA								CST11 (13406 upstream) : CST8 (24878 downstream)																							catcaaaaagaaaaaaAACTC	0.010													4	2	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25829628	25829629	+	Intron	INS	-	AA	AA	rs141949476	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25829628_25829629insAA	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						ctgcaattgacagaggtagtgg	0.000													4	2	---	---	---	---	
C20orf191	149934	broad.mit.edu	37	20	26084964	26084968	+	Intron	DEL	CTACC	-	-	rs111717973		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26084964_26084968delCTACC	uc002wvj.3	-							NR_003678				SubName: Full=Putative uncharacterized protein ENSP00000323172;												0						CCAAAATCCACTACCCTCCAACACA	0.380													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26129265	26129266	+	IGR	DEL	GA	-	-	rs139001833		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26129265_26129266delGA								C20orf191 (34588 upstream) : MIR663 (59556 downstream)																							TTTTAATATTGAGTTAGGTTTT	0.262													3	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29636482	29636482	+	Intron	DEL	T	-	-	rs62891160		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29636482delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						CTTTGCAATATATTTTCCTCC	0.114													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46839998	46839999	+	IGR	INS	-	A	A	rs142774759	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46839998_46839999insA								SULF2 (424638 upstream) : LOC284749 (148655 downstream)																							gggaatccctgagctgagctgc	0.000													2	4	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51759453	51759453	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51759453delT	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			AAATAGCGTGTTTTTTGCTTA	0.408													4	2	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51986521	51986521	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51986521delT	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			ttccttgaaattttttttaat	0.144													4	2	---	---	---	---	
ZNF217	7764	broad.mit.edu	37	20	52213462	52213462	+	5'Flank	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52213462delA	uc010gij.1	-							NM_006526	NP_006517	O75362	ZN217_HUMAN	zinc finger protein 217						negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			ACAATCATCCAAACAGGCCCT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9832470	9832471	+	IGR	INS	-	G	G	rs77696304		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9832470_9832471insG								None (None upstream) : None (None downstream)																							AATTTTTTTTTTTTTAGTAACA	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9852426	9852426	+	IGR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9852426delT								None (None upstream) : None (None downstream)																							GGGATGTGCATTCTGAAAAAT	0.303													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10418627	10418629	+	IGR	DEL	TTT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10418627_10418629delTTT								None (None upstream) : TPTE (488114 downstream)																							GAGCTTAATGTTTATGTGATATT	0.246													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10426013	10426013	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10426013delA								None (None upstream) : TPTE (480730 downstream)																							caaaatggggaaaaaaaaatc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14343231	14343232	+	IGR	INS	-	AG	AG	rs111660103		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14343231_14343232insAG								None (None upstream) : C21orf99 (67255 downstream)																							attctgcaaaaagtgtttcaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18423183	18423183	+	IGR	DEL	G	-	-	rs66634455		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18423183delG								C21orf34 (441089 upstream) : CXADR (462147 downstream)																							ATGTATTAATGGGGCTTTGTG	0.378													4	2	---	---	---	---	
GRIK1	2897	broad.mit.edu	37	21	31044983	31044984	+	Intron	DEL	AG	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31044983_31044984delAG	uc002yno.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Intron	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	AAGAGACATAAGAGAGAGAGAG	0.426													7	4	---	---	---	---	
C21orf45	54069	broad.mit.edu	37	21	33641107	33641107	+	3'UTR	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641107delT	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						CAATTTTGGGttttttttttg	0.139													4	3	---	---	---	---	
C21orf59	56683	broad.mit.edu	37	21	33954884	33954885	+	Intron	INS	-	TTCT	TTCT	rs71971113		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33954884_33954885insTTCT	uc002ypy.1	-						TCP10L_uc002ypw.3_Intron|C21orf59_uc002ypx.1_Intron|C21orf59_uc002ypz.1_Intron	NM_021254	NP_067077	P57076	CU059_HUMAN	hypothetical protein LOC56683							cytosol|nucleus					0						CTTtttctttcttctttctttc	0.193													4	2	---	---	---	---	
CLIC6	54102	broad.mit.edu	37	21	36060367	36060367	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36060367delA	uc010gmt.1	+						CLIC6_uc002yuf.1_Intron	NM_053277	NP_444507	Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6							chloride channel complex|cytoplasm|plasma membrane	voltage-gated chloride channel activity			ovary(1)|central_nervous_system(1)	2						ATTTATTTACAAAAAAAAATT	0.373													4	2	---	---	---	---	
RUNX1	861	broad.mit.edu	37	21	36654399	36654399	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36654399delC	uc002yut.1	-									Q01196	RUNX1_HUMAN	Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						gaaactgacacCCAGGGCTTT	0.244			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				4	2	---	---	---	---	
B3GALT5	10317	broad.mit.edu	37	21	41008301	41008301	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41008301delG	uc002yyb.1	+						B3GALT5_uc002yyf.1_Intron|B3GALT5_uc002yye.2_Intron|B3GALT5_uc002yyg.1_Intron|B3GALT5_uc010gol.1_Intron	NM_033173	NP_149363	Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta						protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1		Prostate(19;2.55e-06)				ctgtgaggaaggagctgagca	0.154													4	2	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41388021	41388021	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41388021delG	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TCTAGAGAATGGGCTGGTGGT	0.199													4	2	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45824752	45824753	+	Intron	INS	-	TGA	TGA			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45824752_45824753insTGA	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gacagtgactgtgatgatagtg	0.114													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21980989	21980990	+	IGR	DEL	AG	-	-	rs67654491		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21980989_21980990delAG								UBE2L3 (2666 upstream) : YDJC (1388 downstream)																							TCCTCCTCTCAGAACACTTCCA	0.584													4	5	---	---	---	---	
DDT	1652	broad.mit.edu	37	22	24245106	24245106	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24245106delC	uc011ajf.1	-							NM_001355	NP_001346	P30046	DOPD_HUMAN	D-dopachrome tautomerase						melanin biosynthetic process	cytoplasm	D-dopachrome decarboxylase activity|dopachrome isomerase activity|protein binding				0						GCTGTGTGCTCCCTGCCTTCT	0.542													4	2	---	---	---	---	
UPB1	51733	broad.mit.edu	37	22	24929298	24929298	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24929298delC	uc011ajt.1	+							NM_016327	NP_057411	Q9UBR1	BUP1_HUMAN	beta-ureidopropionase						pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	beta-ureidopropionase activity|metal ion binding			ovary(2)	2	Colorectal(2;0.0339)					ctcgttctctccacagaatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27420025	27420025	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27420025delA								MIAT (305076 upstream) : MN1 (724241 downstream)																							CTTACTTATCAAAATAAGTGT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34767045	34767046	+	IGR	INS	-	T	T	rs137881755	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34767045_34767046insT								LARGE (448461 upstream) : ISX (695083 downstream)																							ATGTCCTTCTGTTTTATCTCAA	0.431													2	5	---	---	---	---	
TMPRSS6	164656	broad.mit.edu	37	22	37481043	37481043	+	Intron	DEL	G	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37481043delG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron|TMPRSS6_uc003aqu.2_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						tgtaaaatgaggacagtaata	0.065													7	4	---	---	---	---	
EIF3L	51386	broad.mit.edu	37	22	38272141	38272141	+	Intron	DEL	T	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38272141delT	uc003auf.2	+						EIF3L_uc003aue.1_Intron|EIF3L_uc011ann.1_Intron|EIF3L_uc003aug.2_Intron|EIF3L_uc003auh.2_Intron	NM_016091	NP_057175	Q9Y262	EIF3L_HUMAN	eukaryotic translation initiation factor 3							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1						AGTTCAAGACTGTAGAGCGCT	0.303													2	8	---	---	---	---	
MKL1	57591	broad.mit.edu	37	22	41011052	41011052	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41011052delA	uc003ayw.1	-						MKL1_uc010gye.1_Intron|MKL1_uc010gyf.1_Intron|MKL1_uc003ayy.1_Intron	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein						positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						cacgtgctagaaaaaaaaaaa	0.000			T	RBM15	acute megakaryocytic leukemia								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	43426872	43426873	+	IGR	INS	-	T	T	rs150187451	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43426872_43426873insT								PACSIN2 (15721 upstream) : TTLL1 (8651 downstream)																							TAAATCATCCCTCTTAAGACTA	0.485													1	8	---	---	---	---	
CELSR1	9620	broad.mit.edu	37	22	46789872	46789872	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46789872delC	uc003bhw.1	-						CELSR1_uc011arc.1_Intron	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGCAAGGAAACCAAAAACCAC	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48767803	48767804	+	IGR	INS	-	T	T	rs150245686	by1000genomes	TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48767803_48767804insT								None (None upstream) : FAM19A5 (117484 downstream)																							CCATCTTTAAGTTTTTTTCCAA	0.426													4	5	---	---	---	---	
C22orf34	348645	broad.mit.edu	37	22	49816105	49816105	+	Intron	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49816105delA	uc003biq.2	-											Homo sapiens cDNA FLJ42972 fis, clone BRSTN2019129.												0						GATCTGAAACAAAAAAAAATC	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2544391	2544392	+	Intron	DEL	TC	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2544391_2544392delTC	uc004cqi.1	+						uc004cqj.1_Intron|uc004cqk.1_Intron					Homo sapiens cDNA FLJ13471 fis, clone PLACE1003566.																		TTACTTTGTTtctctctctctc	0.376													8	4	---	---	---	---	
GPR173	54328	broad.mit.edu	37	X	53107201	53107202	+	3'UTR	DEL	TC	-	-	rs12847453		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53107201_53107202delTC	uc004dru.2	+	2						NM_018969	NP_061842	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173							integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						tctctctctgtctctctctctc	0.351													4	2	---	---	---	---	
MAP7D3	79649	broad.mit.edu	37	X	135315964	135315965	+	Intron	DEL	TT	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135315964_135315965delTT	uc004ezt.2	-						MAP7D3_uc004ezs.2_Intron|MAP7D3_uc011mwc.1_Intron|MAP7D3_uc010nsa.1_Intron	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3							cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					AGTCCCTCACTTTTAGTGGAGA	0.317													4	2	---	---	---	---	
MCF2	4168	broad.mit.edu	37	X	138701686	138701686	+	Intron	DEL	C	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138701686delC	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					ACTACCTACTCCCGCCAAAAC	0.174													32	38	---	---	---	---	
PASD1	139135	broad.mit.edu	37	X	150791277	150791278	+	Intron	INS	-	A	A			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150791277_150791278insA	uc004fev.3	+							NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1							nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AAGAAGACAGGAAAAATCCCAT	0.381													12	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9945244	9945244	+	IGR	DEL	A	-	-			TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9945244delA								TTTY22 (294390 upstream) : None (None downstream)																							agattgaaataaaaagaataa	0.000													12	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10019375	10019376	+	IGR	INS	-	CT	CT	rs33969087		TCGA-CJ-5678-01A-11D-1534-10	TCGA-CJ-5678-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10019375_10019376insCT								TTTY22 (368521 upstream) : None (None downstream)																							tgaacacccccgtcagaagttt	0.015													6	4	---	---	---	---	
