Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
VPS13D	55187	broad.mit.edu	37	1	12463994	12463994	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12463994T>C	uc001atv.2	+	63	12139	c.11998T>C	c.(11998-12000)TTC>CTC	p.F4000L	VPS13D_uc001atw.2_Missense_Mutation_p.F3975L|VPS13D_uc001atx.2_Missense_Mutation_p.F3187L|VPS13D_uc009vnl.2_RNA	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3999					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCTAAGTGTGTTCACCTCCAA	0.378													6	294	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70505476	70505476	+	Silent	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70505476G>A	uc001dep.2	+	19	3885	c.3855G>A	c.(3853-3855)AGG>AGA	p.R1285R	LRRC7_uc009wbg.2_Silent_p.R569R|LRRC7_uc001deq.2_Silent_p.R526R	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1285						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						GGTTAGACAGGGTATGTCTGG	0.448													3	29	---	---	---	---	PASS
ARHGAP29	9411	broad.mit.edu	37	1	94655748	94655748	+	Intron	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94655748T>C	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dqk.2_5'UTR	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CAGTGAAGCATACAACACTGA	0.343													7	25	---	---	---	---	PASS
HCN3	57657	broad.mit.edu	37	1	155254427	155254427	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155254427C>T	uc001fjz.1	+	4	976	c.968C>T	c.(967-969)CCC>CTC	p.P323L	RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_Intron	NM_020897	NP_065948	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic	323	Extracellular (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)|breast(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTAGGCATGCCCGACGTCTGG	0.597													11	15	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161512834	161512834	+	Missense_Mutation	SNP	A	G	G	rs1042208	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161512834A>G	uc001gat.3	-	6	870	c.733T>C	c.(733-735)TTT>CTT	p.F245L	FCGR3A_uc001gar.2_Missense_Mutation_p.F281L|FCGR3A_uc001gas.2_Missense_Mutation_p.F280L|FCGR3A_uc009wuh.2_Missense_Mutation_p.F244L|FCGR3A_uc009wui.2_Missense_Mutation_p.F245L	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	245	Cytoplasmic (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CTCCATTTAAATTTATGGTCC	0.443													10	319	---	---	---	---	PASS
TADA1	117143	broad.mit.edu	37	1	166845479	166845479	+	Translation_Start_Site	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166845479G>A	uc001gdw.2	-	1	176	c.-8C>T	c.(-10--6)CACGC>CATGC		TADA1_uc009wve.2_Translation_Start_Site	NM_053053	NP_444281	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1-like						histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(1)	1						ATTGCTCCGCGTGTCTCAGCC	0.627													14	23	---	---	---	---	PASS
SCYL3	57147	broad.mit.edu	37	1	169833584	169833584	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169833584A>G	uc001ggs.2	-	9	1079	c.881T>C	c.(880-882)CTG>CCG	p.L294P	SCYL3_uc010plw.1_5'UTR|SCYL3_uc001ggt.2_Missense_Mutation_p.L294P|SCYL3_uc001ggu.2_RNA	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2	294	HEAT 2.				cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)|skin(1)	2	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTGATTAAGCAGAAGAGGCAC	0.448													25	57	---	---	---	---	PASS
ZBTB37	84614	broad.mit.edu	37	1	173854993	173854993	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173854993C>A	uc009wwp.1	+	5	1519	c.1243C>A	c.(1243-1245)CAG>AAG	p.Q415K	ZBTB37_uc001gjp.1_3'UTR|ZBTB37_uc001gjr.2_Missense_Mutation_p.Q415K	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	415	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCGGAAAGATCAGCTGGAGTA	0.517													38	67	---	---	---	---	PASS
PM20D1	148811	broad.mit.edu	37	1	205819199	205819199	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205819199A>T	uc001hdj.2	-	1	47	c.2T>A	c.(1-3)ATG>AAG	p.M1K	PM20D1_uc009xbr.2_RNA	NM_152491	NP_689704	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1 precursor	1						extracellular region	metal ion binding|peptidase activity			skin(1)	1	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			CCGCTGAGCCATGCTTCTCTC	0.587													7	20	---	---	---	---	PASS
PPP2R5A	5525	broad.mit.edu	37	1	212532043	212532043	+	Silent	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212532043G>A	uc001hjb.2	+	12	1816	c.1242G>A	c.(1240-1242)CTG>CTA	p.L414L	PPP2R5A_uc010ptd.1_Silent_p.L355L	NM_006243	NP_006234	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B	414					negative regulation of establishment of protein localization in plasma membrane|negative regulation of lipid kinase activity|positive regulation of protein dephosphorylation|signal transduction	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex	kinase binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		TTGTAGCACTGGTATACAATG	0.378													4	151	---	---	---	---	PASS
KCTD3	51133	broad.mit.edu	37	1	215775516	215775516	+	Silent	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215775516C>T	uc001hks.2	+	12	1405	c.1111C>T	c.(1111-1113)CTG>TTG	p.L371L	KCTD3_uc001hkt.2_Silent_p.L371L|KCTD3_uc010pub.1_Silent_p.L269L|KCTD3_uc009xdn.2_Silent_p.L123L	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN	potassium channel tetramerisation domain	371						voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(3)	3				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TATTACTGCTCTGAGTGTTTA	0.323													4	263	---	---	---	---	PASS
CABC1	56997	broad.mit.edu	37	1	227171879	227171879	+	Silent	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227171879G>A	uc001hqm.1	+	16	4760	c.1341G>A	c.(1339-1341)CTG>CTA	p.L447L	CABC1_uc001hqn.1_Silent_p.L447L|CABC1_uc009xeq.1_Silent_p.L395L|CABC1_uc010pvq.1_Silent_p.L168L|CABC1_uc010pvr.1_Silent_p.L121L|CABC1_uc001hqo.1_Silent_p.L168L|CABC1_uc009xer.1_5'UTR	NM_020247	NP_064632	Q8NI60	ADCK3_HUMAN	chaperone, ABC1 activity of bc1 complex like	447	Protein kinase.				cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)				CCACAGAGCTGGTGTCTGGCT	0.627													8	20	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227192738	227192738	+	Silent	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227192738A>G	uc001hqr.2	-	34	5770	c.4827T>C	c.(4825-4827)CCT>CCC	p.P1609P	CDC42BPA_uc001hqq.2_Silent_p.P908P|CDC42BPA_uc001hqs.2_Silent_p.P1528P|CDC42BPA_uc009xes.2_Silent_p.P1581P|CDC42BPA_uc010pvs.1_Silent_p.P1589P|CDC42BPA_uc001hqp.2_Silent_p.P827P|CDC42BPA_uc001hqt.2_Silent_p.P487P	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	1622					actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				GGCCTGGCTCAGGGCGGGATT	0.557													33	82	---	---	---	---	PASS
ZNF678	339500	broad.mit.edu	37	1	227751268	227751268	+	5'UTR	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227751268G>T	uc001hqw.1	+	1					ZNF678_uc009xet.1_RNA|ZNF678_uc009xeu.1_RNA	NM_178549	NP_848644	F5GXA7	F5GXA7_HUMAN	zinc finger protein 678						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			pancreas(1)	1		Prostate(94;0.0885)				TTTGTCTTGTGCTCCAGCTGG	0.597											OREG0031717	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)	4	11	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236761225	236761225	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236761225G>A	uc001hyd.1	-	5	681	c.556C>T	c.(556-558)CTT>TTT	p.L186F		NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	186					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ATGAATCCAAGATCTTTGTAG	0.368													14	481	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237955606	237955606	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237955606G>A	uc001hyl.1	+	94	13885	c.13765G>A	c.(13765-13767)GGA>AGA	p.G4589R	RYR2_uc010pyb.1_Missense_Mutation_p.G22R	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4589	Helical; Name=M6; (Potential).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGCATCATTGGATACTACTG	0.333													3	33	---	---	---	---	PASS
SLC30A3	7781	broad.mit.edu	37	2	27480972	27480972	+	Intron	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27480972C>T	uc002rjk.2	-						SLC30A3_uc002rjj.2_5'UTR|SLC30A3_uc010ylh.1_Intron	NM_003459	NP_003450	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter),						regulation of sequestering of zinc ion	cell junction|integral to plasma membrane|late endosome|membrane fraction|synaptic vesicle membrane	zinc transporting ATPase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTTGGGACCCTGACGGGTG	0.637													6	10	---	---	---	---	PASS
PROM2	150696	broad.mit.edu	37	2	95947697	95947697	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95947697C>A	uc002suh.1	+	13	1709	c.1576C>A	c.(1576-1578)CCC>ACC	p.P526T	PROM2_uc002sui.2_Missense_Mutation_p.P526T|PROM2_uc002suj.2_Missense_Mutation_p.P180T|PROM2_uc002suk.2_Missense_Mutation_p.P526T|PROM2_uc002sul.2_Missense_Mutation_p.P52T|PROM2_uc002sum.2_RNA	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	526	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						AGGGAACCTGCCCCCGTCCAT	0.637													9	35	---	---	---	---	PASS
COBLL1	22837	broad.mit.edu	37	2	165551694	165551694	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165551694T>C	uc010zcw.1	-	15	2647	c.2523A>G	c.(2521-2523)ATA>ATG	p.I841M	COBLL1_uc002ucp.2_Missense_Mutation_p.I774M|COBLL1_uc002ucq.2_Missense_Mutation_p.I736M|COBLL1_uc010zcx.1_Missense_Mutation_p.I782M|COBLL1_uc002ucn.2_Missense_Mutation_p.I202M|COBLL1_uc002uco.2_Missense_Mutation_p.I505M	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1	812										ovary(2)|pancreas(1)	3						TGGGAGGCACTATTTTATAAG	0.378													173	388	---	---	---	---	PASS
NOSTRIN	115677	broad.mit.edu	37	2	169707624	169707624	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169707624C>A	uc002ueg.2	+	9	665	c.661C>A	c.(661-663)CAA>AAA	p.Q221K	NOSTRIN_uc002uef.2_Missense_Mutation_p.Q278K|NOSTRIN_uc002uei.2_Missense_Mutation_p.Q104K|NOSTRIN_uc010fpu.2_Missense_Mutation_p.Q193K|NOSTRIN_uc002ueh.2_Missense_Mutation_p.Q143K|NOSTRIN_uc002uej.2_Missense_Mutation_p.Q104K	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2	221	Potential.				endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						GGAAAGAATTCAACTTTTATG	0.388													112	198	---	---	---	---	PASS
SLC25A12	8604	broad.mit.edu	37	2	172725235	172725235	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172725235C>A	uc002uhh.2	-	3	254	c.165G>T	c.(163-165)AAG>AAT	p.K55N	SLC25A12_uc010fqh.2_5'UTR|SLC25A12_uc010zdv.1_RNA	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12	55					gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	GCTGCACGATCTTTGGGTTAC	0.398													71	156	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179468956	179468956	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179468956C>T	uc010zfg.1	-	231	46978	c.46754G>A	c.(46753-46755)TGC>TAC	p.C15585Y	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.C9280Y|TTN_uc010zfi.1_Missense_Mutation_p.C9213Y|TTN_uc010zfj.1_Missense_Mutation_p.C9088Y	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16512							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCTGATTTGCACTCATCACT	0.408													38	123	---	---	---	---	PASS
CPO	130749	broad.mit.edu	37	2	207804342	207804342	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207804342A>G	uc002vby.2	+	1	65	c.19A>G	c.(19-21)ACC>GCC	p.T7A		NM_173077	NP_775100	Q8IVL8	CBPO_HUMAN	carboxypeptidase O precursor	7					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		TCTGCTTGAAACCCTTTATCT	0.428													10	606	---	---	---	---	PASS
AGFG1	3267	broad.mit.edu	37	2	228419271	228419271	+	3'UTR	SNP	T	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228419271T>A	uc002vpc.2	+	13					AGFG1_uc002vpd.2_3'UTR|AGFG1_uc002vpe.2_3'UTR|AGFG1_uc002vpf.2_3'UTR	NM_004504	NP_004495	P52594	AGFG1_HUMAN	HIV-1 Rev binding protein isoform 2						cell differentiation|mRNA export from nucleus|multicellular organismal development|regulation of ARF GTPase activity|spermatogenesis	cytoplasmic membrane-bounded vesicle|Golgi apparatus|nuclear pore	ARF GTPase activator activity|DNA binding|protein binding|RNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4						TCTCTCCACCTCTTGCACTGT	0.358													69	179	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230724156	230724156	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230724156G>A	uc002vpw.1	-	3	342	c.233C>T	c.(232-234)CCA>CTA	p.P78L	TRIP12_uc002vpx.1_Missense_Mutation_p.P120L|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_RNA|TRIP12_uc010fxh.1_Missense_Mutation_p.P78L	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	78					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GTTGTAGTCTGGACTAGCACT	0.448													5	359	---	---	---	---	PASS
ABHD5	51099	broad.mit.edu	37	3	43753329	43753329	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43753329C>T	uc003cmx.2	+	4	745	c.635C>T	c.(634-636)GCT>GTT	p.A212V		NM_016006	NP_057090	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	212					cell differentiation|fatty acid metabolic process|negative regulation of sequestering of triglyceride|phosphatidic acid biosynthetic process|positive regulation of triglyceride catabolic process|triglyceride catabolic process	cytosol|lipid particle	1-acylglycerol-3-phosphate O-acyltransferase activity|lysophosphatidic acid acyltransferase activity			ovary(1)	1		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)		AACCCTTTAGCTGGCCTAAGG	0.448													4	176	---	---	---	---	PASS
ZNF445	353274	broad.mit.edu	37	3	44488518	44488518	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44488518C>A	uc003cnf.2	-	8	2993	c.2645G>T	c.(2644-2646)CGC>CTC	p.R882L	ZNF445_uc011azv.1_Missense_Mutation_p.R870L|ZNF445_uc011azw.1_Missense_Mutation_p.R882L	NM_181489	NP_852466	P59923	ZN445_HUMAN	zinc finger protein 445	882	C2H2-type 11.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		GTTAACAAGGCGATAGTTTCT	0.408													4	136	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47125791	47125791	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47125791A>G	uc003cqs.2	-	12	5532	c.5479T>C	c.(5479-5481)TGG>CGG	p.W1827R	SETD2_uc003cqv.2_Missense_Mutation_p.W1894R|SETD2_uc003cqt.1_RNA	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1827					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GTCTGAGACCAGCGTTGAATA	0.403			N|F|S|Mis		clear cell renal carcinoma								48	79	---	---	---	---	PASS
GABRR3	200959	broad.mit.edu	37	3	97726651	97726651	+	Silent	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97726651T>C	uc011bgr.1	-	6	711	c.711A>G	c.(709-711)GAA>GAG	p.E237E		NM_001105580	NP_001099050	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 3	237	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity				0						CACTGAAGTCTTCAATGAAGA	0.388													7	305	---	---	---	---	PASS
MBD4	8930	broad.mit.edu	37	3	129152727	129152727	+	Silent	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129152727A>G	uc003emh.1	-	5	1553	c.1377T>C	c.(1375-1377)CTT>CTC	p.L459L	MBD4_uc003emi.1_Silent_p.L459L|MBD4_uc003emj.1_Silent_p.L453L|MBD4_uc003emk.1_Silent_p.L141L|MBD4_uc011bkw.1_Silent_p.L459L	NM_003925	NP_003916	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	459					depyrimidination	nucleoplasm	DNA N-glycosylase activity|endodeoxyribonuclease activity|protein binding|satellite DNA binding			ovary(1)|lung(1)	2						TAGCGATGAGAAGCTTCCATG	0.348								BER_DNA_glycosylases					98	96	---	---	---	---	PASS
CRIPAK	285464	broad.mit.edu	37	4	1388536	1388536	+	Silent	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1388536G>A	uc003gdf.2	+	1	3197	c.237G>A	c.(235-237)GTG>GTA	p.V79V		NM_175918	NP_787114	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	79					ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CTGCTCATGTGCCCATGTGGA	0.637													4	17	---	---	---	---	PASS
RBPJ	3516	broad.mit.edu	37	4	26430436	26430436	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26430436A>G	uc003grx.1	+	9	1117	c.881A>G	c.(880-882)GAA>GGA	p.E294G	RBPJ_uc003gry.1_Missense_Mutation_p.E279G|RBPJ_uc003grz.1_Missense_Mutation_p.E294G|RBPJ_uc011bxt.1_Missense_Mutation_p.E294G|RBPJ_uc003gsa.1_Missense_Mutation_p.E280G|RBPJ_uc003gsb.1_Missense_Mutation_p.E281G|RBPJ_uc003gsc.1_Missense_Mutation_p.E280G	NM_005349	NP_005340	Q06330	SUH_HUMAN	recombining binding protein suppressor of	294					DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)	3		Breast(46;0.0503)				AAGGATACAGAAAGAATGTAT	0.323													85	206	---	---	---	---	PASS
LIAS	11019	broad.mit.edu	37	4	39469186	39469186	+	Silent	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39469186T>C	uc003guf.2	+	7	730	c.657T>C	c.(655-657)GAT>GAC	p.D219D	LIAS_uc003gug.2_Silent_p.D219D|LIAS_uc003guh.2_Intron	NM_006859	NP_006850	O43766	LIAS_HUMAN	lipoic acid synthetase isoform 1 precursor	219					inflammatory response|response to lipopolysaccharide|response to oxidative stress	mitochondrion	4 iron, 4 sulfur cluster binding|lipoate synthase activity|metal ion binding				0					Lipoic Acid(DB00166)	TTCGAGGTGATCTCAAAGCAA	0.388													7	441	---	---	---	---	PASS
GRXCR1	389207	broad.mit.edu	37	4	43022413	43022413	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43022413C>A	uc003gwt.2	+	3	670	c.670C>A	c.(670-672)CAA>AAA	p.Q224K		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	224	Glutaredoxin.				cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1						AGGAGAACTGCAAGACATCCT	0.303													12	329	---	---	---	---	PASS
LIN54	132660	broad.mit.edu	37	4	83857207	83857207	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83857207G>T	uc003hnx.3	-	11	2150	c.1772C>A	c.(1771-1773)TCT>TAT	p.S591Y	LIN54_uc003hnz.3_Missense_Mutation_p.S370Y|LIN54_uc003hny.3_Missense_Mutation_p.S190Y|LIN54_uc010ijt.2_Missense_Mutation_p.S502Y|LIN54_uc010iju.2_Missense_Mutation_p.S190Y|LIN54_uc010ijv.2_Missense_Mutation_p.S370Y	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a	591					cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)				ACGTCGATCAGATTCTCCCTC	0.403													124	289	---	---	---	---	PASS
PDE5A	8654	broad.mit.edu	37	4	120446851	120446851	+	Splice_Site	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120446851C>A	uc003idh.2	-	12	1788	c.1633_splice	c.e12-1	p.A545_splice	uc003ide.3_Intron|PDE5A_uc003idf.2_Splice_Site_p.A503_splice|PDE5A_uc003idg.2_Splice_Site_p.A493_splice|uc003idi.3_Intron	NM_001083	NP_001074	O76074	PDE5A_HUMAN	phosphodiesterase 5A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)	CCACAGCAGCCTTGGGTAAGG	0.408													40	86	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123274224	123274224	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123274224A>T	uc003ieh.2	+	79	14060	c.14015A>T	c.(14014-14016)AAT>ATT	p.N4672I	KIAA1109_uc003iem.2_Missense_Mutation_p.N1028I	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	4672					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						CATGGTCCAAATTTTCGTTCA	0.368													113	243	---	---	---	---	PASS
CCRN4L	25819	broad.mit.edu	37	4	139966177	139966177	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139966177T>C	uc003ihl.2	+	3	1038	c.845T>C	c.(844-846)ATC>ACC	p.I282T		NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like	282					rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					CAGTTCTGCATCGCTGTTACC	0.532													11	28	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151223890	151223890	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151223890C>A	uc010ipj.2	-	54	8411	c.7937G>T	c.(7936-7938)CGT>CTT	p.R2646L	LRBA_uc010ipi.2_Missense_Mutation_p.R168L|LRBA_uc003ils.3_Missense_Mutation_p.R541L|LRBA_uc003ilt.3_Missense_Mutation_p.R1294L|LRBA_uc003ilu.3_Missense_Mutation_p.R2635L|LRBA_uc003ilr.3_Missense_Mutation_p.R66L	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	2646	WD 3.					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					TGACTCAGAACGAGCAAGGCA	0.393													6	336	---	---	---	---	PASS
MAP9	79884	broad.mit.edu	37	4	156268906	156268906	+	3'UTR	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156268906A>G	uc003ios.2	-	14					MAP9_uc011cin.1_3'UTR	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein						cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		AAACCGATAAATAACCAAATA	0.348													80	167	---	---	---	---	PASS
ACSL1	2180	broad.mit.edu	37	4	185724580	185724580	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185724580A>G	uc003iww.2	-	2	383	c.89T>C	c.(88-90)CTT>CCT	p.L30P	ACSL1_uc011ckm.1_5'UTR|ACSL1_uc003iwt.1_Missense_Mutation_p.L30P|ACSL1_uc003iwu.1_Missense_Mutation_p.L30P|ACSL1_uc011ckn.1_Missense_Mutation_p.L30P|ACSL1_uc003iwv.1_Missense_Mutation_p.L30P	NM_001995	NP_001986	P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	30	Helical; Signal-anchor for type III membrane protein; (Potential).				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GAAGCCCATAAGCGTGTTGGT	0.552													5	96	---	---	---	---	PASS
SORBS2	8470	broad.mit.edu	37	4	186545257	186545257	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186545257G>C	uc003iyl.2	-	13	2172	c.1314C>G	c.(1312-1314)ATC>ATG	p.I438M	SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Missense_Mutation_p.I538M|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.I342M|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.I552M|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2	438						actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		ACCTGTGTCTGATCCTTGATC	0.592													13	33	---	---	---	---	PASS
FASTKD3	79072	broad.mit.edu	37	5	7867283	7867283	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7867283A>G	uc003jeb.2	-	2	1051	c.914T>C	c.(913-915)GTT>GCT	p.V305A	FASTKD3_uc011cmp.1_Missense_Mutation_p.V7A|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	305					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|breast(1)|pancreas(1)	4						TTGATCAAGAACCACCAGGGC	0.388													7	196	---	---	---	---	PASS
LMBRD2	92255	broad.mit.edu	37	5	36136613	36136613	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36136613A>G	uc003jkb.1	-	6	960	c.545T>C	c.(544-546)CTT>CCT	p.L182P		NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	182	Extracellular (Potential).					integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AATTGTCTGAAGCTGGTTCCT	0.383													138	361	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37122589	37122589	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37122589A>G	uc011cpa.1	-	47	9029	c.8798T>C	c.(8797-8799)CTT>CCT	p.L2933P	C5orf42_uc003jko.1_5'Flank|C5orf42_uc003jkp.1_RNA|C5orf42_uc011coy.1_Missense_Mutation_p.L1451P|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.L2026P	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	2933										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AGTCATGTAAAGCTGCATAAA	0.348													186	460	---	---	---	---	PASS
DAB2	1601	broad.mit.edu	37	5	39383077	39383077	+	Silent	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39383077A>G	uc003jlx.2	-	10	1515	c.984T>C	c.(982-984)TCT>TCC	p.S328S	DAB2_uc003jlw.2_Silent_p.S307S	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2	328					cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			TCAGCGGAGTAGACGAGCTAC	0.483													42	107	---	---	---	---	PASS
DHX29	54505	broad.mit.edu	37	5	54552206	54552206	+	3'UTR	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54552206G>A	uc003jpx.2	-	27					DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29								ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTAATGGCTAGTACCAACATT	0.289													10	153	---	---	---	---	PASS
ACOT12	134526	broad.mit.edu	37	5	80640000	80640000	+	Missense_Mutation	SNP	C	T	T	rs78935755	byFrequency	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80640000C>T	uc003khl.3	-	9	1014	c.959G>A	c.(958-960)CGC>CAC	p.R320H	RNU5E_uc011cto.1_Intron	NM_130767	NP_570123	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	320					acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		AATTCGCTTGCGTGCAATAGC	0.343													4	188	---	---	---	---	PASS
NUDT12	83594	broad.mit.edu	37	5	102891795	102891795	+	Silent	SNP	A	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102891795A>C	uc003koi.2	-	4	894	c.801T>G	c.(799-801)GTT>GTG	p.V267V	NUDT12_uc011cvb.1_Silent_p.V249V	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12	267						nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		CTTGAGCTACAACCCCTTCAA	0.333													61	162	---	---	---	---	PASS
PJA2	9867	broad.mit.edu	37	5	108704442	108704442	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108704442T>C	uc003kos.3	-	5	1509	c.1289A>G	c.(1288-1290)GAA>GGA	p.E430G		NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing	430					long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		ATCACTGCATTCAGAACTGCA	0.343													7	327	---	---	---	---	PASS
MYOT	9499	broad.mit.edu	37	5	137222571	137222571	+	Silent	SNP	T	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137222571T>A	uc011cye.1	+	9	1226	c.1209T>A	c.(1207-1209)ACT>ACA	p.T403T	PKD2L2_uc010jep.1_5'Flank|PKD2L2_uc003lbw.1_5'Flank|PKD2L2_uc003lbx.2_5'Flank|PKD2L2_uc003lby.2_5'Flank|MYOT_uc003lbv.2_Silent_p.T403T|MYOT_uc011cyg.1_Silent_p.T219T|MYOT_uc011cyh.1_Silent_p.T288T	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b	403	Necessary for interaction with ACTA1.|Ig-like C2-type 2.|Necessary for interaction with FLNC.				muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AAGATAACACTGGAAGAGTTA	0.348													89	221	---	---	---	---	PASS
CTNNA1	1495	broad.mit.edu	37	5	138147874	138147874	+	Silent	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138147874G>T	uc003ldh.2	+	5	566	c.471G>T	c.(469-471)GTG>GTT	p.V157V	CTNNA1_uc011cyx.1_Silent_p.V54V|CTNNA1_uc011cyy.1_Silent_p.V34V|CTNNA1_uc003ldi.2_Intron|CTNNA1_uc003ldj.2_Silent_p.V157V	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	157	Involved in homodimerization.				adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTTTATAGGTGGAAGATGGTA	0.378													128	349	---	---	---	---	PASS
RNF14	9604	broad.mit.edu	37	5	141354483	141354483	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141354483C>T	uc003lly.2	+	3	308	c.269C>T	c.(268-270)TCA>TTA	p.S90L	RNF14_uc003llz.2_Missense_Mutation_p.S90L|RNF14_uc003lma.2_Missense_Mutation_p.S90L|RNF14_uc003lmb.2_Intron|RNF14_uc003lmc.2_Missense_Mutation_p.S90L|RNF14_uc011dbg.1_Missense_Mutation_p.S90L|RNF14_uc011dbh.1_Intron|RNF14_uc003lmd.2_Missense_Mutation_p.S90L	NM_183399	NP_899646	Q9UBS8	RNF14_HUMAN	ring finger protein 14 isoform 1	90	RWD.				androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|protein ubiquitination|regulation of androgen receptor signaling pathway|regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|small conjugating protein ligase activity|transcription coactivator activity|zinc ion binding				0		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		TCCCCACCTTCATTCACACTT	0.393													90	235	---	---	---	---	PASS
SLU7	10569	broad.mit.edu	37	5	159831535	159831535	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159831535T>C	uc003lyg.2	-	15	1648	c.1493A>G	c.(1492-1494)AAG>AGG	p.K498R		NM_006425	NP_006416	O95391	SLU7_HUMAN	step II splicing factor SLU7	498					alternative nuclear mRNA splicing, via spliceosome|nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|cytoplasm|nuclear speck|small nuclear ribonucleoprotein complex	pre-mRNA 3'-splice site binding|second spliceosomal transesterification activity|zinc ion binding			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			cttcttcttcttttcctcttT	0.259													8	751	---	---	---	---	PASS
EHMT2	10919	broad.mit.edu	37	6	31848507	31848507	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31848507C>T	uc003nxz.1	-	27	3405	c.3395G>A	c.(3394-3396)CGA>CAA	p.R1132Q	EHMT2_uc003nxv.1_Missense_Mutation_p.R171Q|EHMT2_uc003nxw.1_Missense_Mutation_p.R171Q|EHMT2_uc003nxx.1_Missense_Mutation_p.R330Q|EHMT2_uc003nxy.1_Missense_Mutation_p.R930Q|EHMT2_uc011don.1_Missense_Mutation_p.R1155Q|EHMT2_uc003nya.1_Missense_Mutation_p.R1098Q|SLC44A4_uc010jti.2_5'Flank|SLC44A4_uc011dom.1_5'Flank	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	1132	SET.				DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						GCGTGGAAATCGCAGGTCTTG	0.577													38	61	---	---	---	---	PASS
FKBPL	63943	broad.mit.edu	37	6	32096783	32096783	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32096783C>G	uc003nzr.2	-	2	1045	c.775G>C	c.(775-777)GCT>CCT	p.A259P	ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	NM_022110	NP_071393	Q9UIM3	FKBPL_HUMAN	WAF-1/CIP1 stabilizing protein 39	259	TPR 2.				response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0						TGACAGGCAGCCAGATTGGCA	0.597													5	12	---	---	---	---	PASS
XPO5	57510	broad.mit.edu	37	6	43491550	43491550	+	3'UTR	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43491550C>A	uc003ovp.2	-	32					POLR1C_uc003ovo.1_Intron	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			AGATCGGCTACAAAGGGAAAG	0.542													5	48	---	---	---	---	PASS
XPO5	57510	broad.mit.edu	37	6	43493658	43493658	+	Silent	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43493658A>G	uc003ovp.2	-	28	3196	c.2985T>C	c.(2983-2985)GAT>GAC	p.D995D	POLR1C_uc003ovo.1_Intron	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5	995					gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			TCATTTCTTCATCTGTTATCA	0.453													36	92	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56417328	56417328	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56417328T>G	uc003pdf.2	-	55	9933	c.9905A>C	c.(9904-9906)CAA>CCA	p.Q3302P	DST_uc003pcz.3_Missense_Mutation_p.Q3124P|DST_uc011dxj.1_Missense_Mutation_p.Q3153P|DST_uc011dxk.1_Missense_Mutation_p.Q3164P|DST_uc003pcy.3_Missense_Mutation_p.Q2798P	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	5210					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTTTCCTTTTGCTTTTGCAA	0.408													52	137	---	---	---	---	PASS
LPAL2	80350	broad.mit.edu	37	6	160906946	160906946	+	RNA	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160906946C>T	uc003qtj.2	-	5		c.751G>A			LPAL2_uc011efy.1_RNA	NR_028093				Homo sapiens cDNA FLJ43922 fis, clone TESTI4012406.												0		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		GTATGTGCCTCGATAACTCTG	0.453													4	127	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161523807	161523807	+	Silent	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161523807T>C	uc003qtn.2	+	19	3994	c.3852T>C	c.(3850-3852)AGT>AGC	p.S1284S	MAP3K4_uc010kkc.1_Silent_p.S1280S|MAP3K4_uc003qto.2_Silent_p.S1234S|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Silent_p.S737S|MAP3K4_uc003qtp.2_Silent_p.S220S|MAP3K4_uc003qtq.2_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1284					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TCAGCCAGAGTAAAGGTGAGA	0.363													51	123	---	---	---	---	PASS
PHF14	9678	broad.mit.edu	37	7	11076624	11076624	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11076624G>C	uc003sry.1	+	10	2321	c.1886G>C	c.(1885-1887)CGC>CCC	p.R629P	PHF14_uc011jxi.1_Missense_Mutation_p.R344P|PHF14_uc003srz.2_Missense_Mutation_p.R629P|PHF14_uc011jxj.1_Missense_Mutation_p.R344P	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2	629							zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		AGAAATATGCGCATGATTCAA	0.269													132	284	---	---	---	---	PASS
DPY19L2P1	554236	broad.mit.edu	37	7	35144349	35144349	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35144349T>A	uc003teq.1	-	18	1866	c.759A>T	c.(757-759)TTA>TTT	p.L253F	DPY19L2P1_uc003tep.1_RNA|DPY19L2P1_uc010kwz.1_RNA					RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						CAGTAAACGCTAACAACTGCA	0.338													76	125	---	---	---	---	PASS
URGCP	55665	broad.mit.edu	37	7	43916855	43916855	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43916855G>T	uc003tiw.2	-	6	2264	c.2207C>A	c.(2206-2208)GCT>GAT	p.A736D	URGCP_uc003tiu.2_Missense_Mutation_p.A693D|URGCP_uc003tiv.2_Missense_Mutation_p.A661D|URGCP_uc003tix.2_Missense_Mutation_p.A727D|URGCP_uc003tiy.2_Missense_Mutation_p.A693D|URGCP_uc003tiz.2_Missense_Mutation_p.A693D|URGCP_uc011kbj.1_Missense_Mutation_p.A693D	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	736					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						GAAGCCCTCAGCCACTGTGAT	0.602													5	13	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101747717	101747717	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101747717A>G	uc003uyx.3	+	6	546	c.508A>G	c.(508-510)AAT>GAT	p.N170D	CUX1_uc003uys.3_Missense_Mutation_p.N181D|CUX1_uc003uyt.2_Missense_Mutation_p.N181D|CUX1_uc011kkn.1_Missense_Mutation_p.N144D|CUX1_uc003uyw.2_Missense_Mutation_p.N135D|CUX1_uc003uyv.2_Missense_Mutation_p.N165D|CUX1_uc003uyu.2_Missense_Mutation_p.N181D	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	170	Potential.				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						GAAGTTACAGAATGACTTTGC	0.418													100	242	---	---	---	---	PASS
OR2F1	26211	broad.mit.edu	37	7	143657717	143657717	+	Silent	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657717C>T	uc003wds.1	+	1	698	c.654C>T	c.(652-654)TAC>TAT	p.Y218Y		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	218	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)					TTTTGTCCTACATCCAGATCA	0.502													123	280	---	---	---	---	PASS
ATG9B	285973	broad.mit.edu	37	7	150714122	150714122	+	Splice_Site	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150714122C>T	uc011kvc.1	-	9	2365	c.2289_splice	c.e9+1	p.L763_splice	ATG9B_uc003wig.3_Splice_Site	NM_173681	NP_775952	Q674R7	ATG9B_HUMAN	ATG9 autophagy related 9 homolog B						autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane				ovary(1)	1	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTGGGACTCACCAGGGGCGAG	0.652													2	0	---	---	---	---	PASS
GFRA2	2675	broad.mit.edu	37	8	21563505	21563505	+	Silent	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21563505C>T	uc003wzu.1	-	5	1518	c.843G>A	c.(841-843)ACG>ACA	p.T281T	GFRA2_uc003wzv.1_Silent_p.T176T|GFRA2_uc003wzw.1_Silent_p.T148T	NM_001495	NP_001486	O00451	GFRA2_HUMAN	GDNF family receptor alpha 2 isoform a	281						anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity				0				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		AGCTGGTGACCGTCTGGTAGG	0.577													12	31	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68178355	68178355	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68178355G>A	uc003xxo.1	-	14	2399	c.2009C>T	c.(2008-2010)TCA>TTA	p.S670L	ARFGEF1_uc003xxl.1_Missense_Mutation_p.S124L	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	670					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TGATGATGTTGACTCCAGGGA	0.388													139	504	---	---	---	---	PASS
ATP6V1C1	528	broad.mit.edu	37	8	104066116	104066116	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104066116A>G	uc003ykz.3	+	7	723	c.478A>G	c.(478-480)AGT>GGT	p.S160G	ATP6V1C1_uc010mbz.2_Missense_Mutation_p.S85G|ATP6V1C1_uc003yla.2_Missense_Mutation_p.S160G|ATP6V1C1_uc011lhl.1_Missense_Mutation_p.S85G	NM_001695	NP_001686	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit	160					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism				0	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			CCTCAGAGGAAGTTTGCTAAC	0.343													8	607	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106814187	106814187	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106814187T>G	uc003ymd.2	+	8	1900	c.1877T>G	c.(1876-1878)ATC>AGC	p.I626S	ZFPM2_uc011lhs.1_Missense_Mutation_p.I357S	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	626					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ACATCTTGCATCAATTCTTCC	0.448													62	125	---	---	---	---	PASS
NDUFB9	4715	broad.mit.edu	37	8	125562076	125562076	+	Silent	SNP	T	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125562076T>A	uc003yrg.3	+	4	568	c.483T>A	c.(481-483)GGT>GGA	p.G161G	NDUFB9_uc011lim.1_Intron	NM_005005	NP_004996	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	161					mitochondrial electron transport, NADH to ubiquinone|sensory perception of sound|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			ovary(1)|skin(1)	2	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)		NADH(DB00157)	GAAAGGAAGGTGATTTGCCCC	0.517													23	56	---	---	---	---	PASS
KDM4C	23081	broad.mit.edu	37	9	7013979	7013979	+	Silent	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7013979G>A	uc003zkh.2	+	14	2740	c.2160G>A	c.(2158-2160)AAG>AAA	p.K720K	KDM4C_uc010mhu.2_Silent_p.K742K|KDM4C_uc011lmi.1_Silent_p.K720K|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Silent_p.K720K|KDM4C_uc011lmk.1_Silent_p.K465K|KDM4C_uc011lml.1_Silent_p.K407K	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1	720	PHD-type 1.				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						CCTGTGCAAAGTGCTGCGTAC	0.368													77	166	---	---	---	---	PASS
UBAP2	55833	broad.mit.edu	37	9	33941709	33941709	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33941709G>T	uc003ztq.1	-	16	1980	c.1867C>A	c.(1867-1869)CAT>AAT	p.H623N	UBAP2_uc011loc.1_Missense_Mutation_p.H532N|UBAP2_uc011lod.1_Missense_Mutation_p.H356N|UBAP2_uc011loe.1_Missense_Mutation_p.H378N|UBAP2_uc011lof.1_Missense_Mutation_p.H548N|UBAP2_uc011log.1_Missense_Mutation_p.H569N|UBAP2_uc003ztr.2_Missense_Mutation_p.H495N|UBAP2_uc003zts.2_Missense_Mutation_p.H256N	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2	623										ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		ATCCTGTTATGCACAGAACTC	0.438													74	187	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	66459898	66459898	+	5'Flank	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66459898A>G	uc010mng.1	-						uc004aeb.2_5'Flank|uc004aec.2_RNA					Homo sapiens cDNA, FLJ98602.																		cagtgtctggacattaaaatc	0.000													3	6	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79259745	79259745	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79259745G>A	uc010mpk.2	-	12	8762	c.8638C>T	c.(8638-8640)CGG>TGG	p.R2880W	PRUNE2_uc011lsk.1_Missense_Mutation_p.R129W|PRUNE2_uc011lsl.1_Missense_Mutation_p.R144W|PRUNE2_uc011lsm.1_Missense_Mutation_p.R145W|PRUNE2_uc004akj.3_Missense_Mutation_p.R334W|PRUNE2_uc010mpl.1_Missense_Mutation_p.R334W	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	2880					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						CTCCAAAGCCGGTTGTCCTCC	0.512													5	249	---	---	---	---	PASS
NSUN6	221078	broad.mit.edu	37	10	18834812	18834812	+	3'UTR	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18834812C>A	uc010qcp.1	-	11					NSUN6_uc001iqb.2_5'Flank	NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN	NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2						AAAAAAAAACCACAGACAGCA	0.378													4	47	---	---	---	---	PASS
TALDO1	6888	broad.mit.edu	37	11	763505	763505	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:763505C>A	uc001lqz.2	+	5	673	c.623C>A	c.(622-624)CCC>CAC	p.P208H	TALDO1_uc001lra.2_Missense_Mutation_p.P208H	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1	208					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)		TCCTATGAGCCCCTGGAAGAC	0.607													15	47	---	---	---	---	PASS
TRIM6	117854	broad.mit.edu	37	11	5625935	5625935	+	Intron	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5625935C>A	uc001mbc.1	+						HBG2_uc001mak.1_Intron|TRIM6-TRIM34_uc001mbf.2_Intron|TRIM6_uc009yeo.1_Intron|TRIM6_uc010qzj.1_5'UTR|TRIM6_uc001mbe.2_Intron|TRIM6_uc010qzk.1_Intron|TRIM6_uc010qzl.1_Intron|TRIM6_uc001mbd.2_Intron|TRIM6_uc001mbg.1_5'Flank|TRIM6_uc009yep.1_5'Flank	NM_058166	NP_477514	Q9C030	TRIM6_HUMAN	tripartite motif-containing 6 isoform 2						protein trimerization	cytoplasm	zinc ion binding				0		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		CAAAGGAGTCCTTGTCCTGTC	0.507													12	51	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	19372436	19372436	+	5'UTR	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19372436T>C	uc001mpp.2	+	1						NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TTGTGTGGGTTATTTTGTTCC	0.463													31	88	---	---	---	---	PASS
OR4C16	219428	broad.mit.edu	37	11	55339616	55339616	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55339616A>T	uc010rih.1	+	1	13	c.13A>T	c.(13-15)AAT>TAT	p.N5Y		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	5	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)				GCAACTGAATAATAATGTGAC	0.373													56	128	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55872537	55872537	+	Missense_Mutation	SNP	A	G	G	rs61746549	byFrequency	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872537A>G	uc010riy.1	+	1	19	c.19A>G	c.(19-21)AAC>GAC	p.N7D		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					TAGAAGGAATAACACAAATGT	0.343										HNSCC(53;0.14)			6	285	---	---	---	---	PASS
PACS1	55690	broad.mit.edu	37	11	65988247	65988247	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65988247C>T	uc001oha.1	+	9	1318	c.1184C>T	c.(1183-1185)CCA>CTA	p.P395L		NM_018026	NP_060496	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	395					interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6						CTCAGCACGCCAAAGCCCAAG	0.572													13	58	---	---	---	---	PASS
MTL5	9633	broad.mit.edu	37	11	68514801	68514801	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68514801T>C	uc001ooc.2	-	3	645	c.505A>G	c.(505-507)AGT>GGT	p.S169G	MTL5_uc001ood.1_Missense_Mutation_p.S169G|MTL5_uc009ysi.1_Missense_Mutation_p.S169G|MTL5_uc001ooe.2_Missense_Mutation_p.S169G	NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform	169					cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			GGATTATTACTTGTAGTAGTA	0.423													7	368	---	---	---	---	PASS
MYEOV	26579	broad.mit.edu	37	11	69063609	69063609	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69063609G>C	uc001oov.2	+	3	1142	c.692G>C	c.(691-693)AGG>ACG	p.R231T	MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Missense_Mutation_p.R231T|MYEOV_uc001oow.2_Missense_Mutation_p.R173T	NM_138768	NP_620123	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	231											0	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		GACTATGAAAGGGGAAGAAGA	0.652													6	25	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103114505	103114505	+	Silent	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103114505A>G	uc001pho.2	+	64	10047	c.9903A>G	c.(9901-9903)GAA>GAG	p.E3301E	DYNC2H1_uc001phn.1_Silent_p.E3308E|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3301	AAA 5 (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CACGTTTAGAAGTTATCAATC	0.269													7	451	---	---	---	---	PASS
HYOU1	10525	broad.mit.edu	37	11	118922276	118922276	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118922276C>T	uc001puu.2	-	13	1593	c.1400G>A	c.(1399-1401)CGG>CAG	p.R467Q	HYOU1_uc001put.2_Missense_Mutation_p.R432Q|HYOU1_uc010ryu.1_Missense_Mutation_p.R487Q|HYOU1_uc010ryv.1_Missense_Mutation_p.R356Q|HYOU1_uc001pux.3_Missense_Mutation_p.R467Q|HYOU1_uc010ryw.1_RNA|HYOU1_uc001puw.1_Missense_Mutation_p.R467Q	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor	467						endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		GAAGAGTACCCGTTTATTGTG	0.537													45	143	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120331394	120331394	+	Silent	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120331394A>G	uc001pxl.1	+	27	2548	c.2541A>G	c.(2539-2541)GAA>GAG	p.E847E	ARHGEF12_uc009zat.2_Silent_p.E828E|ARHGEF12_uc010rzn.1_Silent_p.E744E|ARHGEF12_uc009zau.1_Silent_p.E744E	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	847	DH.				apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GATTGAATGAACAAATGAAGG	0.323			T	MLL	AML								7	516	---	---	---	---	PASS
RACGAP1	29127	broad.mit.edu	37	12	50396037	50396037	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50396037T>C	uc001rvt.2	-	8	852	c.542A>G	c.(541-543)GAA>GGA	p.E181G	RACGAP1_uc009zlm.1_Missense_Mutation_p.E181G|RACGAP1_uc001rvs.2_Missense_Mutation_p.E181G|RACGAP1_uc001rvu.2_Missense_Mutation_p.E181G	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	181	Interaction with SLC26A8.				blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						TACCCTCTTTTCTCTCTTCTT	0.328													7	394	---	---	---	---	PASS
PFDN5	5204	broad.mit.edu	37	12	53691896	53691896	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53691896T>G	uc001scl.2	+	5	467	c.350T>G	c.(349-351)ATC>AGC	p.I117S	PFDN5_uc001scm.2_Missense_Mutation_p.I72S|PFDN5_uc001scn.2_RNA|PFDN5_uc001sco.2_RNA|C12orf10_uc010sof.1_5'Flank|C12orf10_uc001scp.3_5'Flank|C12orf10_uc009zmx.2_5'Flank|C12orf10_uc001scq.3_5'Flank	NM_002624	NP_002615	Q99471	PFD5_HUMAN	prefoldin subunit 5 isoform alpha	117					'de novo' posttranslational protein folding|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent	nucleus|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)	1						ATGGAGAAAATCCAACCAGCT	0.453													37	88	---	---	---	---	PASS
E2F7	144455	broad.mit.edu	37	12	77438543	77438543	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77438543T>C	uc001sym.3	-	6	1098	c.862A>G	c.(862-864)AGA>GGA	p.R288G		NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	288	Potential.				cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						CTCATAATTCTCAGAGACTTG	0.388													8	367	---	---	---	---	PASS
KITLG	4254	broad.mit.edu	37	12	88910211	88910211	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88910211G>C	uc001tav.2	-	5	603	c.420C>G	c.(418-420)TTC>TTG	p.F140L	KITLG_uc009zsn.2_Intron|KITLG_uc001taw.2_Missense_Mutation_p.F140L|KITLG_uc009zso.1_Intron	NM_000899	NP_000890	P21583	SCF_HUMAN	KIT ligand isoform b precursor	140	Extracellular (Potential).				cell adhesion|cell proliferation|hemopoiesis|male gonad development|positive regulation of DNA replication|signal transduction	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	growth factor activity|identical protein binding|stem cell factor receptor binding			ovary(1)	1						AAATTCTAAAGAATTCTTCAG	0.348									Testicular_Cancer_Familial_Clustering_of				61	128	---	---	---	---	PASS
NCRNA00173	100287569	broad.mit.edu	37	12	116972403	116972403	+	RNA	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116972403C>A	uc001tvx.1	+	2		c.674C>A			NCRNA00173_uc001tvy.2_Intron	NR_027345				Homo sapiens cDNA FLJ42957 fis, clone BRSTN2010500.												0						CAGCACAAACCAATGTGAAAA	0.428													4	113	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120128175	120128175	+	Silent	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120128175G>A	uc001txi.1	-	46	5894	c.5841C>T	c.(5839-5841)CCC>CCT	p.P1947P	CIT_uc001txh.1_Silent_p.P1465P|CIT_uc001txj.1_Silent_p.P1989P	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1947					intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GCGGGTGGCTGGGGCCTTCGG	0.701													4	6	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123034395	123034395	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123034395A>G	uc001ucv.2	+	13	1233	c.1070A>G	c.(1069-1071)CAA>CGA	p.Q357R	KNTC1_uc010taf.1_Missense_Mutation_p.Q320R	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	357					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TCTCTGGTCCAAACAGGAATT	0.299													96	243	---	---	---	---	PASS
UBC	7316	broad.mit.edu	37	12	125397445	125397445	+	Silent	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125397445T>C	uc001ugs.3	-	2	1321	c.873A>G	c.(871-873)AAA>AAG	p.K291K	UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Silent_p.K291K|UBC_uc001ugt.2_Silent_p.K291K|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_Silent_p.K139K	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	291	Ubiquitin-like 4.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		GGGTAGACTCTTTCTGGATGT	0.547													5	116	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101763549	101763549	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101763549C>T	uc001vox.1	-	19	2410	c.2221G>A	c.(2221-2223)GGA>AGA	p.G741R		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	741	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCAAATGATCCGCTCAGCATG	0.493													6	72	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21967473	21967473	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21967473C>G	uc001wbc.2	-	9	1587	c.1495G>C	c.(1495-1497)GAT>CAT	p.D499H	METTL3_uc001wbb.2_Missense_Mutation_p.D344H	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3	499					gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		ACATCACAATCCAGACCCTGG	0.448													83	178	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47600945	47600945	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47600945C>T	uc001wwj.3	-	5	886	c.690G>A	c.(688-690)ATG>ATA	p.M230I	MDGA2_uc001wwi.3_Missense_Mutation_p.M1I|MDGA2_uc010ani.2_5'UTR	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	230	Ig-like 2.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TAAACGACACCATCTTATCAG	0.313													110	253	---	---	---	---	PASS
MAPK1IP1L	93487	broad.mit.edu	37	14	55531491	55531491	+	3'UTR	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55531491C>A	uc001xbq.1	+	4						NM_144578	NP_653179	Q8NDC0	MISSL_HUMAN	MAPK-interacting and spindle-stabilizing												0						ATAACTGCCTCTTGTACTTGG	0.338													8	34	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68047714	68047714	+	Silent	SNP	T	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68047714T>A	uc001xjl.1	+	23	3385	c.3243T>A	c.(3241-3243)TCT>TCA	p.S1081S	PLEKHH1_uc010tsw.1_Silent_p.S649S|PLEKHH1_uc001xjn.1_Silent_p.S596S|PLEKHH1_uc010tsx.1_5'UTR|PLEKHH1_uc001xjo.1_5'Flank|PLEKHH1_uc001xjp.1_5'Flank	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	1081	FERM.					cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CCGGAAAGTCTGAGGGTGGGA	0.527													35	77	---	---	---	---	PASS
SERPINA5	5104	broad.mit.edu	37	14	95058616	95058616	+	3'UTR	SNP	A	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95058616A>T	uc001ydm.2	+	6					SERPINA3_uc001ydo.3_Intron	NM_000624	NP_000615	P05154	IPSP_HUMAN	serine (or cysteine) proteinase inhibitor, clade						fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(2)	2				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	TCAGGGTGGGAGATGAAGGGG	0.458													10	17	---	---	---	---	PASS
THBS1	7057	broad.mit.edu	37	15	39882215	39882215	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39882215C>A	uc001zkh.2	+	13	2315	c.2136C>A	c.(2134-2136)CAC>CAA	p.H712Q	THBS1_uc010bbi.2_Missense_Mutation_p.H184Q	NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	712	TSP type-3 1.				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	CGACTTACCACTGCAAAAAGG	0.512													11	42	---	---	---	---	PASS
ADAL	161823	broad.mit.edu	37	15	43628006	43628006	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43628006A>G	uc010udo.1	+	5	750	c.176A>G	c.(175-177)AAG>AGG	p.K59R	ADAL_uc001zrh.2_Missense_Mutation_p.K59R	NM_001159280	NP_001152752	Q6DHV7	ADAL_HUMAN	adenosine deaminase-like isoform 1	59					adenosine catabolic process|inosine biosynthetic process|purine ribonucleoside monophosphate biosynthetic process		adenosine deaminase activity|metal ion binding				0		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		GACAAGGGAAAGAAAAGAACT	0.368													9	304	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43748191	43748191	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43748191G>T	uc001zrs.2	-	12	2748	c.2600C>A	c.(2599-2601)TCA>TAA	p.S867*	TP53BP1_uc010udp.1_Nonsense_Mutation_p.S867*|TP53BP1_uc001zrq.3_Nonsense_Mutation_p.S872*|TP53BP1_uc001zrr.3_Nonsense_Mutation_p.S872*|TP53BP1_uc010udq.1_Nonsense_Mutation_p.S872*	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	867					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AGCCATTTTTGAGTCTTCTGT	0.463								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					68	171	---	---	---	---	PASS
PATL2	197135	broad.mit.edu	37	15	44960676	44960676	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44960676A>G	uc010uej.1	-	13	1327	c.1229T>C	c.(1228-1230)CTA>CCA	p.L410P	PATL2_uc001zub.3_Missense_Mutation_p.L208P	NM_001145112	NP_001138584	C9JE40	PATL2_HUMAN	protein associated with topoisomerase II homolog	410					negative regulation of translation	cytoplasm|nucleus	protein binding|RNA binding				0						TAACATTTGTAGGGCCTGCAA	0.502													5	223	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48718059	48718059	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48718059T>G	uc001zwx.1	-	59	7535	c.7207A>C	c.(7207-7209)ATC>CTC	p.I2403L	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2403	EGF-like 41; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CATTCATCGATATCTGTAATT	0.313													71	170	---	---	---	---	PASS
TMOD3	29766	broad.mit.edu	37	15	52161517	52161517	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52161517C>A	uc002abm.2	+	3	449	c.230C>A	c.(229-231)GCA>GAA	p.A77E		NM_014547	NP_055362	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)	77						cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		GAGAAAGAAGCATTGGAGCAT	0.443													64	128	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63046202	63046202	+	Intron	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63046202A>G	uc002alb.3	+						TLN2_uc002alc.3_5'UTR	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						TTAGTAAAGAATCTTGTTCTT	0.408													8	19	---	---	---	---	PASS
C15orf37	283687	broad.mit.edu	37	15	80215117	80215117	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80215117T>C	uc002bfb.2	+	1	5	c.2T>C	c.(1-3)ATG>ACG	p.M1T	ST20_uc002bfa.3_Intron	NM_175898	NP_787094			RecName: Full=Putative uncharacterized protein C15orf37;												0						ACATCCAAAATGCCCAGACCA	0.562													25	54	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4940260	4940260	+	Silent	SNP	T	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4940260T>G	uc002cyd.1	-	18	2328	c.2238A>C	c.(2236-2238)CTA>CTC	p.L746L		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	746	Spectrin 4.|Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GGATGCTGACTAGGAACTGCA	0.612													21	54	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4940261	4940261	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4940261A>G	uc002cyd.1	-	18	2327	c.2237T>C	c.(2236-2238)CTA>CCA	p.L746P		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	746	Spectrin 4.|Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GATGCTGACTAGGAACTGCAG	0.612													20	59	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4940294	4940294	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4940294A>G	uc002cyd.1	-	18	2294	c.2204T>C	c.(2203-2205)TTC>TCC	p.F735S		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	735	Spectrin 4.|Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GCCGCGGTGGAAGTGCTCGTA	0.612													13	41	---	---	---	---	PASS
NOMO3	408050	broad.mit.edu	37	16	16349957	16349957	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16349957A>G	uc002deq.2	+	11	1297	c.1162A>G	c.(1162-1164)ACG>GCG	p.T388A	NOMO3_uc002dep.2_Missense_Mutation_p.T388A|NOMO3_uc010bvp.1_Missense_Mutation_p.T221A	NM_001004067	NP_001004067	P69849	NOMO3_HUMAN	nodal modulator 3 precursor	388	Extracellular (Potential).					integral to membrane	carbohydrate binding|carboxypeptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		CTACTTTGAAACGGTCACCAT	0.438													8	594	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24816853	24816853	+	Intron	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24816853T>C	uc002dmm.2	+						TNRC6A_uc010bxs.2_Intron|TNRC6A_uc002dmn.2_Intron|TNRC6A_uc002dmo.2_Intron|TNRC6A_uc002dmp.2_5'UTR|TNRC6A_uc002dmq.2_Intron	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		TATTGACAACTGAAAACACAC	0.373													23	71	---	---	---	---	PASS
MT1X	4501	broad.mit.edu	37	16	56717289	56717289	+	Intron	SNP	T	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56717289T>A	uc002ejy.2	+						MT1X_uc002ejz.2_RNA	NM_005952	NP_005943	P80297	MT1X_HUMAN	metallothionein 1X						response to metal ion		metal ion binding				0						tcaaattgccttaaaaatggg	0.239													3	12	---	---	---	---	PASS
TMED6	146456	broad.mit.edu	37	16	69385482	69385482	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69385482A>T	uc002exc.1	-	1	208	c.175T>A	c.(175-177)TTT>ATT	p.F59I		NM_144676	NP_653277	Q8WW62	TMED6_HUMAN	transmembrane emp24 protein transport domain	59	Lumenal (Potential).|GOLD.				transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1						TGGTGGGCAAATTGCCAAAAG	0.488													13	25	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71712811	71712811	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71712811G>T	uc002fax.2	-	7	1121	c.1115C>A	c.(1114-1116)TCC>TAC	p.S372Y	PHLPP2_uc002fav.2_RNA|PHLPP2_uc010cgf.2_Missense_Mutation_p.S372Y|PHLPP2_uc002fay.1_Missense_Mutation_p.S372Y	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	372	LRR 6.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						AATTCCCAAGGAGGAAAGCTG	0.388													48	126	---	---	---	---	PASS
CLDN7	1366	broad.mit.edu	37	17	7163812	7163812	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7163812C>T	uc002gfm.3	-	4	950	c.517G>A	c.(517-519)GCC>ACC	p.A173T	CLDN7_uc010cmc.2_Silent_p.L144L|CLDN7_uc002gfn.3_Missense_Mutation_p.A173T	NM_001307	NP_001298	O95471	CLD7_HUMAN	claudin 7	173	Helical; (Potential).				calcium-independent cell-cell adhesion	integral to membrane|lateral plasma membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1						ATGACTAGGGCAGACCCTGCC	0.572													3	12	---	---	---	---	PASS
SMCR8	140775	broad.mit.edu	37	17	18219366	18219366	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18219366A>G	uc002gsy.3	+	1	773	c.263A>G	c.(262-264)AAT>AGT	p.N88S		NM_144775	NP_658988	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region,	88										central_nervous_system(1)	1						TTTGATCTCAATTACTTCTCC	0.507													70	122	---	---	---	---	PASS
RDM1	201299	broad.mit.edu	37	17	34257695	34257695	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34257695T>A	uc002hkh.2	-	1	86	c.37A>T	c.(37-39)AGT>TGT	p.S13C	RDM1_uc010cty.2_5'Flank|RDM1_uc010ctz.2_5'Flank|RDM1_uc010cua.2_5'Flank|RDM1_uc002hkg.3_5'Flank|RDM1_uc010cub.2_5'Flank|RDM1_uc010cud.2_Missense_Mutation_p.S13C|RDM1_uc010cuf.2_RNA|RDM1_uc010cue.2_RNA|RDM1_uc010cug.2_RNA|RDM1_uc010cuc.2_Missense_Mutation_p.S13C|RDM1_uc010wco.1_5'Flank|RDM1_uc010wcp.1_5'Flank|RDM1_uc002hki.2_Missense_Mutation_p.S13C	NM_145654	NP_663629	Q8NG50	RDM1_HUMAN	RAD52 motif 1 isoform 1	13	Necessary for nuclear localization and for nucleolar accumulation in response to heat shock.				DNA recombination|DNA repair	Cajal body|cytoplasm|nucleolus|PML body	DNA binding|nucleotide binding|RNA binding			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GTTTTGTCACTCTCGATGGGA	0.637								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					6	40	---	---	---	---	PASS
TOP2A	7153	broad.mit.edu	37	17	38545832	38545832	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38545832G>A	uc002huq.2	-	35	4661	c.4535C>T	c.(4534-4536)TCT>TTT	p.S1512F		NM_001067	NP_001058	P11388	TOP2A_HUMAN	DNA topoisomerase II, alpha isozyme	1512					apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TGCCCGTACAGATTTTGCCCG	0.408													74	165	---	---	---	---	PASS
GHDC	84514	broad.mit.edu	37	17	40342212	40342212	+	Silent	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40342212A>G	uc002hzd.2	-	8	1849	c.1365T>C	c.(1363-1365)AAT>AAC	p.N455N	GHDC_uc002hzg.1_Silent_p.N455N|GHDC_uc010wgg.1_Silent_p.N416N|GHDC_uc002hze.3_3'UTR|GHDC_uc002hzf.3_Silent_p.N455N	NM_032484	NP_115873	Q8N2G8	GHDC_HUMAN	LGP1 homolog isoform 1	455						endoplasmic reticulum|nuclear envelope					0		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CCTTGTCTCGATTTTCCTCTG	0.562													39	84	---	---	---	---	PASS
ACSF2	80221	broad.mit.edu	37	17	48540792	48540792	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48540792C>A	uc002iqu.2	+	8	1029	c.925C>A	c.(925-927)CTG>ATG	p.L309M	ACSF2_uc010wml.1_Missense_Mutation_p.L266M|ACSF2_uc010wmm.1_Missense_Mutation_p.L334M|ACSF2_uc010wmn.1_Missense_Mutation_p.L296M|ACSF2_uc010wmo.1_Missense_Mutation_p.L149M	NM_025149	NP_079425	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2 precursor	309					fatty acid metabolic process	mitochondrion	ATP binding|ligase activity				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GCCCAACCCCCTGTACCATTG	0.582													15	42	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61613155	61613155	+	Silent	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61613155G>A	uc002jay.2	+	6	1307	c.1227G>A	c.(1225-1227)GCG>GCA	p.A409A	KCNH6_uc002jax.1_Silent_p.A409A|KCNH6_uc010wpl.1_Silent_p.A286A|KCNH6_uc010wpm.1_Silent_p.A409A|KCNH6_uc002jaz.1_Silent_p.A409A	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	409	Helical; Name=Segment S5; (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	GCACCTTCGCGCTCATAGCGC	0.632													6	14	---	---	---	---	PASS
CCDC46	201134	broad.mit.edu	37	17	64059172	64059172	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64059172A>T	uc002jfl.2	-	11	1202	c.983T>A	c.(982-984)GTT>GAT	p.V328D	CCDC46_uc010deo.2_Missense_Mutation_p.V70D|CCDC46_uc002jfm.2_Missense_Mutation_p.V328D|CCDC46_uc010dep.2_Missense_Mutation_p.V286D	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a	328	Potential.					centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			CTCTCTGATAACTTGACAGTC	0.333													217	434	---	---	---	---	PASS
HELZ	9931	broad.mit.edu	37	17	65174829	65174829	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65174829C>A	uc010wqk.1	-	13	1563	c.1376G>T	c.(1375-1377)CGG>CTG	p.R459L	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.R459L	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GTCATGTAACCGTGACTGATA	0.378													5	328	---	---	---	---	PASS
SRP68	6730	broad.mit.edu	37	17	74042206	74042206	+	Silent	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74042206C>T	uc002jqk.1	-	11	1247	c.1212G>A	c.(1210-1212)AGG>AGA	p.R404R	SRP68_uc010wsu.1_Silent_p.R303R|SRP68_uc002jql.1_Silent_p.R366R|SRP68_uc002jqj.1_Silent_p.R65R	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	404					response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						GCAGCAGAGCCCTCTGCAGAC	0.532													20	47	---	---	---	---	PASS
SLC16A3	9123	broad.mit.edu	37	17	80194627	80194627	+	Silent	SNP	G	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80194627G>C	uc002kea.2	+	3	385	c.246G>C	c.(244-246)GTG>GTC	p.V82V	SLC16A3_uc002kee.2_Silent_p.V82V|SLC16A3_uc002keb.2_Silent_p.V82V|SLC16A3_uc002kec.2_Silent_p.V82V|SLC16A3_uc002ked.2_Silent_p.V82V	NM_001042422	NP_001035887	O15427	MOT4_HUMAN	solute carrier family 16, member 3	82	Helical; (Potential).				blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	actin cytoskeleton|integral to plasma membrane|membrane fraction|nuclear membrane	secondary active monocarboxylate transmembrane transporter activity|symporter activity			upper_aerodigestive_tract(1)|lung(1)	2	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Pyruvic acid(DB00119)	GTGTGTGCGTGAACCGCTTTG	0.667											OREG0024821	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	9	---	---	---	---	PASS
GREB1L	80000	broad.mit.edu	37	18	19032159	19032159	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19032159G>A	uc010xam.1	+	14	2236	c.1965G>A	c.(1963-1965)ATG>ATA	p.M655I	GREB1L_uc002ktf.1_Missense_Mutation_p.M655I|GREB1L_uc010dlp.1_Missense_Mutation_p.M546I|GREB1L_uc010xan.1_Missense_Mutation_p.M71I|GREB1L_uc010dlr.1_5'UTR	NM_001142966	NP_001136438	Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast	655						integral to membrane					0						CTGCTGCTATGATTCCCACAC	0.453													71	129	---	---	---	---	PASS
OSBPL1A	114876	broad.mit.edu	37	18	21759711	21759711	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21759711T>C	uc002kve.2	-	20	2075	c.1901A>G	c.(1900-1902)GAA>GGA	p.E634G	OSBPL1A_uc002kvd.2_Missense_Mutation_p.E121G|OSBPL1A_uc010xbc.1_Missense_Mutation_p.E252G	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B	634					cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CCGCACTAATTCATAAGTCTC	0.443													5	175	---	---	---	---	PASS
CHST9	83539	broad.mit.edu	37	18	24496329	24496329	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24496329A>G	uc002kwd.2	-	5	1424	c.1226T>C	c.(1225-1227)GTC>GCC	p.V409A	C18orf16_uc002kwb.2_Intron|C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_Missense_Mutation_p.V324A|CHST9_uc002kwe.2_Missense_Mutation_p.V409A	NM_031422	NP_113610	Q7L1S5	CHST9_HUMAN	GalNAc-4-sulfotransferase 2	409	Lumenal (Potential).				carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)					CTGTCTCACGACTTGAGCATT	0.353													71	220	---	---	---	---	PASS
ME2	4200	broad.mit.edu	37	18	48422198	48422198	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48422198C>T	uc002ley.2	+	2	264	c.8C>T	c.(7-9)TCC>TTC	p.S3F	ME2_uc010dpd.2_Missense_Mutation_p.S3F	NM_002396	NP_002387	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	3					malate metabolic process	mitochondrial matrix	electron carrier activity|malate dehydrogenase (decarboxylating) activity|malate dehydrogenase (oxaloacetate-decarboxylating) activity|metal ion binding|NAD binding				0		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)	NADH(DB00157)	AAGATGTTGTCCCGGTTAAGA	0.388													69	181	---	---	---	---	PASS
SERPINB4	6318	broad.mit.edu	37	18	61326705	61326705	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61326705G>T	uc002ljg.2	-	3	305	c.279C>A	c.(277-279)AAC>AAA	p.N93K	SERPINB3_uc002lji.2_Missense_Mutation_p.N93K|SERPINB3_uc010dqa.2_Missense_Mutation_p.N93K|SERPINB3_uc010dqb.2_Missense_Mutation_p.N93K			P48594	SPB4_HUMAN	SubName: Full=Squamous cell carcinoma antigen 2;	93					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						CAGTGGATTTGTTGAATTCAG	0.383													8	711	---	---	---	---	PASS
C3	718	broad.mit.edu	37	19	6697533	6697533	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6697533C>T	uc002mfm.2	-	21	2680	c.2618G>A	c.(2617-2619)TGC>TAC	p.C873Y		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	873					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		GGCCAGGCTGCAGAAGGCTGG	0.602													15	23	---	---	---	---	PASS
CEACAM6	4680	broad.mit.edu	37	19	42260806	42260806	+	Silent	SNP	C	T	T	rs138986236		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42260806C>T	uc002orm.2	+	2	512	c.363C>T	c.(361-363)ACC>ACT	p.T121T		NM_002483	NP_002474	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion	121	Ig-like V-type.				cell-cell signaling|signal transduction	anchored to membrane|integral to plasma membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		GATTCTATACCCTACAAGTCA	0.493													97	255	---	---	---	---	PASS
CCDC61	729440	broad.mit.edu	37	19	46511489	46511489	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46511489C>T	uc002pdw.2	+	6	652	c.652C>T	c.(652-654)CGC>TGC	p.R218C		NM_001080402	NP_001073871			coiled-coil domain containing 61											ovary(1)	1		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		GGAACTGGGCCGCCTGCAAGG	0.647													4	8	---	---	---	---	PASS
MIR519C	574466	broad.mit.edu	37	19	54189764	54189764	+	RNA	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54189764C>T	hsa-mir-519c|MI0003148	+			c.42C>T			MIR1283-1_hsa-mir-1283-1|MI0003832_5'Flank																	0						TTTCTGTTGTCTGAAAGAAAA	0.413													48	154	---	---	---	---	PASS
ZNF304	57343	broad.mit.edu	37	19	57865150	57865150	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57865150C>T	uc010ygw.1	+	2	479	c.91C>T	c.(91-93)CTT>TTT	p.L31F	ZNF304_uc010etw.2_Missense_Mutation_p.L31F|ZNF304_uc010etx.2_5'UTR	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN	zinc finger protein 304	31	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		GTGGGAACTCCTTGAGGAGGC	0.453													91	214	---	---	---	---	PASS
CSRP2BP	57325	broad.mit.edu	37	20	18167975	18167975	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18167975C>A	uc002wqj.2	+	11	2843	c.2221C>A	c.(2221-2223)CCC>ACC	p.P741T	CSRP2BP_uc002wqk.2_Missense_Mutation_p.P613T|CSRP2BP_uc010zru.1_Missense_Mutation_p.P612T	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	741	N-acetyltransferase.				histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						AGCAAGCAACCCTGCTATGCT	0.403													5	261	---	---	---	---	PASS
FOXA2	3170	broad.mit.edu	37	20	22562794	22562794	+	Silent	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22562794C>T	uc002wsn.2	-	3	1258	c.1068G>A	c.(1066-1068)CCG>CCA	p.P356P	FOXA2_uc002wsm.2_Silent_p.P362P	NM_153675	NP_710141	Q9Y261	FOXA2_HUMAN	forkhead box A2 isoform 2	356					cell differentiation in hindbrain|central nervous system myelin formation|chromatin modification|dorsal/ventral neural tube patterning|ectoderm formation|endocrine pancreas development|endoderm development|epithelial tube branching involved in lung morphogenesis|in utero embryonic development|lung epithelial cell differentiation|negative regulation of neuron differentiation|neuron fate specification|oligodendrocyte cell fate commitment|positive regulation of embryonic development|positive regulation of gastrulation|positive regulation of neuron differentiation|primitive streak formation|regulation of blood coagulation|regulation of sequence-specific DNA binding transcription factor activity|response to interleukin-6	cytoplasm|transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|kidney(1)|central_nervous_system(1)	4	Lung NSC(19;0.188)					GCGGCAGGCCCGGGTGGTGGG	0.701													6	20	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33337785	33337785	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33337785G>T	uc002xav.2	-	10	4784	c.2213C>A	c.(2212-2214)CCG>CAG	p.P738Q	NCOA6_uc002xaw.2_Missense_Mutation_p.P738Q	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	738	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						GGCTGGTCCCGGCATGACATT	0.488													4	168	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35414908	35414908	+	Intron	SNP	C	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35414908C>A	uc002xgd.1	-						C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				GGGGGGAGTGCCCTCTCCTCC	0.657													6	6	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10941937	10941937	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10941937T>C	uc002yip.1	-	14	1134	c.766A>G	c.(766-768)AGG>GGG	p.R256G	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.R238G|TPTE_uc002yir.1_Missense_Mutation_p.R218G|TPTE_uc010gkv.1_Missense_Mutation_p.R118G	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	256	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAAGACTGCCTTCCAGAAGAT	0.294													8	758	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40559338	40559338	+	Missense_Mutation	SNP	C	A	A	rs140524582		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40559338C>A	uc002yxk.1	-	42	6716	c.6577G>T	c.(6577-6579)GTT>TTT	p.V2193F	BRWD1_uc010goc.1_Missense_Mutation_p.V836F	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	2193					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TCTCTAGGAACAAATTCTGAA	0.358													58	131	---	---	---	---	PASS
MMP11	4320	broad.mit.edu	37	22	24122848	24122848	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24122848G>T	uc002zxx.2	+	4	584	c.562G>T	c.(562-564)GAA>TAA	p.E188*	MMP11_uc002zxy.2_RNA|MMP11_uc002zxz.2_5'Flank	NM_005940	NP_005931	P24347	MMP11_HUMAN	matrix metalloproteinase 11 preproprotein	188					collagen catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|large_intestine(1)	3		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)				GACTCACCGAGAAGGGGATGT	0.517													17	46	---	---	---	---	PASS
TTC28	23331	broad.mit.edu	37	22	28504358	28504358	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28504358G>T	uc003adp.3	-	7	1617	c.1475C>A	c.(1474-1476)ACT>AAT	p.T492N		NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	492	TPR 11.						binding				0						TTTCAGTGCAGTGTCATAATC	0.433													6	17	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	A	A	rs146546850	byFrequency	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091841G>A	uc003adu.1	-	11	1188	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	372	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				4	78	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37469600	37469600	+	Silent	SNP	G	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37469600G>A	uc003aqs.1	-	13	1668	c.1554C>T	c.(1552-1554)AAC>AAT	p.N518N	TMPRSS6_uc003aqt.1_Silent_p.N509N	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	518	LDL-receptor class A 2.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						CGTCGCTGCCGTTGAGACAAT	0.562													30	51	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37499264	37499264	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37499264T>A	uc003aqs.1	-	2	335	c.221A>T	c.(220-222)TAT>TTT	p.Y74F	TMPRSS6_uc003aqt.1_Missense_Mutation_p.Y65F|TMPRSS6_uc003aqu.2_Missense_Mutation_p.Y65F	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	74	Helical; Signal-anchor for type II membrane protein; (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						ACCTAGGAAATACCAGAGTAG	0.488													3	3	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38120006	38120006	+	Silent	SNP	T	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38120006T>C	uc003atr.2	+	7	1714	c.1443T>C	c.(1441-1443)TGT>TGC	p.C481C	TRIOBP_uc003atu.2_Silent_p.C309C|TRIOBP_uc003atq.1_Silent_p.C481C|TRIOBP_uc003ats.1_Silent_p.C309C	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	481					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GAACATCCTGTGCCCAGCGGG	0.592													7	94	---	---	---	---	PASS
ARSH	347527	broad.mit.edu	37	X	2928175	2928175	+	Missense_Mutation	SNP	G	T	T	rs143754233	byFrequency	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2928175G>T	uc011mhj.1	+	2	197	c.197G>T	c.(196-198)CGG>CTG	p.R66L		NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	66						integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CTGACCGGCCGGTACCCCATC	0.483													3	28	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	33357388	33357388	+	5'UTR	SNP	C	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:33357388C>T	uc004ddb.1	-	1					DMD_uc004ddf.2_5'UTR	NM_000109	NP_000100	P11532	DMD_HUMAN	dystrophin Dp427c isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCCATGCCAGCTGTTTTTCCT	0.388													5	354	---	---	---	---	PASS
NKRF	55922	broad.mit.edu	37	X	118724240	118724240	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118724240T>G	uc004erq.2	-	2	1801	c.1148A>C	c.(1147-1149)CAA>CCA	p.Q383P	NKRF_uc004err.2_Missense_Mutation_p.Q383P	NM_017544	NP_060014	O15226	NKRF_HUMAN	transcription factor NRF	383					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding			ovary(1)|central_nervous_system(1)	2						GCAGTGATCTTGTAAAAACAC	0.388													60	48	---	---	---	---	PASS
TNFRSF14	8764	broad.mit.edu	37	1	2489665	2489665	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2489665delT	uc001ajr.2	+						TNFRSF14_uc010nzc.1_Intron|TNFRSF14_uc009vlf.1_Intron|TNFRSF14_uc001ajt.1_Intron|TNFRSF14_uc001ajs.2_Intron|LOC115110_uc010nzb.1_5'Flank	NM_003820	NP_003811	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily,						immune response|interspecies interaction between organisms|T cell costimulation		tumor necrosis factor receptor activity			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		TCATGGGCCATTTGAGTCCCC	0.637			Mis|N|F		follicular lymphoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	10053534	10053534	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10053534delA								NMNAT1 (7979 upstream) : RBP7 (3721 downstream)																							accccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14439238	14439238	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14439238delA								PRDM2 (287666 upstream) : KAZ (485975 downstream)																							ggcatgagagagtgcagtctt	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26327682	26327682	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26327682delT								PAFAH2 (3034 upstream) : EXTL1 (20589 downstream)																							tatgaagttgtttatgttcaa	0.035													4	2	---	---	---	---	
LDLRAD1	388633	broad.mit.edu	37	1	54486220	54486220	+	5'Flank	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54486220delT	uc001cwm.1	-						LDLRAD1_uc010onz.1_5'Flank|LDLRAD1_uc010ooa.1_5'Flank|LDLRAD1_uc009vzn.1_5'Flank	NM_001010978	NP_001010978	Q5T700	LRAD1_HUMAN	low density lipoprotein receptor class A domain							integral to membrane	receptor activity			skin(2)|large_intestine(1)	3						TAAGTGTTCCTTTATAAAAAG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	56213925	56213925	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56213925delT								USP24 (533163 upstream) : PPAP2B (746508 downstream)																							GCAGCTGAGGTTTTTttttta	0.194													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	87647621	87647625	+	IGR	DEL	CTACT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87647621_87647625delCTACT								LOC339524 (12737 upstream) : LMO4 (146526 downstream)																							CTgctcctccctactcctgtctcat	0.229													4	2	---	---	---	---	
AMY2A	279	broad.mit.edu	37	1	104159715	104159715	+	5'Flank	DEL	T	-	-	rs1178000		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104159715delT	uc001dut.2	+						AMY2A_uc010ouq.1_5'Flank	NM_000699	NP_000690	P04746	AMYP_HUMAN	pancreatic amylase alpha 2A precursor						carbohydrate catabolic process|polysaccharide digestion	extracellular space	alpha-amylase activity|calcium ion binding|chloride ion binding			ovary(1)|skin(1)	2		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Bentiromide(DB00522)|Icodextrin(DB00702)|Miglitol(DB00491)|Pancrelipase(DB00085)	TTATGTAAAGTTTTTTTGTAT	0.373													4	3	---	---	---	---	
HSD3B2	3284	broad.mit.edu	37	1	119963049	119963049	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119963049delA	uc001ehs.2	+						HSD3B2_uc001eht.2_Intron|HSD3B2_uc001ehu.2_Intron	NM_000198	NP_000189	P26439	3BHS2_HUMAN	3 beta-hydroxysteroid dehydrogenase 2						androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	AAAAACAAACAAAAAAAAAAC	0.388													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148864013	148864013	+	IGR	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148864013delC								NBPF16 (105702 upstream) : LOC645166 (64273 downstream)																							gatttataatcccaccccagc	0.000													5	3	---	---	---	---	
IQGAP3	128239	broad.mit.edu	37	1	156532095	156532096	+	Intron	DEL	CT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156532095_156532096delCT	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CACATTGCCCCTCTCGAAGGAC	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	168404951	168404951	+	IGR	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168404951delG								MIR557 (60092 upstream) : XCL2 (105054 downstream)																							tagtagaggaggggcagcgta	0.000													4	2	---	---	---	---	
LAMC2	3918	broad.mit.edu	37	1	183205371	183205372	+	Intron	INS	-	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183205371_183205372insG	uc001gqa.2	+						LAMC2_uc001gpz.3_Intron|LAMC2_uc010poa.1_Intron	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						TTAAAAAAAAAGGGGGGgccag	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207184903	207184903	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207184903delT								FCAMR (40933 upstream) : C1orf116 (6963 downstream)																							AAtttttttcttttttttttt	0.159													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221307067	221307068	+	IGR	INS	-	A	A	rs140242409	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221307067_221307068insA								HLX (248669 upstream) : LOC400804 (196202 downstream)																							TAAGATCTATTAAAAAAAAAAT	0.317													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237220495	237220495	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237220495delT	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGGAAACttcttttttttttg	0.239													8	5	---	---	---	---	
NOL10	79954	broad.mit.edu	37	2	10721400	10721400	+	Intron	DEL	T	-	-	rs71392240		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10721400delT	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		tggcagtctcttatcgcatac	0.000													4	10	---	---	---	---	
TRIB2	28951	broad.mit.edu	37	2	12877501	12877502	+	Intron	INS	-	A	A	rs147592331	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12877501_12877502insA	uc002rbv.3	+						TRIB2_uc010yjp.1_Intron|hsa-mir-3125|MI0014142_RNA	NM_021643	NP_067675	Q92519	TRIB2_HUMAN	tribbles homolog 2						negative regulation of fat cell differentiation|negative regulation of interleukin-10 biosynthetic process|negative regulation of protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity	cytoplasm|cytoskeleton|nucleus	ATP binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			stomach(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGAGAATGGGTAGAGGAAGCT	0.490													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19978134	19978135	+	IGR	INS	-	AG	AG			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19978134_19978135insAG								OSR1 (419762 upstream) : TTC32 (118383 downstream)																							AAGATGACAACAGAGTCCAAAG	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	48197878	48197878	+	IGR	DEL	G	-	-	rs67643592		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48197878delG								FBXO11 (65064 upstream) : FOXN2 (343917 downstream)																							aatctcctcaggtgattccaa	0.005													4	3	---	---	---	---	
COMMD1	150684	broad.mit.edu	37	2	62349580	62349580	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62349580delT	uc002sbp.2	+						uc002sbr.2_Intron	NM_152516	NP_689729	Q8N668	COMD1_HUMAN	MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)			ctttcttttcttttttttttt	0.358													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91802160	91802161	+	IGR	INS	-	G	G	rs140424741		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91802160_91802161insG								None (None upstream) : LOC654342 (3031 downstream)																							aggttTCtcttgcctttttaaa	0.020													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103502114	103502114	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103502114delA								TMEM182 (67978 upstream) : None (None downstream)																							aaggtacaagaaaaaaaaaaa	0.035													4	3	---	---	---	---	
SH3RF3	344558	broad.mit.edu	37	2	109815949	109815950	+	Intron	INS	-	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109815949_109815950insG	uc010ywt.1	+							NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1						tggaatggaatggatggaatgg	0.000													4	2	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	115940857	115940857	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115940857delA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AATTTTGTGGAAAAAAAAAAT	0.348													3	4	---	---	---	---	
CLASP1	23332	broad.mit.edu	37	2	122106314	122106315	+	Intron	INS	-	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122106314_122106315insA	uc002tnc.2	-						CLASP1_uc010yyv.1_Intron|CLASP1_uc002tmz.2_Intron|CLASP1_uc002tna.2_Intron|CLASP1_uc010yyw.1_Intron|CLASP1_uc002tnb.2_Intron|CLASP1_uc010yyx.1_Intron|CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tmy.2_Intron	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					CCAGTTCCCCCAAAGAGTGAGC	0.554													27	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133062949	133062949	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133062949delG	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																		TGACTCCACTGGGGCATTTCT	0.498													4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141492306	141492306	+	Intron	DEL	G	-	-	rs71412704		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141492306delG	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ctcagctaatgactgtgtgaa	0.000										TSP Lung(27;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	162402124	162402124	+	IGR	DEL	T	-	-	rs111947487		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162402124delT								TBR1 (120551 upstream) : SLC4A10 (78721 downstream)																							tggaaaaaacttttttttttt	0.000													4	2	---	---	---	---	
GPR155	151556	broad.mit.edu	37	2	175306646	175306646	+	Intron	DEL	T	-	-	rs113036023		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175306646delT	uc002uit.2	-						GPR155_uc002uiu.2_Intron|GPR155_uc002uiv.2_Intron|GPR155_uc010fqs.2_Intron	NM_001033045	NP_001028217	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155 isoform 9						intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1						aatttttgtattttttttttt	0.000													10	5	---	---	---	---	
ZNF804A	91752	broad.mit.edu	37	2	185731406	185731406	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185731406delT	uc002uph.2	+							NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A							intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						AGCAAAATCCttttttttttt	0.249													6	3	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	206208829	206208829	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206208829delA	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		TTGATCTTTTAATGGTGTTGC	0.393													4	2	---	---	---	---	
RUFY4	285180	broad.mit.edu	37	2	218947673	218947673	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218947673delG	uc002vgw.2	+						RUFY4_uc002vgy.1_Intron|RUFY4_uc010fvl.1_Intron	NM_198483	NP_940885	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4								metal ion binding			pancreas(1)	1		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		gtaggcatgtgtgtgctgtgt	0.348													4	2	---	---	---	---	
MSL3L2	151507	broad.mit.edu	37	2	234776128	234776129	+	Intron	INS	-	CC	CC			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234776128_234776129insCC	uc010znf.1	-							NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						tttctttctttctttttttTGT	0.203													4	2	---	---	---	---	
ITPR1	3708	broad.mit.edu	37	3	4703361	4703361	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4703361delT	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Intron	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		TTACTGaacatttttagattt	0.169													4	2	---	---	---	---	
SRGAP3	9901	broad.mit.edu	37	3	9241090	9241090	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9241090delT	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CTGACTGAGATTTTTTTTTAA	0.343			T	RAF1	pilocytic astrocytoma								6	4	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188234	10188235	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188234_10188235insT	uc003bvc.2	+	2	590_591	c.377_378insT	c.(376-378)GATfs	p.D126fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	126	Involved in binding to CCT complex.		D -> Y (in ECYT2).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.D126G(3)|p.D126N(1)|p.D126fs*5(1)|p.D126fs*33(1)|p.G127fs*5(1)|p.L128fs*4(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GGGACACACGATGGGCTTCTGG	0.411		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				140	127	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	60117471	60117472	+	Intron	INS	-	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60117471_60117472insC	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		ccaatcatcttcccctactgct	0.114			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65553048	65553048	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65553048delA	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		ACTGACCATGAAAAAAAAAAT	0.323													4	3	---	---	---	---	
TOPBP1	11073	broad.mit.edu	37	3	133337435	133337435	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133337435delT	uc003eps.2	-						TOPBP1_uc003ept.1_Intron	NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1						DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						CCTAGGGACATTTTTTTTTTT	0.219								Other_conserved_DNA_damage_response_genes					3	3	---	---	---	---	
GMPS	8833	broad.mit.edu	37	3	155632554	155632554	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155632554delT	uc003faq.2	+						GMPS_uc011bom.1_Intron	NM_003875	NP_003866	P49915	GUAA_HUMAN	guanine monophosphate synthetase						glutamine metabolic process|purine base biosynthetic process	cytosol	ATP binding|GMP synthase (glutamine-hydrolyzing) activity|GMP synthase activity			ovary(2)|lung(1)	3			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TGTTGTTTGGttttttttttg	0.134			T	MLL	AML								4	3	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171889582	171889582	+	Intron	DEL	A	-	-	rs66787172		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171889582delA	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		CTTTGAAATGAAAAAAAAAAA	0.383													2	4	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180401816	180401816	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180401816delC	uc003fkn.2	-									Q9UFE4	CCD39_HUMAN	Homo sapiens cDNA FLJ58733 complete cds, moderately similar to Coiled-coil domain-containing protein 39.						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ctactgctctccatctccact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	46814	46815	+	IGR	INS	-	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46814_46815insC								None (None upstream) : ZNF595 (6412 downstream)																							TGCCTACAAGTCCCCAGCCTGc	0.252													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	7950589	7950589	+	IGR	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7950589delC								AFAP1 (8936 upstream) : ABLIM2 (16449 downstream)																							caccatctcacagctgcccta	0.000													4	2	---	---	---	---	
PROM1	8842	broad.mit.edu	37	4	16018089	16018089	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16018089delA	uc003goo.2	-						PROM1_uc003gor.2_Intron|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Intron|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron|PROM1_uc010iec.1_Intron	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1						camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						gtaaccagctaaaaaaaagag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33288988	33288989	+	IGR	INS	-	C	C	rs148398528	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33288988_33288989insC								None (None upstream) : None (None downstream)																							TTCACACTGAGCCCCCCTTGAA	0.515													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	43588321	43588321	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43588321delT								GRXCR1 (555648 upstream) : KCTD8 (587601 downstream)																							TAATAATACCTTTTTTTTTCA	0.333													4	2	---	---	---	---	
CSN1S1	1446	broad.mit.edu	37	4	70806861	70806861	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70806861delA	uc003hep.1	+						CSN1S1_uc003heq.1_Intron|CSN1S1_uc003her.1_Intron	NM_001890	NP_001881	P47710	CASA1_HUMAN	casein alpha s1 isoform 1							extracellular region	protein binding|transporter activity				0						GGCCATTTCtaaatatatttt	0.254													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	74577986	74577987	+	IGR	DEL	GA	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74577986_74577987delGA								RASSF6 (91646 upstream) : IL8 (28288 downstream)																							actgattactgaaatggaaaac	0.054													4	2	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143611600	143611600	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143611600delC	uc003iix.3	-						INPP4B_uc003iiw.3_Intron	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					CAATTTCCCACCCTCTTCAGT	0.378													4	5	---	---	---	---	
DCHS2	54798	broad.mit.edu	37	4	155176472	155176472	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155176472delT	uc003inw.2	-							NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ttttaatcacttttttccaaa	0.199													4	2	---	---	---	---	
CDH6	1004	broad.mit.edu	37	5	31200675	31200676	+	Intron	DEL	AC	-	-	rs10533381		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31200675_31200676delAC	uc003jhe.1	+						CDH6_uc003jhc.1_Intron|CDH6_uc003jhd.1_Intron	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						acacatacatacacacacacac	0.198													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42951747	42951747	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42951747delA								SEPP1 (125749 upstream) : C5orf39 (87436 downstream)																							CAACTAGCAGAAAACCGTCTG	0.587													4	2	---	---	---	---	
PARP8	79668	broad.mit.edu	37	5	50010846	50010846	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50010846delT	uc003jon.3	+						PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_Intron|PARP8_uc003jop.2_Intron	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				gaatttatgcttttttttcct	0.224													4	2	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	66093646	66093646	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66093646delG	uc003jur.3	+						MAST4_uc010iwz.2_Intron	NM_198828	NP_942123	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TGTGATGGGTGGGGAGTGGTA	0.308													4	2	---	---	---	---	
MARVELD2	153562	broad.mit.edu	37	5	68716482	68716482	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68716482delT	uc003jwq.2	+						MARVELD2_uc010ixf.2_Intron|MARVELD2_uc003jwr.1_Intron|MARVELD2_uc003jws.1_Intron	NM_001038603	NP_001033692	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2 isoform 1						sensory perception of sound	integral to membrane|tight junction					0		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		TCTTTCTTCCTTTTTTTTTTT	0.338													4	2	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70835143	70835143	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70835143delT	uc003kbp.1	+						BDP1_uc003kbo.2_Intron|BDP1_uc003kbq.1_Intron|BDP1_uc003kbr.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGGGAGAGCATTTTCCTTGAA	0.328													4	2	---	---	---	---	
UTP15	84135	broad.mit.edu	37	5	72874391	72874391	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72874391delT	uc003kcw.1	+						UTP15_uc011cso.1_Intron|UTP15_uc011csp.1_Intron|UTP15_uc010ize.1_Intron	NM_032175	NP_115551	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein,						rRNA processing	cytoplasm|nucleolus					0		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		AAGTTACTCCTTTTTTTTTTT	0.289													9	4	---	---	---	---	
FAM169A	26049	broad.mit.edu	37	5	74096090	74096090	+	Intron	DEL	T	-	-	rs113346993		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74096090delT	uc003kdm.2	-						FAM169A_uc010izm.2_Intron|FAM169A_uc003kdl.2_Intron	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049												0						TTTTTGTTTGTTTTTTTTTTG	0.284													3	4	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94845063	94845063	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94845063delA	uc003klb.2	-							NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						aggaaaaaagaaaaaaaacct	0.000													4	2	---	---	---	---	
PCDH1	5097	broad.mit.edu	37	5	141237529	141237529	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141237529delA	uc003llp.2	-							NM_032420	NP_115796	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 2 precursor						cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		ACAGCTTCCTAAAAGAAGCAG	0.478													4	2	---	---	---	---	
SPARC	6678	broad.mit.edu	37	5	151049603	151049603	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151049603delA	uc003luh.2	-						GM2A_uc011dcs.1_Intron|SPARC_uc003lug.2_Intron|SPARC_uc003lui.2_Intron	NM_003118	NP_003109	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich						ossification|platelet activation|platelet degranulation|signal transduction	basement membrane|extracellular space|platelet alpha granule lumen	calcium ion binding|collagen binding			central_nervous_system(1)	1		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)	Becaplermin(DB00102)	AGATATAGGGAAAAAAATCCT	0.289													4	2	---	---	---	---	
DOCK2	1794	broad.mit.edu	37	5	169151756	169151756	+	Intron	DEL	T	-	-	rs68048448		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169151756delT	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCTTTTGTCTTTTTTTTTTT	0.448													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	176756532	176756532	+	IGR	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176756532delC								MXD3 (17240 upstream) : LMAN2 (2032 downstream)																							CAAAGACTCACCAACCATGCT	0.408													4	2	---	---	---	---	
ZFP2	80108	broad.mit.edu	37	5	178349879	178349879	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178349879delT	uc003mjn.1	+						ZFP2_uc010jky.2_Intron|ZFP2_uc010jkx.1_Intron	NM_030613	NP_085116	Q6ZN57	ZFP2_HUMAN	zinc finger protein 2 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		CCCTGAGAGATTGTACCTTCT	0.224													40	20	---	---	---	---	
HNRNPH1	3187	broad.mit.edu	37	5	179046625	179046626	+	Intron	INS	-	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179046625_179046626insA	uc003mkf.3	-						HNRNPH1_uc011dgn.1_5'Flank|HNRNPH1_uc003mkg.3_Intron|HNRNPH1_uc003mke.3_Intron|HNRNPH1_uc003mkh.3_Intron	NM_005520	NP_005511	P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1						regulation of RNA splicing	actin cytoskeleton|catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|poly(U) RNA binding|protein binding				0						CAGTATATATTAAAAAAAACTT	0.267													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	5810004	5810005	+	IGR	DEL	GT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5810004_5810005delGT								FARS2 (38188 upstream) : NRN1 (188230 downstream)																							AACACCTGTGGTGTGTGTGTGG	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8495018	8495018	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8495018delT	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																		ctaatttttcttttttttttc	0.015													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	51966165	51966165	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51966165delT								PKHD1 (13742 upstream) : MIR206 (42982 downstream)																							CTCAGCCCAGTTTTCCACTCC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57593772	57593772	+	IGR	DEL	A	-	-	rs11311756		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57593772delA								PRIM2 (80397 upstream) : GUSBL2 (652387 downstream)																							CTTAAgagtcatttttttagt	0.189													4	2	---	---	---	---	
CD109	135228	broad.mit.edu	37	6	74490459	74490464	+	Intron	DEL	TATGTA	-	-	rs67214511		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74490459_74490464delTATGTA	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						ATTTTTCCTTtatgtatatgtatttc	0.126													6	3	---	---	---	---	
CD109	135228	broad.mit.edu	37	6	74491385	74491395	+	Intron	DEL	ATATTTTTGAA	-	-	rs149119160		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74491385_74491395delATATTTTTGAA	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						AAGGAGCAACATATTTTTGAAATATTTTTGT	0.294													4	2	---	---	---	---	
SFRS18	25957	broad.mit.edu	37	6	99862807	99862808	+	Intron	INS	-	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99862807_99862808insA	uc003ppo.3	-						SFRS18_uc003ppp.3_Intron|SFRS18_uc011eag.1_Intron|SFRS18_uc003ppr.2_Intron|SFRS18_uc003ppt.2_Intron|SFRS18_uc003pps.2_Intron	NM_032870	NP_116259	Q8TF01	PNISR_HUMAN	splicing factor, arginine/serine-rich 130							nuclear speck					0		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0631)		AAAAAGACTTTAAAAAAAACTC	0.287													4	2	---	---	---	---	
MARCKS	4082	broad.mit.edu	37	6	114181210	114181210	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114181210delA	uc003pvy.3	+	2	849	c.454delA	c.(454-456)AAAfs	p.K152fs		NM_002356	NP_002347	P29966	MARCS_HUMAN	myristoylated alanine-rich protein kinase C	152	Calmodulin-binding (PSD).				energy reserve metabolic process|regulation of insulin secretion	actin cytoskeleton|plasma membrane	actin filament binding|calmodulin binding				0		all_cancers(87;7.65e-05)|all_epithelial(87;0.000296)|all_hematologic(75;0.0172)|Colorectal(196;0.0317)|all_lung(197;0.198)		Epithelial(106;1.59e-07)|all cancers(137;9.85e-07)|OV - Ovarian serous cystadenocarcinoma(136;0.000322)		CGAGACCCCGAAAAAAAAAAA	0.612													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116118696	116118696	+	IGR	DEL	A	-	-	rs71554836		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116118696delA								None (None upstream) : FRK (143997 downstream)																							CAAAGTTATCACAGGTGTTGG	0.418													1	5	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117710369	117710370	+	Intron	INS	-	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117710369_117710370insT	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AATGTATAAACTTTTTTTTTAG	0.302			T	GOPC|ROS1	glioblastoma|NSCLC								4	2	---	---	---	---	
TPD52L1	7164	broad.mit.edu	37	6	125550033	125550033	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125550033delT	uc003pzu.1	+						TPD52L1_uc003pzv.1_Intron|TPD52L1_uc003pzw.1_Intron|TPD52L1_uc003pzx.1_Intron|TPD52L1_uc003pzy.1_Intron|TPD52L1_uc003pzz.1_Intron	NM_003287	NP_003278	Q16890	TPD53_HUMAN	tumor protein D52-like 1 isoform 1						DNA fragmentation involved in apoptotic nuclear change|G2/M transition of mitotic cell cycle|induction of apoptosis|positive regulation of JNK cascade|positive regulation of MAP kinase activity	perinuclear region of cytoplasm	caspase activator activity|protein heterodimerization activity|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		acaatctcactttttttttta	0.085													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	144635294	144635294	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144635294delC	uc003qkt.2	+						UTRN_uc010khq.1_Intron	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGGCAGTTTGCCCAGACTAGA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	154298455	154298456	+	IGR	DEL	CT	-	-	rs148305858		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154298455_154298456delCT								RGS17 (846066 upstream) : OPRM1 (33180 downstream)																							GATTCTCTGACTCTTTTCACAA	0.381													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	161397455	161397456	+	IGR	INS	-	TAT	TAT	rs149768065	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161397455_161397456insTAT								PLG (223110 upstream) : MAP3K4 (15366 downstream)																							ttggggtaaaatatgactttct	0.000													11	6	---	---	---	---	
LOC389458	389458	broad.mit.edu	37	7	5073764	5073764	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5073764delG	uc003snr.2	+											Synthetic construct DNA, clone: pF1KB3788, Homo sapiens RBAK gene for RB-associated KRAB repressor, complete cds, without stop codon, in Flexi system.												0						ATGGGGGTCTGGGGAGGGGTT	0.532													4	2	---	---	---	---	
ISPD	729920	broad.mit.edu	37	7	16374181	16374182	+	Intron	DEL	GG	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16374181_16374182delGG	uc010ktx.2	-						ISPD_uc010kty.2_Intron	NM_001101426	NP_001094896	A4D126	ISPD_HUMAN	notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1						ACTCAGCCTTGGAGTCCTTCAC	0.470										Multiple Myeloma(15;0.18)			4	2	---	---	---	---	
C7orf41	222166	broad.mit.edu	37	7	30182299	30182299	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30182299delC	uc011kab.1	+						C7orf41_uc010kvr.1_Intron|C7orf41_uc003tar.1_Intron	NM_152793	NP_690006	Q8N3F0	CG041_HUMAN	hypothetical protein LOC222166												0						TTAAACTCTGCccccccagca	0.313													4	2	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	35029257	35029257	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35029257delA	uc003tem.3	-							NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						caacaacaacaaaaaaAAAAA	0.134													6	3	---	---	---	---	
IKZF1	10320	broad.mit.edu	37	7	50443949	50443949	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50443949delA	uc003tow.3	+						IKZF1_uc003tox.3_Intron|IKZF1_uc003toy.3_Intron|IKZF1_uc011kck.1_Intron|IKZF1_uc003toz.3_Intron|IKZF1_uc010kyx.2_Intron	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)						cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	p.?(14)		haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GGAACTATGTAAATACCTTTC	0.532			D		ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56994143	56994144	+	IGR	DEL	GA	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56994143_56994144delGA								DKFZp434L192 (429166 upstream) : ZNF479 (193184 downstream)																							gcccagagtggagaggagtaaa	0.104													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61815251	61815252	+	IGR	DEL	AA	-	-	rs62455630		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61815251_61815252delAA								None (None upstream) : LOC643955 (936420 downstream)																							GCATcattataagacagaaaat	0.109													4	4	---	---	---	---	
RFC2	5982	broad.mit.edu	37	7	73268199	73268199	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73268199delG	uc011kfa.1	-							NM_181471		P35250	RFC2_HUMAN	replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2						CAGGGGTGCTGGGAGAATGTC	0.323													4	2	---	---	---	---	
CLIP2	7461	broad.mit.edu	37	7	73771615	73771615	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73771615delG	uc003uam.2	+	6	1350	c.1023delG	c.(1021-1023)ACGfs	p.T341fs	CLIP2_uc003uan.2_Frame_Shift_Del_p.T341fs	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	341	Ser-rich.					microtubule associated complex				skin(3)	3						TGCAGCTCACGGAGACCTCTT	0.597													4	2	---	---	---	---	
CACNA2D1	781	broad.mit.edu	37	7	81965000	81965001	+	Intron	DEL	GA	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81965000_81965001delGA	uc003uhr.1	-							NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	CTACAGAACGGAGAGAGAGAGA	0.446													4	2	---	---	---	---	
PCLO	27445	broad.mit.edu	37	7	82457498	82457499	+	Intron	INS	-	T	T	rs146095985	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82457498_82457499insT	uc003uhx.2	-						PCLO_uc003uhv.2_Intron|PCLO_uc003uht.1_Intron|PCLO_uc003uhu.1_Intron	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGCCCTTATGATTTTTTTTTAA	0.287													6	3	---	---	---	---	
SEMA3D	223117	broad.mit.edu	37	7	84697822	84697822	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84697822delG	uc003uic.2	-						SEMA3D_uc010led.2_Intron|SEMA3D_uc010lee.1_Intron	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor						cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						ATATAATACTGAGTGAATTTT	0.338													4	2	---	---	---	---	
KRIT1	889	broad.mit.edu	37	7	91855629	91855629	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91855629delA	uc003ulq.1	-						KRIT1_uc010lev.1_Intron|KRIT1_uc003ulr.1_Intron|KRIT1_uc003uls.1_Intron|KRIT1_uc003ult.1_Intron|KRIT1_uc003ulu.1_Intron|KRIT1_uc003ulv.1_Intron	NM_194456	NP_919438	O00522	KRIT1_HUMAN	krev interaction trapped 1 isoform 1						angiogenesis|cell redox homeostasis|negative regulation of angiogenesis|negative regulation of endothelial cell apoptosis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|regulation of establishment of cell polarity|small GTPase mediated signal transduction	cell-cell junction|cytoskeleton	protein binding|small GTPase regulator activity			ovary(2)|lung(1)	3	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			taaaaaatctaaaaaaaAAAT	0.114									Familial_Cerebral_Cavernous_Angioma				4	3	---	---	---	---	
PEX1	5189	broad.mit.edu	37	7	92123366	92123366	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92123366delT	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GTTTCTTGCATTTTTTTTTCC	0.323													5	3	---	---	---	---	
PMPCB	9512	broad.mit.edu	37	7	102937696	102937697	+	5'Flank	DEL	AT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102937696_102937697delAT	uc003vbl.2	+						PMPCB_uc010liu.1_5'Flank|PMPCB_uc003vbk.1_5'Flank|PMPCB_uc003vbm.2_5'Flank|PMPCB_uc010liv.2_5'Flank|PMPCB_uc010liw.2_5'Flank|PMPCB_uc011kll.1_5'Flank|PMPCB_uc011klm.1_5'Flank	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit						proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						gatcgataaaATAACTGATGAT	0.386											OREG0018240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103127001	103127001	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103127001delA	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		acaactttacaaaaaaaaaaa	0.124													7	4	---	---	---	---	
PTPRZ1	5803	broad.mit.edu	37	7	121522702	121522702	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121522702delA	uc003vjy.2	+						PTPRZ1_uc003vjz.2_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,						central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						ttgagcagtgaaatgactgga	0.000													4	2	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126541197	126541197	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126541197delT	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	ccctgaactattttttttttc	0.020										HNSCC(24;0.065)			6	3	---	---	---	---	
NRF1	4899	broad.mit.edu	37	7	129367307	129367307	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129367307delT	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						TGAGCTTCGATTTTTTTTTCT	0.373													5	3	---	---	---	---	
ZC3HAV1L	92092	broad.mit.edu	37	7	138711009	138711009	+	3'UTR	DEL	A	-	-	rs72045931		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138711009delA	uc003vum.1	-	5						NM_080660	NP_542391	Q96H79	ZCCHL_HUMAN	zinc finger CCCH-type, antiviral 1-like												0						ATATTAAGTGAAAAAAAAAAA	0.318													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141563611	141563612	+	IGR	INS	-	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141563611_141563612insA								PRSS37 (22326 upstream) : OR9A4 (55064 downstream)																							CTCTGTCCTGGGGACAATCCTT	0.366													7	4	---	---	---	---	
RNF32	140545	broad.mit.edu	37	7	156463514	156463514	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156463514delT	uc003wmo.2	+						RNF32_uc010lqm.2_Intron|RNF32_uc003wmq.2_Intron|RNF32_uc003wmr.2_Intron|RNF32_uc003wmu.2_Intron	NM_030936	NP_112198	Q9H0A6	RNF32_HUMAN	ring finger protein 32							aggresome|endosome	protein binding|zinc ion binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		aacgtcttcgttaaaggaaat	0.000													4	2	---	---	---	---	
AMAC1L2	83650	broad.mit.edu	37	8	11188433	11188442	+	5'Flank	DEL	AAAAAGAAAG	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11188433_11188442delAAAAAGAAAG	uc003wtp.1	+							NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme							integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		taaaaaaaaaaaaaagaaaGAAAGAAAGAA	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	15864764	15864764	+	IGR	DEL	G	-	-	rs112023325		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15864764delG								TUSC3 (242771 upstream) : MSR1 (100624 downstream)																							aaagtaaaaagaaaaaaaaaA	0.234													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20517685	20517686	+	IGR	INS	-	T	T	rs140099851	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20517685_20517686insT								LZTS1 (404882 upstream) : None (None downstream)																							atattttaatcttttttttctg	0.000													4	2	---	---	---	---	
CHD7	55636	broad.mit.edu	37	8	61602846	61602846	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61602846delT	uc003xue.2	+							NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7						central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			atgtttatagtttttttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	62700828	62700828	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62700828delT								ASPH (73629 upstream) : NKAIN3 (460673 downstream)																							TTAATTTTTCTTTTTTTTTCA	0.289													6	3	---	---	---	---	
NCALD	83988	broad.mit.edu	37	8	102946896	102946897	+	Intron	INS	-	T	T	rs149586436	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102946896_102946897insT	uc003ykf.2	-						NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_001040628	NP_001035718	P61601	NCALD_HUMAN	neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			gttttattagatatgacaggaa	0.074													3	3	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113403257	113403261	+	Intron	DEL	AACTC	-	-	rs35793283		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113403257_113403261delAACTC	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CACTACAATTAACTCAATAACAGCA	0.259										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	118525443	118525445	+	IGR	DEL	CCT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118525443_118525445delCCT								SLC30A8 (336491 upstream) : MED30 (7520 downstream)																							TAAGAGGTTCCCTCCTCCTCCTC	0.429													4	2	---	---	---	---	
MRPL13	28998	broad.mit.edu	37	8	121429707	121429707	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121429707delT	uc003ypa.2	-						MRPL13_uc010mdf.2_Intron	NM_014078	NP_054797	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13						translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome			central_nervous_system(1)	1	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			tccttccatattttttatatg	0.000													4	2	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141840863	141840864	+	Intron	INS	-	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141840863_141840864insT	uc003yvu.2	-						PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			AATCCTTTTGGTTTTTTCTTTT	0.267													4	2	---	---	---	---	
C9orf11	54586	broad.mit.edu	37	9	27297260	27297260	+	5'Flank	DEL	A	-	-	rs7875090	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27297260delA	uc003zql.2	-						C9orf11_uc011lnq.1_5'Flank|C9orf11_uc003zqm.2_5'Flank	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1							acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		GTTTTTAGTTATTTTTTAAAT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68393548	68393548	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68393548delA								FAM27B (599359 upstream) : MIR1299 (608691 downstream)																							atatccctttagcatttcttg	0.000													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68426353	68426353	+	IGR	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68426353delG								FAM27B (632164 upstream) : MIR1299 (575886 downstream)																							TCTTGAAGGCGGTGTTCCTCA	0.313													4	2	---	---	---	---	
SPTLC1	10558	broad.mit.edu	37	9	94829935	94829935	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94829935delG	uc004arl.1	-						SPTLC1_uc011ltv.1_Intron|SPTLC1_uc004arm.1_Intron	NM_006415	NP_006406	O15269	SPTC1_HUMAN	serine palmitoyltransferase subunit 1 isoform a							integral to membrane|SPOTS complex	protein binding|pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			ovary(1)|breast(1)	2					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	CGGGCAGTCTGACTGACAACG	0.507													4	2	---	---	---	---	
RC3H2	54542	broad.mit.edu	37	9	125639776	125639776	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125639776delA	uc010mwc.1	-	9	1540	c.1299delT	c.(1297-1299)TTTfs	p.F433fs	RC3H2_uc004bnc.2_RNA|RC3H2_uc004bnd.1_Frame_Shift_Del_p.F433fs|RC3H2_uc004bne.3_Frame_Shift_Del_p.F433fs|RC3H2_uc011lzf.1_Frame_Shift_Del_p.F170fs|RC3H2_uc011lzg.1_Frame_Shift_Del_p.F433fs	NM_001100588	NP_001094058	Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type zinc finger domains 2	433	C3H1-type.					cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding			ovary(2)|lung(2)	4						GAGAATGGGCAAATGTACAAT	0.398													340	152	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	129063359	129063359	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129063359delT								PBX3 (333706 upstream) : FAM125B (25769 downstream)																							CCAATCCAGATTTTTTTTGGC	0.065													4	2	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137559169	137559169	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137559169delC	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGAAATGCCTCCAGGCCCTCT	0.552													4	2	---	---	---	---	
SEC61A2	55176	broad.mit.edu	37	10	12202709	12202710	+	Intron	DEL	AA	-	-	rs149915491		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12202709_12202710delAA	uc001ile.2	+						SEC61A2_uc010qbq.1_Intron|SEC61A2_uc001ilf.3_Intron|SEC61A2_uc001ilh.3_Intron|SEC61A2_uc001ilg.3_Intron	NM_018144	NP_060614	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform a							endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				AAAATGACTCAATATTTTCACA	0.277													3	7	---	---	---	---	
FAM171A1	221061	broad.mit.edu	37	10	15318181	15318181	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15318181delT	uc001iob.2	-							NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor							integral to membrane				ovary(2)|breast(1)|skin(1)	4						AGAAGttttcttttttttttc	0.149													4	2	---	---	---	---	
BMI1	648	broad.mit.edu	37	10	22616126	22616126	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22616126delT	uc001irh.2	+						BMI1_uc009xkg.2_Intron	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene						hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2						GATTTTAAGATTTTTTTTTCC	0.328													4	2	---	---	---	---	
MYO3A	53904	broad.mit.edu	37	10	26345612	26345612	+	Intron	DEL	G	-	-	rs34669089		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26345612delG	uc001isn.2	+						MYO3A_uc009xko.1_Intron|MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA						protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						ATGTGTTCAAGTTCCAAATGC	0.383													3	3	---	---	---	---	
ANKRD26	22852	broad.mit.edu	37	10	27375563	27375564	+	Intron	INS	-	TT	TT			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27375563_27375564insTT	uc001ith.2	-						ANKRD26_uc009xku.1_Intron	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						ATGTAACAAAATTATGTTAATA	0.272													240	107	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51633256	51633256	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51633256delT	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|uc010qhh.1_Intron	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		GTGAAGATAATTTTTTTTTTC	0.294													4	3	---	---	---	---	
RNLS	55328	broad.mit.edu	37	10	90210753	90210754	+	Intron	INS	-	AAG	AAG	rs148139301	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90210753_90210754insAAG	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_Intron	NM_001031709	NP_001026879	Q5VYX0	RNLS_HUMAN	renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1						TGACAGGAAAAAAGTTGTCCAA	0.450													5	4	---	---	---	---	
SH3PXD2A	9644	broad.mit.edu	37	10	105380650	105380650	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105380650delG	uc001kxj.1	-						SH3PXD2A_uc010qqr.1_Intron|SH3PXD2A_uc010qqs.1_Intron|SH3PXD2A_uc010qqt.1_Intron|SH3PXD2A_uc009xxn.1_Intron|SH3PXD2A_uc010qqu.1_Intron	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		ccttgtgagtgttgctgtgga	0.189													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128600769	128600769	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128600769delG	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		aggctgaggtgggcgggtcac	0.000													4	2	---	---	---	---	
RBM4	5936	broad.mit.edu	37	11	66410772	66410772	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66410772delT	uc009yrj.2	+						RBM4_uc009yrk.2_Intron|RBM4_uc001oiw.1_Intron|RBM4_uc001oix.1_Intron|RBM4_uc010rpj.1_Intron|RBM4_uc001oiy.1_Intron|RBM4_uc001oiz.1_Intron	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4						circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		ATGTTGAGTCTTTTTTTTTTT	0.343													8	6	---	---	---	---	
C11orf80	79703	broad.mit.edu	37	11	66581711	66581711	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66581711delT	uc001ojf.2	+						C11orf80_uc001ojg.2_Intron|C11orf80_uc001ojh.2_Intron|C11orf80_uc001oji.2_Intron|C11orf80_uc010rpl.1_Intron|C11orf80_uc001ojj.2_Intron	NM_024650	NP_078926	Q8N6T0	CK080_HUMAN	hypothetical protein LOC79703												0						GCATTGCATGTTTTTTTTTGT	0.269													4	2	---	---	---	---	
LRP5	4041	broad.mit.edu	37	11	68078497	68078498	+	5'Flank	INS	-	G	G			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68078497_68078498insG	uc001ont.2	+						LRP5_uc009ysg.2_5'Flank	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein						adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						atcaggtggaagggggtcgagg	0.000													4	2	---	---	---	---	
ALKBH8	91801	broad.mit.edu	37	11	107422421	107422421	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107422421delA	uc010rvr.1	-						ALKBH8_uc001pjk.2_Intron|ALKBH8_uc010rvq.1_Intron|ALKBH8_uc009yxp.2_Intron|ALKBH8_uc001pjl.2_Intron	NM_138775	NP_620130	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8						response to DNA damage stimulus	cytosol|nucleus	metal ion binding|nucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|protein binding|RNA binding|tRNA (uracil) methyltransferase activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		actccatctcaaaaaaaaaaa	0.095													10	5	---	---	---	---	
ARHGEF12	23365	broad.mit.edu	37	11	120329653	120329653	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120329653delA	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GGAATACACTAAAAAAAATAG	0.323			T	MLL	AML								5	3	---	---	---	---	
UBASH3B	84959	broad.mit.edu	37	11	122680263	122680264	+	Intron	DEL	AT	-	-	rs146476661		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122680263_122680264delAT	uc001pyi.3	+							NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,							cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		TGCAATGTAAATACTCTTCTAA	0.351													6	3	---	---	---	---	
FLI1	2313	broad.mit.edu	37	11	128666946	128666947	+	Intron	DEL	TG	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128666946_128666947delTG	uc010sbu.1	+						FLI1_uc010sbt.1_Intron|FLI1_uc010sbv.1_Intron|FLI1_uc009zci.2_Intron	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1						hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		TCTGCTACACTGAACCCAGAGA	0.322			T	EWSR1	Ewing sarcoma								4	2	---	---	---	---	
VWF	7450	broad.mit.edu	37	12	6092567	6092568	+	Intron	INS	-	GATAGATA	GATAGATA	rs138350612	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6092567_6092568insGATAGATA	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	ACATGGGTTAGgatagatagat	0.198													6	3	---	---	---	---	
CLEC4D	338339	broad.mit.edu	37	12	8674037	8674038	+	3'UTR	DEL	TG	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8674037_8674038delTG	uc001qun.2	+	6						NM_080387	NP_525126	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D						innate immune response	integral to membrane	sugar binding				0	Lung SC(5;0.184)					CAtgtgtgtatgtgtgtgtgtg	0.282													11	5	---	---	---	---	
ABCC9	10060	broad.mit.edu	37	12	21971393	21971398	+	Intron	DEL	TATATC	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21971393_21971398delTATATC	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	TCTCACtatatatatctatatctata	0.184													4	2	---	---	---	---	
LRMP	4033	broad.mit.edu	37	12	25235121	25235122	+	Intron	INS	-	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25235121_25235122insA	uc001rgh.2	+						LRMP_uc001rgg.1_Intron|LRMP_uc010sja.1_Intron|LRMP_uc010sjb.1_Intron|LRMP_uc001rgi.2_Intron|LRMP_uc010sjc.1_Intron|LRMP_uc010sjd.1_Intron	NM_006152	NP_006143	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein						vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					TGTGTCTAGGGAGATAAACTGG	0.267													4	2	---	---	---	---	
CCDC91	55297	broad.mit.edu	37	12	28605234	28605235	+	Intron	INS	-	AA	AA			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28605234_28605235insAA	uc001riq.2	+						CCDC91_uc001rio.2_Intron|CCDC91_uc009zjk.2_Intron|CCDC91_uc001rip.1_Intron|CCDC91_uc001rir.2_Intron|CCDC91_uc009zjl.2_Intron	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner						protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					AATATTTGTATAAAAAAGAATA	0.228													10	7	---	---	---	---	
SLC4A8	9498	broad.mit.edu	37	12	51827656	51827663	+	Intron	DEL	TTTTTTTG	-	-	rs12817572		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51827656_51827663delTTTTTTTG	uc001rys.1	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc001ryp.1_Intron|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryq.3_Intron|SLC4A8_uc001ryr.2_Intron|SLC4A8_uc010snk.1_Intron	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		tttttttttttttttttggttggttttt	0.000													4	2	---	---	---	---	
ESPL1	9700	broad.mit.edu	37	12	53685373	53685373	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53685373delA	uc001sck.2	+						ESPL1_uc001scj.2_Intron	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase						apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						agactctgtcaaaaaaaaaag	0.209													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	56062199	56062199	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56062199delA								OR10P1 (30583 upstream) : METTL7B (13131 downstream)																							CCACGGGGAGAAAAAAAAATC	0.493													4	2	---	---	---	---	
AVIL	10677	broad.mit.edu	37	12	58202497	58202497	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58202497delA	uc001sqj.1	-						AVIL_uc009zqe.1_Intron|AVIL_uc001sqk.1_5'Flank|AVIL_uc001sql.3_Intron	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin						actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GTACCTGCCTAAAAAAAAAAT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68831556	68831557	+	IGR	INS	-	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68831556_68831557insA								MDM1 (105395 upstream) : RAP1B (173095 downstream)																							aATTTTTAAGGAAAAAAAAAAG	0.223													4	2	---	---	---	---	
KCNMB4	27345	broad.mit.edu	37	12	70796606	70796606	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70796606delG	uc001svx.2	+							NM_014505	NP_055320	Q86W47	KCMB4_HUMAN	calcium-activated potassium channel beta 4						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of neurotransmitter secretion|regulation of vasoconstriction|synaptic transmission	voltage-gated potassium channel complex	calcium-activated potassium channel activity|protein binding				0	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			taatatagttgcttcagttcc	0.000													4	2	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78392511	78392511	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78392511delT	uc001syp.2	+						NAV3_uc001syo.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAACAGGTCCTTCCAAATGCA	0.264										HNSCC(70;0.22)			6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80151092	80151093	+	IGR	INS	-	TT	TT	rs146528988	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80151092_80151093insTT								PAWR (66302 upstream) : PPP1R12A (16251 downstream)																							gaacaaactcagcctttagcaa	0.000													2	4	---	---	---	---	
NR2C1	7181	broad.mit.edu	37	12	95445934	95445935	+	Intron	INS	-	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95445934_95445935insT	uc001tdm.3	-						NR2C1_uc010suu.1_Intron|NR2C1_uc001tdo.3_Intron|NR2C1_uc001tdn.3_Intron	NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						ATGTTACtttgttttttttttt	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98259612	98259613	+	IGR	INS	-	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98259612_98259613insC								RMST (300819 upstream) : LOC100128191 (647140 downstream)																							CCTCAATCTATCCCCCCAGGTG	0.386													4	2	---	---	---	---	
SCYL2	55681	broad.mit.edu	37	12	100711988	100711988	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100711988delG	uc001thn.2	+						SCYL2_uc009ztw.1_Intron|SCYL2_uc001thm.1_Intron	NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 protein						endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6						GTACTATTATGGAAGAAGATT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	104749515	104749516	+	IGR	INS	-	C	C	rs138330943	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104749515_104749516insC								TXNRD1 (5457 upstream) : CHST11 (101233 downstream)																							aagtgcaaaggcctgaggcagc	0.000													2	4	---	---	---	---	
SSH1	54434	broad.mit.edu	37	12	109211047	109211047	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109211047delA	uc001tnm.2	-						SSH1_uc010sxg.1_Intron|SSH1_uc001tnn.3_Intron|SSH1_uc001tno.1_5'UTR	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1						actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						TCTGGGAGTTAAAAATGAAGA	0.274													4	2	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109647447	109647447	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109647447delA	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	AGCATTTCCCAAAAAATAAAC	0.378													4	2	---	---	---	---	
TAOK3	51347	broad.mit.edu	37	12	118632552	118632553	+	Intron	DEL	TT	-	-	rs61349665	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118632552_118632553delTT	uc001twx.2	-						TAOK3_uc001tww.2_Intron|TAOK3_uc001twy.3_Intron	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTAGAATGGCTTTTTTTCCCCC	0.243													4	2	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119558340	119558341	+	Intron	DEL	TA	-	-	rs59057088		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119558340_119558341delTA	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						GTCTCATTACTACCCCTGCCAC	0.515													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131853894	131853895	+	IGR	DEL	GA	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131853894_131853895delGA								LOC116437 (156419 upstream) : SFRS8 (341740 downstream)																							CTCCTCACCTGATCCCCTTCAG	0.624													4	2	---	---	---	---	
GALNT9	50614	broad.mit.edu	37	12	132808286	132808286	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132808286delT	uc001ukc.3	-						GALNT9_uc009zyr.2_Intron|GALNT9_uc001ukb.2_Intron	NM_001122636	NP_001116108	Q9HCQ5	GALT9_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide						protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		tgacacctgcttttacctgtt	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	25300994	25300995	+	IGR	INS	-	TCCT	TCCT	rs140345459	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25300994_25300995insTCCT								ATP12A (15077 upstream) : RNF17 (37306 downstream)																							CCTCAACTCTGTAAGGCAAGGC	0.302													4	5	---	---	---	---	
USP12	219333	broad.mit.edu	37	13	27743171	27743171	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27743171delC	uc001uqy.2	-							NM_182488	NP_872294	O75317	UBP12_HUMAN	ubiquitin thiolesterase 12						protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)	1		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)		ACCCGGCATACCAGGAGGAGG	0.468													4	2	---	---	---	---	
NBEA	26960	broad.mit.edu	37	13	35692160	35692161	+	Intron	DEL	TT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35692160_35692161delTT	uc001uvb.2	+							NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TACTAATGACTTTTAAAAATTG	0.223													5	3	---	---	---	---	
NUFIP1	26747	broad.mit.edu	37	13	45562997	45562997	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45562997delT	uc001uzp.2	-						KIAA1704_uc010tfo.1_5'Flank|KIAA1704_uc001uzq.2_5'Flank|KIAA1704_uc001uzr.1_5'Flank|KIAA1704_uc001uzs.2_5'Flank	NM_012345	NP_036477	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein						box C/D snoRNP assembly|positive regulation of transcription from RNA polymerase II promoter|RNA processing	actin cytoskeleton|cytosolic ribosome|nuclear matrix|nucleolus|perichromatin fibrils|pre-snoRNP complex|presynaptic active zone|transcription elongation factor complex	DNA binding|identical protein binding|protein binding, bridging|RNA binding|zinc ion binding				0		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		gctaattttattttttttgta	0.174													4	2	---	---	---	---	
COMMD6	170622	broad.mit.edu	37	13	76104644	76104644	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76104644delA	uc001vjo.1	-						COMMD6_uc001vjn.1_Intron|COMMD6_uc010aet.1_Intron|COMMD6_uc001vjp.1_Intron	NM_203495	NP_987091	Q7Z4G1	COMD6_HUMAN	COMM domain containing 6 isoform b							cytoplasm|nucleus	protein binding				0		Breast(118;0.0979)|Prostate(6;0.122)		GBM - Glioblastoma multiforme(99;0.0104)		ACAAAAAGTGAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20081407	20081408	+	IGR	DEL	AC	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20081407_20081408delAC								P704P (61135 upstream) : OR4Q3 (134179 downstream)																							ATATATGTGGacacacacacac	0.257													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	49848497	49848497	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49848497delT								None (None upstream) : SDCCAG1 (184530 downstream)																							TAATGCTCCGTTTTAGGTATG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	51171494	51171495	+	IGR	DEL	GA	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51171494_51171495delGA								SAV1 (36471 upstream) : NIN (14987 downstream)																							GGCTGCGCTGGAGCAGGAGTTG	0.609													3	3	---	---	---	---	
FRMD6	122786	broad.mit.edu	37	14	52188464	52188464	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52188464delG	uc001wzd.2	+						FRMD6_uc001wzb.2_Intron|FRMD6_uc001wzc.2_Intron|FRMD6_uc001wze.2_Intron|FRMD6_uc001wzf.2_Intron|FRMD6_uc001wzg.2_Intron	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					gaggaaggaagggaggaagga	0.184													5	3	---	---	---	---	
FRMD6	122786	broad.mit.edu	37	14	52188469	52188471	+	Intron	DEL	GAA	-	-	rs149590944	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52188469_52188471delGAA	uc001wzd.2	+						FRMD6_uc001wzb.2_Intron|FRMD6_uc001wzc.2_Intron|FRMD6_uc001wze.2_Intron|FRMD6_uc001wzf.2_Intron|FRMD6_uc001wzg.2_Intron	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					aggaagggaggaaggaaggaggg	0.187													6	3	---	---	---	---	
KTN1	3895	broad.mit.edu	37	14	56103556	56103556	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56103556delT	uc001xcb.2	+						KTN1_uc001xce.2_Intron|KTN1_uc001xcc.2_Intron|KTN1_uc001xcd.2_Intron|KTN1_uc010trb.1_Intron|KTN1_uc001xcf.1_Intron	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a						microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7						TGGTTAATTCTTTTTTTTTTT	0.323			T	RET	papillary thryoid								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66505598	66505602	+	IGR	DEL	AATCC	-	-	rs71979237		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66505598_66505602delAATCC								FUT8 (295637 upstream) : C14orf53 (447507 downstream)																							GGGTACAAGAAATCCAATGCAGTGA	0.444													3	4	---	---	---	---	
ATP6V1D	51382	broad.mit.edu	37	14	67807396	67807396	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67807396delC	uc001xjf.2	-						ATP6V1D_uc001xje.2_Intron	NM_015994	NP_057078	Q9Y5K8	VATD_HUMAN	H(+)-transporting two-sector ATPase						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain|vacuolar proton-transporting V-type ATPase complex	protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)|lung(1)	2				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		ctcttcctctccccctccccc	0.040													4	2	---	---	---	---	
HEATR4	399671	broad.mit.edu	37	14	73989820	73989820	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73989820delG	uc010tub.1	-	3	359	c.37delC	c.(37-39)CATfs	p.H13fs	HEATR4_uc010tua.1_5'UTR	NM_203309	NP_976054			HEAT repeat containing 4											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TAGAAGCAATGGGGGAGAAAG	0.527													4	2	---	---	---	---	
MLH3	27030	broad.mit.edu	37	14	75483428	75483428	+	3'UTR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75483428delA	uc001xrd.1	-	13					MLH3_uc001xre.1_3'UTR	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1						mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		GTGAAGCTTGAAAAAAAACTG	0.408								MMR					4	2	---	---	---	---	
POMT2	29954	broad.mit.edu	37	14	77747047	77747048	+	Intron	INS	-	GGAAAGA	GGAAAGA	rs140537636	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77747047_77747048insGGAAAGA	uc001xti.2	-						POMT2_uc001xth.1_Intron	NM_013382	NP_037514	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2						protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		GGAAAAAGAAGGGAAAGAGGAA	0.475													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	87537496	87537498	+	IGR	DEL	ACC	-	-	rs11159800	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87537496_87537498delACC								None (None upstream) : GALC (766666 downstream)																							GCCCTCTACTACCACCACCACCA	0.227													4	2	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89803701	89803701	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89803701delA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						AATGTAGGGGAAAAAAACTAA	0.443													4	2	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347465	92347468	+	Intron	DEL	ACAC	-	-	rs140834248	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347465_92347468delACAC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTTCTATTCTacacacacacacac	0.201													5	5	---	---	---	---	
FAM189A1	23359	broad.mit.edu	37	15	29730301	29730301	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29730301delC	uc010azk.1	-							NM_015307	NP_056122	O60320	F1891_HUMAN	hypothetical protein LOC23359							integral to membrane					0						catcctgcctccggccctggg	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	42944470	42944470	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42944470delA	uc001zqg.2	+						uc001zqh.2_Intron					Homo sapiens cDNA FLJ16106 fis, clone THYMU1000496, moderately similar to KINESIN-LIKE PROTEIN KIF1C.																		TCTATTGCTTAAAAAAAAAAA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	59692460	59692460	+	IGR	DEL	A	-	-	rs35538190		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59692460delA								MYO1E (27389 upstream) : FAM81A (37912 downstream)																							gaaagtcaggagtcagcccaa	0.000													6	4	---	---	---	---	
IREB2	3658	broad.mit.edu	37	15	78762520	78762520	+	Intron	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78762520delG	uc002bdr.2	+						IREB2_uc010unb.1_Intron|IREB2_uc002bdq.2_Intron	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2								4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		AGAGCCAGGTGGGGAGGAAAG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85842549	85842549	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85842549delT								PDE8A (160179 upstream) : AKAP13 (81322 downstream)																							TCTGGCACTATTTTTAGTAGC	0.393													4	2	---	---	---	---	
POLG	5428	broad.mit.edu	37	15	89867602	89867602	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89867602delT	uc002bns.3	-						POLG_uc002bnr.3_Intron	NM_002693	NP_002684	P54098	DPOG1_HUMAN	DNA-directed DNA polymerase gamma						base-excision repair, gap-filling|cell death|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CTTTCCCGGGTTTTAGACAGG	0.294								DNA_polymerases_(catalytic_subunits)					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90828371	90828372	+	IGR	INS	-	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90828371_90828372insC								TTLL13 (12928 upstream) : GABARAPL3 (61393 downstream)																							TTCTGATTATACCGTTTCACTG	0.371													150	67	---	---	---	---	
SNRNP25	79622	broad.mit.edu	37	16	107571	107571	+	3'UTR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:107571delA	uc002cfj.3	+	5					SNRNP25_uc002cfk.3_RNA	NM_024571	NP_078847	Q9BV90	SNR25_HUMAN	U11/U12 snRNP 25K protein						mRNA processing	U12-type spliceosomal complex					0						CCACACCACCAAAGCCTTGAG	0.517													4	2	---	---	---	---	
PDPK1	5170	broad.mit.edu	37	16	2600219	2600220	+	Intron	INS	-	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2600219_2600220insT	uc002cqs.2	+						PDPK1_uc002cqt.2_Intron|PDPK1_uc010bsn.2_Intron|PDPK1_uc002cqu.2_Intron|PDPK1_uc010uwe.1_Intron	NM_002613	NP_002604	O15530	PDPK1_HUMAN	3-phosphoinositide dependent protein kinase-1						actin cytoskeleton organization|activation of protein kinase B activity|insulin receptor signaling pathway|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|peptidyl-threonine phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|synaptic transmission|T cell costimulation|T cell receptor signaling pathway	cytosol|nucleoplasm|plasma membrane	3-phosphoinositide-dependent protein kinase activity|ATP binding			central_nervous_system(2)|ovary(1)	3		Ovarian(90;0.17)			Celecoxib(DB00482)	cacttaataaattttttttttt	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	11733476	11733476	+	IGR	DEL	A	-	-	rs71406262		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11733476delA								LITAF (52154 upstream) : SNN (28825 downstream)																							aaAGATTTTTAAAAAAAAAAA	0.119													4	2	---	---	---	---	
PALB2	79728	broad.mit.edu	37	16	23619548	23619548	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23619548delT	uc002dlx.1	-							NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2						double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		GTTCTtcttcttttttttttt	0.199			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33944572	33944572	+	IGR	DEL	T	-	-	rs111472633		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33944572delT								None (None upstream) : MIR1826 (20936 downstream)																							atgattaagcttactgaagat	0.030													4	2	---	---	---	---	
C16orf78	123970	broad.mit.edu	37	16	49430154	49430155	+	Intron	INS	-	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49430154_49430155insA	uc002efr.2	+							NM_144602	NP_653203	Q8WTQ4	CP078_HUMAN	hypothetical protein LOC123970											central_nervous_system(1)	1						aactcagtctcaaaaaaagaaa	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	68038958	68038958	+	IGR	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68038958delT								DPEP2 (4469 upstream) : DDX28 (16216 downstream)																							tttctttttcttttttttttg	0.214													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75594085	75594085	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75594085delA								TMEM231 (3915 upstream) : GABARAPL2 (6164 downstream)																							gaagaaagggaaaaaaaaaaa	0.224													4	2	---	---	---	---	
P2RX1	5023	broad.mit.edu	37	17	3802504	3802504	+	Intron	DEL	T	-	-	rs71381525		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3802504delT	uc002fww.2	-							NM_002558	NP_002549	P51575	P2RX1_HUMAN	purinergic receptor P2X1						platelet activation	integral to plasma membrane	calcium channel activity|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity			ovary(1)|skin(1)	2				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		CTCCtttttcttttttttttt	0.254													4	3	---	---	---	---	
USP6	9098	broad.mit.edu	37	17	5038289	5038289	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5038289delA	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|uc002gay.1_5'Flank|uc002gba.2_5'Flank|uc002gbb.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						tgtgcaaaagaaaaaaaaaat	0.169			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								6	3	---	---	---	---	
ZNF287	57336	broad.mit.edu	37	17	16471303	16471304	+	Intron	DEL	AC	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16471303_16471304delAC	uc002gqi.2	-							NM_020653	NP_065704	Q9HBT7	ZN287_HUMAN	zinc finger protein 287						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		CTATACATATACACACACAGAA	0.446													4	2	---	---	---	---	
KRT12	3859	broad.mit.edu	37	17	39021170	39021171	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39021170_39021171insT	uc002hvk.2	-	3	718_719	c.694_695insA	c.(694-696)ATCfs	p.I232fs		NM_000223	NP_000214	Q99456	K1C12_HUMAN	keratin 12	232	Rod.|Coil 1B.				visual perception	intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				CAGGCCATTGATGTCGGCCTCT	0.564													33	15	---	---	---	---	
EFTUD2	9343	broad.mit.edu	37	17	42929296	42929296	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42929296delT	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				cttattattatttttttgaga	0.169													4	2	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43869111	43869111	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43869111delC	uc010dap.2	+						CRHR1_uc010wjx.1_Intron|CRHR1_uc002ijp.2_Intron|CRHR1_uc002ijm.2_Intron|CRHR1_uc002ijn.2_Intron|CRHR1_uc010dar.2_Intron|CRHR1_uc010dao.2_Intron|CRHR1_uc010daq.2_Intron	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		TGCTCCTCCTCCCCAGAAGCA	0.527													4	2	---	---	---	---	
CACNA1G	8913	broad.mit.edu	37	17	48686266	48686267	+	Intron	DEL	CT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48686266_48686267delCT	uc002irk.1	+						CACNA1G_uc002irj.1_Intron|CACNA1G_uc002irl.1_Intron|CACNA1G_uc002irm.1_Intron|CACNA1G_uc002irn.1_Intron|CACNA1G_uc002iro.1_Intron|CACNA1G_uc002irp.1_Intron|CACNA1G_uc002irq.1_Intron|CACNA1G_uc002irr.1_Intron|CACNA1G_uc002irs.1_Intron|CACNA1G_uc002irt.1_Intron|CACNA1G_uc002irv.1_Intron|CACNA1G_uc002irw.1_Intron|CACNA1G_uc002iru.1_Intron|CACNA1G_uc002irx.1_Intron|CACNA1G_uc002iry.1_Intron|CACNA1G_uc002irz.1_Intron|CACNA1G_uc002isa.1_Intron|CACNA1G_uc002isb.1_Intron|CACNA1G_uc002isc.1_Intron|CACNA1G_uc002isd.1_Intron|CACNA1G_uc002ise.1_Intron|CACNA1G_uc002isf.1_Intron|CACNA1G_uc002isg.1_Intron|CACNA1G_uc002ish.1_Intron|CACNA1G_uc002isi.1_Intron	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G						axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	ATCTCCGCgcctctctctctct	0.317													4	2	---	---	---	---	
MSI2	124540	broad.mit.edu	37	17	55335199	55335200	+	Intron	INS	-	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55335199_55335200insT	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		CTTTCGCATAGTTTTTTTTTTT	0.376			T	HOXA9	CML								3	4	---	---	---	---	
LOC146880	146880	broad.mit.edu	37	17	62757843	62757843	+	Intron	DEL	A	-	-	rs76968253		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62757843delA	uc010wqc.1	-							NR_026899				Homo sapiens cDNA FLJ30780 fis, clone FEBRA2000856.												0						actccgtctcaaaaaaaaaaa	0.104													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70416883	70416883	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70416883delA	uc002jix.2	-						uc002jiz.1_Intron|uc002jiy.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		GTATTTCACTAAGCAGCCCCA	0.547													4	2	---	---	---	---	
TMEM104	54868	broad.mit.edu	37	17	72784801	72784802	+	Intron	INS	-	A	A			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72784801_72784802insA	uc002jls.3	+						TMEM104_uc010wrf.1_Intron|TMEM104_uc010wrg.1_Intron|TMEM104_uc010dfx.2_Intron	NM_017728	NP_060198	Q8NE00	TM104_HUMAN	transmembrane protein 104							integral to membrane					0	all_lung(278;0.23)					CATCTCTAGGGAACAGCTCTCA	0.490													4	2	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14808187	14808187	+	Intron	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14808187delT	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						CTAGGACTTATTTTTTTTTTG	0.333													4	2	---	---	---	---	
ZNF521	25925	broad.mit.edu	37	18	22660361	22660362	+	Intron	DEL	CT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22660361_22660362delCT	uc002kvk.2	-						ZNF521_uc010xbe.1_Intron|ZNF521_uc010dly.2_Intron|ZNF521_uc002kvl.2_Intron	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CAGAACACTACTCTCTCTCTCC	0.441			T	PAX5	ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36512759	36512759	+	IGR	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36512759delG								None (None upstream) : LOC647946 (274129 downstream)																							GTCTCAAAAAGGGGAGGATGA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	73921024	73921024	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73921024delA								C18orf62 (781435 upstream) : ZNF516 (150595 downstream)																							GATTAGAGACAAACGGGAGAA	0.522													4	2	---	---	---	---	
PSG6	5675	broad.mit.edu	37	19	43662782	43662782	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43662782delC	uc010xwk.1	-									Q00889	PSG6_HUMAN	SubName: Full=Pregnancy-specific beta-1 glycoprotein; Flags: Fragment;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				AGGTGTtcttcccttattgaa	0.045													4	2	---	---	---	---	
CEACAM16	388551	broad.mit.edu	37	19	45207037	45207037	+	Intron	DEL	A	-	-	rs71364503		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45207037delA	uc010xxd.1	+						CEACAM16_uc002ozq.2_Intron	NM_001039213	NP_001034302	A7LI12	A7LI12_HUMAN	carcinoembryonic antigen-related cell adhesion											ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				TCttttttttaaaaaaaaaaa	0.468													4	4	---	---	---	---	
PPP1R12C	54776	broad.mit.edu	37	19	55605585	55605586	+	Intron	INS	-	C	C			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55605585_55605586insC	uc002qix.2	-						PPP1R12C_uc010yfs.1_Intron|PPP1R12C_uc002qiy.2_Intron	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C							cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		aggagtccaggccccagcccct	0.000													3	3	---	---	---	---	
SIRPA	140885	broad.mit.edu	37	20	1892767	1892767	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1892767delA	uc002wfq.2	+						SIRPA_uc010zps.1_Intron|SIRPA_uc002wfr.2_Intron|SIRPA_uc002wfs.2_Intron|SIRPA_uc002wft.2_Intron	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor						blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GAGAGGAGCTAAAAAAAAAAT	0.473													4	2	---	---	---	---	
ATRN	8455	broad.mit.edu	37	20	3469940	3469941	+	Intron	INS	-	T	T			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3469940_3469941insT	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						gtatctttaaatttttttttGA	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23256572	23256572	+	IGR	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23256572delG								CD93 (189595 upstream) : NXT1 (74801 downstream)																							gcaagtctatgggcgccattt	0.000													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41776032	41776034	+	Intron	DEL	CAT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41776032_41776034delCAT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AAACGCCAACCATCATCATCATC	0.315													4	2	---	---	---	---	
CSE1L	1434	broad.mit.edu	37	20	47710455	47710455	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47710455delA	uc002xty.2	+						CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Intron|CSE1L_uc010ghy.2_Intron|CSE1L_uc010zyh.1_Intron	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein						apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			actccgtctcaaaaaaaaaaa	0.154													8	4	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51948276	51948277	+	Intron	INS	-	AATGTAT	AATGTAT	rs143456481	by1000genomes	TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51948276_51948277insAATGTAT	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			cagattaggaaaagggttatga	0.114													4	2	---	---	---	---	
ZNF831	128611	broad.mit.edu	37	20	57828418	57828418	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57828418delA	uc002yan.2	+							NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831							intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					TGGTTTCTTTAAAAAAAACCC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9416490	9416491	+	IGR	DEL	AA	-	-	rs71302920		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9416490_9416491delAA								None (None upstream) : None (None downstream)																							atctcccattaagttatatatt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10709864	10709864	+	IGR	DEL	A	-	-	rs141808935		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10709864delA								None (None upstream) : TPTE (196879 downstream)																							agacagaaacattctgagaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11180395	11180396	+	IGR	INS	-	A	A	rs11429487		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11180395_11180396insA								BAGE (81458 upstream) : None (None downstream)																							catttcactgcaaaaaaaatat	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11183694	11183694	+	IGR	DEL	G	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11183694delG								BAGE (84757 upstream) : None (None downstream)																							cccagtcttagggggccctac	0.000													4	2	---	---	---	---	
KRTAP19-1	337882	broad.mit.edu	37	21	31852884	31852884	+	5'Flank	DEL	T	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31852884delT	uc011acx.1	-							NM_181607	NP_853638	Q8IUB9	KR191_HUMAN	keratin associated protein 19-1							intermediate filament					0						GCTGCTTTAATTTTATTAGAA	0.378													4	2	---	---	---	---	
ADARB1	104	broad.mit.edu	37	21	46644986	46644990	+	3'UTR	DEL	TTGTT	-	-	rs6487		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46644986_46644990delTTGTT	uc002zgy.2	+	12					ADARB1_uc002zgr.2_Intron|ADARB1_uc002zgs.2_Intron|ADARB1_uc002zgw.2_Intron|ADARB1_uc002zgv.2_Intron|ADARB1_uc002zgt.2_3'UTR|ADARB1_uc010gpx.2_Intron|ADARB1_uc002zgq.2_Intron|ADARB1_uc002zgu.2_Intron	NM_015833	NP_056648	P78563	RED1_HUMAN	RNA-specific adenosine deaminase B1 isoform 2						adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding			skin(1)	1				Colorectal(79;0.115)		AGGGCTTCTGttgttttgttttgtt	0.366													4	2	---	---	---	---	
HIRA	7290	broad.mit.edu	37	22	19383533	19383533	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19383533delA	uc002zpf.1	-						HIRA_uc011agx.1_Intron|HIRA_uc010grn.1_Intron|HIRA_uc010gro.1_Intron|HIRA_uc010grp.2_Intron	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective						chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					TCCAGCCAGGAAAAAAGGCCC	0.488													4	2	---	---	---	---	
MTMR3	8897	broad.mit.edu	37	22	30399250	30399250	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30399250delA	uc003agv.3	+						MTMR3_uc003agu.3_Intron|MTMR3_uc003agw.3_Intron	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c						phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			TATCCTTCTTACATTCTGTGA	0.373													4	2	---	---	---	---	
PDGFB	5155	broad.mit.edu	37	22	39637914	39637914	+	Intron	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39637914delA	uc003axf.2	-						PDGFB_uc003axe.2_5'Flank	NM_002608	NP_002599	P01127	PDGFB_HUMAN	platelet-derived growth factor beta isoform 1						activation of protein kinase B activity|cellular response to mycophenolic acid|embryonic placenta development|heart development|hemopoiesis|metanephric glomerular mesangial cell development|monocyte chemotaxis|negative regulation of phosphatidylinositol biosynthetic process|negative regulation of platelet activation|negative regulation of transcription, DNA-dependent|paracrine signaling|peptidyl-serine phosphorylation|peptidyl-tyrosine phosphorylation|platelet activation|platelet degranulation|positive regulation of blood vessel endothelial cell migration|positive regulation of calcium ion import|positive regulation of cell division|positive regulation of chemotaxis|positive regulation of cyclin-dependent protein kinase activity|positive regulation of DNA biosynthetic process|positive regulation of DNA replication|positive regulation of endothelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of glomerular filtration|positive regulation of glomerular mesangial cell proliferation|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein autophosphorylation|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription, DNA-dependent|reactive oxygen species metabolic process|transforming growth factor beta receptor signaling pathway	basolateral plasma membrane|cell surface|endoplasmic reticulum lumen|extracellular region|Golgi membrane|platelet alpha granule lumen	collagen binding|eukaryotic cell surface binding|growth factor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity|superoxide-generating NADPH oxidase activator activity		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(1)	373	Melanoma(58;0.04)				Becaplermin(DB00102)	CTGACGAGGCAAAAAAAAAAG	0.562			T	COL1A1	DFSP								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	41470048	41470048	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41470048delA								RBX1 (101382 upstream) : MIR1281 (18469 downstream)																							GAGTCAAGCCAAAAAAAAGCC	0.363													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	904242	904243	+	IGR	INS	-	CA	CA			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:904242_904243insCA								SHOX (284097 upstream) : CRLF2 (410644 downstream)																							ATTTGCTGGTCCACACACAAGC	0.322													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	19182955	19182955	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19182955delA								GPR64 (42278 upstream) : PDHA1 (179056 downstream)																							CCTGCCTCCTAAAGCATTATT	0.458													4	2	---	---	---	---	
MAGED1	9500	broad.mit.edu	37	X	51638054	51638054	+	Intron	DEL	C	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51638054delC	uc004dpm.2	+						MAGED1_uc004dpn.2_Intron|MAGED1_uc004dpo.2_Intron|MAGED1_uc011mnx.1_Intron	NM_001005332	NP_001005332	Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1 isoform b						apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding			ovary(3)	3	Ovarian(276;0.236)					CCGCCTGCAGCTCCGCTGCTG	0.647										Multiple Myeloma(10;0.10)			4	2	---	---	---	---	
ARHGEF6	9459	broad.mit.edu	37	X	135788829	135788831	+	Intron	DEL	CCT	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135788829_135788831delCCT	uc004fab.2	-						ARHGEF6_uc011mwd.1_Intron|ARHGEF6_uc011mwe.1_Intron	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6						apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)					aggggaaggacctcctcctcctt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9945244	9945244	+	IGR	DEL	A	-	-			TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9945244delA								TTTY22 (294390 upstream) : None (None downstream)																							agattgaaataaaaagaataa	0.000													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58982733	58982734	+	IGR	INS	-	CACTC	CACTC	rs76443387		TCGA-CZ-5459-01A-01D-1501-10	TCGA-CZ-5459-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58982733_58982734insCACTC								None (None upstream) : None (None downstream)																							ccaatccacttcactccactcc	0.000													3	4	---	---	---	---	
