Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
WDR78	79819	broad.mit.edu	37	1	67292589	67292589	+	Silent	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67292589G>A	uc001dcx.2	-	15	2309	c.2253C>T	c.(2251-2253)TAC>TAT	p.Y751Y	WDR78_uc009waw.2_Silent_p.Y464Y|WDR78_uc009wax.2_RNA	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	751	WD 5.									ovary(2)	2						AGGCAACGTCGTAAACAACAG	0.393													7	289	---	---	---	---	PASS
CRYZ	1429	broad.mit.edu	37	1	75172631	75172631	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75172631C>T	uc001dgk.2	-	9	1285	c.780G>A	c.(778-780)ATG>ATA	p.M260I	CRYZ_uc001dgj.2_Missense_Mutation_p.M260I|CRYZ_uc001dgl.2_Missense_Mutation_p.M226I|CRYZ_uc001dgm.2_Missense_Mutation_p.M123I	NM_001130042	NP_001123514	Q08257	QOR_HUMAN	crystallin, zeta isoform a	260					protein homotetramerization|visual perception|xenobiotic catabolic process	cytosol|Golgi apparatus	mRNA 3'-UTR binding|NADPH binding|NADPH:quinone reductase activity|zinc ion binding				0					Dicumarol(DB00266)	ACTCCTTTGCCATGGTGTCTC	0.363													49	335	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91841143	91841143	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91841143G>A	uc001doa.3	-	12	1637	c.1537C>T	c.(1537-1539)CTC>TTC	p.L513F	HFM1_uc010osu.1_Missense_Mutation_p.L192F|HFM1_uc010osv.1_Missense_Mutation_p.L197F	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	513							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTGTAGTTGAGGGTTAAATCA	0.363													12	260	---	---	---	---	PASS
SASS6	163786	broad.mit.edu	37	1	100575995	100575995	+	Silent	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100575995A>G	uc001dsu.2	-	8	855	c.714T>C	c.(712-714)GAT>GAC	p.D238D	SASS6_uc009wdz.2_Silent_p.D71D	NM_194292	NP_919268	Q6UVJ0	SAS6_HUMAN	spindle assembly abnormal protein 6	238	Potential.				centriole replication	centriole				upper_aerodigestive_tract(1)|ovary(1)	2		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		GGATTTCTAAATCTTTTTTCT	0.328													64	113	---	---	---	---	PASS
WDR3	10885	broad.mit.edu	37	1	118475936	118475936	+	5'UTR	SNP	T	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118475936T>A	uc010oxe.1	+	2					WDR3_uc001ehi.2_RNA|WDR3_uc001ehh.2_5'UTR	NM_006784	NP_006775	Q9UNX4	WDR3_HUMAN	WD repeat-containing protein 3							nuclear membrane|nucleolus				upper_aerodigestive_tract(1)	1	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		GTATCAGACATCACAACATGG	0.443													35	56	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152188491	152188491	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152188491C>A	uc001ezt.1	-	3	5690	c.5614G>T	c.(5614-5616)GGT>TGT	p.G1872C		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1872	20.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCATGGTGACCAAATCCAGAA	0.572													34	777	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154309919	154309919	+	Silent	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154309919G>A	uc001fey.1	+	11	1179	c.990G>A	c.(988-990)CCG>CCA	p.P330P	ATP8B2_uc001few.2_Silent_p.P311P|ATP8B2_uc001fex.2_Silent_p.P344P	NM_001005855	NP_001005855	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform b	330	Extracellular (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCTACCTGCCGTGGGATGAGG	0.542													10	402	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157803202	157803202	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157803202C>A	uc001frk.3	-	5	962	c.819G>T	c.(817-819)TGG>TGT	p.W273C		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	273	SRCR 3.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCTTTTCTCCCCAGTTGTCAT	0.572													4	184	---	---	---	---	PASS
CADM3	57863	broad.mit.edu	37	1	159161760	159161760	+	Silent	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159161760G>A	uc001ftl.2	+	2	265	c.123G>A	c.(121-123)GTG>GTA	p.V41V	CADM3_uc009wsx.1_Silent_p.V75V|CADM3_uc009wsy.1_Silent_p.V41V|CADM3_uc001ftk.2_Silent_p.V75V	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	41	Ig-like V-type.|Extracellular (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					AAACAGTGGTGGCTGGTGGCA	0.542													30	48	---	---	---	---	PASS
VANGL2	57216	broad.mit.edu	37	1	160385972	160385972	+	Silent	SNP	G	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160385972G>C	uc001fwb.1	+	4	491	c.192G>C	c.(190-192)CGG>CGC	p.R64R	VANGL2_uc001fwc.1_Silent_p.R64R	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	vang-like 2	64	Cytoplasmic (Potential).				apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane				ovary(1)	1	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGGATGAGCGGGTGAGCACTG	0.642													31	61	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186281526	186281526	+	3'UTR	SNP	A	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186281526A>C	uc001grv.2	-	51					PRG4_uc001gru.3_Intron|PRG4_uc001grt.3_Intron|PRG4_uc009wyl.2_Intron|PRG4_uc009wym.2_Intron|PRG4_uc010poo.1_Intron	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR						carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ATTGTGTTAAAAAAATCCTTA	0.333			T	NTRK1	papillary thyroid								32	135	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186281553	186281553	+	3'UTR	SNP	A	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186281553A>C	uc001grv.2	-	51					PRG4_uc001gru.3_Intron|PRG4_uc001grt.3_Intron|PRG4_uc009wyl.2_Intron|PRG4_uc009wym.2_Intron|PRG4_uc010poo.1_Intron	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR						carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AGTAGATGTAATACAGTTTCT	0.323			T	NTRK1	papillary thyroid								24	85	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214825173	214825173	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214825173C>T	uc001hkm.2	+	15	8278	c.8104C>T	c.(8104-8106)CGG>TGG	p.R2702W		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	2798	Potential.|Sufficient for self-association.|Sufficient for centromere localization.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ATATCAGCTACGGCTTCATGA	0.433													39	58	---	---	---	---	PASS
LGALS8	3964	broad.mit.edu	37	1	236711354	236711354	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236711354A>C	uc001hxz.1	+	11	1228	c.847A>C	c.(847-849)AAT>CAT	p.N283H	LGALS8_uc001hxw.1_Missense_Mutation_p.N325H|LGALS8_uc001hxy.1_Missense_Mutation_p.N325H|LGALS8_uc009xgg.1_RNA|LGALS8_uc001hya.1_Missense_Mutation_p.N283H|LGALS8_uc001hyb.1_Missense_Mutation_p.N283H|LGALS8_uc001hyc.1_Missense_Mutation_p.N266H	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b	283	Galectin 2.					cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GGTTGCAGTAAATGGCGTACA	0.383													22	58	---	---	---	---	PASS
DYNC2LI1	51626	broad.mit.edu	37	2	44001213	44001213	+	5'UTR	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44001213C>T	uc002rtk.2	+	1					DYNC2LI1_uc002rth.2_5'UTR|DYNC2LI1_uc002rti.2_5'UTR|DYNC2LI1_uc002rtj.2_5'UTR|DYNC2LI1_uc002rtl.2_5'UTR|DYNC2LI1_uc010ynz.1_5'UTR	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GCGGAGCTCGCCGCCTGATTC	0.642													7	8	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55570817	55570817	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55570817C>G	uc002ryv.2	-	12	2142	c.1300G>C	c.(1300-1302)GAA>CAA	p.E434Q	CCDC88A_uc010yoz.1_Missense_Mutation_p.E434Q|CCDC88A_uc010ypa.1_Missense_Mutation_p.E434Q|CCDC88A_uc010ypb.1_Missense_Mutation_p.E336Q	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	434					activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						GATATCTGTTCCAGTTCCCAG	0.318													48	139	---	---	---	---	PASS
CNRIP1	25927	broad.mit.edu	37	2	68520911	68520911	+	3'UTR	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68520911C>A	uc002sek.3	-	3					CNRIP1_uc002sej.3_Intron|CNRIP1_uc002sem.1_RNA|CNRIP1_uc002sel.3_RNA	NM_015463	NP_056278	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1								protein binding			liver(1)	1						AATGGTGTGGCATGCCTTGTT	0.433													11	65	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207174437	207174437	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207174437C>T	uc002vbp.2	+	5	5435	c.5185C>T	c.(5185-5187)CGT>TGT	p.R1729C		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1729							nucleic acid binding|zinc ion binding			ovary(3)	3						TAAAAAAAAACGTTCGAAGCT	0.453													6	78	---	---	---	---	PASS
SGPP2	130367	broad.mit.edu	37	2	223389681	223389681	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223389681C>A	uc010zlo.1	+	4	577	c.577C>A	c.(577-579)CTG>ATG	p.L193M	SGPP2_uc010zlp.1_Missense_Mutation_p.L65M	NM_152386	NP_689599	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphotase 2	193	Helical; (Potential).				sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		TGTGTTGGGACTGGTGATGGC	0.483													3	62	---	---	---	---	PASS
TIMP4	7079	broad.mit.edu	37	3	12195084	12195084	+	Silent	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12195084G>A	uc003bwo.2	-	5	913	c.606C>T	c.(604-606)GAC>GAT	p.D202D	SYN2_uc003bwl.1_Intron|SYN2_uc003bwm.2_Intron|SYN2_uc003bwn.2_Intron	NM_003256	NP_003247	Q99727	TIMP4_HUMAN	tissue inhibitor of metalloproteinase 4	202							metal ion binding|metalloendopeptidase inhibitor activity				0						TGCAGGTGCCGTCAACATGCT	0.547													4	85	---	---	---	---	PASS
SFMBT1	51460	broad.mit.edu	37	3	52960072	52960072	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52960072G>C	uc003dgf.2	-	11	1675	c.1106C>G	c.(1105-1107)GCT>GGT	p.A369G	SFMBT1_uc010hmr.2_Missense_Mutation_p.A316G|SFMBT1_uc003dgg.2_Missense_Mutation_p.A369G|SFMBT1_uc003dgh.2_Missense_Mutation_p.A369G	NM_001005159	NP_001005159	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	369	MBT 4.				regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		CTGGGGAGCAGCTTCAGCACC	0.577													73	83	---	---	---	---	PASS
SFMBT1	51460	broad.mit.edu	37	3	52960073	52960073	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52960073C>T	uc003dgf.2	-	11	1674	c.1105G>A	c.(1105-1107)GCT>ACT	p.A369T	SFMBT1_uc010hmr.2_Missense_Mutation_p.A316T|SFMBT1_uc003dgg.2_Missense_Mutation_p.A369T|SFMBT1_uc003dgh.2_Missense_Mutation_p.A369T	NM_001005159	NP_001005159	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	369	MBT 4.				regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		TGGGGAGCAGCTTCAGCACCA	0.577													74	84	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142281172	142281172	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142281172G>A	uc003eux.3	-	4	1194	c.1072C>T	c.(1072-1074)CCA>TCA	p.P358S		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	358					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TACCCAGCTGGCACAAATTTA	0.413								Other_conserved_DNA_damage_response_genes					4	113	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164908058	164908058	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164908058C>A	uc003fej.3	-	2	1005	c.561G>T	c.(559-561)ATG>ATT	p.M187I	SLITRK3_uc003fek.2_Missense_Mutation_p.M187I	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	187	LRR 5.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						TGGTTGGAAGCATGGGGATGA	0.383										HNSCC(40;0.11)			4	115	---	---	---	---	PASS
LOC220729	220729	broad.mit.edu	37	3	197348634	197348634	+	RNA	SNP	G	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197348634G>C	uc011bug.1	-	4		c.457C>G			LOC220729_uc003fxw.2_RNA|LOC220729_uc003fxy.2_RNA|LOC220729_uc010iao.1_Intron					Homo sapiens cDNA FLJ60865 complete cds, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC 1.3.5.1).												0						CAGCAGCACCGATGGGCCTGC	0.542													3	123	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47517590	47517590	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47517590G>T	uc003gxk.1	+	3	552	c.388G>T	c.(388-390)GTC>TTC	p.V130F	ATP10D_uc003gxj.3_Missense_Mutation_p.V130F	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	130	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TCTGGTGGTGGTCCTTACAAT	0.373													5	192	---	---	---	---	PASS
YTHDC1	91746	broad.mit.edu	37	4	69204039	69204039	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69204039T>C	uc003hdx.2	-	2	445	c.92A>G	c.(91-93)TAT>TGT	p.Y31C	YTHDC1_uc003hdy.2_Missense_Mutation_p.Y31C	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	31										upper_aerodigestive_tract(1)|ovary(1)	2						CTCTGGATTATACAGTTCATC	0.279													23	45	---	---	---	---	PASS
FAM175A	84142	broad.mit.edu	37	4	84382418	84382418	+	3'UTR	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84382418A>G	uc003hou.2	-	9					MRPS18C_uc003hor.3_3'UTR|MRPS18C_uc011ccu.1_Intron|FAM175A_uc003hot.2_3'UTR|FAM175A_uc003hov.2_3'UTR	NM_139076	NP_620775	Q6UWZ7	F175A_HUMAN	coiled-coil domain containing 98						chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|response to ionizing radiation	BRCA1-A complex	polyubiquitin binding			kidney(1)	1						ATACTGACTCAAACCAACCTT	0.343													23	47	---	---	---	---	PASS
PPA2	27068	broad.mit.edu	37	4	106395063	106395063	+	Missense_Mutation	SNP	G	A	A	rs142379853		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106395063G>A	uc003hxl.2	-	1	165	c.145C>T	c.(145-147)CGC>TGC	p.R49C	PPA2_uc003hxm.2_Missense_Mutation_p.R49C|PPA2_uc003hxn.2_Missense_Mutation_p.R49C|PPA2_uc003hxo.2_Missense_Mutation_p.R49C|PPA2_uc003hxp.2_Missense_Mutation_p.R49C|PPA2_uc003hxq.2_5'UTR|PPA2_uc003hxr.2_5'UTR|PPA2_uc011cfa.1_5'UTR|PPA2_uc003hxs.2_RNA	NM_176869	NP_789845	Q9H2U2	IPYR2_HUMAN	inorganic pyrophosphatase 2 isoform 1 precursor	49					diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)		AAGAAGAGGCGGTAATTCTGC	0.672											OREG0016281	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	36	---	---	---	---	PASS
NPNT	255743	broad.mit.edu	37	4	106848531	106848531	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106848531G>A	uc003hya.2	+	3	416	c.211G>A	c.(211-213)GGG>AGG	p.G71R	NPNT_uc011cfc.1_Missense_Mutation_p.G88R|NPNT_uc011cfd.1_Missense_Mutation_p.G71R|NPNT_uc011cfe.1_Missense_Mutation_p.G71R|NPNT_uc010ilt.1_Missense_Mutation_p.G71R|NPNT_uc011cff.1_Missense_Mutation_p.G71R|NPNT_uc010ilu.1_5'UTR	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	71	EGF-like 1.				cell differentiation	membrane	calcium ion binding			skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		TGAATGTATCGGGCCAAACAA	0.413													20	67	---	---	---	---	PASS
IL21	59067	broad.mit.edu	37	4	123542048	123542048	+	Missense_Mutation	SNP	C	T	T	rs141748932	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123542048C>T	uc003ies.2	-	1	164	c.119G>A	c.(118-120)CGT>CAT	p.R40H	uc003iet.2_RNA|IL21_uc010int.2_Missense_Mutation_p.R33H	NM_021803	NP_068575	Q9HBE4	IL21_HUMAN	interleukin 21	33					cell maturation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-17 production|positive regulation of T cell proliferation|signal transduction	extracellular space	cytokine activity|interleukin-2 receptor binding				0						TATAAGTTGACGCATTCTAAT	0.363													54	129	---	---	---	---	PASS
FLJ33360	401172	broad.mit.edu	37	5	6312623	6312623	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6312623A>G	uc003jdn.1	-	2	350	c.253T>C	c.(253-255)TGC>CGC	p.C85R		NM_001001702	NP_001001702			SubName: Full=FLJ33360 protein; SubName: Full=cDNA FLJ33360 fis, clone BRACE2005253;												0						GAGAGCAGGCAGAGGAACCCC	0.542													2	12	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34757614	34757614	+	Silent	SNP	C	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34757614C>G	uc003jir.2	+	3	274	c.78C>G	c.(76-78)GCC>GCG	p.A26A	RAI14_uc010iur.2_Silent_p.A26A|RAI14_uc011coj.1_Silent_p.A26A|RAI14_uc010ius.1_5'UTR|RAI14_uc003jis.2_Silent_p.A29A|RAI14_uc003jit.2_Silent_p.A26A|RAI14_uc011cok.1_Silent_p.A18A	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	26	ANK 1.					cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					TACTGCAGGCCGTGGAGAATG	0.552													38	66	---	---	---	---	PASS
BRIX1	55299	broad.mit.edu	37	5	34915840	34915840	+	5'UTR	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34915840C>T	uc003jja.2	+	1					RAD1_uc003jiw.2_5'Flank|RAD1_uc003jix.2_5'Flank|RAD1_uc003jiy.2_Intron|BRIX1_uc003jiz.2_5'UTR|BRIX1_uc011col.1_5'UTR	NM_018321	NP_060791	Q8TDN6	BRX1_HUMAN	BRIX						ribosome biogenesis|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|protein binding				0						GGCGGCGAGGCAAGATGGCGG	0.617													5	8	---	---	---	---	PASS
ZBED3	84327	broad.mit.edu	37	5	76376388	76376388	+	Intron	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76376388A>G	uc003kev.1	-						SNORA47_uc003kew.1_RNA	NM_032367	NP_115743	Q96IU2	ZBED3_HUMAN	zinc finger, BED-type containing 3								DNA binding|metal ion binding				0		all_lung(232;0.00645)|Lung NSC(167;0.0135)|Ovarian(174;0.0798)|Prostate(461;0.121)		OV - Ovarian serous cystadenocarcinoma(54;2.24e-51)|Epithelial(54;9.06e-46)|all cancers(79;2.48e-41)		TCACCTTCTCAGTCCTCCACA	0.552													7	73	---	---	---	---	PASS
CCDC112	153733	broad.mit.edu	37	5	114620509	114620509	+	Translation_Start_Site	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114620509G>A	uc003kqy.2	-	2	478	c.-35C>T	c.(-37--33)TACGC>TATGC		CCDC112_uc003kqz.2_Missense_Mutation_p.R72C|CCDC112_uc003kra.2_Missense_Mutation_p.R72C	NM_152549	NP_689762	Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112 isoform 2												0		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		TCTGCTGTGCGTACAAATTCT	0.313													41	95	---	---	---	---	PASS
RAPGEF6	51735	broad.mit.edu	37	5	130764648	130764648	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130764648T>G	uc003kvn.1	-	27	4933	c.4727A>C	c.(4726-4728)CAG>CCG	p.Q1576P	RAPGEF6_uc003kvp.1_Missense_Mutation_p.Q1626P|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Missense_Mutation_p.Q1584P|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvm.1_Missense_Mutation_p.Q499P	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide	1576					Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		ATGGAATGGCTGCAAATTATG	0.458													33	234	---	---	---	---	PASS
P4HA2	8974	broad.mit.edu	37	5	131543565	131543565	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131543565G>A	uc003kwh.2	-	8	1480	c.916C>T	c.(916-918)CAG>TAG	p.Q306*	P4HA2_uc003kwg.2_Nonsense_Mutation_p.Q306*|P4HA2_uc003kwi.2_Nonsense_Mutation_p.Q306*|P4HA2_uc003kwk.2_Nonsense_Mutation_p.Q306*|P4HA2_uc003kwl.2_Nonsense_Mutation_p.Q306*|P4HA2_uc003kwj.2_Nonsense_Mutation_p.Q306*	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1	306						endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	AGCCTCTTCTGTCTACGGGGT	0.577													47	284	---	---	---	---	PASS
PDLIM4	8572	broad.mit.edu	37	5	131607453	131607453	+	Intron	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131607453C>A	uc003kwn.2	+						uc003kwm.3_Intron|PDLIM4_uc003kwp.2_Intron|PDLIM4_uc003kwo.2_Missense_Mutation_p.P322T	NM_003687	NP_003678	P50479	PDLI4_HUMAN	PDZ and LIM domain 4 isoform 1								protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCTCCTCACCCCGTTCATGCC	0.687													3	70	---	---	---	---	PASS
PCBD2	84105	broad.mit.edu	37	5	134294744	134294744	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134294744G>T	uc010jdz.2	+	3	251	c.231G>T	c.(229-231)ATG>ATT	p.M77I	PCBD2_uc011cxw.1_Missense_Mutation_p.M77I	NM_032151	NP_115527	Q9H0N5	PHS2_HUMAN	pterin-4 alpha-carbinolamine dehydratase 2	77					positive regulation of transcription, DNA-dependent|tetrahydrobiopterin biosynthetic process		4-alpha-hydroxytetrahydrobiopterin dehydratase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTGGCTTTATGTCCCGAGTTG	0.413													73	99	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140723794	140723794	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140723794G>A	uc003ljm.1	+	1	194	c.194G>A	c.(193-195)CGC>CAC	p.R65H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.R65H	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	65	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGGAGTCCGCATCGTCTCC	0.617											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	252	---	---	---	---	PASS
PLAC8L1	153770	broad.mit.edu	37	5	145477733	145477733	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145477733C>T	uc003lnv.2	-	2	314	c.242G>A	c.(241-243)AGA>AAA	p.R81K	PLAC8L1_uc011dbp.1_RNA	NM_001029869	NP_001025040	A1L4L8	PL8L1_HUMAN	PLAC8-like 1	81											0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTCCTATCTCTGCAGACACT	0.498													58	65	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180056352	180056352	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180056352G>T	uc003mma.3	-	7	971	c.892C>A	c.(892-894)CAC>AAC	p.H298N	FLT4_uc003mlz.3_Missense_Mutation_p.H298N|FLT4_uc003mmb.1_5'UTR|FLT4_uc011dgy.1_Missense_Mutation_p.H298N|FLT4_uc011dgz.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	298	Ig-like C2-type 3.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CTGACGTTGTGGATGGTCAGG	0.632									Congenital_Hereditary_Lymphedema				3	57	---	---	---	---	PASS
BTNL3	10917	broad.mit.edu	37	5	180420008	180420008	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180420008G>A	uc003mmr.2	+	2	373	c.245G>A	c.(244-246)CGA>CAA	p.R82Q		NM_197975	NP_932079	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3 precursor	82	Extracellular (Potential).				lipid metabolic process	integral to membrane					0	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			CCACAGTATCGAGGGAGAACT	0.527													21	41	---	---	---	---	PASS
GPX6	257202	broad.mit.edu	37	6	28472158	28472158	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28472158C>T	uc011dlj.1	-	6	627	c.577G>A	c.(577-579)GTC>ATC	p.V193I	GPX6_uc010jrg.1_RNA	NM_182701	NP_874360	P59796	GPX6_HUMAN	glutathione peroxidase 6 precursor	193					response to oxidative stress	extracellular region	glutathione peroxidase activity			ovary(3)|pancreas(1)|skin(1)	5					Glutathione(DB00143)	ATGACAGGGACTCCATCGGGC	0.517													4	126	---	---	---	---	PASS
DDAH2	23564	broad.mit.edu	37	6	31697051	31697051	+	5'UTR	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31697051C>A	uc003nwp.2	-	1					DDAH2_uc003nwq.2_Intron	NM_013974	NP_039268	O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2						anti-apoptosis|arginine catabolic process|citrulline metabolic process|nitric oxide biosynthetic process|nitric oxide mediated signal transduction	cytoplasm	dimethylargininase activity|protein binding				0					L-Citrulline(DB00155)	GACATGCAGACAAGGGCGTTG	0.557													10	14	---	---	---	---	PASS
DDAH2	23564	broad.mit.edu	37	6	31697052	31697052	+	5'UTR	SNP	A	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31697052A>T	uc003nwp.2	-	1					DDAH2_uc003nwq.2_Intron	NM_013974	NP_039268	O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2						anti-apoptosis|arginine catabolic process|citrulline metabolic process|nitric oxide biosynthetic process|nitric oxide mediated signal transduction	cytoplasm	dimethylargininase activity|protein binding				0					L-Citrulline(DB00155)	ACATGCAGACAAGGGCGTTGG	0.557													10	14	---	---	---	---	PASS
FANCE	2178	broad.mit.edu	37	6	35426171	35426171	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35426171G>A	uc003oko.1	+	5	1252	c.1067G>A	c.(1066-1068)AGC>AAC	p.S356N	FANCE_uc010jvw.1_Missense_Mutation_p.S349N	NM_021922	NP_068741	Q9HB96	FANCE_HUMAN	Fanconi anemia, complementation group E	356	Interaction with FANCC.				DNA repair	nucleoplasm	protein binding			ovary(1)|lung(1)|skin(1)	3						CCTGATCTCAGCCTCAGCAAT	0.577			N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				126	231	---	---	---	---	PASS
MRPS18A	55168	broad.mit.edu	37	6	43655468	43655468	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43655468C>A	uc003ovy.1	-	1	61	c.49G>T	c.(49-51)GGG>TGG	p.G17W	MRPS18A_uc003ovz.1_Missense_Mutation_p.G17W|MRPS18A_uc003owa.1_Missense_Mutation_p.G17W|MRPS18A_uc010jyw.2_Missense_Mutation_p.G17W	NM_018135	NP_060605	Q9NVS2	RT18A_HUMAN	mitochondrial ribosomal protein S18A precursor	17					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0	all_cancers(18;6.56e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000479)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0102)|OV - Ovarian serous cystadenocarcinoma(102;0.137)			GCTAGTAGCCCACGGAGAAGC	0.617													3	3	---	---	---	---	PASS
SEC63	11231	broad.mit.edu	37	6	108222672	108222672	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108222672C>A	uc003psc.3	-	13	1528	c.1259G>T	c.(1258-1260)CGT>CTT	p.R420L	SEC63_uc003psb.3_Missense_Mutation_p.R280L	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	420	SEC63 1.|Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TAGAGTGTGACGATCTGATTC	0.328													3	118	---	---	---	---	PASS
TCF21	6943	broad.mit.edu	37	6	134210516	134210516	+	5'UTR	SNP	C	T	T	rs77092807		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134210516C>T	uc003qei.3	+	1					uc003qeg.1_5'Flank|TCF21_uc003qej.2_5'UTR	NM_003206	NP_003197	O43680	TCF21_HUMAN	transcription factor 21						branching involved in ureteric bud morphogenesis|mesoderm development|negative regulation of androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	androgen receptor binding|E-box binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity				0	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		tctctctctccctcGTCCACT	0.373													4	171	---	---	---	---	PASS
RSPH3	83861	broad.mit.edu	37	6	159403509	159403509	+	Intron	SNP	A	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159403509A>T	uc003qrx.2	-						RSPH3_uc010kju.2_Intron|RSPH3_uc003qry.1_Missense_Mutation_p.I377K	NM_031924	NP_114130	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog											ovary(1)|skin(1)	2		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		AAATATAATTATATATACTTT	0.353													8	73	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82764131	82764131	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82764131A>T	uc003uhx.2	-	3	3024	c.2735T>A	c.(2734-2736)ATT>AAT	p.I912N	PCLO_uc003uhv.2_Missense_Mutation_p.I912N	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	858	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGCATCAGTAATACTTCCCAG	0.522													18	244	---	---	---	---	PASS
ZKSCAN5	23660	broad.mit.edu	37	7	99129114	99129114	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99129114C>A	uc003uqv.2	+	7	1886	c.1762C>A	c.(1762-1764)CAA>AAA	p.Q588K	ZKSCAN5_uc010lfx.2_Missense_Mutation_p.Q588K|ZKSCAN5_uc003uqw.2_Missense_Mutation_p.Q588K|ZKSCAN5_uc003uqx.2_Missense_Mutation_p.Q515K|ZKSCAN5_uc003uqy.2_Missense_Mutation_p.Q324K	NM_145102	NP_659570	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	588	C2H2-type 6.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					AAGCTACAACCAACGCGTGCA	0.493													4	76	---	---	---	---	PASS
TSGA14	95681	broad.mit.edu	37	7	130042593	130042593	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130042593T>C	uc003vpz.2	-	7	517	c.470A>G	c.(469-471)AAG>AGG	p.K157R	TSGA14_uc003vpy.2_5'Flank|TSGA14_uc010lmf.2_5'UTR|TSGA14_uc003vqa.2_Missense_Mutation_p.K157R|TSGA14_uc011kpg.1_Missense_Mutation_p.K141R	NM_018718	NP_061188	Q9BYV8	CEP41_HUMAN	testis specific, 14	157					G2/M transition of mitotic cell cycle	centrosome|cytosol					0	Melanoma(18;0.0435)					CTCTGCTTTCTTCACTGGCCC	0.478													58	260	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151877175	151877175	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151877175G>A	uc003wla.2	-	37	7405	c.7186C>T	c.(7186-7188)CAG>TAG	p.Q2396*	MLL3_uc003wkz.2_Nonsense_Mutation_p.Q1457*|MLL3_uc003wky.2_5'Flank	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2396					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTCTTCTGCTGTTGCTGCTGG	0.463			N		medulloblastoma								65	285	---	---	---	---	PASS
C8orf74	203076	broad.mit.edu	37	8	10555181	10555181	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10555181C>A	uc003wtd.1	+	3	343	c.314C>A	c.(313-315)ACC>AAC	p.T105N	C8orf74_uc003wte.1_RNA	NM_001040032	NP_001035121	Q6P047	CH074_HUMAN	hypothetical protein LOC203076	105											0				COAD - Colon adenocarcinoma(149;0.0811)		TTCAACACCACCCACCTGCTG	0.567													5	226	---	---	---	---	PASS
INTS10	55174	broad.mit.edu	37	8	19687916	19687916	+	Splice_Site	SNP	G	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19687916G>C	uc003wzj.2	+	10	1272	c.1141_splice	c.e10-1	p.S381_splice		NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10						snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		TCTTTAAGCAGAGTTCAGACG	0.363													27	73	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41836218	41836218	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41836218G>A	uc010lxb.2	-	7	1529	c.985C>T	c.(985-987)CGG>TGG	p.R329W	MYST3_uc010lxc.2_Missense_Mutation_p.R329W|MYST3_uc003xon.3_Missense_Mutation_p.R329W|MYST3_uc010lxd.2_Missense_Mutation_p.R329W	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	329	Interaction with RUNX1-1.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			GTATAGCGCCGTTTTATCTGT	0.383													106	394	---	---	---	---	PASS
SAMD12	401474	broad.mit.edu	37	8	119452181	119452181	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119452181G>C	uc003yom.2	-	3	341	c.212C>G	c.(211-213)TCT>TGT	p.S71C	SAMD12_uc010mda.1_Missense_Mutation_p.S71C|SAMD12_uc010mdb.1_RNA	NM_207506	NP_997389	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12 isoform	71										ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			CACCGGTTTAGATAGCTTCAC	0.428													3	149	---	---	---	---	PASS
FOXH1	8928	broad.mit.edu	37	8	145699579	145699579	+	3'UTR	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145699579G>T	uc003zdc.2	-	3						NM_003923	NP_003914	O75593	FOXH1_HUMAN	forkhead box H1						axial mesoderm development|blood vessel development|cell migration involved in gastrulation|embryonic heart tube anterior/posterior pattern formation|floor plate formation|heart looping|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|specification of organ position|transforming growth factor beta receptor signaling pathway	activin responsive factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|R-SMAD binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			AACAAGGTGGGGGTGGGAGCG	0.662													4	10	---	---	---	---	PASS
ACO1	48	broad.mit.edu	37	9	32408576	32408576	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32408576C>A	uc003zqw.3	+	4	486	c.331C>A	c.(331-333)CCA>ACA	p.P111T	ACO1_uc010mjh.1_5'UTR|ACO1_uc003zqx.3_Missense_Mutation_p.P111T|ACO1_uc003zqy.3_RNA	NM_002197	NP_002188	P21399	ACOC_HUMAN	aconitase 1	111					citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		AGGAGGAGATCCAGAGAAAAT	0.428													33	142	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32630843	32630843	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32630843G>T	uc003zrg.1	-	1	4825	c.4735C>A	c.(4735-4737)CAC>AAC	p.H1579N	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1579	Bromo 2.				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGATACTTGTGCTTGGAGATG	0.383													75	192	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32630844	32630844	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32630844C>G	uc003zrg.1	-	1	4824	c.4734G>C	c.(4732-4734)AAG>AAC	p.K1578N	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1578	Bromo 2.				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GATACTTGTGCTTGGAGATGT	0.383													73	189	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385532	33385532	+	Intron	SNP	T	C	C	rs115950431	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385532T>C	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CTCCCCAGGCTACCTGGGGGC	0.592													3	26	---	---	---	---	PASS
GCNT1	2650	broad.mit.edu	37	9	79117316	79117316	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79117316C>T	uc010mpf.2	+	3	360	c.19C>T	c.(19-21)CGA>TGA	p.R7*	GCNT1_uc010mpg.2_Nonsense_Mutation_p.R7*|GCNT1_uc010mph.2_Nonsense_Mutation_p.R7*|GCNT1_uc004akf.3_Nonsense_Mutation_p.R7*|GCNT1_uc010mpi.2_Nonsense_Mutation_p.R7*|GCNT1_uc004akh.3_Nonsense_Mutation_p.R7*	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein	7	Cytoplasmic (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0						GACGTTGCTGCGAAGGAGACT	0.418													31	226	---	---	---	---	PASS
ECM2	1842	broad.mit.edu	37	9	95272275	95272275	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95272275A>C	uc004ash.2	-	6	1277	c.1212T>G	c.(1210-1212)AAT>AAG	p.N404K	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Missense_Mutation_p.N382K|ECM2_uc011lty.1_Missense_Mutation_p.N404K|ECM2_uc004asg.2_Missense_Mutation_p.N382K	NM_001393	NP_001384	O94769	ECM2_HUMAN	extracellular matrix protein 2 precursor	404	LRR 2.				cell-matrix adhesion		integrin binding			ovary(1)|skin(1)	2						TCTGTATCAAATTATTTCCAT	0.323													56	95	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104316360	104316360	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104316360G>T	uc004bbn.2	+	14	2082	c.1992G>T	c.(1990-1992)ATG>ATT	p.M664I		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	664	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TTCAGCTGATGGCAGCTGAGA	0.438													51	89	---	---	---	---	PASS
NUP214	8021	broad.mit.edu	37	9	134022951	134022951	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134022951G>A	uc004cag.2	+	14	2131	c.2020G>A	c.(2020-2022)GCA>ACA	p.A674T	NUP214_uc004cah.2_Missense_Mutation_p.A664T|NUP214_uc004cai.2_Missense_Mutation_p.A104T|NUP214_uc004caf.1_Missense_Mutation_p.A663T|NUP214_uc010mzf.2_Intron	NM_005085	NP_005076	P35658	NU214_HUMAN	nucleoporin 214kDa	674	11 X 5 AA approximate repeats.				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CCCTCCAGCGGCAAAGCCAGG	0.438			T	DEK|SET|ABL1	AML|T-ALL								4	181	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832122	42832122	+	RNA	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832122C>T	uc010qey.1	-	3		c.1853G>A				NR_024380				Homo sapiens noncoding mRNA sequence.												0						CAGTAAAAGGCTTTGCCACAT	0.348													3	20	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50690813	50690813	+	Silent	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50690813A>G	uc001jhs.3	-	10	2243	c.2089T>C	c.(2089-2091)TTA>CTA	p.L697L	ERCC6_uc010qgr.1_Silent_p.L67L|ERCC6_uc001jhr.3_Silent_p.L97L	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	697					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						AACGTGCCTAACTTTCCCGGG	0.483								Direct_reversal_of_damage|NER					43	94	---	---	---	---	PASS
C10orf129	142827	broad.mit.edu	37	10	96979668	96979668	+	Silent	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96979668C>A	uc001kke.2	+	9	1265	c.1140C>A	c.(1138-1140)TCC>TCA	p.S380S	C10orf129_uc009xuu.1_Silent_p.S290S	NM_207321	NP_997204	Q6P461	ACSM6_HUMAN	acyl-coenzyme A synthetase ACSM6, mitochondrial	380					fatty acid metabolic process	mitochondrion	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GTGCCACTTCCAAAACAATAA	0.299													4	177	---	---	---	---	PASS
TRIM22	10346	broad.mit.edu	37	11	5730863	5730863	+	Silent	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5730863C>T	uc001mbr.2	+	8	1759	c.1482C>T	c.(1480-1482)TGC>TGT	p.C494C	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Silent_p.C490C|TRIM22_uc010qzm.1_Silent_p.C322C|TRIM22_uc009yeu.2_Silent_p.C305C|OR56B1_uc001mbs.1_Intron|OR56B1_uc009yev.1_Intron	NM_006074	NP_006065	Q8IYM9	TRI22_HUMAN	tripartite motif-containing 22	494	B30.2/SPRY.			VC->AA: Reduces formation of regular nuclear bodies.	immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TGACTGTGTGCCCACCGAGCT	0.498													4	215	---	---	---	---	PASS
SPTY2D1	144108	broad.mit.edu	37	11	18638510	18638510	+	Silent	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18638510A>G	uc001moy.2	-	2	303	c.87T>C	c.(85-87)CCT>CCC	p.P29P	SPTY2D1_uc010rdi.1_Silent_p.P29P	NM_194285	NP_919261	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1	29				P -> L (in Ref. 1; CAE46047).						breast(1)	1						CTTTTTTTGGAGGCCCCACTG	0.358													3	236	---	---	---	---	PASS
SLC15A3	51296	broad.mit.edu	37	11	60709539	60709539	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60709539C>T	uc001nqn.2	-	4	1309	c.1075G>A	c.(1075-1077)GTG>ATG	p.V359M	SLC15A3_uc001nqo.2_Missense_Mutation_p.V359M	NM_016582	NP_057666	Q8IY34	S15A3_HUMAN	solute carrier family 15, member 3	359					oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0						CTCAGGGCCACAGAGATGTTG	0.572													63	161	---	---	---	---	PASS
POLR2G	5436	broad.mit.edu	37	11	62529417	62529417	+	Intron	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62529417G>T	uc001nva.2	+						POLR2G_uc001nvb.2_RNA	NM_002696	NP_002687	P62487	RPB7_HUMAN	DNA directed RNA polymerase II polypeptide G						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA-directed RNA polymerase activity|protein binding|RNA binding				0						CGTTCGATGCGCACACGGGGC	0.622													18	44	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65270626	65270626	+	RNA	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65270626C>T	uc010roh.1	+	1		c.5394C>T			uc001ody.2_RNA|MALAT1_uc001odz.2_RNA	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TGCTTCATTTCATCTGGGAGC	0.428													13	21	---	---	---	---	PASS
SLC29A2	3177	broad.mit.edu	37	11	66136880	66136880	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66136880G>T	uc001oht.2	-	3	464	c.235C>A	c.(235-237)CTG>ATG	p.L79M	SLC29A2_uc001ohs.2_Translation_Start_Site|SLC29A2_uc010rpb.1_RNA|SLC29A2_uc009yrf.2_Translation_Start_Site|SLC29A2_uc001ohu.2_Missense_Mutation_p.L79M|SLC29A2_uc001ohv.2_Missense_Mutation_p.L79M|uc001ohw.1_RNA	NM_001532	NP_001523	Q14542	S29A2_HUMAN	solute carrier family 29 (nucleoside	79	Helical; (Potential).				cell proliferation|nucleobase, nucleoside and nucleotide metabolic process	basolateral plasma membrane|integral to plasma membrane|nuclear membrane|nucleolus	nucleoside transmembrane transporter activity			ovary(1)	1						AAGAGCAGCAGGGGCAGCTGG	0.632													4	183	---	---	---	---	PASS
ANKRD42	338699	broad.mit.edu	37	11	82924151	82924151	+	Intron	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82924151G>A	uc001ozz.1	+						ANKRD42_uc009yvi.1_3'UTR|ANKRD42_uc010rsv.1_Intron|ANKRD42_uc001paa.2_Intron|ANKRD42_uc001pab.1_Intron	NM_182603	NP_872409	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42											skin(1)	1						AGTGTAACTGGCAGAAACCCA	0.453													4	232	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122930262	122930262	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122930262G>A	uc001pyo.2	-	5	1117	c.1039C>T	c.(1039-1041)CAG>TAG	p.Q347*	HSPA8_uc009zbc.2_Nonsense_Mutation_p.Q111*|HSPA8_uc001pyp.2_Nonsense_Mutation_p.Q347*|HSPA8_uc010rzu.1_Nonsense_Mutation_p.Q270*|HSPA8_uc009zbd.1_Nonsense_Mutation_p.Q347*	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	347	Interaction with BAG1.				cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGAAGCTTCTGAATCTTGGGG	0.438													75	152	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122930264	122930264	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122930264A>T	uc001pyo.2	-	5	1115	c.1037T>A	c.(1036-1038)ATT>AAT	p.I346N	HSPA8_uc009zbc.2_Missense_Mutation_p.I110N|HSPA8_uc001pyp.2_Missense_Mutation_p.I346N|HSPA8_uc010rzu.1_Missense_Mutation_p.I269N|HSPA8_uc009zbd.1_Missense_Mutation_p.I346N	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	346	Interaction with BAG1.				cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AAGCTTCTGAATCTTGGGGAT	0.443													77	147	---	---	---	---	PASS
TMEM45B	120224	broad.mit.edu	37	11	129728494	129728494	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129728494G>A	uc001qfe.1	+	6	803	c.742G>A	c.(742-744)GGA>AGA	p.G248R	TMEM45B_uc001qff.1_Missense_Mutation_p.G248R	NM_138788	NP_620143	Q96B21	TM45B_HUMAN	transmembrane protein 45B	248						integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)		GAAGAGACACGGAAGGGGAGA	0.458													6	8	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9248168	9248168	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9248168A>T	uc001qvk.1	-	16	2093	c.1980T>A	c.(1978-1980)AGT>AGA	p.S660R	A2M_uc009zgk.1_Missense_Mutation_p.S510R	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	660					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	TTTCATTTGTACTTGATACTG	0.378													41	95	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31279359	31279359	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31279359A>C	uc010sjy.1	-	26	3394	c.3394T>G	c.(3394-3396)TAT>GAT	p.Y1132D						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		GCAAAAGCATAAGCTAGAATT	0.423													23	60	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78400974	78400974	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78400974G>T	uc001syp.2	+	8	1829	c.1656G>T	c.(1654-1656)GAG>GAT	p.E552D	NAV3_uc001syo.2_Missense_Mutation_p.E552D	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	552						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAGAGTCTGAGAAATTCAGGA	0.468										HNSCC(70;0.22)			40	87	---	---	---	---	PASS
DHX37	57647	broad.mit.edu	37	12	125462030	125462030	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125462030G>A	uc001ugy.2	-	5	844	c.745C>T	c.(745-747)CGG>TGG	p.R249W		NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	249							ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		AGCTTCAGCCGTTCCTCCTGG	0.562													9	32	---	---	---	---	PASS
GTF3A	2971	broad.mit.edu	37	13	27997908	27997908	+	5'Flank	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27997908C>A	uc001ure.2	+						GTF3A_uc001urf.2_5'Flank|GTF3A_uc001urg.2_5'Flank	NM_002097	NP_002088	Q92664	TF3A_HUMAN	transcription factor IIIA						regulation of transcription, DNA-dependent|rRNA transcription|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|protein binding|RNA binding|zinc ion binding				0		Lung SC(185;0.0156)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.11)|OV - Ovarian serous cystadenocarcinoma(117;0.158)		TGCCAGTTATCTGTATCCAAG	0.358													3	20	---	---	---	---	PASS
IRF9	10379	broad.mit.edu	37	14	24635394	24635394	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24635394T>C	uc001wmq.2	+	9	1298	c.1171T>C	c.(1171-1173)TCC>CCC	p.S391P	RNF31_uc001wmp.2_RNA|IRF9_uc010alj.2_Missense_Mutation_p.S175P	NM_006084	NP_006075	Q00978	IRF9_HUMAN	interferon-stimulated transcription factor 3,	391					interferon-gamma-mediated signaling pathway|response to virus|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|nucleoplasm	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00853)		AGCCATTCTGTCCCTGGTGTA	0.532													9	30	---	---	---	---	PASS
GALC	2581	broad.mit.edu	37	14	88401078	88401078	+	Nonstop_Mutation	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88401078A>G	uc001xvt.2	-	17	2455	c.2056T>C	c.(2056-2058)TAA>CAA	p.*686Q	GALC_uc010tvw.1_Intron|GALC_uc010tvx.1_Nonstop_Mutation_p.*660Q|GALC_uc010tvy.1_Nonstop_Mutation_p.*663Q|GALC_uc010tvz.1_Intron	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	686					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						GTTAAGTATTAGCGTGTGGCT	0.408													3	123	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102489262	102489262	+	Intron	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102489262C>T	uc001yks.2	+						DYNC1H1_uc001ykt.1_Silent_p.I385I	NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TTTCTGCCATCCCTTTCTAAC	0.308													13	65	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105414746	105414746	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105414746C>T	uc010axc.1	-	7	7162	c.7042G>A	c.(7042-7044)GTG>ATG	p.V2348M	AHNAK2_uc001ypx.2_Missense_Mutation_p.V2248M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2348						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCGGCCTCCACCTTCAACGCA	0.602													80	169	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106234219	106234219	+	Intron	SNP	C	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106234219C>G	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						TGGTGATGGTCGTCCACAGCC	0.607													2	12	---	---	---	---	PASS
THBS1	7057	broad.mit.edu	37	15	39882824	39882824	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39882824G>T	uc001zkh.2	+	14	2432	c.2253G>T	c.(2251-2253)AGG>AGT	p.R751S	THBS1_uc010bbi.2_Missense_Mutation_p.R223S	NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	751	TSP type-3 2.				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	CAGATGACAGGGTAAAAACAG	0.403													20	52	---	---	---	---	PASS
SERF2	10169	broad.mit.edu	37	15	44085976	44085976	+	3'UTR	SNP	G	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44085976G>C	uc001zsz.3	+	3					ELL3_uc001zsx.1_Intron|SERF2_uc010bdq.2_Missense_Mutation_p.V107L|SERF2_uc010uee.1_Missense_Mutation_p.V35L|C15orf63_uc001ztb.2_Intron|MIR1282_hsa-mir-1282|MI0006429_5'Flank	NM_001018108	NP_001018118	P84101	SERF2_HUMAN	small EDRK-rich factor 2							cytosol|nucleus					0		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		AAGTAGCTTTGTGGCTTCGTG	0.582													27	48	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49284863	49284863	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49284863C>T	uc001zxe.1	-	18	3018	c.2884G>A	c.(2884-2886)GGC>AGC	p.G962S	SECISBP2L_uc001zxd.1_Missense_Mutation_p.G917S	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	962										breast(1)|skin(1)	2						TCCAAAGAGCCAGTCTCTGTA	0.453													66	146	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49284864	49284864	+	Silent	SNP	A	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49284864A>C	uc001zxe.1	-	18	3017	c.2883T>G	c.(2881-2883)ACT>ACG	p.T961T	SECISBP2L_uc001zxd.1_Silent_p.T916T	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	961										breast(1)|skin(1)	2						CCAAAGAGCCAGTCTCTGTAC	0.458													66	147	---	---	---	---	PASS
NEO1	4756	broad.mit.edu	37	15	73575304	73575304	+	Splice_Site	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73575304G>A	uc002avm.3	+	23	3405	c.3263_splice	c.e23-1	p.G1088_splice	NEO1_uc010ukx.1_Splice_Site_p.G1077_splice|NEO1_uc010uky.1_Splice_Site_p.G1088_splice|NEO1_uc010ukz.1_Splice_Site_p.G501_splice|NEO1_uc002avn.3_Splice_Site_p.G726_splice	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						TCTCTCTGCAGGCAGTAACAG	0.438													257	474	---	---	---	---	PASS
TOM1L2	146691	broad.mit.edu	37	17	17769632	17769632	+	Silent	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17769632G>T	uc002grz.3	-	10	1219	c.1062C>A	c.(1060-1062)CTC>CTA	p.L354L	TOM1L2_uc002gry.3_Silent_p.L304L|TOM1L2_uc010vwy.1_Silent_p.L301L|TOM1L2_uc010cpr.2_Silent_p.L309L|TOM1L2_uc010vwz.1_Silent_p.L206L|TOM1L2_uc010vxa.1_Silent_p.L256L|TOM1L2_uc002grv.3_Silent_p.L87L	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3	354					intracellular protein transport	intracellular					0	all_neural(463;0.228)					GCTGGGAGGAGAGGGAAGATG	0.562													5	15	---	---	---	---	PASS
GOSR1	9527	broad.mit.edu	37	17	28846964	28846964	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28846964A>G	uc002hfe.2	+	8	579	c.553A>G	c.(553-555)ATG>GTG	p.M185V	GOSR1_uc002hfd.2_Missense_Mutation_p.M183V|GOSR1_uc002hff.2_Missense_Mutation_p.M120V	NM_004871	NP_004862	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1 isoform 1	185	Cytoplasmic (Potential).				intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0						CAGCATTGCTATGGCAACAAA	0.383													123	187	---	---	---	---	PASS
AP2B1	163	broad.mit.edu	37	17	33932800	33932800	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33932800A>T	uc002hjr.2	+	4	409	c.220A>T	c.(220-222)ATG>TTG	p.M74L	AP2B1_uc002hjq.2_Missense_Mutation_p.M74L|AP2B1_uc010wci.1_Missense_Mutation_p.M74L|AP2B1_uc002hjs.2_Missense_Mutation_p.M17L|AP2B1_uc002hjt.2_Missense_Mutation_p.M74L|AP2B1_uc010ctv.2_Missense_Mutation_p.M74L	NM_001282	NP_001273	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1	74					axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TCTCTACTTGATGAACTACGC	0.428													82	123	---	---	---	---	PASS
EIF1	10209	broad.mit.edu	37	17	39845179	39845179	+	5'UTR	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39845179C>T	uc002hxj.2	+	1					JUP_uc010wfs.1_Intron|EIF1_uc002hxk.2_RNA	NM_005801	NP_005792	P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1						regulation of translational initiation|response to stress	cytoplasm	translation initiation factor activity				0		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			GCAGCCTCCCCCTTGAGCCCC	0.697													9	7	---	---	---	---	PASS
LOC146880	146880	broad.mit.edu	37	17	62750126	62750126	+	RNA	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62750126A>G	uc010wqc.1	-	10		c.2232T>C				NR_026899				Homo sapiens cDNA FLJ30780 fis, clone FEBRA2000856.												0						GACTTACCTGAAAGATATTTG	0.383													354	458	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71427653	71427653	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71427653G>T	uc010dfm.2	-	11	1468	c.1468C>A	c.(1468-1470)CTA>ATA	p.L490I	SDK2_uc010dfn.2_Missense_Mutation_p.L169I	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	490	Ig-like C2-type 5.|Extracellular (Potential).				cell adhesion	integral to membrane				ovary(2)	2						CAAACGACTAGGTCTGCTGAG	0.602													9	248	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18586538	18586538	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18586538T>A	uc002kte.2	-	16	2600	c.1659A>T	c.(1657-1659)TTA>TTT	p.L553F		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	553	Interaction with FHOD1.|Potential.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					CTGTCCTAAGTAAGTCATTGG	0.348													90	148	---	---	---	---	PASS
NETO1	81832	broad.mit.edu	37	18	70502440	70502440	+	Intron	SNP	T	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70502440T>C	uc002lkw.2	-						NETO1_uc002lkx.1_Intron|NETO1_uc002lky.1_Intron|NETO1_uc002lkz.2_3'UTR	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin- and tolloid-like protein 1 isoform 3						memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GCATGTGTGCTTCAAGATGGT	0.328													18	43	---	---	---	---	PASS
UBXN6	80700	broad.mit.edu	37	19	4446542	4446542	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4446542A>C	uc002man.1	-	8	971	c.875T>G	c.(874-876)TTC>TGC	p.F292C	UBXN6_uc010dty.1_Missense_Mutation_p.F196C|UBXN6_uc002mam.1_Missense_Mutation_p.F239C	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	292						microtubule organizing center|nucleus	protein binding				0						GAGGTTGAAGAAGTCCCCAGG	0.697													25	37	---	---	---	---	PASS
ARRDC5	645432	broad.mit.edu	37	19	4891119	4891119	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4891119G>A	uc002mbm.2	-	3	968	c.968C>T	c.(967-969)TCT>TTT	p.S323F		NM_001080523	NP_001073992	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	323					signal transduction						0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		GCAGATGGCAGAGTCCACTGA	0.527													21	155	---	---	---	---	PASS
HPN	3249	broad.mit.edu	37	19	35540222	35540222	+	Silent	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35540222A>G	uc002nxq.1	+	4	290	c.45A>G	c.(43-45)AGA>AGG	p.R15R	HPN_uc002nxr.1_Silent_p.R15R|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_5'UTR|HPN_uc002nxt.1_5'UTR	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin	15	Cytoplasmic (Potential).				cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	GCTGCTCCAGACCCAAGGTGG	0.662													48	77	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44516512	44516512	+	3'UTR	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44516512A>G	uc002oyb.1	+	5						NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				GTGTGTGTTTATATCATAATT	0.338													3	167	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52942411	52942411	+	Silent	SNP	G	A	A	rs113700997		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52942411G>A	uc002pzk.2	+	4	1798	c.1737G>A	c.(1735-1737)GCG>GCA	p.A579A	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Silent_p.A566A	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	579	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACACCTTGCGCGACATAGGA	0.443													4	39	---	---	---	---	PASS
SAPS1	22870	broad.mit.edu	37	19	55748092	55748092	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55748092C>T	uc002qjw.3	-	17	2149	c.1907G>A	c.(1906-1908)GGG>GAG	p.G636E	SAPS1_uc002qjv.2_Missense_Mutation_p.G698E	NM_014931	NP_055746	Q9UPN7	PP6R1_HUMAN	SAPS domain family, member 1	636	Glu-rich.				regulation of phosphoprotein phosphatase activity	cytoplasm	protein phosphatase binding				0		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		ATCAGACTCCCCTGAGCCCTG	0.622													8	38	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57428891	57428891	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57428891G>C	uc002xzw.2	+	1	856	c.571G>C	c.(571-573)GCT>CCT	p.A191P	GNASAS_uc002xzs.1_5'Flank|GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_RNA	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	Error:Variant_position_missing_in_P63092_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			AGGCCCAGGTGCTGCAGGGGT	0.622			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			2	3	---	---	---	---	PASS
CDH4	1002	broad.mit.edu	37	20	60499473	60499473	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60499473C>A	uc002ybn.1	+	11	1724	c.1710C>A	c.(1708-1710)GAC>GAA	p.D570E	CDH4_uc002ybp.1_Missense_Mutation_p.D496E	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	570	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CAGTGCTGGACCGTGAGTCCC	0.617													11	19	---	---	---	---	PASS
PCMTD2	55251	broad.mit.edu	37	20	62891566	62891566	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62891566C>G	uc002yil.3	+	2	448	c.248C>G	c.(247-249)TCG>TGG	p.S83W	PCMTD2_uc002yim.3_Missense_Mutation_p.S83W	NM_018257	NP_060727	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate)	83						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CCTGGACTCTCGTTTCTGAAC	0.522													4	253	---	---	---	---	PASS
HSPA13	6782	broad.mit.edu	37	21	15755454	15755454	+	5'UTR	SNP	A	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15755454A>C	uc002yjt.2	-	1					HSPA13_uc011abx.1_5'UTR	NM_006948	NP_008879	P48723	HSP13_HUMAN	heat shock protein 70kDa family member 13							endoplasmic reticulum|microsome	ATP binding			kidney(1)	1						AGTCCCGCCGAACAGGCTTGT	0.617													13	22	---	---	---	---	PASS
psiTPTE22	387590	broad.mit.edu	37	22	17178595	17178595	+	RNA	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17178595C>A	uc002zls.1	+	3		c.677C>A								Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0						CGGAAGGCTTCAGGGCGGTCG	0.597													4	75	---	---	---	---	PASS
KCNJ4	3761	broad.mit.edu	37	22	38824088	38824088	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38824088C>T	uc003avs.1	-	2	147	c.50G>A	c.(49-51)CGC>CAC	p.R17H	KCNJ4_uc003avt.1_Missense_Mutation_p.R17H	NM_004981	NP_004972	P48050	IRK4_HUMAN	potassium inwardly-rectifying channel J4	17	Cytoplasmic (By similarity).			KR -> NG (in Ref. 3; AAC60632).	synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding				0	Melanoma(58;0.0286)					GCGGTTGCGGCGCTTCCGCCG	0.642													6	466	---	---	---	---	PASS
SCUBE1	80274	broad.mit.edu	37	22	43625097	43625097	+	Silent	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43625097G>A	uc003bdt.1	-	9	1153	c.1065C>T	c.(1063-1065)TAC>TAT	p.Y355Y		NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	355	EGF-like 8; calcium-binding (Potential).				adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				GGGTTGTCCCGTAGAGGATGT	0.677											OREG0026614	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	18	---	---	---	---	PASS
SMC1B	27127	broad.mit.edu	37	22	45785706	45785706	+	Silent	SNP	G	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45785706G>A	uc003bgc.2	-	10	1669	c.1617C>T	c.(1615-1617)GGC>GGT	p.G539G	SMC1B_uc003bgd.2_Silent_p.G539G|SMC1B_uc003bge.1_Silent_p.G322G	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	539	Flexible hinge.				chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TGATGAACCGGCCAAAAACCT	0.413													6	252	---	---	---	---	PASS
CLCN4	1183	broad.mit.edu	37	X	10176319	10176319	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10176319C>T	uc004csy.3	+	9	1508	c.1078C>T	c.(1078-1080)CGC>TGC	p.R360C	CLCN4_uc011mid.1_Missense_Mutation_p.R266C	NM_001830	NP_001821	P51793	CLCN4_HUMAN	chloride channel 4	360						early endosome membrane|integral to membrane|late endosome membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						GTGCAGGAGGCGCAAGACCAC	0.597													81	161	---	---	---	---	PASS
ATXN3L	92552	broad.mit.edu	37	X	13336997	13336997	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13336997C>A	uc010ned.2	-	1	1522	c.1057G>T	c.(1057-1059)GGG>TGG	p.G353W		NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	353					protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity			lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						TATTTTTCCCCTTTGATTTTC	0.353													4	285	---	---	---	---	PASS
RAB9A	9367	broad.mit.edu	37	X	13727344	13727344	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13727344A>T	uc004cvm.2	+	3	661	c.479A>T	c.(478-480)AAT>ATT	p.N160I	RAB9A_uc010neh.2_Missense_Mutation_p.N160I	NM_004251	NP_004242	P51151	RAB9A_HUMAN	RAB9A, member RAS oncogene family	160					protein transport|small GTPase mediated signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome|lysosome|plasma membrane	GDP binding|GTP binding|GTPase activity|protein binding			ovary(1)	1						GATGCCACAAATGTGGCAGCA	0.478													9	189	---	---	---	---	PASS
SCML2	10389	broad.mit.edu	37	X	18348707	18348707	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18348707C>G	uc004cyl.2	-	3	248	c.91G>C	c.(91-93)GAT>CAT	p.D31H	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.D31H|SCML2_uc011miz.1_Intron	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	31					anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					TAAAACCTACCCCTTTGTACA	0.303													9	138	---	---	---	---	PASS
CFP	5199	broad.mit.edu	37	X	47485783	47485783	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47485783C>T	uc004dig.3	-	7	1202	c.1076G>A	c.(1075-1077)CGA>CAA	p.R359Q	CFP_uc004dih.2_Missense_Mutation_p.R359Q|CFP_uc004dii.1_Missense_Mutation_p.R295Q|CFP_uc010nhu.2_Missense_Mutation_p.R359Q	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor	359	TSP type-1 5.				complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						CCCGGCACATCGATGTCCGTC	0.612													6	31	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	48155421	48155421	+	3'UTR	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48155421C>T	uc010nib.1	-	8						NM_174962	NP_777622			synovial sarcoma, X breakpoint 9																		GCCATGCCCACGTTCGTGAAA	0.493													29	78	---	---	---	---	PASS
CYSLTR1	10800	broad.mit.edu	37	X	77529262	77529262	+	5'UTR	SNP	G	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77529262G>C	uc004edb.2	-	3					CYSLTR1_uc010nma.2_5'UTR|CYSLTR1_uc010nmb.2_5'UTR	NM_006639	NP_006630	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1						elevation of cytosolic calcium ion concentration|respiratory gaseous exchange	integral to plasma membrane|membrane fraction	leukotriene receptor activity			ovary(1)	1					Amlexanox(DB01025)|Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	ACGAATGTCTGCTTTGTGCCT	0.328													69	126	---	---	---	---	PASS
USP26	83844	broad.mit.edu	37	X	132160271	132160271	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132160271A>G	uc010nrm.1	-	6	2448	c.1978T>C	c.(1978-1980)TAT>CAT	p.Y660H	USP26_uc011mvf.1_Missense_Mutation_p.Y660H	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	660					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					TCTTCCAGATACGTCATTAAG	0.423													117	179	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153593246	153593246	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153593246C>T	uc004fkk.2	-	12	2020	c.1771G>A	c.(1771-1773)GTT>ATT	p.V591I	FLNA_uc010nuu.1_Missense_Mutation_p.V591I	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	591	Filamin 4.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GACTTGCCAACGACGCCGCCC	0.632													4	228	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9111	9111	+	RNA	SNP	T	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9111T>C	uc011mfi.1	+	1		c.449T>C			uc004cov.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		ATCTTCACAATTCTAATTCTA	0.433													2	4	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16959732	16959733	+	Intron	INS	-	GGGCCTGCAGCA	GGGCCTGCAGCA	rs12063740		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16959732_16959733insGGGCCTGCAGCA	uc001azf.2	-						CROCCL1_uc009vov.1_5'Flank|CROCCL1_uc001aze.2_5'Flank|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA|uc001azj.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						CTCCTCCAGCTGGGCCTGCTTC	0.668													5	3	---	---	---	---	
PADI4	23569	broad.mit.edu	37	1	17666545	17666546	+	Intron	INS	-	CACA	CACA	rs146100213	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17666545_17666546insCACA	uc001baj.2	+						PADI4_uc009vpc.2_Intron	NM_012387	NP_036519	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV						chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	acacacgcgcgcgcacacacac	0.243													4	2	---	---	---	---	
EPHB2	2048	broad.mit.edu	37	1	23107812	23107812	+	Intron	DEL	A	-	-	rs143757031		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23107812delA	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		gactccgtctaaaaaaaaaaa	0.224									Hereditary_Prostate_Cancer				9	4	---	---	---	---	
FUCA1	2517	broad.mit.edu	37	1	24175456	24175456	+	Intron	DEL	T	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24175456delT	uc001bie.2	-							NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor						fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GCTGTTTTAAttttttttttt	0.184													9	4	---	---	---	---	
RAD54L	8438	broad.mit.edu	37	1	46726269	46726269	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46726269delC	uc009vye.2	+	7	577	c.463delC	c.(463-465)CCTfs	p.P155fs	RAD54L_uc001cpl.2_Frame_Shift_Del_p.P155fs|RAD54L_uc001cpm.1_5'UTR	NM_001142548	NP_001136020	Q92698	RAD54_HUMAN	RAD54-like protein	155					meiosis	nucleus	ATP binding|DNA binding|helicase activity			ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		GGTTTTGCGGCCTCATCAGAG	0.537								Direct_reversal_of_damage|Homologous_recombination					120	65	---	---	---	---	
RAP1A	5906	broad.mit.edu	37	1	112246771	112246771	+	Intron	DEL	T	-	-	rs145864366		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112246771delT	uc001ebi.2	+						RAP1A_uc001ebk.2_Intron|RAP1A_uc001ebl.2_Intron|RAP1A_uc001ebm.2_Intron	NM_002884	NP_002875	P62834	RAP1A_HUMAN	RAP1A, member of RAS oncogene family precursor						activation of MAPKK activity|blood coagulation|energy reserve metabolic process|nerve growth factor receptor signaling pathway|regulation of insulin secretion	cytosol|plasma membrane	GTP binding|GTPase activity				0		all_cancers(81;6.79e-06)|all_epithelial(167;2.42e-05)|all_lung(203;0.000105)|Lung NSC(277;0.00021)		Lung(183;0.0183)|Colorectal(144;0.0418)|LUSC - Lung squamous cell carcinoma(189;0.0966)|all cancers(265;0.098)|Epithelial(280;0.0981)|COAD - Colon adenocarcinoma(174;0.141)		ATCTCTTCCATTTTTTTTTTT	0.259													4	2	---	---	---	---	
PTPN22	26191	broad.mit.edu	37	1	114375847	114375848	+	Intron	DEL	TA	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114375847_114375848delTA	uc001eds.2	-						PTPN22_uc009wgq.2_Intron|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Intron|PTPN22_uc009wgs.2_Intron|PTPN22_uc001edu.2_Intron	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type						negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTTTGAACTTATATGTAATAT	0.282													14	9	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	154115677	154115678	+	Intron	INS	-	A	A	rs149484827		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154115677_154115678insA	uc001fdw.2	-						NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			tccccctgcccaaaaaaaaaaa	0.094													3	3	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162259067	162259070	+	Intron	DEL	CTTT	-	-	rs72224178	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162259067_162259070delCTTT	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			tccttccttcctttccttccttcc	0.029													9	8	---	---	---	---	
SCYL3	57147	broad.mit.edu	37	1	169827999	169827999	+	Intron	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169827999delA	uc001ggs.2	-						SCYL3_uc010plw.1_Intron|SCYL3_uc001ggt.2_Intron|SCYL3_uc001ggu.2_Intron	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2						cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)|skin(1)	2	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTGCAAGCTTAAAAAAAAAGT	0.229													4	2	---	---	---	---	
FCAMR	83953	broad.mit.edu	37	1	207132821	207132821	+	Intron	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207132821delA	uc001hfa.3	-						FCAMR_uc001hfb.2_Intron|FCAMR_uc009xca.1_Intron|FCAMR_uc001hfc.2_Intron	NM_001122980	NP_001116452	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity isoform 2							integral to membrane|plasma membrane	receptor activity			ovary(1)	1						gagtctgtctaaaaaaaaaaa	0.104													4	2	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247031195	247031196	+	Intron	INS	-	A	A			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247031195_247031196insA	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron|AHCTF1_uc009xgs.1_Intron|AHCTF1_uc001ibw.1_Intron	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ATGATTACACCCCCCCCCCcac	0.243													4	2	---	---	---	---	
C1orf150	148823	broad.mit.edu	37	1	247712252	247712253	+	5'Flank	DEL	GT	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247712252_247712253delGT	uc001idf.2	+						C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823												0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			gtgtgtatgagtgtgtgtgtgt	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248604559	248604560	+	IGR	INS	-	TC	TC	rs150497047	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248604559_248604560insTC								OR2T1 (34155 upstream) : OR2T2 (11539 downstream)																							TTCCCCTGGCTTCTTTGCCCTC	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38717960	38717961	+	IGR	INS	-	GT	GT	rs34926370		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38717960_38717961insGT								ATL2 (113528 upstream) : HNRPLL (72367 downstream)																							TATAGTGGGGCgtgtgtgtgtg	0.356													5	7	---	---	---	---	
MTIF2	4528	broad.mit.edu	37	2	55464785	55464786	+	Intron	INS	-	T	T	rs72103107		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55464785_55464786insT	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1						ttctttttttcttttttttttt	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	111442498	111442499	+	IGR	DEL	GT	-	-	rs67313849		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111442498_111442499delGT								BUB1 (6814 upstream) : ACOXL (47651 downstream)																							GACATTTTTCgtgtgtgtgtgt	0.292													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174602561	174602564	+	IGR	DEL	AAAT	-	-	rs72576321		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174602561_174602564delAAAT								CDCA7 (368843 upstream) : SP3 (170695 downstream)																							ggaaggaaggaaataaggaagata	0.000													8	4	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10191482	10191482	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191482delA	uc003bvc.2	+	3	688	c.475delA	c.(475-477)AAAfs	p.K159fs	VHL_uc003bvd.2_Frame_Shift_Del_p.K118fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	159	Interaction with Elongin BC complex.		K -> E (in VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.T157_K159del(1)|p.L158_K159del(1)|p.L158fs*6(1)|p.K159fs*13(1)|p.Y156*(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTATACTCTGAAAGAGCGATG	0.507		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				20	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	76860977	76860978	+	IGR	INS	-	T	T	rs71104624		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76860977_76860978insT								None (None upstream) : ROBO2 (228316 downstream)																							tccttccttccttccttccttc	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149701114	149701114	+	IGR	DEL	G	-	-	rs34404328		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149701114delG								PFN2 (12373 upstream) : TSC22D2 (425674 downstream)																							CCAGAGAGCCGGCCCCGGTAG	0.577													2	4	---	---	---	---	
YIPF7	285525	broad.mit.edu	37	4	44651969	44651969	+	Intron	DEL	A	-	-	rs35447406		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44651969delA	uc010ifx.1	-						YIPF7_uc010ify.1_Intron	NM_182592	NP_872398	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7							endoplasmic reticulum membrane|integral to membrane					0						agactctgtcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
NIPAL1	152519	broad.mit.edu	37	4	48026829	48026829	+	Intron	DEL	G	-	-	rs11285596		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48026829delG	uc003gxw.2	+							NM_207330	NP_997213	Q6NVV3	NIPA3_HUMAN	NIPA-like domain containing 1							integral to membrane					0						cgaatttatagggggaatcca	0.000													4	2	---	---	---	---	
CCDC158	339965	broad.mit.edu	37	4	77272467	77272467	+	Intron	DEL	C	-	-	rs113856518		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77272467delC	uc003hkb.3	-							NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6						AAAAAAAAAACGTTTTGTCAT	0.149													6	3	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83801734	83801735	+	Intron	DEL	TC	-	-	rs10529877		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83801734_83801735delTC	uc003hnf.2	-						SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				gaagtaagattctgtctcaaaa	0.094													4	2	---	---	---	---	
ELF2	1998	broad.mit.edu	37	4	139981004	139981004	+	Intron	DEL	T	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139981004delT	uc003ihp.1	-						ELF2_uc003ihm.1_Intron|ELF2_uc003ihn.1_Intron|ELF2_uc003iho.1_Intron|ELF2_uc011chc.1_Intron	NM_201999	NP_973728	Q15723	ELF2_HUMAN	E74-like factor 2 (ets domain transcription						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)					AGACATCTACttttttttttt	0.139													3	3	---	---	---	---	
RNASEN	29102	broad.mit.edu	37	5	31529070	31529070	+	Intron	DEL	C	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31529070delC	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron|RNASEN_uc010iui.1_5'Flank	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						ATCCTTTCCACCCTCTATAGC	0.353													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116217580	116217580	+	IGR	DEL	A	-	-	rs76319772		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116217580delA								SEMA6A (307029 upstream) : None (None downstream)																							agaaagaaagaaaagaaagaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122088375	122088382	+	IGR	DEL	GGAAGAAG	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122088375_122088382delGGAAGAAG								SNCAIP (288581 upstream) : SNX2 (22368 downstream)																							gagaaagagaggaagaagggaagaaggg	0.010													3	3	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127680393	127680393	+	Intron	DEL	T	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127680393delT	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCTTATAttcttttttttttt	0.164													11	6	---	---	---	---	
YIPF5	81555	broad.mit.edu	37	5	143549537	143549537	+	Intron	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143549537delA	uc003lnk.3	-						KCTD16_uc003lnm.1_5'Flank|YIPF5_uc003lnl.3_Intron|YIPF5_uc010jgl.2_Intron	NM_001024947	NP_001020118	Q969M3	YIPF5_HUMAN	Yip1 domain family, member 5						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle|Golgi cisterna membrane|integral to membrane				ovary(1)|skin(1)	2		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			AATCTGTAATAAAAGAGAAAT	0.358													129	77	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173545212	173545223	+	IGR	DEL	TCCCTCCCTCCC	-	-	rs70984997	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173545212_173545223delTCCCTCCCTCCC								HMP19 (9031 upstream) : MSX2 (606352 downstream)																							cttccttccttccctccctccctccttccttc	0.000													3	4	---	---	---	---	
CYP39A1	51302	broad.mit.edu	37	6	46607082	46607082	+	Intron	DEL	T	-	-	rs145394714		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46607082delT	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						caaaaaaaaaTAATTTAAAAG	0.219													4	3	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51893318	51893318	+	Intron	DEL	T	-	-	rs62917962		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51893318delT	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CTAACAACTAttttttttttt	0.154													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	71063390	71063391	+	IGR	DEL	TC	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71063390_71063391delTC								COL9A1 (50604 upstream) : FAM135A (59716 downstream)																							AGGCCAACTGTCTCTCTCTCTC	0.173													3	3	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152578100	152578100	+	Intron	DEL	T	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152578100delT	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATGGATGGATTTTTTTTTTT	0.234										HNSCC(10;0.0054)			5	3	---	---	---	---	
IGF2R	3482	broad.mit.edu	37	6	160526024	160526024	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160526024delG	uc003qta.2	+	48	7532	c.7384delG	c.(7384-7386)GGGfs	p.G2462fs		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	2462	Cytoplasmic (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		GGCGAGGAAAGGGAAGTCCAG	0.592													36	21	---	---	---	---	
PHF14	9678	broad.mit.edu	37	7	11101395	11101395	+	Intron	DEL	T	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11101395delT	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		ttgttttttgttttttttttt	0.279													6	3	---	---	---	---	
ABCB5	340273	broad.mit.edu	37	7	20697951	20697951	+	Intron	DEL	T	-	-	rs34847636		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20697951delT	uc003suw.3	+						ABCB5_uc010kuh.2_Intron|ABCB5_uc003suv.3_Intron|ABCB5_uc011jyi.1_Intron	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						CTTTGGGCTCTTTTTTTTTTT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	85590337	85590338	+	IGR	INS	-	TT	TT	rs146683302	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85590337_85590338insTT								SEMA3D (774166 upstream) : GRM3 (682892 downstream)																							ATCTCTCTCTCACCgtgtgtgt	0.337													4	3	---	---	---	---	
TRRAP	8295	broad.mit.edu	37	7	98509398	98509398	+	Intron	DEL	A	-	-	rs113146131		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98509398delA	uc003upp.2	+						TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Intron	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			tcaaaatctcaaaaaaaaaaa	0.164													4	2	---	---	---	---	
NRF1	4899	broad.mit.edu	37	7	129349134	129349134	+	Intron	DEL	T	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129349134delT	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						ACCACCTCAATTTTTGTCATT	0.413													28	30	---	---	---	---	
MTUS1	57509	broad.mit.edu	37	8	17581095	17581095	+	Intron	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17581095delA	uc003wxv.2	-						MTUS1_uc003wxt.2_5'Flank|MTUS1_uc011kyg.1_5'Flank|MTUS1_uc010lsy.2_Intron|MTUS1_uc003wxw.2_Intron|MTUS1_uc010lsz.2_Frame_Shift_Del_p.F845fs	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1							Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		CCCCAGAAACAAAAATTCTAA	0.343													32	14	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48614655	48614660	+	Intron	DEL	TCTCTT	-	-	rs72232339	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48614655_48614660delTCTCTT	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				tctctctctctctctTacacacacac	0.160													13	6	---	---	---	---	
CSPP1	79848	broad.mit.edu	37	8	68049568	68049569	+	Intron	INS	-	A	A	rs34987713		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68049568_68049569insA	uc003xxi.2	+						CSPP1_uc003xxg.1_Intron|CSPP1_uc003xxh.1_Intron|CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GTACACTGGGGAAAAAAAAAAA	0.223													4	2	---	---	---	---	
CPA6	57094	broad.mit.edu	37	8	68396310	68396310	+	Intron	DEL	T	-	-	rs71554608		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68396310delT	uc003xxq.3	-						CPA6_uc003xxr.3_Intron|CPA6_uc003xxs.2_Intron	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			ttgccttctcttttttttttt	0.055													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	15362229	15362230	+	IGR	INS	-	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15362229_15362230insT								TTC39B (54985 upstream) : SNAPC3 (60552 downstream)																							TTTCCCCTGTAttttttttttt	0.158													3	3	---	---	---	---	
SUGT1P1	441394	broad.mit.edu	37	9	33449647	33449647	+	Intron	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33449647delA	uc010mjq.1	-						AQP3_uc003zsv.1_5'Flank|AQP3_uc003zsx.2_5'Flank|AQP3_uc010mju.2_5'Flank	NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0						actccatctcaaaaaaaaaaa	0.224													3	3	---	---	---	---	
RMI1	80010	broad.mit.edu	37	9	86617962	86617962	+	3'UTR	DEL	T	-	-	rs11296264		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86617962delT	uc004anq.3	+	3					RMI1_uc004anr.3_3'UTR|RMI1_uc004anp.3_3'UTR|RMI1_uc004ans.3_3'UTR	NM_024945	NP_079221	Q9H9A7	RMI1_HUMAN	RMI1, RecQ mediated genome instability 1,						DNA replication	nucleus					0						TAAGTTAATCttttttttttt	0.114													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102150493	102150494	+	IGR	INS	-	CTTCCTTC	CTTCCTTC			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102150493_102150494insCTTCCTTC								SEC61B (157593 upstream) : NR4A3 (433643 downstream)																							ATTTGCCCTGTcttccttcctt	0.050													6	6	---	---	---	---	
ALDOB	229	broad.mit.edu	37	9	104192955	104192955	+	Intron	DEL	C	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104192955delC	uc004bbk.2	-							NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate						fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)				CTCCCGTGTACATAAACCTTT	0.383													4	4	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113243811	113243817	+	Intron	DEL	CTGTCTA	-	-	rs3841727		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113243811_113243817delCTGTCTA	uc010mtz.2	-						SVEP1_uc010mua.1_Intron|SVEP1_uc004beu.2_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						AGGACTCCTCCTGTCTATCGCTATTTC	0.348													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	135962494	135962494	+	IGR	DEL	C	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135962494delC								CELP (16 upstream) : RALGDS (10614 downstream)																							TCTGAGGCTGCCCCCGTGTCC	0.677													4	4	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137618916	137618917	+	Intron	INS	-	GGAC	GGAC	rs139171326	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137618916_137618917insGGAC	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		gatggatggatggatggatggG	0.238													5	7	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7249383	7249386	+	Intron	DEL	GAAA	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7249383_7249386delGAAA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						aagaaagaaggaaagaaagaaaga	0.000													1	6	---	---	---	---	
KIN	22944	broad.mit.edu	37	10	7804183	7804184	+	Intron	DEL	AA	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7804183_7804184delAA	uc001ijt.2	-						KIN_uc010qaz.1_Intron|KIN_uc009xip.2_Intron|KIN_uc010qba.1_Intron	NM_012311	NP_036443	O60870	KIN17_HUMAN	HsKin17 protein						DNA recombination|DNA repair|DNA replication|interspecies interaction between organisms|mRNA processing	cytoplasm|nuclear matrix	double-stranded DNA binding|RNA binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TTGCTTCAGGAAAAAAAAAAAA	0.282													3	3	---	---	---	---	
GBF1	8729	broad.mit.edu	37	10	104103557	104103557	+	Intron	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104103557delA	uc001kux.1	+						GBF1_uc001kuw.2_Intron|GBF1_uc001kuy.1_Intron|GBF1_uc001kuz.1_Intron	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine						COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		tctgtctgacaaaaaaaaaaa	0.000													3	3	---	---	---	---	
GBF1	8729	broad.mit.edu	37	10	104117962	104117963	+	Intron	INS	-	ACG	ACG			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104117962_104117963insACG	uc001kux.1	+						GBF1_uc001kuw.2_Intron|GBF1_uc001kuy.1_Intron|GBF1_uc001kuz.1_Intron	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine						COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CCTGGACTACTTCCTCTGATTA	0.485													81	54	---	---	---	---	
TCIRG1	10312	broad.mit.edu	37	11	67816197	67816200	+	Intron	DEL	TCTG	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67816197_67816200delTCTG	uc001one.2	+						TCIRG1_uc001ong.2_Intron|TCIRG1_uc001onh.2_Intron|TCIRG1_uc001oni.2_Intron|TCIRG1_uc009ysd.2_5'Flank	NM_006019	NP_006010	Q13488	VPP3_HUMAN	T-cell, immune regulator 1 isoform a						ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity			ovary(1)	1						CCATCTGCGCTCTGTTGCCCCTCG	0.377													9	4	---	---	---	---	
P4HA3	283208	broad.mit.edu	37	11	73999993	73999994	+	Intron	INS	-	A	A	rs36086552		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73999993_73999994insA	uc001ouz.2	-						P4HA3_uc001ouy.3_Intron|P4HA3_uc010rrj.1_Intron	NM_182904	NP_878907	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha III subunit							endoplasmic reticulum lumen	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			skin(1)	1	Breast(11;2.31e-05)					gatgccatctcaaaaaaaAAAA	0.173													4	2	---	---	---	---	
ZW10	9183	broad.mit.edu	37	11	113621741	113621742	+	Intron	INS	-	T	T	rs34836136		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113621741_113621742insT	uc001poe.2	-						ZW10_uc009yyv.2_Intron	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10						cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		actgcaaatacttttttttTTT	0.149													4	4	---	---	---	---	
ASAM	79827	broad.mit.edu	37	11	123021290	123021291	+	Intron	INS	-	AAGG	AAGG	rs12284315		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123021290_123021291insAAGG	uc001pyt.2	-							NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		ggaaggaaggaaaggaaggaag	0.094													6	3	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134037240	134037241	+	Intron	INS	-	ACTT	ACTT	rs72311832		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134037240_134037241insACTT	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron|NCAPD3_uc001qhc.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GGCGCACACTCGTGAGATGAGC	0.589													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5321087	5321090	+	IGR	DEL	GAAG	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5321087_5321090delGAAG								KCNA5 (165139 upstream) : NTF3 (220190 downstream)																							caaaaagagagaaggaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	15464239	15464253	+	IGR	DEL	TTCTTTCTTTCTTTC	-	-	rs139890862		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15464239_15464253delTTCTTTCTTTCTTTC								RERG (89935 upstream) : PTPRO (11234 downstream)																							tcctttctttttctttctttctttcttctttcttt	0.000													4	2	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48253630	48253649	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCT	-	-	rs60761635		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48253630_48253649delTTCCTTCCTTCCTTCCTTCT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	tttcccttccttccttccttccttccttctttccttcctt	0.036													4	4	---	---	---	---	
RPS26	6231	broad.mit.edu	37	12	56437595	56437596	+	Intron	INS	-	A	A	rs72234051		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56437595_56437596insA	uc001sjf.2	+							NM_001029	NP_001020	P62854	RS26_HUMAN	ribosomal protein S26						endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|protein binding|structural constituent of ribosome			breast(1)	1			OV - Ovarian serous cystadenocarcinoma(18;0.123)			ccttgtctcttaaaaaaaaaaa	0.228													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	75170113	75170113	+	IGR	DEL	A	-	-	rs145285977		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75170113delA								ATXN7L3B (234890 upstream) : KCNC2 (263784 downstream)																							gtgaagaaagaaaaaaaaaaa	0.040													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77054687	77054687	+	IGR	DEL	T	-	-	rs2369296	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77054687delT								OSBPL8 (101098 upstream) : ZDHHC17 (103167 downstream)																							aaaaaaaaaataaataaaGGA	0.358													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	96221820	96221823	+	IGR	DEL	AGGA	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96221820_96221823delAGGA								NTN4 (36890 upstream) : SNRPF (30886 downstream)																							agagaaagagaggaaggaaggaag	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110072974	110072975	+	IGR	INS	-	CAC	CAC	rs147461690	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110072974_110072975insCAC								MVK (37904 upstream) : C12orf34 (79215 downstream)																							accacaatcatcaccaccaCTG	0.010													3	4	---	---	---	---	
FZD10	11211	broad.mit.edu	37	12	130649317	130649317	+	3'UTR	DEL	T	-	-	rs112714527		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130649317delT	uc001uii.2	+	1					uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor						brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		cttcttcttcttttttttttt	0.388													5	7	---	---	---	---	
GPR180	160897	broad.mit.edu	37	13	95271760	95271762	+	In_Frame_Del	DEL	GTT	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95271760_95271762delGTT	uc001vly.2	+	5	803_805	c.725_727delGTT	c.(724-729)AGTTTG>ATG	p.242_243SL>M	GPR180_uc001vlz.2_In_Frame_Del_p.141_142SL>M|GPR180_uc010afi.2_In_Frame_Del_p.3_4SL>M	NM_180989	NP_851320	Q86V85	GP180_HUMAN	G protein-coupled receptor 180 precursor	242_243						integral to membrane				breast(1)	1	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					TTTATGGGAAGTTTGGCAGAATG	0.305													113	54	---	---	---	---	
AP1G2	8906	broad.mit.edu	37	14	24036229	24036229	+	Intron	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24036229delA	uc001wkl.2	-						AP1G2_uc001wkj.2_Intron|AP1G2_uc001wkk.3_Intron|AP1G2_uc001wkn.2_Intron|uc001wko.1_RNA|AP1G2_uc001wkp.1_5'Flank|AP1G2_uc010tnp.1_Intron|AP1G2_uc010aks.2_Intron|AP1G2_uc010akt.2_Intron|AP1G2_uc010tnq.1_Intron	NM_003917	NP_003908	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2						interspecies interaction between organisms|intracellular protein transport|vesicle-mediated transport	AP-1 adaptor complex|endosome membrane	protein binding|protein transporter activity			ovary(1)	1	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		TGTAGAATTTAAAAAACCAGG	0.502											OREG0022606	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66970228	66970229	+	Intron	DEL	AC	-	-	rs139322436		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66970228_66970229delAC	uc010tsr.1	-											DJ031130																		TTGTGTGTGTacacacacacac	0.030													4	3	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89647259	89647260	+	Intron	INS	-	GCAGAGAACATGCATGGA	GCAGAGAACATGCATGGA	rs140257053	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89647259_89647260insGCAGAGAACATGCATGGA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						agagacagagggcagagacaga	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	93161980	93161980	+	IGR	DEL	C	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93161980delC								RIN3 (6648 upstream) : LGMN (8177 downstream)																							ccaagtagctcagactacagg	0.015													4	2	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30020389	30020390	+	Intron	INS	-	T	T			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30020389_30020390insT	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GCATACTTCCCTTTTTTTTTTT	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31490972	31490991	+	IGR	DEL	CTTTCTTTCTTTCTTTCTTT	-	-	rs4041983	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31490972_31490991delCTTTCTTTCTTTCTTTCTTT								TRPM1 (97048 upstream) : KLF13 (128092 downstream)																							tccttccttcctttctttctttctttctttctttctttct	0.000													6	3	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50882045	50882046	+	Intron	INS	-	TTTTTTG	TTTTTTG	rs148695282	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50882045_50882046insTTTTTTG	uc001zyt.3	-						TRPM7_uc010bew.1_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AGGTTACAGttttttttgtttt	0.178													10	5	---	---	---	---	
RASL12	51285	broad.mit.edu	37	15	65351037	65351037	+	Intron	DEL	C	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65351037delC	uc002aoi.1	-						RASL12_uc002aoj.1_Intron|RASL12_uc010uir.1_Intron	NM_016563	NP_057647	Q9NYN1	RASLC_HUMAN	RAS-like, family 12 protein						small GTPase mediated signal transduction	membrane	GTP binding|GTPase activity			skin(1)	1						AATCCCACCTCCCCACTCCCC	0.582													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13966971	13966973	+	IGR	DEL	TGG	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13966971_13966973delTGG								SHISA9 (632699 upstream) : ERCC4 (47041 downstream)																							gtggtggtgatggtggtggtggt	0.177													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32224972	32224974	+	IGR	DEL	ATA	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32224972_32224974delATA								HERC2P4 (61098 upstream) : TP53TG3B (459867 downstream)																							TGGCACAGCTATAATGTTTTTCC	0.330													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54535786	54535789	+	IGR	DEL	GAAG	-	-	rs71377132		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54535786_54535789delGAAG								IRX3 (215408 upstream) : IRX5 (429322 downstream)																							aggaaggaaagaaggaaggaagga	0.039													5	3	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58572759	58572763	+	Frame_Shift_Del	DEL	GTAGC	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58572759_58572763delGTAGC	uc002env.2	-	36	5341_5345	c.5048_5052delGCTAC	c.(5047-5052)CGCTACfs	p.R1683fs	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Frame_Shift_Del_p.R1678fs|CNOT1_uc010vik.1_Frame_Shift_Del_p.R640fs	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1683_1684					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GGCATTCCCTGTAGCGCAGCAGAAG	0.502													70	34	---	---	---	---	
DHRS13	147015	broad.mit.edu	37	17	27228249	27228249	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27228249delA	uc002hde.3	-	4	568	c.441delT	c.(439-441)TTTfs	p.F147fs	DHRS13_uc002hdd.3_Frame_Shift_Del_p.F97fs|DHRS13_uc010wba.1_Frame_Shift_Del_p.F66fs	NM_144683	NP_653284	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	147						extracellular region	binding|oxidoreductase activity				0	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GTGTCAGCAGAAAGGGACCGA	0.602													64	33	---	---	---	---	
STAT5B	6777	broad.mit.edu	37	17	40368184	40368184	+	Intron	DEL	T	-	-	rs67502138		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40368184delT	uc002hzh.2	-							NM_012448	NP_036580	P51692	STA5B_HUMAN	signal transducer and activator of transcription						2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity			ovary(3)|lung(2)|skin(1)	6		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	TCCTTCTCTCTTTTTTTTTTT	0.418													5	3	---	---	---	---	
LRRC37A4	55073	broad.mit.edu	37	17	43587835	43587837	+	Intron	DEL	TTG	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587835_43587837delTTG	uc002ije.2	-											Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						Tcagtcatccttgctatcttgcg	0.153													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48378355	48378358	+	IGR	DEL	GGAA	-	-	rs11654860		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48378355_48378358delGGAA								TMEM92 (19511 upstream) : XYLT2 (45035 downstream)																							aggaaggaagggaaggaaggaagg	0.206													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75864764	75864765	+	IGR	DEL	TG	-	-	rs113869156		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75864764_75864765delTG								SEPT9 (368088 upstream) : FLJ45079 (10344 downstream)																							GCCCAGACTCtgtgtgtgtgtg	0.307													3	5	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79419160	79419185	+	Intron	DEL	GGGAGGGTCGCAGCACCCCCACCCCC	-	-	rs67000403		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79419160_79419185delGGGAGGGTCGCAGCACCCCCACCCCC	uc002kaf.2	+						BAHCC1_uc002kae.2_Intron|hsa-mir-3186|MI0014229_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			GGGGGGGCCTGGGAGGGTCGCAGCACCCCCACCCCCGGGAGGCGCC	0.726													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5847899	5847899	+	IGR	DEL	T	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5847899delT								EPB41L3 (217257 upstream) : TMEM200C (42285 downstream)																							TTTGTGTTGGTTTTTTACCCC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3332499	3332500	+	IGR	INS	-	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3332499_3332500insC								CELF5 (35428 upstream) : NFIC (27116 downstream)																							cctccttccttccttccctcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9130430	9130430	+	IGR	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9130430delA								MUC16 (38412 upstream) : OR1M1 (73491 downstream)																							agacaacgtcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
ANKRD27	84079	broad.mit.edu	37	19	33108658	33108659	+	Intron	DEL	AG	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33108658_33108659delAG	uc002ntn.1	-							NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					CGTCTGATTTAGtttttttttt	0.109													6	3	---	---	---	---	
GRIN2D	2906	broad.mit.edu	37	19	48922310	48922310	+	Intron	DEL	T	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48922310delT	uc002pjc.3	+						GRIN2D_uc010elx.2_5'Flank	NM_000836	NP_000827	O15399	NMDE4_HUMAN	N-methyl-D-aspartate receptor subunit 2D							cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)	tttttcttccttttttttttt	0.224													6	3	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49964436	49964437	+	Intron	INS	-	G	G			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49964436_49964437insG	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		gaggaggggctggggtctggat	0.000													4	3	---	---	---	---	
NOP56	10528	broad.mit.edu	37	20	2633399	2633404	+	Intron	DEL	GCCTGC	-	-	rs68063608	by1000genomes	TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2633399_2633404delGCCTGC	uc002wgh.2	+						NOP56_uc010zpy.1_Intron|MIR1292_hsa-mir-1292|MI0006433_5'Flank|NOP56_uc002wgi.2_5'Flank|SNORD110_uc002wgj.2_5'Flank|SNORA51_uc002wgk.1_5'Flank|NOP56_uc002wgm.1_5'Flank	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A						rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						ctgggcctgggcctgcgcctgcgcct	0.544													4	2	---	---	---	---	
ERGIC3	51614	broad.mit.edu	37	20	34143584	34143584	+	Intron	DEL	A	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34143584delA	uc002xct.2	+						ERGIC3_uc010zvg.1_Intron|ERGIC3_uc002xcs.2_Intron|ERGIC3_uc002xcu.2_Intron|ERGIC3_uc002xcv.2_Intron	NM_015966	NP_057050	Q9Y282	ERGI3_HUMAN	serologically defined breast cancer antigen 84						vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane	protein binding			large_intestine(2)|ovary(1)	3	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			accttgtctcaaaaaaaaaaa	0.214													4	2	---	---	---	---	
CSE1L	1434	broad.mit.edu	37	20	47683569	47683579	+	Intron	DEL	AAAAAAAAAAA	-	-	rs72233036		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47683569_47683579delAAAAAAAAAAA	uc002xty.2	+						CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Intron	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein						apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			actccgtctcaaaaaaaaaaaaaaaaaaaaa	0.156													7	4	---	---	---	---	
psiTPTE22	387590	broad.mit.edu	37	22	17131536	17131537	+	Intron	INS	-	CTG	CTG	rs34452519		TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17131536_17131537insCTG	uc002zls.1	+						psiTPTE22_uc002zlt.2_Intron					Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0						TGCCCACTCTTCTGGTCTCATG	0.470													6	3	---	---	---	---	
SRRD	402055	broad.mit.edu	37	22	26883836	26883837	+	Intron	DEL	TG	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26883836_26883837delTG	uc010gve.2	+						SRRD_uc003acp.3_Intron	NM_001013694	NP_001013716	Q9UH36	SRR1L_HUMAN	SRR1 domain containing						rhythmic process						0						CAGGCATGTTTGGGAATGAGGC	0.465													7	10	---	---	---	---	
TNRC6B	23112	broad.mit.edu	37	22	40717004	40717007	+	Intron	DEL	CTAG	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40717004_40717007delCTAG	uc011aor.1	+						TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Intron|TNRC6B_uc003ayo.2_Intron	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						AATGGGCACACTAGGTCTCAGCCA	0.392													32	27	---	---	---	---	
NFAM1	150372	broad.mit.edu	37	22	42807545	42807546	+	Frame_Shift_Ins	INS	-	C	C			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42807545_42807546insC	uc003bcn.3	-	2	356_357	c.318_319insG	c.(316-321)GAGAACfs	p.E106fs		NM_145912	NP_666017	Q8NET5	NFAM1_HUMAN	NFAT activation molecule 1 precursor	106_107	Extracellular (Potential).|Ig-like V-type.				B cell differentiation|inflammatory response|intracellular signal transduction|positive regulation of B cell receptor signaling pathway|positive regulation of cytokine production|positive regulation of sequence-specific DNA binding transcription factor activity	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity				0						TGGCTCTGGTTCTCTGTGCCCA	0.574													123	110	---	---	---	---	
CD99	4267	broad.mit.edu	37	X	2638655	2638661	+	Intron	DEL	AGTTTGC	-	-			TCGA-B0-5099-01A-01D-1421-08	TCGA-B0-5099-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2638655_2638661delAGTTTGC	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						TTTTATTTTTAGTTTGCtttttttttt	0.169													8	4	---	---	---	---	
