Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SASS6	163786	broad.mit.edu	37	1	100550761	100550761	+	3'UTR	SNP	C	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100550761C>G	uc001dsu.2	-	17					SASS6_uc009wdz.2_3'UTR	NM_194292	NP_919268	Q6UVJ0	SAS6_HUMAN	spindle assembly abnormal protein 6						centriole replication	centriole				upper_aerodigestive_tract(1)|ovary(1)	2		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		CTTAAAGTATCCAGTCTTTAA	0.308													10	17	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39519948	39519948	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39519948C>A	uc002rro.2	-	18	1328	c.1237G>T	c.(1237-1239)GAA>TAA	p.E413*	MAP4K3_uc002rrp.2_Nonsense_Mutation_p.E392*|MAP4K3_uc010yns.1_5'UTR	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	413					JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				TCATCATCTTCTAAATGTGCG	0.318													20	123	---	---	---	---	PASS
SRGAP3	9901	broad.mit.edu	37	3	9034602	9034602	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9034602C>T	uc003brf.1	-	20	3222	c.2546G>A	c.(2545-2547)GGG>GAG	p.G849E	SRGAP3_uc003brg.1_Missense_Mutation_p.G825E	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	849					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GCCCATCACCCCCCCAAAGCC	0.552			T	RAF1	pilocytic astrocytoma								18	66	---	---	---	---	PASS
PPARG	5468	broad.mit.edu	37	3	12422837	12422837	+	Silent	SNP	G	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12422837G>A	uc003bwx.2	+	3	418	c.327G>A	c.(325-327)GAG>GAA	p.E109E	PPARG_uc003bwr.2_Silent_p.E81E|PPARG_uc003bws.2_Silent_p.E81E|PPARG_uc003bwu.2_Silent_p.E81E|PPARG_uc003bwv.2_Silent_p.E81E|PPARG_uc010hea.1_RNA|PPARG_uc003bwq.1_Silent_p.E81E|PPARG_uc003bwt.1_Silent_p.E81E|PPARG_uc003bww.1_Silent_p.E109E	NM_015869	NP_056953	P37231	PPARG_HUMAN	peroxisome proliferative activated receptor	109					activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|kidney(1)	2					Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)	TCAAAGTGGAGCCTGCATCTC	0.453			T	PAX8	follicular thyroid		Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension						8	40	---	---	---	---	PASS
PPP2R2C	5522	broad.mit.edu	37	4	6349697	6349697	+	Silent	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6349697C>T	uc003gjc.2	-	6	1036	c.666G>A	c.(664-666)ACG>ACA	p.T222T	PPP2R2C_uc003gjb.2_Silent_p.T205T|PPP2R2C_uc011bwd.1_Silent_p.T215T|PPP2R2C_uc011bwe.1_Silent_p.T215T|PPP2R2C_uc003gja.2_Silent_p.T222T|PPP2R2C_uc003gjd.1_Silent_p.T310T	NM_020416	NP_065149	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein	222	WD 4.				signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						TGATCACCTCCGTAAGGTCCT	0.622													13	50	---	---	---	---	PASS
SLC30A9	10463	broad.mit.edu	37	4	42037333	42037333	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42037333T>G	uc003gwl.2	+	7	798	c.652T>G	c.(652-654)TTC>GTC	p.F218V	SLC30A9_uc011byx.1_Translation_Start_Site	NM_006345	NP_006336	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter),	218					nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3						ATACAGAGATTTCTTGGGAAA	0.299													6	122	---	---	---	---	PASS
NFXL1	152518	broad.mit.edu	37	4	47850290	47850290	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47850290C>T	uc010igh.2	-	23	2803	c.2626G>A	c.(2626-2628)GAA>AAA	p.E876K	NFXL1_uc003gxo.2_Missense_Mutation_p.E201K|NFXL1_uc003gxp.2_Missense_Mutation_p.E876K|NFXL1_uc003gxq.3_RNA|NFXL1_uc010igi.2_Missense_Mutation_p.E876K	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like	876						integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						ACTGCCACTTCATCTCTTTTC	0.373													18	77	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69811110	69811110	+	Missense_Mutation	SNP	A	C	C	rs62641705		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69811110A>C	uc003hef.2	-	2	809	c.778T>G	c.(778-780)TGG>GGG	p.W260G	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	260	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						TCAAAATCCCAATATGTTCGT	0.378													4	85	---	---	---	---	PASS
BMP2K	55589	broad.mit.edu	37	4	79832708	79832708	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79832708A>G	uc003hlk.2	+	16	3173	c.3007A>G	c.(3007-3009)AGC>GGC	p.S1003G	PAQR3_uc003hlm.2_Intron|PAQR3_uc003hln.2_Intron|uc010ijm.1_5'Flank	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	1003						nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						CACGCCAACTAGCACAAAGAA	0.498													18	75	---	---	---	---	PASS
NHEDC1	150159	broad.mit.edu	37	4	103822215	103822215	+	3'UTR	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103822215C>T	uc003hww.2	-	12					NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_3'UTR	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN	Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)		CTTTAAAATTCTTCTGTCATG	0.333													3	47	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24492951	24492951	+	Silent	SNP	T	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24492951T>G	uc003jgr.1	-	10	1931	c.1599A>C	c.(1597-1599)CCA>CCC	p.P533P	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	533	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		CTGTGAAGTTTGGATTGACAG	0.338										HNSCC(23;0.051)			7	188	---	---	---	---	PASS
ANKRD32	84250	broad.mit.edu	37	5	94014548	94014548	+	Silent	SNP	A	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94014548A>G	uc003kkr.3	+	15	1943	c.1863A>G	c.(1861-1863)GGA>GGG	p.G621G	ANKRD32_uc003kks.2_5'UTR	NM_032290	NP_115666	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	621										ovary(2)	2		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		TATTGGCTGGAATTCTTGGAG	0.308													15	87	---	---	---	---	PASS
CSF1R	1436	broad.mit.edu	37	5	149456746	149456746	+	Intron	SNP	C	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149456746C>A	uc003lrl.2	-						CSF1R_uc011dcd.1_Intron|CSF1R_uc010jhc.2_Intron|CSF1R_uc003lrm.2_Intron|CSF1R_uc011dce.1_Intron|CSF1R_uc011dcf.1_Missense_Mutation_p.D328Y	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor						cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	CTCAGCAGGTCTCCTTCCCTG	0.552													3	23	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42116424	42116424	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42116424G>A	uc011kbh.1	-	4	491	c.400C>T	c.(400-402)CCT>TCT	p.P134S	GLI3_uc011kbg.1_Missense_Mutation_p.P75S	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	134					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						ATTGGTACAGGAGGATGGAAG	0.418									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				15	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	65222986	65222986	+	Intron	SNP	G	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65222986G>T	uc003tud.1	-						CCT6P1_uc003tug.2_RNA|CCT6P1_uc003tuh.2_RNA|CCT6P1_uc003tui.2_RNA|uc003tuk.1_5'Flank					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		GAATTCTGGCGTTTTTTACAA	0.289													4	17	---	---	---	---	PASS
CDCA2	157313	broad.mit.edu	37	8	25343306	25343306	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25343306C>T	uc003xep.1	+	11	1876	c.1397C>T	c.(1396-1398)GCC>GTC	p.A466V	PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.A466V|CDCA2_uc003xeq.1_Missense_Mutation_p.A451V|CDCA2_uc003xer.1_Missense_Mutation_p.A129V	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	466					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		GTATCATTTGCCGTTCTCAGT	0.308													3	54	---	---	---	---	PASS
TCEB1	6921	broad.mit.edu	37	8	74858967	74858967	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74858967G>T	uc003xzx.1	-	4	322	c.237C>A	c.(235-237)TAC>TAA	p.Y79*	TCEB1_uc003xzy.1_Nonsense_Mutation_p.Y79*|TCEB1_uc003xzz.1_Nonsense_Mutation_p.Y63*|TCEB1_uc003yaa.1_Nonsense_Mutation_p.Y79*	NM_005648	NP_005639	Q15369	ELOC_HUMAN	elongin C	79					interspecies interaction between organisms|positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm	protein binding				0	Breast(64;0.0311)		Epithelial(68;0.0136)|all cancers(69;0.0431)|BRCA - Breast invasive adenocarcinoma(89;0.0499)			AGCGAACCTTGTACGTAAAAT	0.413													12	25	---	---	---	---	PASS
TCEB1	6921	broad.mit.edu	37	8	74858968	74858968	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74858968T>A	uc003xzx.1	-	4	321	c.236A>T	c.(235-237)TAC>TTC	p.Y79F	TCEB1_uc003xzy.1_Missense_Mutation_p.Y79F|TCEB1_uc003xzz.1_Missense_Mutation_p.Y63F|TCEB1_uc003yaa.1_Missense_Mutation_p.Y79F	NM_005648	NP_005639	Q15369	ELOC_HUMAN	elongin C	79					interspecies interaction between organisms|positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm	protein binding				0	Breast(64;0.0311)		Epithelial(68;0.0136)|all cancers(69;0.0431)|BRCA - Breast invasive adenocarcinoma(89;0.0499)			GCGAACCTTGTACGTAAAATA	0.413													12	25	---	---	---	---	PASS
PRKACG	5568	broad.mit.edu	37	9	71627879	71627879	+	3'UTR	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71627879C>T	uc004agy.2	-	1						NM_002732	NP_002723	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic,						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|gluconeogenesis|intracellular protein kinase cascade|male gonad development|nerve growth factor receptor signaling pathway|regulation of insulin secretion|spermatogenesis|transmembrane transport|triglyceride catabolic process|water transport	cytosol|nucleoplasm	ATP binding|cAMP-dependent protein kinase activity			ovary(1)|pancreas(1)|skin(1)	3						TCTGGCTGTTCAATCCAACCC	0.512													4	17	---	---	---	---	PASS
IARS	3376	broad.mit.edu	37	9	95012199	95012199	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95012199T>A	uc004art.1	-	25	2814	c.2557A>T	c.(2557-2559)ATC>TTC	p.I853F	IARS_uc004ars.1_Missense_Mutation_p.I698F|IARS_uc004aru.3_Missense_Mutation_p.I853F|IARS_uc010mqr.2_Missense_Mutation_p.I743F|IARS_uc010mqt.2_Missense_Mutation_p.I76F	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	853					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	TCTTGATGGATAACCACAATT	0.368													28	138	---	---	---	---	PASS
IARS	3376	broad.mit.edu	37	9	95012201	95012201	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95012201A>G	uc004art.1	-	25	2812	c.2555T>C	c.(2554-2556)GTT>GCT	p.V852A	IARS_uc004ars.1_Missense_Mutation_p.V697A|IARS_uc004aru.3_Missense_Mutation_p.V852A|IARS_uc010mqr.2_Missense_Mutation_p.V742A|IARS_uc010mqt.2_Missense_Mutation_p.V75A	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	852					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	TTGATGGATAACCACAATTTC	0.368													28	140	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16919092	16919092	+	Silent	SNP	A	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16919092A>G	uc001ioo.2	-	57	8962	c.8910T>C	c.(8908-8910)CGT>CGC	p.R2970R	CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_Silent_p.R326R	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	2970	CUB 22.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCACAGCGGAACGAGCTGGAA	0.453													3	20	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61835269	61835269	+	Silent	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61835269C>T	uc001jky.2	-	37	5562	c.5370G>A	c.(5368-5370)CAG>CAA	p.Q1790Q	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1790	Ser-rich.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TTCTTAGAGACTGAAAAGCTG	0.453													25	109	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													7	54	---	---	---	---	PASS
OR52K1	390036	broad.mit.edu	37	11	4510414	4510414	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4510414A>G	uc001lza.1	+	1	284	c.284A>G	c.(283-285)AAC>AGC	p.N95S		NM_001005171	NP_001005171	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K,	95	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		CAGGAGATCAACTTCTTTGCC	0.498													4	49	---	---	---	---	PASS
LGR4	55366	broad.mit.edu	37	11	27390552	27390552	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27390552G>A	uc001mrj.3	-	18	2203	c.1718C>T	c.(1717-1719)TCC>TTC	p.S573F	LGR4_uc001mrk.3_Missense_Mutation_p.S549F	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled	573	Cytoplasmic (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1						AAACAATTTGGACGAAGGCAG	0.378													27	91	---	---	---	---	PASS
SLITRK6	84189	broad.mit.edu	37	13	86370304	86370304	+	Silent	SNP	G	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86370304G>A	uc001vll.1	-	2	799	c.340C>T	c.(340-342)CTG>TTG	p.L114L	SLITRK6_uc010afe.1_5'Flank	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	114	Extracellular (Potential).|LRR 2.					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		AGTTGTTTCAGGAGGCCAAGG	0.358													35	111	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75230960	75230960	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75230960T>G	uc001xqj.3	+	1	892	c.768T>G	c.(766-768)AAT>AAG	p.N256K		NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CCCCTGGAAATAAGACAACTG	0.572													10	33	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25331751	25331751	+	Intron	SNP	G	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25331751G>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_RNA|uc001yyd.2_Intron|SNORD116-19_uc001yye.1_RNA|SNORD116-20_uc001yyf.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CGTCATCCTCGTCGAACTGAG	0.468													41	190	---	---	---	---	PASS
PRSS54	221191	broad.mit.edu	37	16	58325018	58325018	+	Silent	SNP	G	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58325018G>A	uc002enf.2	-	4	503	c.108C>T	c.(106-108)TCC>TCT	p.S36S	PRSS54_uc002eng.2_Silent_p.S36S|PRSS54_uc010vie.1_Intron	NM_001080492	NP_001073961	Q6PEW0	PRS54_HUMAN	plasma kallikrein-like protein 4 precursor	36					proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						CGTAGAAAACGGAAGCTTTCT	0.627													3	52	---	---	---	---	PASS
ATPAF2	91647	broad.mit.edu	37	17	17929649	17929649	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17929649C>T	uc002gse.1	-	4	559	c.406G>A	c.(406-408)GAC>AAC	p.D136N	ATPAF2_uc002gsd.1_RNA|ATPAF2_uc002gsf.1_RNA|ATPAF2_uc010cps.1_RNA	NM_145691	NP_663729	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly	136					proton-transporting ATP synthase complex assembly	mitochondrion|nuclear speck	protein binding				0	all_neural(463;0.228)					GTGTCGGTGTCCAGAAACTTC	0.463													28	105	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42531246	42531246	+	Silent	SNP	A	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42531246A>G	uc010dni.2	+	4	2237	c.1941A>G	c.(1939-1941)AAA>AAG	p.K647K		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	647						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GCGAGATGAAATTTCACAAGA	0.448									Schinzel-Giedion_syndrome				15	59	---	---	---	---	PASS
MBP	4155	broad.mit.edu	37	18	74728852	74728852	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74728852A>G	uc010xfd.1	-	4	776	c.512T>C	c.(511-513)ATC>ACC	p.I171T	MBP_uc002lml.2_Missense_Mutation_p.I38T|MBP_uc002lmn.2_Missense_Mutation_p.I38T|MBP_uc002lmp.2_Missense_Mutation_p.I38T|MBP_uc010xfe.1_Missense_Mutation_p.I38T|MBP_uc002lmr.2_Missense_Mutation_p.I171T	NM_001025101	NP_001020272	P02686	MBP_HUMAN	Golli-mbp isoform 1	171					central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)		GGAGTCAAGGATGCCCGTGTC	0.582													13	45	---	---	---	---	PASS
SLCO4A1	28231	broad.mit.edu	37	20	61303317	61303317	+	3'UTR	SNP	A	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61303317A>T	uc002ydb.1	+	12					SLCO4A1_uc002ydc.1_Intron|SLCO4A1_uc002yde.1_3'UTR	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family						sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)			CCGTTGGGTGATGCAATCACA	0.587													5	22	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22724315	22724315	+	RNA	SNP	G	C	C			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22724315G>C	uc011aim.1	+	43		c.4588G>C								Parts of antibodies, mostly variable regions.												0						ACTGATTTATGATACAAGCAA	0.577													3	30	---	---	---	---	PASS
FGD1	2245	broad.mit.edu	37	X	54475272	54475272	+	Silent	SNP	C	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54475272C>T	uc004dtg.2	-	16	3137	c.2403G>A	c.(2401-2403)CAG>CAA	p.Q801Q	FGD1_uc011moi.1_3'UTR	NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	801					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GGGGTGTATGCTGGCTGCAGG	0.612													3	29	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12568746	12568746	+	Intron	DEL	A	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12568746delA	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron|VPS13D_uc010obd.1_Intron	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		actccgtctcaaaaaaaaaaa	0.169													5	3	---	---	---	---	
C1orf135	79000	broad.mit.edu	37	1	26186959	26186960	+	5'Flank	INS	-	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26186959_26186960insT	uc001bkw.1	-							NM_024037	NP_076942	Q9H7T9	CA135_HUMAN	aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AAATTTTGTAATTTTTTTTTTT	0.272													4	2	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45323200	45323200	+	Intron	DEL	A	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45323200delA	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					tgaaactccgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
IL12RB2	3595	broad.mit.edu	37	1	67787765	67787766	+	Intron	DEL	TC	-	-	rs71945445		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67787765_67787766delTC	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						ATTTGGCAAGtctctctctctc	0.342													4	2	---	---	---	---	
RC3H1	149041	broad.mit.edu	37	1	173930702	173930702	+	Intron	DEL	A	-	-	rs71715802		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173930702delA	uc001gju.3	-						RC3H1_uc010pms.1_Intron|RC3H1_uc001gjv.2_Intron|RC3H1_uc010pmt.1_Intron	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin						cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TATATAGTTTAAAAAAAAAAA	0.259													9	6	---	---	---	---	
RFTN2	130132	broad.mit.edu	37	2	198540353	198540354	+	5'UTR	DEL	AC	-	-	rs148812496		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198540353_198540354delAC	uc002uuo.3	-	1						NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2							plasma membrane					0						aaaaaaaaaaacccaaaaaaaa	0.248													4	2	---	---	---	---	
RPE	6120	broad.mit.edu	37	2	210882456	210882457	+	Intron	DEL	GC	-	-	rs2243769		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210882456_210882457delGC	uc002vdn.2	+						RPE_uc002vdm.2_Intron|RPE_uc002vdo.2_Intron|RPE_uc010zjf.1_Intron|RPE_uc002vdp.2_Intron|RPE_uc010fup.2_Intron|RPE_uc002vdq.2_Intron|RPE_uc002vdr.2_Intron	NM_199229	NP_954699	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase isoform 1						pentose-phosphate shunt	cytosol	metal ion binding|protein homodimerization activity|ribulose-phosphate 3-epimerase activity				0				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		AAGTGGATATGCTttttttttt	0.188													4	2	---	---	---	---	
CACNA1D	776	broad.mit.edu	37	3	53809704	53809704	+	Intron	DEL	A	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53809704delA	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron|CACNA1D_uc003dgw.3_Intron|CACNA1D_uc003dgx.1_Intron	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	TGATGGCTGTAAATCCAAGGG	0.358													3	5	---	---	---	---	
SAMD7	344658	broad.mit.edu	37	3	169642737	169642738	+	Intron	INS	-	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169642737_169642738insT	uc003fgd.2	+						SAMD7_uc003fge.2_Intron|SAMD7_uc011bpo.1_Intron	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7											skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			TTGCTGGTTTGTTTTTTTTTTT	0.317													4	2	---	---	---	---	
GUF1	60558	broad.mit.edu	37	4	44680573	44680574	+	5'UTR	INS	-	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44680573_44680574insA	uc003gww.3	+	1					GUF1_uc010ifz.1_RNA	NM_021927	NP_068746	Q8N442	GUF1_HUMAN	GUF1 GTPase homolog						translation	mitochondrial inner membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)	1						GGGTACCTTCGAAAAAAAACGG	0.624													4	2	---	---	---	---	
PCDHGA10	56106	broad.mit.edu	37	5	140812926	140812929	+	Intron	DEL	CTAT	-	-	rs72463976		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140812926_140812929delCTAT	uc003lkl.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tactgtctgcctatctatctatct	0.000													3	3	---	---	---	---	
FAM153B	202134	broad.mit.edu	37	5	175530031	175530031	+	Intron	DEL	G	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175530031delG	uc003mdk.2	+							NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134											ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		CCTGCACTGCGTGGTGTGCAC	0.507													4	2	---	---	---	---	
FKBP5	2289	broad.mit.edu	37	6	35554625	35554625	+	Intron	DEL	T	-	-	rs112376611		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35554625delT	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_3'UTR	NM_001145776	NP_001139248	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						GAATCTGTACTTTTTTTTTTT	0.189													4	2	---	---	---	---	
MAPK13	5603	broad.mit.edu	37	6	36098497	36098498	+	Intron	INS	-	GGGGGGC	GGGGGGC	rs146539855	by1000genomes	TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36098497_36098498insGGGGGGC	uc003ols.2	+						MAPK13_uc003olt.2_Intron	NM_002754	NP_002745	O15264	MK13_HUMAN	mitogen-activated protein kinase 13						cell cycle|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|positive regulation of interleukin-6 production|Ras protein signal transduction|response to stress		ATP binding|MAP kinase activity|protein binding			breast(2)|central_nervous_system(1)	3						CCTgggccgctggggggcgggg	0.599													5	3	---	---	---	---	
SYNCRIP	10492	broad.mit.edu	37	6	86329253	86329254	+	Intron	INS	-	A	A	rs71551488		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86329253_86329254insA	uc003pla.2	-						SYNCRIP_uc003pku.2_Intron|SYNCRIP_uc003pkw.2_Intron|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Intron|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Intron	NM_006372	NP_006363	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA						CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		TGTCAGAATATAAAAAAAAAAA	0.193													9	4	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	161771036	161771037	+	3'UTR	DEL	GT	-	-	rs62637702	by1000genomes	TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161771036_161771037delGT	uc003qtx.3	-	12					PARK2_uc003qtv.3_RNA|PARK2_uc010kkd.2_3'UTR|PARK2_uc003qtw.3_3'UTR|PARK2_uc003qty.3_3'UTR|PARK2_uc003qtz.3_3'UTR|PARK2_uc011egf.1_3'UTR	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		gcgcgcgcgcgtgtgtgtgtgt	0.396													4	2	---	---	---	---	
PAPOLB	56903	broad.mit.edu	37	7	4901465	4901466	+	5'UTR	INS	-	CACGTCCCCCACCACCGCGACCTT	CACGTCCCCCACCACCGCGACCTT	rs143942823	by1000genomes	TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4901465_4901466insCACGTCCCCCACCACCGCGACCTT	uc003snk.2	-	1					RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		CCCCGCCAGGGCACGTCCCCCA	0.728													6	4	---	---	---	---	
MLL5	55904	broad.mit.edu	37	7	104681592	104681592	+	Intron	DEL	A	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104681592delA	uc003vcm.2	+						MLL5_uc010lja.1_Intron|MLL5_uc010ljb.1_Intron|MLL5_uc003vcl.2_Intron|MLL5_uc010ljc.2_Intron	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						TTTTTAAAGTAAAAAAAAAAA	0.274													4	2	---	---	---	---	
POTEA	340441	broad.mit.edu	37	8	43216289	43216290	+	3'UTR	INS	-	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43216289_43216290insA	uc003xpz.1	+	13					POTEA_uc003xqa.1_3'UTR	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2											ovary(1)	1						AGAAGTGGCCGAAAAAAAAATG	0.282													4	2	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113192403	113192404	+	Intron	INS	-	GT	GT	rs35386381	by1000genomes	TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113192403_113192404insGT	uc010mtz.2	-						SVEP1_uc010mty.2_5'Flank	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ttttttttttGGTGTGTGTGTG	0.322													5	3	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29776326	29776327	+	Intron	DEL	AA	-	-	rs72152755		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29776326_29776327delAA	uc001iut.1	-						LOC387647_uc001iuq.1_RNA|SVIL_uc010qdw.1_Intron|SVIL_uc001iuu.1_Intron|SVIL_uc009xlc.2_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TTTCACTTCTAAAGAGTCTTGT	0.545													5	3	---	---	---	---	
FCHSD2	9873	broad.mit.edu	37	11	72613575	72613575	+	Intron	DEL	A	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72613575delA	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			ATGAAAATCTATAATTCCCTT	0.388													4	2	---	---	---	---	
TMPRSS13	84000	broad.mit.edu	37	11	117772788	117772793	+	3'UTR	DEL	CACACA	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117772788_117772793delCACACA	uc001prs.1	-	13					TMPRSS13_uc009yzr.1_3'UTR	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		cacacatatgcacacacacacacaca	0.427													5	3	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109883170	109883173	+	Intron	DEL	TTCC	-	-	rs67955379		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109883170_109883173delTTCC	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						CATTCTTCCTTTCCTCAAATATGC	0.358													4	2	---	---	---	---	
TRMT5	57570	broad.mit.edu	37	14	61439184	61439185	+	3'UTR	INS	-	GGC	GGC			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61439184_61439185insGGC	uc001xff.3	-	5						NM_020810	NP_065861	Q32P41	TRMT5_HUMAN	tRNA methyltransferase 5							cytoplasm	tRNA (guanine-N1-)-methyltransferase activity			central_nervous_system(2)|large_intestine(1)	3				OV - Ovarian serous cystadenocarcinoma(108;0.0873)		CTCTTGGGCATggcggcggcgg	0.500													3	3	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	64010690	64010691	+	Intron	INS	-	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64010690_64010691insT	uc002amp.2	-						HERC1_uc010uil.1_Intron	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						ACCAAGGCACATTTTTTTCTCA	0.272													2	4	---	---	---	---	
E4F1	1877	broad.mit.edu	37	16	2279365	2279366	+	Intron	INS	-	G	G	rs148612482	by1000genomes	TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2279365_2279366insG	uc002cpm.2	+						E4F1_uc010bsi.2_Intron|E4F1_uc010bsj.2_Intron	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F						cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						GACCCTGGCCCGGGGGTGAAGG	0.683													3	5	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74394379	74394380	+	Intron	INS	-	A	A	rs142790741	by1000genomes	TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394379_74394380insA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						TAGTCATCCTTAAACAAAATTC	0.327													4	2	---	---	---	---	
PLD2	5338	broad.mit.edu	37	17	4712868	4712868	+	Intron	DEL	C	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4712868delC	uc002fzc.2	+						PLD2_uc010vsj.1_Intron|PLD2_uc002fzd.2_Intron	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2						cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)	GCCCCCTTCACCCAGGCATCC	0.567													88	44	---	---	---	---	
SNX11	29916	broad.mit.edu	37	17	46190911	46190911	+	Intron	DEL	T	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46190911delT	uc002inf.1	+						SNX11_uc010wlg.1_Intron|SNX11_uc010wlh.1_Intron|SNX11_uc010wli.1_Intron|SNX11_uc010wlj.1_Intron|SNX11_uc002ing.1_Intron|SNX11_uc002inh.1_Intron	NM_152244	NP_689450	Q9Y5W9	SNX11_HUMAN	sorting nexin 11						cell communication|protein transport	membrane	phosphatidylinositol binding				0						gttttttgggttttttttttt	0.164													4	2	---	---	---	---	
CA4	762	broad.mit.edu	37	17	58227531	58227531	+	Intron	DEL	C	-	-			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58227531delC	uc002iym.3	+						CA4_uc010wou.1_Intron	NM_000717	NP_000708	P22748	CAH4_HUMAN	carbonic anhydrase IV precursor						bicarbonate transport|one-carbon metabolic process	anchored to external side of plasma membrane|apical plasma membrane|brush border membrane|ER-Golgi intermediate compartment|membrane fraction|perinuclear region of cytoplasm|rough endoplasmic reticulum|secretory granule membrane|trans-Golgi network|transport vesicle membrane	carbonate dehydratase activity|protein binding|zinc ion binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)	TGCAGAGGATCCCCCCGCGGG	0.796													4	2	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60593626	60593626	+	Intron	DEL	T	-	-	rs144318990		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60593626delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						gttttagttcttTTTTTTTTT	0.184													3	3	---	---	---	---	
FAM59A	64762	broad.mit.edu	37	18	29973144	29973144	+	Intron	DEL	T	-	-	rs10708225		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29973144delT	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A											ovary(1)|skin(1)	2						CTCTGAATTGttttttttttt	0.308													2	4	---	---	---	---	
TMPRSS9	360200	broad.mit.edu	37	19	2405705	2405705	+	Intron	DEL	T	-	-	rs113589749		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2405705delT	uc010xgx.1	+						TMPRSS9_uc002lvv.1_Intron	NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGGCAttcttttttttttt	0.214													4	2	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3013987	3013987	+	Intron	DEL	T	-	-	rs67060467		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3013987delT	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron|TLE2_uc010xhd.1_Intron	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gtaaaatgtattttttttttt	0.124													4	3	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153044	7153045	+	Intron	INS	-	ACCACACAT	ACCACACAT	rs137972884	by1000genomes	TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153044_7153045insACCACACAT	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	acaccacacacacacacaccac	0.104													4	2	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10996309	10996310	+	Intron	INS	-	A	A	rs114636497		TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10996309_10996310insA	uc002yis.1	-									P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAAAACAACCAAAAAAAAAAA	0.302													3	3	---	---	---	---	
WNK3	65267	broad.mit.edu	37	X	54265636	54265637	+	Intron	INS	-	A	A			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54265636_54265637insA	uc004dtd.1	-						WNK3_uc004dtc.1_Intron	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2						intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						GTGAAGCTTTTAAAAAAAAAAA	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	92643878	92643879	+	IGR	INS	-	T	T			TCGA-B8-5545-01A-01D-1669-08	TCGA-B8-5545-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92643878_92643879insT								PCDH11X (765652 upstream) : NAP1L3 (282050 downstream)																							CCAtttttttcttttttttttt	0.312													6	3	---	---	---	---	
