Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16975626	16975626	+	Intron	SNP	G	C	C	rs12031642		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16975626G>C	uc010och.1	+						MST1P2_uc001azl.3_Intron|MST1P2_uc009vox.2_Intron|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						TCTAGCATCTGTCCCAGGAGT	0.582													10	40	---	---	---	---	PASS
RCC2	55920	broad.mit.edu	37	1	17739593	17739593	+	Nonsense_Mutation	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17739593C>T	uc001bal.2	-	9	1336	c.1289G>A	c.(1288-1290)TGG>TAG	p.W430*	RCC2_uc001bam.2_Nonsense_Mutation_p.W430*	NM_001136204	NP_001129676	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	430	RCC1 6.				cell division|mitotic prometaphase	chromosome, centromeric region|cytosol|microtubule|nucleolus|spindle					0		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		CCGGATTCTCCAGCCGCAGAG	0.567													20	55	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62288675	62288675	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62288675A>G	uc001dab.2	+	15	1856	c.1742A>G	c.(1741-1743)CAT>CGT	p.H581R	INADL_uc009waf.1_Missense_Mutation_p.H581R|INADL_uc001daa.2_Missense_Mutation_p.H581R|INADL_uc001dad.3_Missense_Mutation_p.H278R|INADL_uc001dac.2_RNA	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	581	PDZ 4.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GATGGGCACCATTATATTTCT	0.423													84	243	---	---	---	---	PASS
NEXN	91624	broad.mit.edu	37	1	78408369	78408369	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78408369A>G	uc001dic.3	+	13	2180	c.1883A>G	c.(1882-1884)TAT>TGT	p.Y628C	NEXN_uc001dib.3_Missense_Mutation_p.Y564C|NEXN_uc001did.1_Missense_Mutation_p.Y538C|NEXN_uc001dif.1_Missense_Mutation_p.Y520C|NEXN_uc001dig.3_Missense_Mutation_p.Y269C	NM_144573	NP_653174	Q0ZGT2	NEXN_HUMAN	nexilin (F actin binding protein)	628	Ig-like.				regulation of cell migration|regulation of cytoskeleton organization	cytoskeleton|Z disc	actin filament binding|structural constituent of muscle			ovary(2)	2				Colorectal(170;0.114)		GGAGAAGACTATCAATATATT	0.398													4	156	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79387470	79387470	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79387470A>C	uc001diq.3	-	9	1241	c.1085T>G	c.(1084-1086)GTC>GGC	p.V362G		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	362	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CCTATCTGTGACCTGAAAAAA	0.343													31	87	---	---	---	---	PASS
CD53	963	broad.mit.edu	37	1	111437023	111437023	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111437023G>T	uc001dzw.2	+	5	498	c.327G>T	c.(325-327)AAG>AAT	p.K109N	CD53_uc001dzx.2_Missense_Mutation_p.K109N|CD53_uc010owa.1_Missense_Mutation_p.K109N|CD53_uc001dzy.2_Missense_Mutation_p.K109N	NM_001040033	NP_001035122	P19397	CD53_HUMAN	CD53 antigen	109	Extracellular (Potential).				signal transduction	integral to membrane|plasma membrane					0		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		ATGAACAGAAGGTAAGTTATA	0.398													5	313	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144813815	144813815	+	Silent	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144813815A>G	uc009wig.1	+	10	1138	c.1062A>G	c.(1060-1062)GCA>GCG	p.A354A	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Silent_p.A354A|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Silent_p.A285A|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Silent_p.A285A|NBPF9_uc010oyg.1_Silent_p.A319A|NBPF9_uc009wii.1_Silent_p.A83A|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Silent_p.A14A	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	354	Potential.					cytoplasm					0						AGAAGCTTGCAGAGCAGCTGA	0.532													8	105	---	---	---	---	PASS
PGLYRP3	114771	broad.mit.edu	37	1	153271694	153271694	+	Nonsense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153271694G>A	uc001fbn.1	-	6	795	c.742C>T	c.(742-744)CAG>TAG	p.Q248*		NM_052891	NP_443123	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3 precursor	248					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCACCATCCTGGCCCACCAGG	0.393													30	72	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155449218	155449218	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155449218G>A	uc009wqq.2	-	3	3923	c.3443C>T	c.(3442-3444)ACT>ATT	p.T1148I	ASH1L_uc001fkt.2_Missense_Mutation_p.T1148I|ASH1L_uc009wqr.1_Missense_Mutation_p.T1148I	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1148					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CATTGCAAGAGTCTGAATCAT	0.463													18	67	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235377328	235377328	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235377328T>C	uc001hwq.2	-	17	2095	c.1597A>G	c.(1597-1599)AAA>GAA	p.K533E	ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwt.3_Missense_Mutation_p.K214E	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	533	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			tcttcttcttTATTCGTTTCA	0.189													5	225	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241934999	241934999	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241934999G>T	uc001hzg.1	+	6	696	c.658G>T	c.(658-660)GGT>TGT	p.G220C	WDR64_uc001hzf.1_Intron	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64	754										skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TGAGGTTAAAGGTCAGTATGA	0.353													5	227	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247079518	247079518	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247079518T>C	uc001ibu.1	-	2	308	c.301A>G	c.(301-303)ACA>GCA	p.T101A	AHCTF1_uc001ibv.1_Missense_Mutation_p.T110A	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	101	Necessary for cytoplasmic localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTCCCTTCTGTTTCTTCCAAT	0.393													5	139	---	---	---	---	PASS
MEMO1	51072	broad.mit.edu	37	2	32117192	32117192	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32117192T>C	uc002rnx.2	-	6	831	c.449A>G	c.(448-450)GAG>GGG	p.E150G	MEMO1_uc010ymu.1_Missense_Mutation_p.E127G|MEMO1_uc010ezq.2_Missense_Mutation_p.E150G|MEMO1_uc002rny.2_Intron|MEMO1_uc002rnz.2_RNA	NM_015955	NP_057039	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1 isoform 1	150					regulation of microtubule-based process	cytosol|nucleus				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					AATGGTAAACTCATCCTTATG	0.338													6	133	---	---	---	---	PASS
PPM1B	5495	broad.mit.edu	37	2	44428806	44428806	+	Silent	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44428806G>A	uc002rtt.2	+	2	896	c.468G>A	c.(466-468)CTG>CTA	p.L156L	PPM1B_uc002rts.2_Silent_p.L156L|PPM1B_uc002rtu.2_Silent_p.L156L|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Silent_p.L156L|PPM1B_uc002rtx.2_Silent_p.L156L	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1	156					protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GTGCTGTTCTGTATAGGAATG	0.453													6	277	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50149352	50149352	+	Silent	SNP	T	A	A	rs55923848	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50149352T>A	uc010fbp.2	-	6	1866	c.1059A>T	c.(1057-1059)CCA>CCT	p.P353P	NRXN1_uc002rxb.3_Silent_p.P1087P|NRXN1_uc010fbq.2_Silent_p.P1458P|NRXN1_uc002rxe.3_Silent_p.P1388P|NRXN1_uc010yon.1_Silent_p.P53P|NRXN1_uc002rxa.3_Silent_p.P50P	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	353	Extracellular (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGCTGAGCCTGGATACGGCT	0.542													25	68	---	---	---	---	PASS
SNRNP27	11017	broad.mit.edu	37	2	70122252	70122252	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70122252C>T	uc002sfw.2	+	2	88	c.61C>T	c.(61-63)CGG>TGG	p.R21W	SNRNP27_uc002sfv.2_RNA|SNRNP27_uc002sfx.2_Missense_Mutation_p.R21W	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa	21	Arg-rich.				mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						GTCCACATCCCGGGAGAGAGA	0.562													15	35	---	---	---	---	PASS
STAMBP	10617	broad.mit.edu	37	2	74087228	74087228	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74087228T>C	uc002sjs.2	+	9	1218	c.1168T>C	c.(1168-1170)TGT>CGT	p.C390R	STAMBP_uc002sjt.2_Missense_Mutation_p.C390R|STAMBP_uc002sju.2_Missense_Mutation_p.C390R|STAMBP_uc002sjv.2_Missense_Mutation_p.C390R	NM_201647	NP_964010	O95630	STABP_HUMAN	STAM binding protein	390		Zinc 2 (By similarity).			JAK-STAT cascade|positive regulation of cell proliferation	early endosome|membrane|nucleus	metal ion binding|metallopeptidase activity|protein binding			ovary(1)|lung(1)|breast(1)|pancreas(1)	4						GATTTCTTCCTGTCGCCAGAA	0.438													37	107	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98413894	98413894	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98413894T>C	uc002syh.3	-	26	3033	c.2804A>G	c.(2803-2805)AAG>AGG	p.K935R		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	935						integral to membrane				ovary(4)|central_nervous_system(2)	6						GACAGATTTCTTTTCTCCAGG	0.373													6	250	---	---	---	---	PASS
SLC9A2	6549	broad.mit.edu	37	2	103281704	103281704	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103281704C>G	uc002tca.2	+	3	1041	c.899C>G	c.(898-900)ACT>AGT	p.T300S		NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN	solute carrier family 9 (sodium/hydrogen	300	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			central_nervous_system(3)|skin(3)|breast(2)	8						GCATTTACTACTCGATTCACC	0.453													171	195	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162799311	162799311	+	Silent	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162799311T>C	uc002ubx.3	+	16	2191	c.2007T>C	c.(2005-2007)TGT>TGC	p.C669C	SLC4A10_uc002uby.3_Silent_p.C639C|SLC4A10_uc010zcs.1_Silent_p.C650C	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	669	Extracellular (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GGTGTAACTGTGTGGAACCGC	0.408													5	128	---	---	---	---	PASS
UBR3	130507	broad.mit.edu	37	2	170885902	170885902	+	Silent	SNP	T	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170885902T>A	uc010zdi.1	+	31	4500	c.4500T>A	c.(4498-4500)ATT>ATA	p.I1500I	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Silent_p.I321I|UBR3_uc002uft.3_Silent_p.I357I|UBR3_uc010zdj.1_Silent_p.I191I|UBR3_uc002ufu.3_Silent_p.I6I	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1500					sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						TTTATAGCATTGACTCTGAGT	0.338													64	219	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183818058	183818058	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183818058A>G	uc002upc.2	-	21	2557	c.2155T>C	c.(2155-2157)TCA>CCA	p.S719P	NCKAP1_uc002upb.2_Missense_Mutation_p.S725P	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	719					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			CCAACAATTGACCTGGGAAGA	0.368													7	323	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201533423	201533423	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201533423G>T	uc002uvx.2	+	33	3796	c.3695G>T	c.(3694-3696)GGT>GTT	p.G1232V	AOX1_uc010zhf.1_Missense_Mutation_p.G788V|AOX1_uc010fsu.2_Missense_Mutation_p.G598V	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	1232					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CACACTCGTGGTCCAGACCAA	0.428													67	251	---	---	---	---	PASS
IDH1	3417	broad.mit.edu	37	2	209108295	209108295	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209108295T>G	uc002vcs.2	-	6	800	c.554A>C	c.(553-555)CAA>CCA	p.Q185P	IDH1_uc002vct.2_Missense_Mutation_p.Q185P|IDH1_uc002vcu.2_Missense_Mutation_p.Q185P	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	185					2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity			central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TGACTTATCTTGATTATACAT	0.403			Mis		gliobastoma 								111	121	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210889826	210889826	+	Splice_Site	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210889826G>A	uc002vds.2	-	13	2772	c.2564_splice	c.e13+1	p.R855_splice	C2orf67_uc002vdt.2_Splice_Site_p.R813_splice	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		TTTGTAACCTGCCTGCTGTTT	0.423													77	287	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52621464	52621464	+	Nonsense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52621464G>A	uc003des.2	-	19	3040	c.3028C>T	c.(3028-3030)CGA>TGA	p.R1010*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.R1010*|PBRM1_uc003der.2_Nonsense_Mutation_p.R978*|PBRM1_uc003det.2_Nonsense_Mutation_p.R1025*|PBRM1_uc003deu.2_Nonsense_Mutation_p.R1025*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.R1010*|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Nonsense_Mutation_p.R1009*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.R922*|PBRM1_uc003dfa.1_Nonsense_Mutation_p.R356*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1010	BAH 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGAAATTTTCGTGTAGCCAGG	0.398			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								114	78	---	---	---	---	PASS
SLC12A8	84561	broad.mit.edu	37	3	124837664	124837664	+	Silent	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124837664G>A	uc003ehv.3	-	8	972	c.861C>T	c.(859-861)GGC>GGT	p.G287G	SLC12A8_uc003ehw.3_Silent_p.G316G|SLC12A8_uc010hrz.1_Missense_Mutation_p.A161V|SLC12A8_uc003eht.3_Silent_p.G88G|SLC12A8_uc003ehu.3_Silent_p.G40G|SLC12A8_uc010hry.2_Silent_p.G40G	NM_024628	NP_078904	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	287	Helical; (Potential).				potassium ion transport	integral to membrane	symporter activity				0						TGCAGATGGCGCCCAGGAGGA	0.567													4	142	---	---	---	---	PASS
CLRN1	7401	broad.mit.edu	37	3	150659493	150659493	+	Silent	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150659493G>T	uc003eyk.1	-	2	600	c.309C>A	c.(307-309)CTC>CTA	p.L103L	CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Silent_p.L27L|CLRN1_uc010hvj.1_RNA	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a	103	Helical; (Potential).				equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TGGCAGAGAAGAGAATGACAT	0.428													83	196	---	---	---	---	PASS
TRIM59	286827	broad.mit.edu	37	3	160156326	160156326	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160156326G>C	uc003fdm.2	-	3	841	c.646C>G	c.(646-648)CAA>GAA	p.Q216E	IFT80_uc003fda.2_RNA	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	216	Potential.					integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GTATATTCTTGATTAATTAGA	0.348													63	112	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195506597	195506597	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195506597G>A	uc011bto.1	-	3	11930	c.11470C>T	c.(11470-11472)CCT>TCT	p.P3824S	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGTGTCA	0.602													4	54	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195506606	195506606	+	Missense_Mutation	SNP	C	G	G	rs149815156	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195506606C>G	uc011bto.1	-	3	11921	c.11461G>C	c.(11461-11463)GAC>CAC	p.D3821H	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	726					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTCACCTGTGGAT	0.587													4	53	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195509171	195509171	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195509171G>A	uc011bto.1	-	3	9356	c.8896C>T	c.(8896-8898)CTT>TTT	p.L2966F	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.602													4	99	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195510192	195510192	+	Silent	SNP	A	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195510192A>C	uc011bto.1	-	3	8335	c.7875T>G	c.(7873-7875)CTT>CTG	p.L2625L	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGTGACAGGAAGAGGGGTGG	0.562													9	40	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195510194	195510194	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195510194G>C	uc011bto.1	-	3	8333	c.7873C>G	c.(7873-7875)CTT>GTT	p.L2625V	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGTG	0.562													9	41	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195513474	195513474	+	Silent	SNP	T	G	G	rs77382269	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195513474T>G	uc011bto.1	-	2	5437	c.4977A>C	c.(4975-4977)ACA>ACC	p.T1659T	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGCGTGACCTGTGGATGCTG	0.592													16	206	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195513694	195513694	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195513694G>T	uc011bto.1	-	2	5217	c.4757C>A	c.(4756-4758)CCT>CAT	p.P1586H	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1066					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGGGGT	0.577													8	142	---	---	---	---	PASS
DRD5	1816	broad.mit.edu	37	4	9784853	9784853	+	Missense_Mutation	SNP	C	G	G	rs114936842	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9784853C>G	uc003gmb.3	+	1	1596	c.1200C>G	c.(1198-1200)ATC>ATG	p.I400M		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	400	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	ACCAAGACATCGTCTTCCACA	0.592													4	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	75485873	75485873	+	IGR	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75485873G>A								AREG (5242 upstream) : BTC (185575 downstream)																							AGAATATTTCGGTGAACGGTG	0.378													52	118	---	---	---	---	PASS
UBE2D3	7323	broad.mit.edu	37	4	103723780	103723780	+	Nonsense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103723780G>A	uc003hwk.2	-	5	597	c.136C>T	c.(136-138)CAA>TAA	p.Q46*	UBE2D3_uc003hwi.2_Nonsense_Mutation_p.Q46*|UBE2D3_uc003hwj.2_RNA|UBE2D3_uc003hwl.2_Nonsense_Mutation_p.Q46*|UBE2D3_uc011cet.1_Nonsense_Mutation_p.Q46*|UBE2D3_uc011ceu.1_Nonsense_Mutation_p.Q46*|UBE2D3_uc003hwo.2_Nonsense_Mutation_p.Q46*|UBE2D3_uc003hwp.2_Nonsense_Mutation_p.Q46*|UBE2D3_uc003hwq.2_Nonsense_Mutation_p.Q48*|UBE2D3_uc003hwr.2_Nonsense_Mutation_p.Q46*	NM_181887	NP_871616	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3 isoform 1	46					apoptosis|BMP signaling pathway|DNA repair|negative regulation of type I interferon production|proteasomal ubiquitin-dependent protein catabolic process|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein monoubiquitination|transforming growth factor beta receptor signaling pathway	endosome membrane|plasma membrane	ATP binding|protein binding|ubiquitin-protein ligase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		ACACCGCCTTGATATGGGCTG	0.318													50	158	---	---	---	---	PASS
PAPSS1	9061	broad.mit.edu	37	4	108608293	108608293	+	Nonsense_Mutation	SNP	A	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108608293A>C	uc003hyk.2	-	4	536	c.452T>G	c.(451-453)TTA>TGA	p.L151*	PAPSS1_uc011cfh.1_Intron	NM_005443	NP_005434	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase	151	Adenylyl-sulfate kinase.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|sulfate adenylyltransferase (ATP) activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		AAAAAACGGTAAACTTGCACC	0.348													66	161	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123192335	123192335	+	Silent	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123192335T>C	uc003ieh.2	+	45	7701	c.7656T>C	c.(7654-7656)TTT>TTC	p.F2552F	KIAA1109_uc003iel.1_Silent_p.F487F|KIAA1109_uc003iek.2_Silent_p.F1171F	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2552					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						ATAACACCTTTCACTGCAACT	0.418													4	97	---	---	---	---	PASS
TMEM154	201799	broad.mit.edu	37	4	153564272	153564272	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153564272A>T	uc003imw.1	-	5	552	c.446T>A	c.(445-447)CTT>CAT	p.L149H		NM_152680	NP_689893	Q6P9G4	TM154_HUMAN	transmembrane protein 154 precursor	149	Cytoplasmic (Potential).					integral to membrane					0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CCATTTATCAAGCTCTTCCAT	0.348													119	373	---	---	---	---	PASS
FNIP2	57600	broad.mit.edu	37	4	159789371	159789371	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159789371C>A	uc003iqe.3	+	13	1766	c.1583C>A	c.(1582-1584)TCT>TAT	p.S528Y		NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	528					DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CTCCGTTGCTCTGAGCTACAA	0.488													20	61	---	---	---	---	PASS
FLJ33360	401172	broad.mit.edu	37	5	6312489	6312489	+	Silent	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6312489C>T	uc003jdn.1	-	2	484	c.387G>A	c.(385-387)CTG>CTA	p.L129L		NM_001001702	NP_001001702			SubName: Full=FLJ33360 protein; SubName: Full=cDNA FLJ33360 fis, clone BRACE2005253;												0						TGGGTCAGCTCAGAAGAGCAG	0.612													5	46	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21760751	21760751	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21760751G>T	uc010iuc.2	-	10	2007	c.1549C>A	c.(1549-1551)CTT>ATT	p.L517I	CDH12_uc011cno.1_Missense_Mutation_p.L477I|CDH12_uc003jgk.2_Missense_Mutation_p.L517I|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	517	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						GCAGGTGAAAGATCTCGGTCT	0.413										HNSCC(59;0.17)			65	359	---	---	---	---	PASS
SLC27A6	28965	broad.mit.edu	37	5	128320979	128320979	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128320979T>C	uc003kuy.2	+	3	1031	c.635T>C	c.(634-636)GTC>GCC	p.V212A	SLC27A6_uc003kuz.2_Missense_Mutation_p.V212A	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	212					long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		CACCATGTTGTCTCACTCCTC	0.423													5	176	---	---	---	---	PASS
SLC17A2	10246	broad.mit.edu	37	6	25926075	25926075	+	5'UTR	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25926075C>T	uc011dkb.1	-	1					SLC17A2_uc011dkc.1_5'UTR|SLC17A2_uc003nfl.2_5'UTR			O00624	NPT3_HUMAN	SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;						phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1						TTTCCCTGTGCCCTGAATCTC	0.433													45	125	---	---	---	---	PASS
URGCP	55665	broad.mit.edu	37	7	43918173	43918173	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43918173C>G	uc003tiw.2	-	6	946	c.889G>C	c.(889-891)GAC>CAC	p.D297H	URGCP_uc003tiu.2_Missense_Mutation_p.D254H|URGCP_uc003tiv.2_Missense_Mutation_p.D222H|URGCP_uc003tix.2_Missense_Mutation_p.D288H|URGCP_uc003tiy.2_Missense_Mutation_p.D254H|URGCP_uc003tiz.2_Missense_Mutation_p.D254H|URGCP_uc011kbj.1_Missense_Mutation_p.D254H	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	297					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						AAGTTGAGGTCCCGATGCCAG	0.577													9	49	---	---	---	---	PASS
PHTF2	57157	broad.mit.edu	37	7	77469587	77469587	+	Silent	SNP	C	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77469587C>G	uc003ugs.3	+	1	141	c.15C>G	c.(13-15)GTC>GTG	p.V5V	PHTF2_uc003ugo.3_Silent_p.V5V|PHTF2_uc003ugp.2_Silent_p.V5V|PHTF2_uc003ugq.3_Silent_p.V5V|PHTF2_uc010ldv.2_Silent_p.V5V|PHTF2_uc003ugr.3_Silent_p.V5V|PHTF2_uc003ugt.3_Silent_p.V5V|PHTF2_uc003ugu.3_Silent_p.V5V	NM_001127357	NP_001120829	Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	5					regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleus	DNA binding			ovary(1)	1						CGTCCAAAGTCACAGATGCTA	0.328													66	313	---	---	---	---	PASS
PLAT	5327	broad.mit.edu	37	8	42033565	42033565	+	Silent	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42033565C>T	uc003xos.2	-	14	1844	c.1635G>A	c.(1633-1635)GTG>GTA	p.V545V	PLAT_uc010lxf.1_Silent_p.V462V|PLAT_uc010lxg.1_Silent_p.V370V|PLAT_uc003xot.2_Silent_p.V499V|PLAT_uc011lcm.1_Silent_p.V456V|PLAT_uc011lcn.1_Silent_p.V419V	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1	545	Peptidase S1.				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CCTTGGTGTACACACCCGGGA	0.567													4	118	---	---	---	---	PASS
SPAG1	6674	broad.mit.edu	37	8	101190099	101190099	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101190099A>G	uc003yjh.1	+	4	442	c.356A>G	c.(355-357)GAG>GGG	p.E119G	SPAG1_uc003yjg.1_Missense_Mutation_p.E119G|SPAG1_uc003yji.1_Missense_Mutation_p.E119G	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1	119					single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		catgaaactgagacatttcca	0.184													6	230	---	---	---	---	PASS
ANGPT1	284	broad.mit.edu	37	8	108348486	108348486	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108348486G>T	uc003ymn.2	-	3	935	c.467C>A	c.(466-468)ACT>AAT	p.T156N	ANGPT1_uc011lhv.1_5'UTR|ANGPT1_uc003ymo.2_Missense_Mutation_p.T156N	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor	156	Potential.				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			AAGTCGAGAAGTTTGATTTAG	0.308													52	181	---	---	---	---	PASS
SH3GL2	6456	broad.mit.edu	37	9	17789454	17789454	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17789454A>G	uc003zna.2	+	6	818	c.530A>G	c.(529-531)AAG>AGG	p.K177R	SH3GL2_uc011lmx.1_Missense_Mutation_p.K142R|SH3GL2_uc011lmy.1_Missense_Mutation_p.K130R	NM_003026	NP_003017	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	177	BAR.				axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		CGACAAGGCAAGATTCCGGAT	0.423													5	198	---	---	---	---	PASS
C9orf64	84267	broad.mit.edu	37	9	86554330	86554330	+	3'UTR	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86554330A>G	uc004anb.2	-	4					C9orf64_uc004anc.2_3'UTR	NM_032307	NP_115683	Q5T6V5	CI064_HUMAN	hypothetical protein LOC84267												0						AATTTCCTATAACCTCGATCA	0.249													3	14	---	---	---	---	PASS
NET1	10276	broad.mit.edu	37	10	5494480	5494480	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5494480C>T	uc001iia.2	+	5	661	c.523C>T	c.(523-525)CGG>TGG	p.R175W	NET1_uc010qar.1_Translation_Start_Site|NET1_uc001iib.2_Missense_Mutation_p.R121W|NET1_uc010qas.1_Translation_Start_Site	NM_001047160	NP_001040625	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming gene 1 isoform	175	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity			breast(1)	1						GGAGATCAGACGGCAGGAGGT	0.488													26	85	---	---	---	---	PASS
OPTN	10133	broad.mit.edu	37	10	13178967	13178967	+	3'UTR	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13178967T>C	uc001ilu.1	+	16					OPTN_uc001ilv.1_3'UTR|OPTN_uc001ilw.1_3'UTR|OPTN_uc001ilx.1_3'UTR|OPTN_uc001ily.1_3'UTR|OPTN_uc010qbr.1_3'UTR|OPTN_uc001ilz.1_3'UTR	NM_001008213	NP_001008214	Q96CV9	OPTN_HUMAN	optineurin						cell death|Golgi ribbon formation|Golgi to plasma membrane protein transport|protein targeting to Golgi|signal transduction	perinuclear region of cytoplasm|trans-Golgi network	protein C-terminus binding			ovary(2)	2						ATATTTTGCCTCATTATTCTT	0.194													4	54	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26432443	26432443	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26432443G>T	uc001isn.2	+	21	2689	c.2329G>T	c.(2329-2331)GAT>TAT	p.D777Y	MYO3A_uc009xko.1_Missense_Mutation_p.D777Y|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	777	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GCCCCTCTTAGATATGTTTCT	0.373													9	468	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	67680122	67680122	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67680122A>T	uc009xpn.1	-	18	2777	c.2654T>A	c.(2653-2655)GTC>GAC	p.V885D	CTNNA3_uc001jmw.2_Missense_Mutation_p.V885D	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	885					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						TTCACTCATGACTTGCAATGG	0.398													21	286	---	---	---	---	PASS
AP3M1	26985	broad.mit.edu	37	10	75886080	75886080	+	Silent	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75886080A>G	uc001jwf.2	-	7	1267	c.837T>C	c.(835-837)AGT>AGC	p.S279S	AP3M1_uc001jwg.2_Silent_p.S279S|AP3M1_uc001jwh.2_Silent_p.S279S|AP3M1_uc010qla.1_Silent_p.S225S	NM_207012	NP_996895	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	279	MHD.				protein targeting to lysosome|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus|lysosome	protein binding				0	Prostate(51;0.0112)					TAAAGCTGATACTATGTTTCA	0.383													7	303	---	---	---	---	PASS
CUEDC2	79004	broad.mit.edu	37	10	104184284	104184284	+	Silent	SNP	T	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104184284T>A	uc001kvn.2	-	4	403	c.252A>T	c.(250-252)TCA>TCT	p.S84S	CUEDC2_uc001kvm.2_5'Flank	NM_024040	NP_076945	Q9H467	CUED2_HUMAN	CUE domain containing 2	84						cytoplasm|nucleus	protein binding				0		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TCAGCTGCCCTGAGAGCTTCT	0.582													17	81	---	---	---	---	PASS
YPEL4	219539	broad.mit.edu	37	11	57414584	57414584	+	5'UTR	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57414584G>A	uc001nkv.3	-	2					uc001nkt.1_Intron|YPEL4_uc009ymk.2_RNA	NM_145008	NP_659445	Q96NS1	YPEL4_HUMAN	yippee-like 4							nucleolus					0						TGGGCATGACGGGCTGGAGGA	0.687													11	32	---	---	---	---	PASS
UBXN1	51035	broad.mit.edu	37	11	62445193	62445193	+	Intron	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62445193C>T	uc001nul.1	-						UBXN1_uc001nuj.2_Intron|UBXN1_uc001num.1_Intron|UBXN1_uc001nuk.2_3'UTR|UBXN1_uc010rme.1_3'UTR	NM_015853	NP_056937	Q04323	UBXN1_HUMAN	UBX domain protein 1						negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process	cytoplasm	ATPase binding|K6-linked polyubiquitin binding				0						CCCTCTGAAGCTGGAAAAGAT	0.473													4	96	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76157949	76157949	+	5'UTR	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76157949A>G	uc001oxl.2	+	2					C11orf30_uc001oxj.2_5'UTR|C11orf30_uc001oxk.2_5'UTR|C11orf30_uc009yuj.1_5'UTR|C11orf30_uc010rsa.1_5'UTR|C11orf30_uc001oxm.2_5'UTR|C11orf30_uc010rsb.1_5'UTR|C11orf30_uc010rsc.1_5'UTR|C11orf30_uc001oxn.2_5'UTR|C11orf30_uc010rsd.1_5'UTR	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						GGTAGGGAGGACAAGCTCTTT	0.443													5	139	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92088147	92088147	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92088147T>C	uc001pdj.3	+	1	2886	c.2869T>C	c.(2869-2871)TGG>CGG	p.W957R		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	957	Cadherin 9.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGTCATTGCTTGGCTTGAGAC	0.438										TCGA Ovarian(4;0.039)			26	103	---	---	---	---	PASS
CCDC67	159989	broad.mit.edu	37	11	93148224	93148224	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93148224T>C	uc001pdq.2	+	13	1682	c.1582T>C	c.(1582-1584)TTT>CTT	p.F528L	CCDC67_uc001pdo.1_Missense_Mutation_p.F528L	NM_181645	NP_857596	Q05D60	CCD67_HUMAN	coiled-coil domain containing 67	528										ovary(1)	1		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				ACCTTCGACATTTCAAGCCAA	0.403													7	484	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	102980332	102980332	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102980332A>G	uc001pho.2	+	1	173	c.29A>G	c.(28-30)AAG>AGG	p.K10R	DYNC2H1_uc001phn.1_Missense_Mutation_p.K10R|DYNC2H1_uc009yxe.1_Missense_Mutation_p.K10R	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	10	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GACGTTCGGAAGCTCTTCATC	0.517													4	65	---	---	---	---	PASS
KRT6B	3854	broad.mit.edu	37	12	52842629	52842629	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52842629C>A	uc001sak.2	-	6	1248	c.1200G>T	c.(1198-1200)AAG>AAT	p.K400N		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	400	Rod.|Coil 2.				ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)		ACCATACCTGCTTCTTGACGT	0.473													83	360	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57577934	57577934	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57577934G>A	uc001snd.2	+	37	6462	c.5996G>A	c.(5995-5997)CGC>CAC	p.R1999H		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1999	LDL-receptor class B 18.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGCTCCTTCCGCTACGTGGTG	0.597													5	27	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78392214	78392214	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78392214G>A	uc001syp.2	+	7	1011	c.838G>A	c.(838-840)GAC>AAC	p.D280N	NAV3_uc001syo.2_Missense_Mutation_p.D280N	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	280						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TAACAGCATTGACAAAAACAA	0.443										HNSCC(70;0.22)			27	138	---	---	---	---	PASS
ATXN2	6311	broad.mit.edu	37	12	111923629	111923629	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111923629G>A	uc001tsj.2	-	17	2987	c.2825C>T	c.(2824-2826)GCA>GTA	p.A942V	ATXN2_uc001tsh.2_Missense_Mutation_p.A677V|ATXN2_uc001tsi.2_Missense_Mutation_p.A653V|ATXN2_uc001tsk.2_RNA|ATXN2_uc001tsg.2_Missense_Mutation_p.A128V	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2	942	Pro-rich.				cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						GCTAGGTTGTGCTTGAGGCCG	0.418													96	404	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120288004	120288004	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120288004A>G	uc001txi.1	-	5	543	c.490T>C	c.(490-492)TTT>CTT	p.F164L	CIT_uc001txj.1_Missense_Mutation_p.F164L	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	164	Protein kinase.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TTGTCCTGAAAGGCATACTGT	0.428													6	335	---	---	---	---	PASS
SPPL3	121665	broad.mit.edu	37	12	121206288	121206288	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121206288A>T	uc001tzd.2	-	8	1094	c.613T>A	c.(613-615)TTT>ATT	p.F205I	SPPL3_uc009zwz.2_Missense_Mutation_p.F198I|SPPL3_uc001tzc.2_Missense_Mutation_p.F35I	NM_139015	NP_620584	Q8TCT6	PSL4_HUMAN	signal peptide peptidase 3	206	Helical; (Potential).					integral to membrane	aspartic-type endopeptidase activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCTGAGAAAAATACCTGCCGA	0.522													24	58	---	---	---	---	PASS
RSRC2	65117	broad.mit.edu	37	12	123003401	123003401	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123003401G>T	uc001ucr.2	-	4	529	c.383C>A	c.(382-384)TCT>TAT	p.S128Y	RSRC2_uc001uco.2_5'UTR|RSRC2_uc001ucp.2_Missense_Mutation_p.S69Y|RSRC2_uc001ucq.2_5'UTR|RSRC2_uc001ucs.2_5'UTR|RSRC2_uc001uct.2_Missense_Mutation_p.S80Y|RSRC2_uc001ucu.2_Missense_Mutation_p.S128Y	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a	128	Ser-rich.									ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		ACGAGACCTAGATCTTGAGTG	0.378													92	450	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39451341	39451341	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39451341A>G	uc001uwv.2	+	21	8941	c.8632A>G	c.(8632-8634)ATG>GTG	p.M2878V		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2878	Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGATGGATCCATGGGATTCGG	0.438													224	288	---	---	---	---	PASS
MIR208B	100126336	broad.mit.edu	37	14	23887232	23887232	+	RNA	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23887232G>T	hsa-mir-208b|MI0005570	-			c.41G>T			MYH7_uc001wjx.2_Intron																	0						TCTTATATTCGGATCAGAAAC	0.552													15	37	---	---	---	---	PASS
C14orf106	55320	broad.mit.edu	37	14	45716336	45716336	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45716336A>G	uc001wwf.2	-	2	613	c.154T>C	c.(154-156)TCC>CCC	p.S52P	C14orf106_uc010anh.2_RNA	NM_018353	NP_060823	Q6P0N0	M18BP_HUMAN	chromosome 14 open reading frame 106	52					cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm	DNA binding				0						AATTTTAAGGAGGAGTTCTGA	0.328													5	142	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369070	22369070	+	Silent	SNP	A	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369070A>T	uc010tzu.1	+	1	495	c.495A>T	c.(493-495)CGA>CGT	p.R165R	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCATTGTTCGACTTCCTTTCT	0.498													49	723	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	30771339	30771339	+	RNA	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30771339A>G	uc001zeh.1	+	3		c.799A>G								Homo sapiens cDNA clone IMAGE:4804281.																		AGACTCTGCAACTCATGAGAG	0.398													5	26	---	---	---	---	PASS
MYEF2	50804	broad.mit.edu	37	15	48441695	48441695	+	Intron	SNP	T	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48441695T>A	uc001zwi.3	-						MYEF2_uc001zwg.3_5'UTR|MYEF2_uc001zwh.3_Intron|MYEF2_uc001zwj.3_Intron	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2						transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		AGGGGGaaattaatttgttta	0.159													3	8	---	---	---	---	PASS
TCF12	6938	broad.mit.edu	37	15	57458628	57458628	+	Silent	SNP	C	A	A	rs147522860		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57458628C>A	uc002aec.2	+	6	638	c.354C>A	c.(352-354)TCC>TCA	p.S118S	TCF12_uc010ugm.1_Silent_p.S170S|TCF12_uc010ugn.1_Silent_p.S114S|TCF12_uc002aea.2_Silent_p.S118S|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Silent_p.S118S|TCF12_uc002aed.2_Silent_p.S118S	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b	118					immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GCTCATTTTCCCTGTACAGCA	0.308			T	TEC	extraskeletal myxoid chondrosarcoma								43	140	---	---	---	---	PASS
FAH	2184	broad.mit.edu	37	15	80452758	80452758	+	Silent	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80452758C>T	uc002bfj.2	+	5	403	c.321C>T	c.(319-321)TTC>TTT	p.F107F	FAH_uc002bfk.1_Silent_p.F107F|FAH_uc002bfm.1_Silent_p.F107F|FAH_uc002bfn.1_Silent_p.F37F|FAH_uc010unl.1_Silent_p.F107F|FAH_uc002bfl.1_Silent_p.F107F	NM_000137	NP_000128	P16930	FAAA_HUMAN	fumarylacetoacetase	107					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	fumarylacetoacetase activity|metal ion binding				0						TCAGTGCATTCATCTCCCAGG	0.567									Tyrosinemia_type_1				79	101	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	82635163	82635163	+	RNA	SNP	C	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82635163C>G	uc002bgx.2	-	5		c.417G>C						A6NI86	GG6LA_HUMAN	Homo sapiens cDNA FLJ40113 fis, clone TESTI2008621.												0						CCCTGTTCTCCGCAGCCCGAA	0.478													7	46	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21115793	21115793	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21115793T>C	uc010vbe.1	-	16	2365	c.2365A>G	c.(2365-2367)AGA>GGA	p.R789G	DNAH3_uc002die.2_Missense_Mutation_p.R743G	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	789	Stem (By similarity).|Potential.				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TCCCGGTACCTTTTAATCAGA	0.502													6	319	---	---	---	---	PASS
SLC6A10P	386757	broad.mit.edu	37	16	32894005	32894005	+	5'Flank	SNP	C	G	G	rs144574848	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32894005C>G	uc002edh.1	-						SLC6A10P_uc002edi.1_RNA					RecName: Full=Transporter;												0						CAGCGTGGTGCTAAAGGACTT	0.582													5	135	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10408350	10408350	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10408350C>T	uc002gmo.2	-	22	2562	c.2468G>A	c.(2467-2469)CGT>CAT	p.R823H	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	823						muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						CATGAAGGCACGGACATTGTA	0.423													85	205	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10409332	10409332	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10409332G>C	uc002gmo.2	-	18	2147	c.2053C>G	c.(2053-2055)CCT>GCT	p.P685A	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	685	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						GTCTTACCAGGAGTTTTAGTT	0.463													126	285	---	---	---	---	PASS
OR7D4	125958	broad.mit.edu	37	19	9325393	9325393	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9325393C>T	uc002mla.1	-	1	121	c.121G>A	c.(121-123)GGG>AGG	p.G41R		NM_001005191	NP_001005191	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D,	41	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AGCAGGTTCCCCAGCACCGTG	0.517													9	31	---	---	---	---	PASS
UBL5	59286	broad.mit.edu	37	19	9940794	9940794	+	3'UTR	SNP	T	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9940794T>A	uc002mmi.1	+	5					FBXL12_uc002mmh.2_5'Flank|UBL5_uc002mmj.1_3'UTR	NM_001048241	NP_001041706	Q9BZL1	UBL5_HUMAN	ubiquitin-like 5							cytoplasm					0						AGATGTTGCTTTGTTGTTGTC	0.463													25	25	---	---	---	---	PASS
ZNF627	199692	broad.mit.edu	37	19	11728757	11728757	+	3'UTR	SNP	G	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11728757G>C	uc002msk.2	+	4					ZNF627_uc010dyf.2_3'UTR	NM_145295	NP_660338	Q7L945	ZN627_HUMAN	zinc finger protein 627						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						ATTTGGGAAAGCCTTCAGTCC	0.403													8	10	---	---	---	---	PASS
ZNF627	199692	broad.mit.edu	37	19	11728758	11728758	+	3'UTR	SNP	C	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11728758C>A	uc002msk.2	+	4					ZNF627_uc010dyf.2_3'UTR	NM_145295	NP_660338	Q7L945	ZN627_HUMAN	zinc finger protein 627						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TTTGGGAAAGCCTTCAGTCCT	0.408													7	10	---	---	---	---	PASS
ZFP30	22835	broad.mit.edu	37	19	38125631	38125631	+	3'UTR	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38125631T>C	uc002ogv.1	-	6					ZFP30_uc002ogw.1_3'UTR|ZFP30_uc002ogx.1_3'UTR|ZFP30_uc010xtt.1_3'UTR	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATAGGTAAGATCAAAAGCTTT	0.254													2	0	---	---	---	---	PASS
ZNF404	342908	broad.mit.edu	37	19	44376818	44376818	+	Silent	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44376818A>G	uc002oxs.3	-	2	1548	c.1539T>C	c.(1537-1539)ATT>ATC	p.I513I		NM_001033719	NP_001028891	Q494X3	ZN404_HUMAN	zinc finger protein 404	516	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				CACCAGTATGAATTGTCTCAT	0.378													5	171	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53912659	53912659	+	3'UTR	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53912659C>T	uc010ydx.1	+	6					ZNF765_uc002qbm.2_3'UTR|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		TGTTTCAAATCCAACCTTGAA	0.413													12	56	---	---	---	---	PASS
C19orf51	352909	broad.mit.edu	37	19	55670934	55670934	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55670934G>T	uc002qji.1	-	11	1239	c.1205C>A	c.(1204-1206)GCA>GAA	p.A402E	TNNI3_uc002qjg.3_5'Flank|TNNI3_uc010yft.1_5'Flank|C19orf51_uc002qjh.1_Missense_Mutation_p.A217E|C19orf51_uc002qjj.1_Missense_Mutation_p.A449E|C19orf51_uc002qjk.1_Missense_Mutation_p.A348E|C19orf51_uc002qjl.1_Missense_Mutation_p.A469E			Q8N9W5	CS051_HUMAN	RecName: Full=UPF0470 protein C19orf51;	402											0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CCCTCCGGGTGCCACACAGGC	0.592													60	92	---	---	---	---	PASS
SYT5	6861	broad.mit.edu	37	19	55686305	55686305	+	Silent	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55686305G>A	uc002qjm.1	-	6	1831	c.771C>T	c.(769-771)ACC>ACT	p.T257T	SYT5_uc002qjp.2_Silent_p.T253T|SYT5_uc002qjn.1_Silent_p.T257T|SYT5_uc002qjo.1_Silent_p.T256T	NM_003180	NP_003171	O00445	SYT5_HUMAN	synaptotagmin V	257	Cytoplasmic (Potential).|C2 2.				energy reserve metabolic process|regulation of insulin secretion|synaptic transmission	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane	metal ion binding|transporter activity				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGACGATGACGGTGAGCTTCC	0.617													27	148	---	---	---	---	PASS
PAK7	57144	broad.mit.edu	37	20	9520120	9520120	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9520120T>C	uc002wnl.2	-	11	2694	c.2149A>G	c.(2149-2151)AGG>GGG	p.R717G	PAK7_uc002wnk.2_Missense_Mutation_p.R717G|PAK7_uc002wnj.2_Missense_Mutation_p.R717G|PAK7_uc010gby.1_Missense_Mutation_p.R630G	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7	717							ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			CAGTGATGCCTGTATTGTCTC	0.493													5	171	---	---	---	---	PASS
B4GALT5	9334	broad.mit.edu	37	20	48273175	48273175	+	Silent	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48273175G>A	uc002xuu.3	-	2	374	c.180C>T	c.(178-180)ATC>ATT	p.I60I		NM_004776	NP_004767	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	60	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CCTGAGCACCGATTGTTCTCA	0.458													84	123	---	---	---	---	PASS
RBM11	54033	broad.mit.edu	37	21	15592035	15592035	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15592035A>T	uc002yjo.3	+	2	290	c.248A>T	c.(247-249)CAG>CTG	p.Q83L	RBM11_uc002yjn.3_5'UTR|RBM11_uc002yjp.3_Intron	NM_144770	NP_658983	P57052	RBM11_HUMAN	RNA binding motif protein 11	83	RRM.						nucleotide binding|RNA binding				0				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		ATTAACGTGCAGTATCGATTT	0.368													52	75	---	---	---	---	PASS
PPP1R3F	89801	broad.mit.edu	37	X	49143162	49143162	+	Silent	SNP	G	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49143162G>A	uc004dnh.1	+	4	2026	c.2010G>A	c.(2008-2010)GGG>GGA	p.G670G	PPP1R3F_uc011mnd.1_Silent_p.G341G|PPP1R3F_uc004dni.2_Silent_p.G324G|PPP1R3F_uc004dnj.1_Silent_p.G324G	NM_033215	NP_149992	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory (inhibitor)	670	Extracellular (Potential).					integral to membrane				ovary(2)|skin(1)	3	Ovarian(276;0.236)					GGGAGGCCGGGACAGAAGCCC	0.577													38	6	---	---	---	---	PASS
ERCC6L	54821	broad.mit.edu	37	X	71427205	71427205	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71427205C>T	uc004eaq.1	-	2	1509	c.1412G>A	c.(1411-1413)AGG>AAG	p.R471K	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Missense_Mutation_p.R348K	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	471	Helicase C-terminal.				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)					ATCTCGCAGCCTCTTAAGTAG	0.403													4	165	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76952113	76952113	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76952113A>G	uc004ecp.3	-	5	554	c.322T>C	c.(322-324)TCT>CCT	p.S108P	ATRX_uc004ecq.3_Missense_Mutation_p.S108P|ATRX_uc004eco.3_5'UTR|ATRX_uc004ecr.2_Missense_Mutation_p.S108P|ATRX_uc010nlx.1_Missense_Mutation_p.S108P|ATRX_uc010nly.1_Missense_Mutation_p.S53P	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	108					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TTTTCATTAGACGCATCTTCA	0.284			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						6	258	---	---	---	---	PASS
XIAP	331	broad.mit.edu	37	X	123025168	123025168	+	Splice_Site	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123025168T>C	uc010nqu.2	+	4	1182	c.1056_splice	c.e4+2	p.L352_splice	XIAP_uc004etx.2_Splice_Site_p.L352_splice|XIAP_uc010nqv.2_Splice_Site	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4						anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2						GAGTGTCTGGTAAGTCTCata	0.184									X-linked_Lymphoproliferative_syndrome				3	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14294	14294	+	RNA	SNP	T	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14294T>C	uc004cox.3	+	1		c.1958T>C			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CCTCTCCTTCATAAATTATTC	0.463													94	51	---	---	---	---	PASS
CHD5	26038	broad.mit.edu	37	1	6226336	6226337	+	Intron	INS	-	G	G	rs149595880	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6226336_6226337insG	uc001amb.1	-							NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CAGGTGGGGGTCGGGGGCAGGG	0.639													12	7	---	---	---	---	
AGMAT	79814	broad.mit.edu	37	1	15899935	15899935	+	3'UTR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15899935delT	uc001awv.1	-	7					DNAJC16_uc001awu.2_Intron	NM_024758	NP_079034	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase) precursor						putrescine biosynthetic process|spermidine biosynthetic process	mitochondrion	agmatinase activity|metal ion binding			skin(1)	1		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		CAAGTACTCCTTTTTTTTTCC	0.358													4	2	---	---	---	---	
COL16A1	1307	broad.mit.edu	37	1	32120077	32120078	+	Intron	INS	-	A	A	rs138711781	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32120077_32120078insA	uc001btk.1	-						COL16A1_uc001bti.1_Intron|COL16A1_uc001btj.1_Intron	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor						cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCAGCCATCTTACAGTGCCGCT	0.327													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	91512708	91512708	+	IGR	DEL	C	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91512708delC								ZNF644 (25037 upstream) : HFM1 (213616 downstream)																							ttttttttttcttttttggat	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	94442040	94442040	+	IGR	DEL	G	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94442040delG								GCLM (67028 upstream) : ABCA4 (16356 downstream)																							GACAGATGGTGGGTGCTGATA	0.453													4	2	---	---	---	---	
SLC44A3	126969	broad.mit.edu	37	1	95332599	95332599	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95332599delT	uc001dqv.3	+						SLC44A3_uc001dqx.3_Intron|SLC44A3_uc010otq.1_Intron|SLC44A3_uc010otr.1_Intron|SLC44A3_uc001dqw.3_Intron|SLC44A3_uc010ots.1_Intron|SLC44A3_uc009wds.2_Intron|SLC44A3_uc010ott.1_Intron|SLC44A3_uc010otu.1_Intron	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1							integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	GGAAGAGAGGTTTTTTTTTTT	0.408													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142827025	142827026	+	Intron	DEL	AG	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142827025_142827026delAG	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		TTCATCAGAAAGAGGATCATAA	0.366													4	3	---	---	---	---	
SOAT1	6646	broad.mit.edu	37	1	179318387	179318387	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179318387delT	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	GGATAGTTTCTTATGAGTCTT	0.299													4	2	---	---	---	---	
JMJD4	65094	broad.mit.edu	37	1	227922141	227922141	+	Intron	DEL	A	-	-	rs13373815	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227922141delA	uc001hrb.2	-						SNAP47_uc001hqz.2_Intron|SNAP47_uc001hra.2_Intron|SNAP47_uc001hrd.2_5'Flank|SNAP47_uc001hre.2_5'Flank|SNAP47_uc001hrf.2_5'Flank|JMJD4_uc001hrc.2_Intron	NM_023007	NP_075383	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4 isoform 1												0		Prostate(94;0.0885)				GATCTCTCTCAAAAAAAAAGG	0.209													4	4	---	---	---	---	
C1orf124	83932	broad.mit.edu	37	1	231488147	231488148	+	Intron	INS	-	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231488147_231488148insT	uc001hur.2	+						C1orf124_uc001hus.2_3'UTR|C1orf124_uc001hut.2_3'UTR	NM_032018	NP_114407	Q9H040	CA124_HUMAN	hypothetical protein LOC83932 isoform a						DNA repair	nuclear speck	DNA binding|metal ion binding				0	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				ATATGAGAGAATTTTTTTTTAT	0.322													4	2	---	---	---	---	
NID1	4811	broad.mit.edu	37	1	236148505	236148505	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236148505delA	uc001hxo.2	-						NID1_uc009xgd.2_Intron|NID1_uc009xgc.2_Intron	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	aaaaaaaaagaaaaaaaaaaG	0.164													4	3	---	---	---	---	
KIF3C	3797	broad.mit.edu	37	2	26152486	26152486	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26152486delT	uc002rgu.2	-						KIF3C_uc010eyj.1_Intron|KIF3C_uc010ykr.1_Intron	NM_002254	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C						blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATAGGCTCttttttttttt	0.294													7	4	---	---	---	---	
XDH	7498	broad.mit.edu	37	2	31600308	31600308	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31600308delA	uc002rnv.1	-							NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	CCAGAAGCTGAAAAAAAAAAC	0.458													3	3	---	---	---	---	
FEZ2	9637	broad.mit.edu	37	2	36805215	36805215	+	Intron	DEL	C	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36805215delC	uc002rph.2	-						FEZ2_uc002rpe.2_Intron|FEZ2_uc002rpf.2_Intron|FEZ2_uc002rpg.2_Intron|FEZ2_uc002rpi.2_Intron|FEZ2_uc002rpj.2_Intron	NM_005102	NP_005093	Q9UHY8	FEZ2_HUMAN	zygin 2 isoform 1						axon guidance|signal transduction		protein binding			ovary(1)	1		all_hematologic(82;0.21)				AAATACTAGGCCACATGGCTG	0.388													4	2	---	---	---	---	
SULT6B1	391365	broad.mit.edu	37	2	37421322	37421322	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37421322delT	uc002rpv.2	-						SULT6B1_uc010fae.1_Intron|SULT6B1_uc010faf.1_Intron|SULT6B1_uc002rpw.2_Intron|SULT6B1_uc010fag.1_Intron|uc002rpx.1_5'Flank			Q6IMI4	ST6B1_HUMAN	Homo sapiens sulfotransferase SULT6B1 (SULT6B1) mRNA, partial 5'UTR; alternate transcript.							cytoplasm	sulfotransferase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(82;0.248)				TGTCTGTAGAttttttttttt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	66921862	66921862	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66921862delT								MEIS1 (121972 upstream) : ETAA1 (702580 downstream)																							AACCAAGGGATTTTAAAATGC	0.468													4	2	---	---	---	---	
RFX8	731220	broad.mit.edu	37	2	102022802	102022802	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102022802delT	uc010yvx.1	-						RFX8_uc002tbb.1_Intron	NM_001145664	NP_001139136	Q6ZV50	RFX8_HUMAN	regulatory factor X, 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						AAAAAGCAAAttttttttttt	0.209													3	3	---	---	---	---	
MAP4K4	9448	broad.mit.edu	37	2	102479998	102479998	+	Intron	DEL	A	-	-	rs2072205	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102479998delA	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron|MAP4K4_uc010yvz.1_Intron|MAP4K4_uc002tbk.2_Intron|MAP4K4_uc002tbl.2_5'Flank	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						CTTTGTGGGGAAAAAAAAAAT	0.363													4	2	---	---	---	---	
ACOXL	55289	broad.mit.edu	37	2	111720674	111720674	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111720674delA	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						AAGTAAAAGGAAAAAAAAATA	0.398													4	2	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121586675	121586676	+	Intron	INS	-	CACC	CACC	rs144922326	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121586675_121586676insCACC	uc010flp.2	+						GLI2_uc010yyu.1_Intron|GLI2_uc002tmp.1_Intron|GLI2_uc010fln.1_Intron|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				ccacgcacctgcacccatgcac	0.134													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122067665	122067666	+	IGR	DEL	GT	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122067665_122067666delGT								TFCP2L1 (24887 upstream) : CLASP1 (27688 downstream)																							CCACATGAACgtgtgtgtgtgt	0.401													6	3	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153481699	153481699	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153481699delA	uc002tye.2	+						FMNL2_uc010fob.2_Intron|FMNL2_uc002tyf.2_Intron	NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						GAGTTAAAAGAAAAAAAAAAA	0.368													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	168615175	168615175	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168615175delT								XIRP2 (498916 upstream) : B3GALT1 (60007 downstream)																							GTTTCGTGCATTTTTTTTTCC	0.458													6	3	---	---	---	---	
LASS6	253782	broad.mit.edu	37	2	169347998	169347998	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169347998delT	uc002ueb.1	+						LASS6_uc002uec.1_Intron	NM_203463	NP_982288	Q6ZMG9	CERS6_HUMAN	longevity assurance homolog 6							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1						CTAATCTTTGTTTTTTTTTCA	0.274													4	2	---	---	---	---	
MAP1D	254042	broad.mit.edu	37	2	172935959	172935959	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172935959delA	uc002uhk.2	+						MAP1D_uc010zdw.1_Intron	NM_199227	NP_954697	Q6UB28	AMP1D_HUMAN	methionine aminopeptidase 1D precursor						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CCCTGAGTTGAAAAAAAAAAA	0.328													10	5	---	---	---	---	
RAPGEF4	11069	broad.mit.edu	37	2	173782813	173782814	+	Intron	INS	-	GCTCTGGTGCCA	GCTCTGGTGCCA	rs146883605	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173782813_173782814insGCTCTGGTGCCA	uc002uhv.3	+						RAPGEF4_uc002uhu.2_Intron|RAPGEF4_uc002uhw.3_Intron|RAPGEF4_uc010zec.1_Intron|RAPGEF4_uc010zed.1_Intron|RAPGEF4_uc010zee.1_Intron|RAPGEF4_uc010fqo.2_Intron	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			GAGAGAGGTATGCTCTGGTGCC	0.376													5	4	---	---	---	---	
LOC151174	151174	broad.mit.edu	37	2	239135606	239135606	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239135606delT	uc002vxx.3	-						LOC151174_uc002vxy.2_Intron	NR_026926				SubName: Full=Putative uncharacterized protein; Flags: Fragment;												0						attgccttgattcctatacac	0.070													4	2	---	---	---	---	
CACNA1D	776	broad.mit.edu	37	3	53715130	53715131	+	Intron	DEL	GA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53715130_53715131delGA	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron|CACNA1D_uc003dgw.3_Intron	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	CCTGGTGTGTGAGATGAGAGGC	0.446													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	95871051	95871051	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95871051delT								LOC255025 (975972 upstream) : EPHA6 (662374 downstream)																							ACTATCTTCATTTTTTTTAAA	0.358													4	2	---	---	---	---	
MORC1	27136	broad.mit.edu	37	3	108746249	108746249	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108746249delA	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						aaaacagcctaacctttggag	0.124													4	2	---	---	---	---	
SLC9A10	285335	broad.mit.edu	37	3	111996338	111996338	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111996338delT	uc003dyu.2	-						SLC9A10_uc011bhu.1_Intron|SLC9A10_uc010hqc.2_Intron	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger						cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						CGTATAATACTTTTTTTGACA	0.433													4	2	---	---	---	---	
LOC100125556	100125556	broad.mit.edu	37	3	125642892	125642893	+	Intron	INS	-	AGAC	AGAC			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125642892_125642893insAGAC	uc003eif.3	+						LOC100125556_uc003eid.3_Intron|LOC100125556_uc003eie.3_Intron	NR_024251				Homo sapiens family with sequence similarity 86, member A pseudogene, mRNA (cDNA clone IMAGE:4425123).												0						ACTGCCAACTTAGCCCCAGAGT	0.554													7	4	---	---	---	---	
COPG	22820	broad.mit.edu	37	3	128991422	128991422	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128991422delT	uc003els.2	+						COPG_uc010htb.2_Intron	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1						COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						TCtttaaaaattttttttttt	0.448													5	3	---	---	---	---	
NMNAT3	349565	broad.mit.edu	37	3	139292815	139292815	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139292815delA	uc003etj.2	-						NMNAT3_uc003etk.2_Intron|NMNAT3_uc003etl.2_Intron|NMNAT3_uc010hul.2_Intron	NM_178177	NP_835471	Q96T66	NMNA3_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0						AATATTTCTCAAAAAAAAAAG	0.194													4	2	---	---	---	---	
NMNAT3	349565	broad.mit.edu	37	3	139368164	139368165	+	Intron	INS	-	AAACAAAC	AAACAAAC	rs148785096	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139368164_139368165insAAACAAAC	uc003etk.2	-						NMNAT3_uc003etl.2_Intron|NMNAT3_uc010hul.2_Intron	NM_178177	NP_835471	Q96T66	NMNA3_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0						GCAAGCAAAGAaaacaaacaaa	0.347													4	2	---	---	---	---	
C3orf55	152078	broad.mit.edu	37	3	157289313	157289313	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157289313delT	uc003fbp.3	+						C3orf55_uc003fbo.2_Intron|C3orf55_uc011bot.1_Intron|C3orf55_uc010hvv.2_Intron	NM_001130002	NP_001123474	A1A4F0	CC055_HUMAN	hypothetical protein LOC152078 isoform 1												0			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)			ATGTGGCAAATTTTTTTATAG	0.189													4	2	---	---	---	---	
TTC14	151613	broad.mit.edu	37	3	180317835	180317835	+	5'Flank	DEL	C	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180317835delC	uc003fkk.2	+						TTC14_uc003fkl.2_5'Flank|TTC14_uc003fkm.2_5'Flank	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a								RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AAGGAACTAACCAAAGACAGA	0.388													4	2	---	---	---	---	
ABCC5	10057	broad.mit.edu	37	3	183668075	183668075	+	Intron	DEL	T	-	-	rs4148588		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183668075delT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GATGCTCTGATTTTTTTTTTT	0.358													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3610214	3610215	+	IGR	INS	-	C	C	rs145974626	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3610214_3610215insC								LRPAP1 (75990 upstream) : ADRA2C (157860 downstream)																							actctcagcatctagcacgatg	0.282													7	4	---	---	---	---	
TBC1D14	57533	broad.mit.edu	37	4	6936955	6936955	+	Intron	DEL	T	-	-	rs78741274		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6936955delT	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						agtggtgtgattttttttttt	0.000													2	4	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54423811	54423811	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54423811delA	uc003haa.2	+						LNX1_uc003haf.3_Intron|LNX1_uc003hag.3_Intron|LNX1_uc003hah.3_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CTGAAGCAGGAAAAAAAAATG	0.393			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
HADH	3033	broad.mit.edu	37	4	108954652	108954652	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108954652delA	uc003hyq.2	+						HADH_uc010ilx.2_Intron|HADH_uc010ily.2_Intron|HADH_uc003hyr.2_Intron	NM_005327	NP_005318	Q16836	HCDH_HUMAN	L-3-hydroxyacyl-Coenzyme A dehydrogenase						fatty acid beta-oxidation	mitochondrial matrix	3-hydroxyacyl-CoA dehydrogenase activity|NAD+ binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)	NADH(DB00157)	GACCTTGAAGAAAAAAAAACC	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	133521068	133521069	+	IGR	DEL	GG	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133521068_133521069delGG								None (None upstream) : PCDH10 (549401 downstream)																							ACAACATTCTGGGAAAAGTCCT	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	140527672	140527672	+	IGR	DEL	G	-	-	rs6846678	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140527672delG								SETD7 (50095 upstream) : MGST2 (59250 downstream)																							AGGATTTGGAGGGGGGTTTGA	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	142940726	142940726	+	IGR	DEL	T	-	-	rs139464041		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142940726delT								IL15 (286115 upstream) : INPP4B (8458 downstream)																							CCCTCTTACCTTTTTTTTTtg	0.055													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	170859455	170859456	+	Intron	INS	-	AACAACAACAAC	AACAACAACAAC	rs148942079	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170859455_170859456insAACAACAACAAC	uc003ism.1	-											Homo sapiens cDNA FLJ43052 fis, clone BRTHA3006318.																		tataaagtttaaacaacaacaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190655269	190655271	+	IGR	DEL	ATA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190655269_190655271delATA								None (None upstream) : FRG1 (206703 downstream)																							ctgcaccatcataatgtcatcca	0.000													6	4	---	---	---	---	
TRIP13	9319	broad.mit.edu	37	5	911759	911760	+	Intron	INS	-	AGG	AGG	rs145194585	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:911759_911760insAGG	uc003jbr.2	+							NM_004237	NP_004228	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13						double-strand break repair|reciprocal meiotic recombination|synaptonemal complex assembly|transcription from RNA polymerase II promoter		ATP binding|identical protein binding|nucleoside-triphosphatase activity|transcription cofactor activity				0			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			AGTGGGGCTGTAGAATTCCCAG	0.450													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2263004	2263006	+	IGR	DEL	TCA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2263004_2263006delTCA								IRX4 (380124 upstream) : IRX2 (483275 downstream)																							GTCAGAGGAGTCAGCACGGGTTT	0.478													8	7	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31962584	31962585	+	Intron	DEL	AG	-	-	rs142136111		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31962584_31962585delAG	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						AAATGTCTGCAGAGAGTCAGGG	0.520													4	7	---	---	---	---	
C5orf42	65250	broad.mit.edu	37	5	37223959	37223959	+	Intron	DEL	A	-	-	rs76701099		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37223959delA	uc011cpa.1	-							NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TCTAAATGACAAAAAAAAAAC	0.348													0	6	---	---	---	---	
GPBP1	65056	broad.mit.edu	37	5	56542533	56542533	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56542533delT	uc003jrh.3	+						GPBP1_uc010iwg.2_Intron|GPBP1_uc003jri.3_Intron|GPBP1_uc003jrj.3_Intron|GPBP1_uc003jrk.3_Intron|GPBP1_uc003jrl.3_Intron	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		AACTTAAAAATTTTTTTTTTT	0.328													2	5	---	---	---	---	
DIMT1L	27292	broad.mit.edu	37	5	61688336	61688337	+	Intron	INS	-	A	A	rs138863703	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61688336_61688337insA	uc003jta.2	-							NM_014473	NP_055288	Q9UNQ2	DIMT1_HUMAN	dimethyladenosine transferase							nucleolus	RNA binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			central_nervous_system(1)	1		Lung NSC(810;8.94e-06)|Prostate(74;0.0235)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.122)		AAAAATCCCCTAAAAAAAAATC	0.342													2	4	---	---	---	---	
VDAC1	7416	broad.mit.edu	37	5	133309209	133309210	+	Intron	DEL	TA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133309209_133309210delTA	uc003kyp.1	-						VDAC1_uc003kyq.1_Intron|VDAC1_uc003kyr.1_Intron	NM_003374	NP_003365	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1						apoptosis|interspecies interaction between organisms	mitochondrial nucleoid|mitochondrial outer membrane|plasma membrane|pore complex	porin activity|protein binding|voltage-gated anion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	TATCAAGCATTATGTCCACACT	0.366													4	2	---	---	---	---	
TGFBI	7045	broad.mit.edu	37	5	135394505	135394505	+	Intron	DEL	C	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135394505delC	uc003lbf.3	+						TGFBI_uc003lbg.3_Intron|TGFBI_uc003lbh.3_Intron|TGFBI_uc011cyb.1_Intron|TGFBI_uc010jed.2_Intron|TGFBI_uc010jee.2_5'Flank	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa						angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGCCAGGGAGCCCAGCATCCC	0.478													4	2	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137322906	137322906	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137322906delA	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						tgttcaggggaaaaaaAACAA	0.164													4	2	---	---	---	---	
PURA	5813	broad.mit.edu	37	5	139494755	139494756	+	3'UTR	DEL	CA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139494755_139494756delCA	uc003lfa.2	+	1						NM_005859	NP_005850	Q00577	PURA_HUMAN	purine-rich element binding protein A						DNA unwinding involved in replication|DNA-dependent DNA replication initiation	DNA replication factor A complex	double-stranded telomeric DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|single-stranded DNA binding|transcription factor binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAAACCCCcacacacacaca	0.213													13	7	---	---	---	---	
PCDHB11	56125	broad.mit.edu	37	5	140581875	140581875	+	3'UTR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140581875delT	uc003liy.2	+	1						NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTCCCCCAAttttttttttt	0.119													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	155035965	155035967	+	IGR	DEL	GGA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155035965_155035967delGGA								KIF4B (638280 upstream) : SGCD (99096 downstream)																							GTTAGGAGGTGGAGGAGGAGGAG	0.419													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161886135	161886137	+	IGR	DEL	ACA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161886135_161886137delACA								GABRG2 (303591 upstream) : CCNG1 (978440 downstream)																							ccaaaggaccacaacaactgtcc	0.000													0	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163344687	163344687	+	IGR	DEL	C	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163344687delC								MAT2B (398354 upstream) : None (None downstream)																							CACAGGGTGGCCCCCACTTGC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	164593659	164593659	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164593659delT								None (None upstream) : None (None downstream)																							ACTGCTCTGATTTTTTTACTT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175592278	175592279	+	Intron	DEL	TC	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175592278_175592279delTC	uc003mdn.2	-											Homo sapiens cDNA clone IMAGE:5171181.																		TCCTGATCATTCTCTCATTTGA	0.351													4	2	---	---	---	---	
ZNF879	345462	broad.mit.edu	37	5	178449980	178449987	+	5'Flank	DEL	GGGAGTTG	-	-	rs72062180		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178449980_178449987delGGGAGTTG	uc003mjt.3	+							NM_001136116	NP_001129588	B4DU55	ZN879_HUMAN	zinc finger protein 879						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						TGATAGCGCTGGGAGTTGGGCTTTATTT	0.250													4	3	---	---	---	---	
CMAH	8418	broad.mit.edu	37	6	25089567	25089568	+	Intron	INS	-	A	A	rs142629252	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25089567_25089568insA	uc003nes.3	-						CMAH_uc003ner.3_Intron					SubName: Full=CMP-N-acetylneuraminic acid hydroxylase;												0						ATGCAGTCTGCCCCAGCTTCAC	0.436													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32441391	32441392	+	IGR	INS	-	T	T	rs28986194		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32441391_32441392insT								HLA-DRA (28570 upstream) : HLA-DRB1 (43771 downstream)																							AAATTATGGGGAGGAGGTTACT	0.505													8	4	---	---	---	---	
POLH	5429	broad.mit.edu	37	6	43549845	43549845	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43549845delA	uc003ovq.3	+						POLH_uc010jyu.2_Intron|POLH_uc011dvl.1_Intron	NM_006502	NP_006493	Q9Y253	POLH_HUMAN	DNA-directed DNA polymerase eta						DNA replication|DNA synthesis involved in DNA repair|regulation of DNA repair|response to UV-C	cytoplasm|nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			breast(2)	2	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			gcaaaatttgaaaaaaatgca	0.045								DNA_polymerases_(catalytic_subunits)	Xeroderma_Pigmentosum				6	3	---	---	---	---	
EFHC1	114327	broad.mit.edu	37	6	52288681	52288681	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52288681delT	uc003pap.3	+						EFHC1_uc011dwv.1_Intron|EFHC1_uc011dww.1_Intron	NM_018100	NP_060570	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1							axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding			ovary(2)|skin(1)	3	Lung NSC(77;0.109)					TAAAAGTTAGTTTTTTTTTTA	0.264													6	3	---	---	---	---	
SERINC1	57515	broad.mit.edu	37	6	122775652	122775652	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122775652delA	uc003pyy.1	-							NM_020755	NP_065806	Q9NRX5	SERC1_HUMAN	serine incorporator 1						phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	L-serine transmembrane transporter activity|protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.126)		AAAACAAAGCAAAAAAAATCT	0.303													6	3	---	---	---	---	
C6orf192	116843	broad.mit.edu	37	6	133097235	133097235	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133097235delT	uc003qdw.1	-						C6orf192_uc010kgd.1_Intron|C6orf192_uc011eco.1_Intron	NM_052831	NP_439896	Q6NT16	CF192_HUMAN	hypothetical protein LOC116843						transmembrane transport	integral to membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;0.00303)|GBM - Glioblastoma multiforme(226;0.0265)		ATCCAATTTATTTTTTTTTAA	0.254													4	2	---	---	---	---	
RBAK	57786	broad.mit.edu	37	7	5097694	5097697	+	Intron	DEL	GTTT	-	-	rs147842930		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5097694_5097697delGTTT	uc010kss.1	+						LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Intron	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		ATTGTTTTGGgtttgtttgtttgt	0.186													6	4	---	---	---	---	
THSD7A	221981	broad.mit.edu	37	7	11854567	11854568	+	Intron	INS	-	CC	CC			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11854567_11854568insCC	uc003ssf.3	-							NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A							integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TACTCCTCTCTCCACAGGGCCC	0.416										HNSCC(18;0.044)			4	2	---	---	---	---	
SCIN	85477	broad.mit.edu	37	7	12664955	12664955	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12664955delA	uc003ssn.3	+						SCIN_uc010ktt.2_Intron|SCIN_uc003sso.3_Intron	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN	scinderin isoform 1						actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TTATGGAGTTAAAAAAAAAGC	0.289													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	17174745	17174745	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17174745delT								AGR3 (253132 upstream) : AHR (163531 downstream)																							GGCTGCATAGTTTTTTTTTTT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20153330	20153330	+	IGR	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20153330delA								TMEM196 (340114 upstream) : MACC1 (20958 downstream)																							ACCAAAAAGGAAAAAAAAAAC	0.338													4	2	---	---	---	---	
TRA2A	29896	broad.mit.edu	37	7	23547487	23547487	+	Intron	DEL	C	-	-	rs145031550	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23547487delC	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425	Q13595	TRA2A_HUMAN	transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1						AATTCCCATTCCCCACTCCAT	0.418													4	2	---	---	---	---	
HIBADH	11112	broad.mit.edu	37	7	27691932	27691932	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27691932delA	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron|HIBADH_uc003szi.2_5'Flank	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)	GATTAAGATTAAAAAAAAAAT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	33693299	33693299	+	IGR	DEL	G	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33693299delG								BBS9 (47619 upstream) : BMPER (251813 downstream)																							TGAGAGTCCTGTGTGTGTCTG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57997251	57997251	+	IGR	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57997251delA								ZNF716 (463986 upstream) : None (None downstream)																							ctgctcaatcaaaagaaagtt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61661760	61661761	+	IGR	INS	-	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61661760_61661761insA								None (None upstream) : None (None downstream)																							AATTATATCACACATGATAGTT	0.317													16	7	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	70238750	70238750	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70238750delT	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron|AUTS2_uc011keg.1_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GTTGCTTCTCTTTTTTGGTCC	0.468													4	2	---	---	---	---	
PION	54103	broad.mit.edu	37	7	76958331	76958331	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76958331delA	uc003ugf.2	-						PION_uc011kgo.1_5'Flank|PION_uc003ugd.2_5'Flank	NM_017439	NP_059135	A4D1B5	GSAP_HUMAN	pigeon homolog						beta-amyloid formation|regulation of proteolysis	trans-Golgi network	beta-amyloid binding			central_nervous_system(1)	1						CTGACACTTTAAAAAAAAAAA	0.338													3	3	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89938365	89938365	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89938365delT	uc010lep.2	+						C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_Intron	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						TCTGGAAGACTTTTAGGTGAC	0.348													4	2	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122120621	122120621	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122120621delT	uc010lkp.2	-						CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TAACTTAGCATTTTTTCCACT	0.313													4	2	---	---	---	---	
FAM40B	57464	broad.mit.edu	37	7	129096108	129096108	+	Intron	DEL	G	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129096108delG	uc011koy.1	+						FAM40B_uc003vow.2_Intron|FAM40B_uc011koz.1_5'Flank	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a												0						CAGTTGCCGTGGGGATGGTAA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141564233	141564234	+	IGR	INS	-	T	T	rs142575113	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141564233_141564234insT								PRSS37 (22948 upstream) : OR9A4 (54442 downstream)																							AGAAAGAAACATTTTTTTTTAC	0.406													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8916317	8916317	+	IGR	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8916317delA								ERI1 (25468 upstream) : PPP1R3B (77457 downstream)																							GAAATAGGCCAaaaaaaataa	0.244													6	4	---	---	---	---	
RAB11FIP1	80223	broad.mit.edu	37	8	37727720	37727720	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37727720delA	uc003xkm.1	-						RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Intron|RAB11FIP1_uc003xko.1_3'UTR|RAB11FIP1_uc003xkp.1_3'UTR	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3						protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			TGCTTGAGACAAAAAAAAAAA	0.224													4	3	---	---	---	---	
NSMAF	8439	broad.mit.edu	37	8	59543849	59543849	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59543849delT	uc003xtt.2	-						NSMAF_uc011lee.1_Intron|NSMAF_uc003xtu.2_Intron	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				TTTTAGGCACTTTTTTTTTTA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	72716543	72716544	+	IGR	INS	-	A	A	rs142919236	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72716543_72716544insA								EYA1 (442076 upstream) : MSC (37233 downstream)																							TGGCATCTGGCGGGGCTGTTGG	0.485													0	7	---	---	---	---	
GDF6	392255	broad.mit.edu	37	8	97172304	97172304	+	Intron	DEL	G	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97172304delG	uc003yhp.2	-							NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN	growth differentiation factor 6 precursor						activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(1)|breast(1)|pancreas(1)	3	Breast(36;2.67e-05)					gagaaagaaagggggggaaag	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	98864929	98864930	+	IGR	DEL	TG	-	-	rs141244568	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98864929_98864930delTG								LAPTM4B (100 upstream) : MATN2 (16381 downstream)																							GGCTTTTTTTTGGGGGGGGGAG	0.406													4	2	---	---	---	---	
COL14A1	7373	broad.mit.edu	37	8	121163211	121163211	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121163211delA	uc003yox.2	+							NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor						cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ttaatagaagaaaaatgactg	0.000													4	2	---	---	---	---	
TG	7038	broad.mit.edu	37	8	134052198	134052199	+	Intron	INS	-	CACA	CACA	rs147401482	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134052198_134052199insCACA	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc011ljd.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCACTTGCATGcacacacacac	0.460													17	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135148609	135148612	+	IGR	DEL	CTCA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135148609_135148612delCTCA								ST3GAL1 (564426 upstream) : ZFAT (341421 downstream)																							GGCTGTTTGTCTCACTCACTCACT	0.510													4	2	---	---	---	---	
FAM154A	158297	broad.mit.edu	37	9	18941449	18941449	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18941449delA	uc003zni.1	-						FAM154A_uc010mip.1_Intron	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN	hypothetical protein LOC158297											pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.53e-16)		ttcaattattaaaaaaaaatg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68417570	68417571	+	IGR	INS	-	AA	AA	rs111263548		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68417570_68417571insAA								FAM27B (623381 upstream) : MIR1299 (584668 downstream)																							AGGATAGGAATAAAACATCAGT	0.243													5	3	---	---	---	---	
TJP2	9414	broad.mit.edu	37	9	71836476	71836476	+	Intron	DEL	T	-	-	rs113816166		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71836476delT	uc004ahe.2	+						TJP2_uc011lrs.1_Intron|TJP2_uc011lrt.1_Intron|TJP2_uc004ahd.2_Intron|TJP2_uc004ahf.2_Intron|TJP2_uc011lru.1_Intron|TJP2_uc011lrv.1_Intron	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)						cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						gttttcttaattttttttttt	0.204													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110809730	110809731	+	IGR	DEL	TG	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110809730_110809731delTG								KLF4 (557683 upstream) : ACTL7B (807140 downstream)																							TTTCTGTGCCTGTAGTTTTTCA	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	114270643	114270644	+	IGR	DEL	GT	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114270643_114270644delGT								KIAA0368 (23618 upstream) : ZNF483 (16803 downstream)																							ggatgtgtgcgtgtgtgtgtgt	0.109													2	4	---	---	---	---	
ZNF618	114991	broad.mit.edu	37	9	116810489	116810489	+	Intron	DEL	G	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116810489delG	uc004bid.2	+						ZNF618_uc004bic.2_Intron|ZNF618_uc011lxi.1_Intron|ZNF618_uc011lxj.1_Intron|ZNF618_uc010mvb.2_Intron	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						gactttttttgtggtcagaaa	0.164													5	3	---	---	---	---	
C9orf171	389799	broad.mit.edu	37	9	135374265	135374266	+	Intron	INS	-	GGAG	GGAG			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135374265_135374266insGGAG	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5						CCTAGCTCGCTGCTTGGCAGCT	0.634													4	2	---	---	---	---	
C9orf171	389799	broad.mit.edu	37	9	135374267	135374268	+	Intron	INS	-	AGCTGG	AGCTGG			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135374267_135374268insAGCTGG	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5						TAGCTCGCTGCTTGGCAGCTGG	0.629													4	2	---	---	---	---	
TRAF2	7186	broad.mit.edu	37	9	139804517	139804518	+	Intron	INS	-	G	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139804517_139804518insG	uc010nbu.2	+						TRAF2_uc004cjv.2_Intron|TRAF2_uc011mek.1_Intron|TRAF2_uc010nbw.2_Intron	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2						activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		GTCCCGTGGGTGGGGGTGGGGC	0.629													17	8	---	---	---	---	
MCM10	55388	broad.mit.edu	37	10	13249348	13249348	+	Intron	DEL	T	-	-	rs76611895		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13249348delT	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						AGAATAGTGATTTTTTTTTTC	0.209													8	4	---	---	---	---	
MLLT10	8028	broad.mit.edu	37	10	21834173	21834173	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21834173delT	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc001iqr.1_Intron|MLLT10_uc001iqq.1_Intron|MLLT10_uc001iqu.1_Intron|MLLT10_uc009xke.1_Intron|MLLT10_uc001iqw.1_Intron|MLLT10_uc001iqx.1_Intron|MLLT10_uc009xkf.1_Intron	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						ACCACATGCCTTTTTTTTTTT	0.333			T	MLL|PICALM|CDK6	AL								6	3	---	---	---	---	
FRMPD2	143162	broad.mit.edu	37	10	49400634	49400634	+	Intron	DEL	A	-	-	rs74923642		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49400634delA	uc001jgi.2	-						FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		actcagtctcaaaaaaaaaat	0.214													6	3	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	68650696	68650696	+	Intron	DEL	C	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68650696delC	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						CATTTGTGTGCCCCACCCACC	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81077350	81077353	+	IGR	DEL	CTCT	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81077350_81077353delCTCT								ZMIZ1 (1065 upstream) : PPIF (29867 downstream)																							GACAGGCTGACTCTCTCTGAACAG	0.534													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	91761884	91761884	+	IGR	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91761884delA								KIF20B (227184 upstream) : HTR7 (738694 downstream)																							CTCCTCAGGGAAAAAAAAAAa	0.338													10	5	---	---	---	---	
PKD2L1	9033	broad.mit.edu	37	10	102048435	102048435	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102048435delT	uc001kqx.1	-						BLOC1S2_uc001kqv.1_5'Flank|BLOC1S2_uc001kqw.1_5'Flank|PKD2L1_uc009xwm.1_Intron	NM_016112	NP_057196	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1						signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding			ovary(4)	4		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		GTTTGTTAACTTTTTTTTTTT	0.423													4	3	---	---	---	---	
PIK3C2A	5286	broad.mit.edu	37	11	17124005	17124007	+	Intron	DEL	AAC	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17124005_17124007delAAC	uc001mmq.3	-						PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha						cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	AAAAGaacaaaacaacaacaaca	0.148													4	2	---	---	---	---	
TUT1	64852	broad.mit.edu	37	11	62346643	62346643	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62346643delT	uc001nto.2	-						TUT1_uc001ntp.1_5'Flank	NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6						mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						acaggaaccctTTTTTTTTTT	0.104													4	3	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892826	76892826	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892826delT	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						tttttttttgttttttttttt	0.274													4	2	---	---	---	---	
MMP8	4317	broad.mit.edu	37	11	102586746	102586746	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102586746delT	uc001phe.2	-						MMP8_uc010rut.1_Intron|MMP8_uc010ruu.1_Intron	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein						collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		TGTTTTCATGTTTTTTTTTTC	0.373													3	3	---	---	---	---	
TMPRSS4	56649	broad.mit.edu	37	11	117974091	117974092	+	Intron	INS	-	TTTGTTTGTTTGTTTG	TTTGTTTGTTTGTTTG	rs138588873	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117974091_117974092insTTTGTTTGTTTGTTTG	uc010rxo.1	+						TMPRSS4_uc010rxp.1_Intron|TMPRSS4_uc010rxq.1_Intron|TMPRSS4_uc010rxr.1_Intron|TMPRSS4_uc010rxs.1_Intron|TMPRSS4_uc009yzu.2_Intron|TMPRSS4_uc010rxt.1_Intron	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		GTATAAGGttctttgtttgttt	0.267													4	2	---	---	---	---	
ARHGEF12	23365	broad.mit.edu	37	11	120298619	120298619	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120298619delT	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GACAAATTAGTTTTTTTTTCT	0.313			T	MLL	AML								4	2	---	---	---	---	
PKNOX2	63876	broad.mit.edu	37	11	125268424	125268426	+	Intron	DEL	CTG	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125268424_125268426delCTG	uc001qbu.2	+						PKNOX2_uc010saz.1_Intron|PKNOX2_uc010sba.1_Intron|PKNOX2_uc010sbb.1_Intron	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		TCCCATGGGCCTGCTGCTCCCTA	0.557													4	2	---	---	---	---	
ADIPOR2	79602	broad.mit.edu	37	12	1831347	1831347	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1831347delA	uc001qjm.2	+						ADIPOR2_uc001qjn.2_Intron	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			attagtggagaaaaataggtt	0.000													4	2	---	---	---	---	
PRMT8	56341	broad.mit.edu	37	12	3677561	3677562	+	Intron	INS	-	GTT	GTT	rs150216277	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3677561_3677562insGTT	uc001qmf.2	+						PRMT8_uc009zed.2_Intron|PRMT8_uc009zee.1_Intron|PRMT8_uc001qmg.2_5'UTR	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4						regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			ttcaaagccaggttgttaaggg	0.000													3	3	---	---	---	---	
A2M	2	broad.mit.edu	37	12	9259920	9259921	+	Intron	INS	-	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9259920_9259921insC	uc001qvk.1	-						A2M_uc009zgk.1_Intron	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor						blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	CTATCGTTCTGAAACACTCACA	0.386													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	22762450	22762451	+	IGR	INS	-	AAAC	AAAC	rs149319339	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22762450_22762451insAAAC								KIAA0528 (64998 upstream) : ETNK1 (15625 downstream)																							cctgtttttaTaaacaaacaaa	0.114													3	4	---	---	---	---	
FAR2	55711	broad.mit.edu	37	12	29460409	29460409	+	Intron	DEL	G	-	-	rs75909823		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29460409delG	uc001ris.3	+						FAR2_uc001rit.2_Intron|FAR2_uc009zjm.2_Intron|uc001riu.1_Intron	NM_018099	NP_060569	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2						ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor				0						GCTTAGCAGTGAAGAGCAAAA	0.343													3	8	---	---	---	---	
SOAT2	8435	broad.mit.edu	37	12	53502235	53502235	+	Intron	DEL	A	-	-	rs34562978		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53502235delA	uc001sbv.2	+						SOAT2_uc009zms.2_Intron	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						gcaaataactaatattgcaaa	0.000													9	4	---	---	---	---	
RAP1B	5908	broad.mit.edu	37	12	69048273	69048273	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69048273delT	uc001sub.2	+						RAP1B_uc010ste.1_Intron|RAP1B_uc001suc.2_Intron|RAP1B_uc010stf.1_Intron|RAP1B_uc010stg.1_Intron|RAP1B_uc010sth.1_Intron|RAP1B_uc010sti.1_Intron	NM_001089704	NP_001083173	P61224	RAP1B_HUMAN	SubName: Full=Ras-related protein Rap-1A; SubName: Full=cDNA FLJ75985, highly similar to Homo sapiens RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2, mRNA; SubName: Full=RAP1A, member of RAS oncogene family;						blood coagulation|energy reserve metabolic process|regulation of establishment of cell polarity|regulation of insulin secretion	cell-cell junction|cytosol	GDP binding|GTP binding|GTPase activity|protein binding				0	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)		ACACCCTTCCttttttttttt	0.164													4	2	---	---	---	---	
TCP11L2	255394	broad.mit.edu	37	12	106707950	106707950	+	Intron	DEL	G	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106707950delG	uc001tln.2	+						TCP11L2_uc001tll.2_Intron|TCP11L2_uc001tlm.2_Intron	NM_152772	NP_689985	Q8N4U5	T11L2_HUMAN	t-complex 11 (mouse) like 2											ovary(3)	3						AGCTATTGAAGGAGTTCTTAA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110678919	110678922	+	IGR	DEL	AGAG	-	-	rs140989783		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110678919_110678922delAGAG								IFT81 (22320 upstream) : ATP2A2 (40110 downstream)																							aagtagaaatagagagaagtggac	0.000													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126395892	126395893	+	IGR	DEL	TT	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126395892_126395893delTT								TMEM132B (252303 upstream) : LOC100128554 (531134 downstream)																							TCAGGATTTATTTAaggagggt	0.069													4	2	---	---	---	---	
TMEM132C	92293	broad.mit.edu	37	12	129091556	129091557	+	Intron	INS	-	ACAGG	ACAGG			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129091556_129091557insACAGG	uc001uhs.3	+							NM_001136103	NP_001129575	Q8N3T6	T132C_HUMAN	transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1						ataaggaagacacaggacaggt	0.000													4	2	---	---	---	---	
C13orf18	80183	broad.mit.edu	37	13	46920550	46920553	+	Intron	DEL	CTAA	-	-	rs143182918		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46920550_46920553delCTAA	uc010acl.2	-						C13orf18_uc010tfy.1_Intron|C13orf18_uc001vbf.3_Intron|C13orf18_uc001vbg.3_Intron|C13orf18_uc010tfz.1_Intron|C13orf18_uc010acm.2_Intron|C13orf18_uc010acn.2_Intron|C13orf18_uc001vbe.3_Intron|C13orf18_uc001vbh.3_Intron|C13orf18_uc001vbi.3_Intron	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183												0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		TATCTCACTCCTAACTGAGCTAAA	0.529													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20315828	20315829	+	IGR	INS	-	T	T	rs150158951	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20315828_20315829insT								OR4N2 (19298 upstream) : OR4K2 (28598 downstream)																							TTTCTCAGATCTTTTTTTGCAC	0.416													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38599367	38599367	+	IGR	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38599367delA								FOXA1 (534878 upstream) : SSTR1 (77837 downstream)																							AAACTGTCAGAGGAGAAGATA	0.353													4	2	---	---	---	---	
SEC23A	10484	broad.mit.edu	37	14	39534454	39534455	+	Intron	DEL	CA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39534454_39534455delCA	uc001wup.1	-						SEC23A_uc010tqa.1_Intron|SEC23A_uc010tqb.1_Intron|SEC23A_uc010tqc.1_Intron	NM_006364	NP_006355	Q15436	SC23A_HUMAN	SEC23-related protein A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|Golgi membrane|smooth endoplasmic reticulum membrane	protein binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		ATCCTGACTTCACACTTCTACC	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	44211241	44211241	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44211241delT								None (None upstream) : FSCB (762114 downstream)																							ctgctacaccttttttttttc	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66335583	66335583	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66335583delT								FUT8 (125622 upstream) : C14orf53 (617526 downstream)																							gtgagagaggttttttttttg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	77171841	77171842	+	IGR	DEL	AC	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77171841_77171842delAC								ESRRB (203663 upstream) : VASH1 (56393 downstream)																							GTGGATGGGTACACACACACAC	0.257													4	2	---	---	---	---	
C14orf159	80017	broad.mit.edu	37	14	91626382	91626382	+	Intron	DEL	C	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91626382delC	uc001xzb.2	+						C14orf159_uc010atu.1_Intron|C14orf159_uc010atv.1_Intron|C14orf159_uc001xyy.2_Intron|C14orf159_uc001xyx.2_Intron|C14orf159_uc001xyw.2_Intron|C14orf159_uc001xzc.2_Intron|C14orf159_uc001xza.2_Intron|C14orf159_uc001xyv.2_Intron|C14orf159_uc001xyz.2_Intron|C14orf159_uc010twj.1_Intron|C14orf159_uc001xze.2_Intron	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN	hypothetical protein LOC80017 isoform a							mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		gggggacgttccaggccaagg	0.189													4	2	---	---	---	---	
KIAA1409	57578	broad.mit.edu	37	14	94084411	94084412	+	Intron	DEL	TC	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94084411_94084412delTC	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		TGTTTCTACTTCTCTCTCTCTC	0.243													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97718018	97718018	+	IGR	DEL	T	-	-	rs34980470		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97718018delT								VRK1 (370068 upstream) : C14orf64 (673929 downstream)																							TATGACACAATTTTTTTTTTC	0.398													6	3	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27556789	27556789	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27556789delA	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		ggggatagggaaaaaaaaaac	0.000													4	4	---	---	---	---	
TTBK2	146057	broad.mit.edu	37	15	43075081	43075081	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43075081delT	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		TCACTAGTGATTTTTTTTTTG	0.403													3	4	---	---	---	---	
MFAP1	4236	broad.mit.edu	37	15	44101692	44101693	+	Intron	DEL	AA	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44101692_44101693delAA	uc001zth.1	-							NM_005926	NP_005917	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1							microfibril				skin(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		tctgtctcttaaaaaaaaaaaa	0.168													4	2	---	---	---	---	
ATP8B4	79895	broad.mit.edu	37	15	50283354	50283355	+	Intron	INS	-	A	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50283354_50283355insA	uc001zxu.2	-						ATP8B4_uc010ber.2_Intron|ATP8B4_uc010ufd.1_Intron|ATP8B4_uc010ufe.1_Intron	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		ATCTGGTAAGCAAAAAAACTCA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79802465	79802466	+	IGR	INS	-	C	C	rs144704649	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79802465_79802466insC								KIAA1024 (37823 upstream) : MTHFS (334854 downstream)																							tctggcccttgcccacttatcc	0.193													10	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97199449	97199449	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97199449delT								NR2F2 (315959 upstream) : SPATA8 (127230 downstream)																							tggcaacctatttttttctgt	0.085													4	2	---	---	---	---	
FAM169B	283777	broad.mit.edu	37	15	99057693	99057693	+	5'Flank	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99057693delT	uc002buk.1	-							NM_182562	NP_872368	Q8N8A8	F169B_HUMAN	hypothetical protein LOC283777												0						TTCTGACTCCTTTAGCTTCCA	0.418													4	2	---	---	---	---	
PCSK6	5046	broad.mit.edu	37	15	101996445	101996445	+	Intron	DEL	T	-	-	rs71154332		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101996445delT	uc002bwy.2	-						PCSK6_uc010bpe.2_Intron|PCSK6_uc002bxa.2_Intron|PCSK6_uc002bxb.2_Intron|PCSK6_uc002bxc.1_Intron|PCSK6_uc002bxd.1_Intron|PCSK6_uc002bxe.2_Intron|PCSK6_uc002bxg.1_Intron	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4						glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCCCTCCACGTGCTGATTCAC	0.493													4	3	---	---	---	---	
PCSK6	5046	broad.mit.edu	37	15	101996452	101996453	+	Intron	INS	-	CACTAAGACTG	CACTAAGACTG	rs142437422	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101996452_101996453insCACTAAGACTG	uc002bwy.2	-						PCSK6_uc010bpe.2_Intron|PCSK6_uc002bxa.2_Intron|PCSK6_uc002bxb.2_Intron|PCSK6_uc002bxc.1_Intron|PCSK6_uc002bxd.1_Intron|PCSK6_uc002bxe.2_Intron|PCSK6_uc002bxg.1_Intron	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4						glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACGTGCTGATTCACGTAACAGC	0.500													6	3	---	---	---	---	
AQP8	343	broad.mit.edu	37	16	25239588	25239588	+	Intron	DEL	A	-	-	rs73551053	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25239588delA	uc002doc.2	+							NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8						cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		tgtctcaattaaaaaaaaaaa	0.219													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46429648	46429649	+	IGR	INS	-	GTC	GTC	rs58411238		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46429648_46429649insGTC								None (None upstream) : ANKRD26P1 (73600 downstream)																							aatcaaatggaatcatcaaata	0.000													4	2	---	---	---	---	
HYDIN	54768	broad.mit.edu	37	16	71061896	71061896	+	Intron	DEL	T	-	-	rs142337199		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71061896delT	uc002ezr.2	-						HYDIN_uc010cfz.1_Intron|HYDIN_uc002ezv.2_Intron	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)				AATATAAGACTTTTTTTTTTT	0.408													7	4	---	---	---	---	
FAM38A	9780	broad.mit.edu	37	16	88787608	88787610	+	In_Frame_Del	DEL	CTT	-	-	rs3217718		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88787608_88787610delCTT	uc010vpb.1	-	39	5635_5637	c.5632_5634delAAG	c.(5632-5634)AAGdel	p.K1878del	FAM38A_uc002flp.3_5'Flank|FAM38A_uc002flq.3_5'Flank|FAM38A_uc002flr.3_In_Frame_Del_p.K1446del|FAM38A_uc010cib.2_In_Frame_Del_p.K741del	NM_001142864	NP_001136336	Q92508	PIEZ1_HUMAN	family with sequence similarity 38, member A	1878						endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane	ion channel activity				0						CTGGGCCCTCCTTCTTCCTTCTT	0.616													15	9	---	---	---	---	
AKAP10	11216	broad.mit.edu	37	17	19846208	19846208	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19846208delT	uc002gwo.2	-						AKAP10_uc002gwp.1_Intron|AKAP10_uc010cqw.1_Intron	NM_007202	NP_009133	O43572	AKA10_HUMAN	A-kinase anchor protein 10 precursor						blood coagulation|protein localization	cytosol|mitochondrion|plasma membrane	signal transducer activity			skin(1)	1	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					ctttgcccagttttttttttt	0.010													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21560338	21560339	+	IGR	INS	-	G	G	rs147837000		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21560338_21560339insG								C17orf51 (82607 upstream) : FAM27L (265031 downstream)																							GGTGAATATAAGCCACAGATAG	0.525													3	4	---	---	---	---	
HEXIM1	10614	broad.mit.edu	37	17	43226413	43226413	+	5'UTR	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43226413delA	uc002iig.2	+	1						NM_006460	NP_006451	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1						negative regulation of cyclin-dependent protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding|snRNA binding			ovary(1)	1						AGGACTAGCTAAAGGCGTCAC	0.433											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
LRRC37A	9884	broad.mit.edu	37	17	44383559	44383559	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44383559delT	uc002ikg.2	+						ARL17A_uc002iki.3_Intron|ARL17A_uc002ikh.3_Intron|ARL17B_uc002ikf.2_Intron	NM_014834	NP_055649	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A precursor							integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TCTGAAATAATTTTTTTTTTC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49547765	49547765	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49547765delT								UTP18 (172475 upstream) : CA10 (159910 downstream)																							AGTTCAGGCGTTTTTTTTTTT	0.393													8	4	---	---	---	---	
DDX42	11325	broad.mit.edu	37	17	61888766	61888766	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61888766delT	uc002jbu.2	+						DDX42_uc002jbv.2_Intron|DDX42_uc002jbw.1_Intron|DDX42_uc002jbx.2_Intron|DDX42_uc002jby.2_5'UTR	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						tcattttgtgttttttttgtt	0.139													3	3	---	---	---	---	
HELZ	9931	broad.mit.edu	37	17	65119431	65119432	+	Intron	DEL	AC	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65119431_65119432delAC	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AAAGCATATTACaaaaaaaaaa	0.233													4	2	---	---	---	---	
ENPP7	339221	broad.mit.edu	37	17	77709528	77709528	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77709528delT	uc002jxa.2	+							NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTGGGtcttcttttttttttt	0.313													4	4	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78576291	78576291	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78576291delT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						TTTTCTTTTCTTTTTTTTTGG	0.199													6	3	---	---	---	---	
AATK	9625	broad.mit.edu	37	17	79098839	79098847	+	Intron	DEL	GCAGGGTGA	-	-	rs141491493		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79098839_79098847delGCAGGGTGA	uc010dia.2	-						AATK_uc010dhz.2_5'Flank|hsa-mir-3065|MI0014228_5'Flank	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase							integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			aggggcaggggcagggtgagcagggtgag	0.330													6	8	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14808187	14808187	+	Intron	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14808187delT	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						CTAGGACTTATTTTTTTTTTG	0.333													4	4	---	---	---	---	
B4GALT6	9331	broad.mit.edu	37	18	29206811	29206811	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29206811delA	uc002kwz.3	-						B4GALT6_uc010dma.2_Intron|B4GALT6_uc010dmb.2_Intron|B4GALT6_uc002kwy.3_5'Flank	NM_004775	NP_004766	Q9UBX8	B4GT6_HUMAN	beta-1,4-galactosyltransferase 6						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding				0			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			AGACTTAATGAAAAAAAAAGA	0.214													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	61674955	61674955	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61674955delT								SERPINB8 (18348 upstream) : C18orf20 (72288 downstream)																							tgctatgcccttttatacaat	0.000													4	2	---	---	---	---	
PLK5P	126520	broad.mit.edu	37	19	1525005	1525005	+	Intron	DEL	T	-	-	rs66651666		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1525005delT	uc002ltf.2	+						PLK5P_uc002ltg.1_5'UTR|PLK5P_uc010dsm.1_5'Flank	NR_026557				RecName: Full=Putative serine/threonine-protein kinase-like protein PLK5; AltName: Full=Putative Polo-like kinase 5;          Short=PLK-5;												0						tgtctgggcgttgcgtgtttg	0.244													8	5	---	---	---	---	
CNN1	1264	broad.mit.edu	37	19	11660012	11660012	+	Intron	DEL	T	-	-	rs8100751	by1000genomes	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11660012delT	uc002msc.1	+						CNN1_uc010xmb.1_Intron|CNN1_uc010xmc.1_Intron	NM_001299	NP_001290	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle						actomyosin structure organization|regulation of smooth muscle contraction	cytoskeleton	actin binding|calmodulin binding				0						caaaaaaaaataaataaaata	0.184													9	4	---	---	---	---	
DMRTC2	63946	broad.mit.edu	37	19	42352414	42352414	+	Intron	DEL	A	-	-	rs79959130		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42352414delA	uc002ors.2	+						DMRTC2_uc002orr.1_Intron|DMRTC2_uc010xwe.1_Intron	NM_001040283	NP_001035373	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2						cell differentiation|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0						actccatctcaaaaaaaaaaa	0.244													5	3	---	---	---	---	
C19orf61	56006	broad.mit.edu	37	19	44238869	44238870	+	Intron	INS	-	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44238869_44238870insT	uc002oxj.2	-						C19orf61_uc002oxk.2_Intron	NM_019108	NP_061981	Q9H0W8	SMG9_HUMAN	SMG9 protein						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	intracellular	protein binding				0		Prostate(69;0.0352)				AGTTTACTGTATTTTTttttta	0.045													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50222670	50222670	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50222670delT								CPT1C (5682 upstream) : TSKS (20342 downstream)																							cctttctttcttTTTTTTTCC	0.229													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41080150	41080150	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41080150delA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				tagagcagagaaaaaaaaata	0.000													3	3	---	---	---	---	
SULF2	55959	broad.mit.edu	37	20	46290336	46290337	+	Intron	INS	-	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46290336_46290337insC	uc002xto.2	-						SULF2_uc002xtr.2_Intron|SULF2_uc002xtq.2_Intron|SULF2_uc010zyd.1_Intron	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor						bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						CTCTCAGGAATCACAGCTTGTT	0.460													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47102631	47102631	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47102631delT								LOC284749 (103250 upstream) : PREX1 (138162 downstream)																							CACCAGctccttcctgggtct	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62604549	62604550	+	IGR	DEL	TG	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62604549_62604550delTG								ZNF512B (3331 upstream) : SAMD10 (916 downstream)																							GTCTGATTGCtgtgtgtgtgtg	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14493164	14493165	+	IGR	INS	-	T	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14493164_14493165insT								C21orf99 (2595 upstream) : POTED (489333 downstream)																							TACATAGTAGAACTATATCTGA	0.376													5	5	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31302452	31302452	+	3'UTR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31302452delT	uc003aiy.1	+	14					OSBP2_uc011ala.1_3'UTR|OSBP2_uc010gwc.1_3'UTR|OSBP2_uc011alb.1_3'UTR|OSBP2_uc003aiz.1_3'UTR|OSBP2_uc003aja.1_3'UTR|OSBP2_uc011alc.1_3'UTR|OSBP2_uc003ajb.2_3'UTR|OSBP2_uc011ald.1_3'UTR|OSBP2_uc010gwd.1_3'UTR	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						TCCTTTCCTATTTTTTTTTTC	0.547													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35561021	35561021	+	IGR	DEL	C	-	-	rs71191344		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35561021delC								ISX (77643 upstream) : HMGXB4 (92424 downstream)																							ttgctccactcccacttatgg	0.000													3	5	---	---	---	---	
MICALL1	85377	broad.mit.edu	37	22	38332911	38332911	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38332911delA	uc003aui.2	+							NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13							cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					aaaaaaaaacaaaaaaaaaag	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	35041277	35041277	+	IGR	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35041277delA								FAM47B (78243 upstream) : MAGEB16 (775182 downstream)																							atatagggttaaaaaaaaaaa	0.000													9	5	---	---	---	---	
CACNA1F	778	broad.mit.edu	37	X	49068087	49068088	+	Intron	INS	-	C	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49068087_49068088insC	uc004dnb.2	-						CACNA1F_uc010nip.2_Intron	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	CAATATTTTAACAGCCAGTGTG	0.475													4	2	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53592345	53592345	+	Intron	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53592345delA	uc004dsp.2	-						HUWE1_uc004dsn.2_Intron	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TTTTGTTTAGAAAAAAAAAAT	0.353													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	114658401	114658401	+	IGR	DEL	T	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114658401delT								LUZP4 (116282 upstream) : PLS3 (136805 downstream)																							ttgttttttgttttttttgag	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	8435654	8435655	+	IGR	DEL	GT	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:8435654_8435655delGT								TTTY12 (756933 upstream) : TTTY18 (115756 downstream)																							ATCtgtgtgagtgtgtgtgtgt	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58856003	58856003	+	IGR	DEL	A	-	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58856003delA								None (None upstream) : None (None downstream)																							actccattctatgcgatttca	0.070													4	2	---	---	---	---	
