Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
C1QC	714	broad.mit.edu	37	1	22973841	22973841	+	Silent	SNP	C	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22973841C>A	uc001bgc.3	+	3	406	c.303C>A	c.(301-303)CCC>CCA	p.P101P	C1QC_uc001bga.3_Silent_p.P101P|C1QC_uc001bgb.2_Silent_p.P101P	NM_172369	NP_758957	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	101	Collagen-like.				complement activation, classical pathway|innate immune response|negative regulation of granulocyte differentiation|negative regulation of macrophage differentiation	collagen					0		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGCCCGGCCCCATGGGCATCC	0.642													9	17	---	---	---	---	PASS
RCC1	1104	broad.mit.edu	37	1	28862846	28862846	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28862846T>A	uc001bqg.1	+	8	975	c.890T>A	c.(889-891)GTG>GAG	p.V297E	SNHG3-RCC1_uc001bqa.1_Missense_Mutation_p.V297E|SNHG3-RCC1_uc001bqb.1_Missense_Mutation_p.V297E|SNHG3-RCC1_uc001bqc.1_Missense_Mutation_p.V297E|RCC1_uc001bqe.1_Missense_Mutation_p.V314E|RCC1_uc001bqf.1_Missense_Mutation_p.V328E	NM_001269	NP_001260	P18754	RCC1_HUMAN	regulator of chromosome condensation 1 isoform	297	RCC1 5.				cell division|chromosome segregation|G1/S transition of mitotic cell cycle|mitosis|mitotic spindle organization|regulation of mitosis|regulation of S phase of mitotic cell cycle|spindle assembly|viral reproduction	condensed nuclear chromosome|cytoplasm|nuclear chromatin|nuclear membrane|nucleoplasm	histone binding|nucleosomal DNA binding|Ran guanyl-nucleotide exchange factor activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		AAGTCCTGGGTGGGCTTCTCT	0.562													5	75	---	---	---	---	PASS
CACHD1	57685	broad.mit.edu	37	1	65047954	65047954	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65047954A>T	uc001dbo.1	+	3	329	c.224A>T	c.(223-225)CAA>CTA	p.Q75L	CACHD1_uc001dbp.1_5'UTR|CACHD1_uc001dbq.1_5'UTR	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1	126	Extracellular (Potential).				calcium ion transport	integral to membrane				ovary(2)	2						ACTGCAATTCAAGACTGCTGT	0.398													28	275	---	---	---	---	PASS
DDX20	11218	broad.mit.edu	37	1	112302139	112302139	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112302139T>C	uc001ebs.2	+	3	871	c.514T>C	c.(514-516)TCA>CCA	p.S172P	DDX20_uc010owf.1_Intron|DDX20_uc001ebt.2_5'Flank	NM_007204	NP_009135	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	172	Helicase ATP-binding.				assembly of spliceosomal tri-snRNP|ncRNA metabolic process	Cajal body|cytoskeleton|cytosol|spliceosomal complex	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding			lung(1)|kidney(1)	2		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACCCCATTATCACAAGACAA	0.383													31	183	---	---	---	---	PASS
TSPAN2	10100	broad.mit.edu	37	1	115592972	115592972	+	3'UTR	SNP	C	T	T	rs17033067	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115592972C>T	uc001eft.2	-	8						NM_005725	NP_005716	O60636	TSN2_HUMAN	tetraspan 2							integral to membrane					0	Lung SC(450;0.211)	all_cancers(81;2.9e-07)|all_epithelial(167;1.42e-06)|all_lung(203;6.72e-06)|Lung NSC(69;1.13e-05)|Acute lymphoblastic leukemia(138;0.191)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)		GCCAAACATACGTACTCATGC	0.383													5	65	---	---	---	---	PASS
FCRL4	83417	broad.mit.edu	37	1	157566118	157566118	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157566118C>T	uc001fqw.2	-	2	188	c.52G>A	c.(52-54)GCA>ACA	p.A18T	FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor	18		Breakpoint for insertion to form FCRL4- IGHA1 fusion protein.				integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				AAGGACTTACCAGATTGTCCA	0.418													10	105	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214802408	214802408	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214802408A>T	uc001hkm.2	+	8	1262	c.1088A>T	c.(1087-1089)AAA>ATA	p.K363I		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	363	Interaction with SNAP25 and required for localization to the cytoplasm (By similarity).|Potential.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TTGGAACAAAAACTGAAAAAA	0.289													21	202	---	---	---	---	PASS
GALNT2	2590	broad.mit.edu	37	1	230398728	230398728	+	Silent	SNP	T	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230398728T>A	uc010pwa.1	+	13	1362	c.1290T>A	c.(1288-1290)CTT>CTA	p.L430L	GALNT2_uc010pvy.1_Silent_p.L392L|GALNT2_uc010pvz.1_RNA|GALNT2_uc001htu.2_Silent_p.L42L	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	430	Lumenal (Potential).				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				AATGGTACCTTGAAAATGTCT	0.428													28	183	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21256217	21256217	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21256217C>G	uc002red.2	-	9	1206	c.1078G>C	c.(1078-1080)GAT>CAT	p.D360H		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	360	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ACTGCTTCATCACTGAGGCCT	0.423													30	180	---	---	---	---	PASS
SPDYA	245711	broad.mit.edu	37	2	29063384	29063384	+	Intron	SNP	G	A	A	rs13006361	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29063384G>A	uc002rmj.2	+						SPDYA_uc002rmi.2_3'UTR|SPDYA_uc002rmk.2_Intron|SPDYA_uc002rml.2_3'UTR	NM_182756	NP_877433	Q5MJ70	SPDYA_HUMAN	speedy homolog A isoform 1						G1/S transition of mitotic cell cycle|multicellular organismal development|positive regulation of cell proliferation|response to DNA damage stimulus	nucleus	protein kinase binding			upper_aerodigestive_tract(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					GTTGTTTACTGAGCTCTAGTC	0.343													4	45	---	---	---	---	PASS
FAM98A	25940	broad.mit.edu	37	2	33817255	33817255	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33817255G>T	uc002rpa.1	-	3	303	c.229C>A	c.(229-231)CTT>ATT	p.L77I	FAM98A_uc010yne.1_5'UTR	NM_015475	NP_056290	Q8NCA5	FA98A_HUMAN	hypothetical protein LOC25940	77								p.L77H(1)		ovary(1)	1	all_hematologic(175;0.115)					CTCACCTCAAGCTGGAATTCT	0.383													8	100	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44201856	44201856	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44201856G>T	uc002rtr.2	-	8	964	c.906C>A	c.(904-906)GAC>GAA	p.D302E	LRPPRC_uc010yob.1_Missense_Mutation_p.D202E|LRPPRC_uc010faw.1_Missense_Mutation_p.D276E	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	302	PPR 6.				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GTAAATCACGGTCCATAAGGT	0.343													17	124	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50779891	50779891	+	Silent	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50779891C>T	uc010fbq.2	-	9	3190	c.1713G>A	c.(1711-1713)AAG>AAA	p.K571K	NRXN1_uc002rxb.3_Silent_p.K203K|NRXN1_uc002rxe.3_Silent_p.K531K|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TCTGTGGGTGCTTGGCATCTT	0.438													8	228	---	---	---	---	PASS
PAPOLG	64895	broad.mit.edu	37	2	60987314	60987314	+	Silent	SNP	T	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60987314T>C	uc002sai.2	+	2	294	c.63T>C	c.(61-63)ATT>ATC	p.I21I	PAPOLG_uc002saj.2_5'UTR|PAPOLG_uc002sak.2_5'UTR	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	21					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			ATTATGGAATTACCTCCCCAA	0.348													41	225	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138330034	138330034	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138330034G>A	uc002tva.1	+	16	3244	c.3244G>A	c.(3244-3246)GAT>AAT	p.D1082N	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GTGCAACCAGGATGAAATTCC	0.453													26	194	---	---	---	---	PASS
PMS1	5378	broad.mit.edu	37	2	190738266	190738266	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190738266A>G	uc002urh.3	+	12	3047	c.2518A>G	c.(2518-2520)AAT>GAT	p.N840D	PMS1_uc002urk.3_Missense_Mutation_p.N801D|PMS1_uc002uri.3_Missense_Mutation_p.N678D|PMS1_uc010zgc.1_Missense_Mutation_p.N664D|PMS1_uc010zgd.1_Missense_Mutation_p.N664D|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_3'UTR|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Missense_Mutation_p.N463D|PMS1_uc002urm.2_RNA	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	840					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AGGAATGGCTAATTGTCTCCC	0.303			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					25	147	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207431961	207431961	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207431961G>T	uc002vbq.2	+	15	1632	c.1409G>T	c.(1408-1410)CGA>CTA	p.R470L	ADAM23_uc010ziv.1_RNA	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	470	Peptidase M12B.|Extracellular (Potential).				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TCCCATTCTCGAAAATTTTCA	0.358													11	371	---	---	---	---	PASS
PAX3	5077	broad.mit.edu	37	2	223065882	223065882	+	3'UTR	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223065882G>T	uc002vmt.1	-	10					PAX3_uc002vmy.1_3'UTR|PAX3_uc002vmv.1_3'UTR|PAX3_uc002vmw.1_3'UTR|PAX3_uc002vmx.1_3'UTR	NM_181459	NP_852124	P23760	PAX3_HUMAN	paired box 3 isoform PAX3e						apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTAAAATGTTGCATTTGTCTT	0.368			T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						18	116	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225637922	225637922	+	Silent	SNP	C	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225637922C>G	uc010fwz.1	-	53	6395	c.6156G>C	c.(6154-6156)GTG>GTC	p.V2052V	DOCK10_uc002vob.2_Silent_p.V2046V|DOCK10_uc002voa.2_Silent_p.V708V	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	2052	DHR-2.						GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TGATCATGTCCACTTCTTCCA	0.473													37	185	---	---	---	---	PASS
STX19	415117	broad.mit.edu	37	3	93733283	93733283	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93733283T>G	uc003drh.1	-	2	1088	c.831A>C	c.(829-831)AGA>AGC	p.R277S	ARL13B_uc003drc.2_Intron|ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_001001850	NP_001001850	Q8N4C7	STX19_HUMAN	syntaxin 19	277					intracellular protein transport|vesicle-mediated transport	membrane	SNAP receptor activity				0						TGCAAGGATTTCTTTTTTTGT	0.328													50	192	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100595388	100595388	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100595388C>G	uc003dun.2	-	7	819	c.734G>C	c.(733-735)AGG>ACG	p.R245T	ABI3BP_uc003duo.2_Missense_Mutation_p.R238T|ABI3BP_uc003dup.3_Missense_Mutation_p.R238T	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	245						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						GATTAGTTTCCTTGGGACATA	0.363													83	503	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114057729	114057729	+	3'UTR	SNP	A	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114057729A>C	uc003ebi.2	-	5					ZBTB20_uc003ebj.2_3'UTR|ZBTB20_uc010hqp.2_3'UTR|ZBTB20_uc003ebk.2_3'UTR|ZBTB20_uc003ebl.2_3'UTR|ZBTB20_uc003ebm.2_3'UTR|ZBTB20_uc003ebn.2_3'UTR	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		ACGaaacaaaaacaaaaacag	0.279													4	14	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154147489	154147489	+	5'UTR	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154147489C>T	uc003faa.2	-	1						NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AATCAGATTTCATTCCTCCTA	0.378													5	23	---	---	---	---	PASS
TP63	8626	broad.mit.edu	37	3	189608582	189608582	+	Silent	SNP	T	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189608582T>C	uc003fry.2	+	13	1746	c.1657T>C	c.(1657-1659)TTA>CTA	p.L553L	TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron|TP63_uc003fsc.2_Silent_p.L459L|TP63_uc003fsd.2_Intron|TP63_uc010hzd.1_Silent_p.L374L	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	553	SAM.		L -> F (in AEC).		anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CTGCAGTTTCTTAGCGAGGTT	0.468									Hay-Wells_syndrome	HNSCC(45;0.13)			27	147	---	---	---	---	PASS
CENPC1	1060	broad.mit.edu	37	4	68384984	68384984	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68384984C>T	uc003hdd.1	-	6	751	c.568G>A	c.(568-570)GTA>ATA	p.V190I	CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA|CENPC1_uc010ihm.1_Missense_Mutation_p.V190I	NM_001812	NP_001803	Q03188	CENPC_HUMAN	centromere protein C 1	190					mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding			urinary_tract(1)|lung(1)	2						AGCATATTTACTGAATTTTCA	0.308													45	246	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85642627	85642627	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85642627A>T	uc003hpd.2	-	47	7948	c.7540T>A	c.(7540-7542)TCC>ACC	p.S2514T	WDFY3_uc003hpe.1_Missense_Mutation_p.S125T	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	2514						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCTTCTATGGAGCTGCCCTCA	0.473													33	196	---	---	---	---	PASS
NDST3	9348	broad.mit.edu	37	4	119036042	119036042	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119036042A>T	uc003ibx.2	+	4	1554	c.1151A>T	c.(1150-1152)CAT>CTT	p.H384L	NDST3_uc011cgf.1_Intron	NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	384	Lumenal (Potential).|Heparan sulfate N-deacetylase 3.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						ATGTGGAGCCATATGCAGCCC	0.443													9	265	---	---	---	---	PASS
SLC45A2	51151	broad.mit.edu	37	5	33951772	33951772	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33951772C>T	uc003jid.2	-	5	1135	c.1043G>A	c.(1042-1044)CGC>CAC	p.R348H	SLC45A2_uc003jie.2_Missense_Mutation_p.R348H|SLC45A2_uc003jif.3_Silent_p.P239P|SLC45A2_uc011coe.1_Silent_p.P239P	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN	membrane-associated transporter protein isoform	348	Extracellular (Potential).				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						GGGATCCCCGCGGTACACAAT	0.493													23	104	---	---	---	---	PASS
MAP1B	4131	broad.mit.edu	37	5	71495362	71495362	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71495362G>C	uc003kbw.3	+	5	6421	c.6180G>C	c.(6178-6180)GAG>GAC	p.E2060D	MAP1B_uc010iyw.1_Missense_Mutation_p.E2077D|MAP1B_uc010iyx.1_Missense_Mutation_p.E1934D|MAP1B_uc010iyy.1_Missense_Mutation_p.E1934D	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2060	MAP1B 10.					microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATTCCTACGAGACTTCAGACC	0.478													11	157	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89986798	89986798	+	Silent	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89986798G>A	uc003kju.2	+	31	6987	c.6891G>A	c.(6889-6891)GGG>GGA	p.G2297G	GPR98_uc003kjt.2_Intron|GPR98_uc003kjv.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2297	Calx-beta 16.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTGCCCCTGGGGAAACCATTC	0.493													21	123	---	---	---	---	PASS
TMED7-TICAM2	100302736	broad.mit.edu	37	5	114916795	114916795	+	Silent	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114916795C>T	uc003krd.2	-	4	1165	c.159G>A	c.(157-159)GAG>GAA	p.E53E	TMED7-TICAM2_uc003kre.2_Silent_p.E222E|TICAM2_uc003krc.2_Silent_p.E53E	NM_021649	NP_067681	Q86XR7	TCAM2_HUMAN	toll-like receptor adaptor molecule 2	53					I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	Golgi apparatus|intrinsic to membrane|plasma membrane	protein binding|transmembrane receptor activity				0						CTGTTGGCCCCTCTGTTGTAT	0.458													17	254	---	---	---	---	PASS
PECI	10455	broad.mit.edu	37	6	4117641	4117641	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4117641C>G	uc003mwf.2	-	9	967	c.930G>C	c.(928-930)GAG>GAC	p.E310D	C6orf201_uc003mwa.3_Intron|C6orf201_uc003mvz.3_Intron|C6orf201_uc011dhw.1_Intron|C6orf201_uc003mwb.3_Intron|PECI_uc003mwc.2_Missense_Mutation_p.E143D|PECI_uc003mwd.2_Missense_Mutation_p.E280D|PECI_uc003mwe.2_Missense_Mutation_p.E157D|PECI_uc010jnr.1_RNA	NM_206836	NP_996667	O75521	ECI2_HUMAN	peroxisomal D3,D2-enoyl-CoA isomerase isoform 2	310	ECH-like.				fatty acid metabolic process	mitochondrion|peroxisomal matrix	dodecenoyl-CoA delta-isomerase activity|fatty-acyl-CoA binding				0	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GAGCACATGCCTCTCCCGCTG	0.413													41	209	---	---	---	---	PASS
DPCR1	135656	broad.mit.edu	37	6	30919792	30919792	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30919792C>T	uc003nsg.2	+	2	3551	c.3551C>T	c.(3550-3552)CCA>CTA	p.P1184L		NM_080870	NP_543146	Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane					0						ACAAGAACCCCAGAAAAGCCT	0.478													53	305	---	---	---	---	PASS
GPR110	266977	broad.mit.edu	37	6	46977222	46977222	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46977222G>A	uc003oyt.2	-	11	2148	c.1949C>T	c.(1948-1950)ACG>ATG	p.T650M	GPR110_uc011dwl.1_Missense_Mutation_p.T338M	NM_153840	NP_722582	Q5T601	GP110_HUMAN	G-protein coupled receptor 110 isoform 1	650	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|pancreas(1)	3						AGGGTTCACCGTGGTGTCCAC	0.498													16	100	---	---	---	---	PASS
GABRR1	2569	broad.mit.edu	37	6	89910935	89910935	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89910935A>T	uc003pna.2	-	3	678	c.223T>A	c.(223-225)TCA>ACA	p.S75T	GABRR1_uc011dzv.1_Missense_Mutation_p.S52T	NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1	75	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)	AGCTGTTCTGACTTTGTCAGA	0.488													10	255	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33644941	33644941	+	3'UTR	SNP	T	C	C	rs1050719	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33644941T>C	uc003tdn.1	+	23					BBS9_uc003tdo.1_3'UTR|BBS9_uc003tdp.1_3'UTR|BBS9_uc003tdq.1_3'UTR|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_3'UTR|BBS9_uc003tds.1_3'UTR|BBS9_uc003tdt.2_RNA	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			AGGTGCTTCCTAAAGCTCACC	0.488									Bardet-Biedl_syndrome				5	114	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42003966	42003966	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42003966G>C	uc011kbh.1	-	15	4796	c.4705C>G	c.(4705-4707)CTA>GTA	p.L1569V	GLI3_uc011kbg.1_Missense_Mutation_p.L1510V	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1569					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						TCTTCCGCTAGGGAGGTCAGC	0.507									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				28	110	---	---	---	---	PASS
GRB10	2887	broad.mit.edu	37	7	50660657	50660657	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50660657C>T	uc003tpi.2	-	16	1808	c.1777G>A	c.(1777-1779)GCC>ACC	p.A593T	GRB10_uc003tph.3_Missense_Mutation_p.A535T|GRB10_uc003tpj.2_Missense_Mutation_p.A547T|GRB10_uc003tpk.2_Missense_Mutation_p.A593T|GRB10_uc010kzb.2_Missense_Mutation_p.A535T|GRB10_uc003tpl.2_Missense_Mutation_p.A587T|GRB10_uc003tpm.2_Missense_Mutation_p.A535T|GRB10_uc003tpn.2_Missense_Mutation_p.A535T	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform	593					insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					GGTCATAAGGCCACTCGGATG	0.517									Russell-Silver_syndrome				15	100	---	---	---	---	PASS
HBP1	26959	broad.mit.edu	37	7	106841613	106841613	+	Intron	SNP	A	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106841613A>G	uc003vdy.2	+						HBP1_uc011klv.1_Intron|HBP1_uc003vdz.2_Intron|HBP1_uc003veb.1_3'UTR	NM_012257	NP_036389	O60381	HBP1_HUMAN	HMG-box transcription factor 1						cell cycle arrest|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	DNA binding			skin(1)	1						TGGTTAATTTAGAATTTCATG	0.353													5	10	---	---	---	---	PASS
CNOT4	4850	broad.mit.edu	37	7	135073410	135073410	+	3'UTR	SNP	G	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135073410G>C	uc003vsv.1	-	11					CNOT4_uc003vss.2_Intron|CNOT4_uc011kpz.1_Intron|CNOT4_uc003vst.2_Intron|CNOT4_uc003vsu.1_3'UTR|CNOT4_uc011kpy.1_Intron	NM_001008225	NP_001008226	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4						nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0						TAACACGCTAGCTGTAGGCAT	0.348													6	50	---	---	---	---	PASS
LUC7L2	51631	broad.mit.edu	37	7	139097305	139097305	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139097305C>A	uc003vux.2	+	8	1162	c.788C>A	c.(787-789)TCA>TAA	p.S263*	LUC7L2_uc011kqs.1_Nonsense_Mutation_p.S260*|LUC7L2_uc011kqt.1_Nonsense_Mutation_p.S329*|LUC7L2_uc003vuy.2_Nonsense_Mutation_p.S262*|LUC7L2_uc003vuz.1_Nonsense_Mutation_p.S210*|LUC7L2_uc003vva.2_Nonsense_Mutation_p.S210*	NM_016019	NP_057103	Q9Y383	LC7L2_HUMAN	LUC7-like 2	263	Arg/Ser-rich.						enzyme binding|metal ion binding				0	Melanoma(164;0.242)					AGGTCCCGATCACACAGCAAG	0.289													56	295	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	29018273	29018273	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29018273C>T	uc003xhh.3	-	13	1440	c.1381G>A	c.(1381-1383)GAG>AAG	p.E461K	KIF13B_uc003xhj.2_Missense_Mutation_p.E358K|KIF13B_uc010lvf.1_Missense_Mutation_p.E397K	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	461					microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		ACCAGAAGCTCATTCAGAGCT	0.388													26	210	---	---	---	---	PASS
ZNF623	9831	broad.mit.edu	37	8	144733430	144733430	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144733430A>G	uc003yzd.2	+	1	1477	c.1388A>G	c.(1387-1389)TAT>TGT	p.Y463C	ZNF623_uc011lkp.1_Missense_Mutation_p.Y423C|ZNF623_uc003yzc.2_Missense_Mutation_p.Y423C	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1	463	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GTGTGCAGTTATTGTGGGAAA	0.428													13	166	---	---	---	---	PASS
UBAP2	55833	broad.mit.edu	37	9	33934653	33934653	+	Intron	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33934653G>A	uc003ztq.1	-						UBAP2_uc011loc.1_Intron|UBAP2_uc011lod.1_Intron|UBAP2_uc011loe.1_Intron|UBAP2_uc011lof.1_Intron|UBAP2_uc011log.1_Intron|UBAP2_uc003ztr.2_Intron|UBAP2_uc003zto.1_5'Flank|UBAP2_uc003ztp.1_5'UTR	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2											ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		AGCTTCACAGGAAGCCTCTCT	0.443													8	69	---	---	---	---	PASS
TRDMT1	1787	broad.mit.edu	37	10	17199558	17199558	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17199558G>C	uc001iop.2	-	8	817	c.769C>G	c.(769-771)CTT>GTT	p.L257V	TRDMT1_uc001ioq.2_Missense_Mutation_p.L233V|TRDMT1_uc001ior.2_Missense_Mutation_p.L211V|TRDMT1_uc001ios.2_Missense_Mutation_p.L186V|TRDMT1_uc009xjt.2_Missense_Mutation_p.L176V|TRDMT1_uc010qcc.1_Missense_Mutation_p.L186V|TRDMT1_uc010qcd.1_Missense_Mutation_p.L134V	NM_004412	NP_004403	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1 isoform	257					tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding			ovary(1)	1						TCATCTTCAAGAAAATCTTTT	0.378													11	310	---	---	---	---	PASS
ARMC3	219681	broad.mit.edu	37	10	23292289	23292289	+	Silent	SNP	T	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23292289T>A	uc001irm.3	+	13	1760	c.1677T>A	c.(1675-1677)ACT>ACA	p.T559T	ARMC3_uc010qcv.1_Silent_p.T559T|ARMC3_uc010qcw.1_Silent_p.T296T	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	559							binding				0						ACAGCCAGACTGGCTATTTGT	0.328													16	291	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55663098	55663098	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55663098C>A	uc001jju.1	-	26	3801	c.3406G>T	c.(3406-3408)GAT>TAT	p.D1136Y	PCDH15_uc010qhq.1_Missense_Mutation_p.D1141Y|PCDH15_uc010qhr.1_Missense_Mutation_p.D1136Y|PCDH15_uc010qhs.1_Missense_Mutation_p.D1148Y|PCDH15_uc010qht.1_Missense_Mutation_p.D1143Y|PCDH15_uc010qhu.1_Missense_Mutation_p.D1136Y|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.D1136Y|PCDH15_uc010qhw.1_Missense_Mutation_p.D1099Y|PCDH15_uc010qhx.1_Missense_Mutation_p.D1065Y|PCDH15_uc010qhy.1_Missense_Mutation_p.D1141Y|PCDH15_uc010qhz.1_Missense_Mutation_p.D1136Y|PCDH15_uc010qia.1_Missense_Mutation_p.D1114Y|PCDH15_uc010qib.1_Missense_Mutation_p.D1114Y	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1136	Cadherin 10.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TTATTTTCATCCTGAATCTCA	0.373										HNSCC(58;0.16)			43	328	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55663099	55663099	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55663099C>A	uc001jju.1	-	26	3800	c.3405G>T	c.(3403-3405)CAG>CAT	p.Q1135H	PCDH15_uc010qhq.1_Missense_Mutation_p.Q1140H|PCDH15_uc010qhr.1_Missense_Mutation_p.Q1135H|PCDH15_uc010qhs.1_Missense_Mutation_p.Q1147H|PCDH15_uc010qht.1_Missense_Mutation_p.Q1142H|PCDH15_uc010qhu.1_Missense_Mutation_p.Q1135H|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.Q1135H|PCDH15_uc010qhw.1_Missense_Mutation_p.Q1098H|PCDH15_uc010qhx.1_Missense_Mutation_p.Q1064H|PCDH15_uc010qhy.1_Missense_Mutation_p.Q1140H|PCDH15_uc010qhz.1_Missense_Mutation_p.Q1135H|PCDH15_uc010qia.1_Missense_Mutation_p.Q1113H|PCDH15_uc010qib.1_Missense_Mutation_p.Q1113H	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1135	Cadherin 10.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TATTTTCATCCTGAATCTCAA	0.368										HNSCC(58;0.16)			44	329	---	---	---	---	PASS
SLC29A3	55315	broad.mit.edu	37	10	73121852	73121852	+	Silent	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73121852G>A	uc001jrr.3	+	6	972	c.915G>A	c.(913-915)ACG>ACA	p.T305T	SLC29A3_uc001jrs.3_3'UTR|SLC29A3_uc010qjq.1_Silent_p.T159T|SLC29A3_uc001jrt.3_Silent_p.T99T|SLC29A3_uc001jru.3_Silent_p.T117T	NM_018344	NP_060814	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (nucleoside	305	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|late endosome membrane|lysosomal membrane	nucleoside transmembrane transporter activity				0						TGAAGAAGACGGCCAGCCTGG	0.592													5	46	---	---	---	---	PASS
RRP12	23223	broad.mit.edu	37	10	99156039	99156039	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99156039G>T	uc001knf.2	-	3	528	c.389C>A	c.(388-390)GCT>GAT	p.A130D	RRP12_uc010qou.1_Missense_Mutation_p.A130D|RRP12_uc009xvn.2_Missense_Mutation_p.A130D	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	130						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CTCAGTGACAGCAGCCAGAAC	0.567													13	71	---	---	---	---	PASS
RRP12	23223	broad.mit.edu	37	10	99156040	99156040	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99156040C>T	uc001knf.2	-	3	527	c.388G>A	c.(388-390)GCT>ACT	p.A130T	RRP12_uc010qou.1_Missense_Mutation_p.A130T|RRP12_uc009xvn.2_Missense_Mutation_p.A130T	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	130						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TCAGTGACAGCAGCCAGAACA	0.567													13	79	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1017718	1017718	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1017718G>T	uc001lsw.2	-	31	5134	c.5083C>A	c.(5083-5085)CAT>AAT	p.H1695N		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1695	Thr-rich.|1; truncated.|Approximate repeats.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGTGTGAATGTAGGGATGTA	0.552													22	634	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32697453	32697453	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32697453G>T	uc001mtv.2	-	8	588	c.544C>A	c.(544-546)CAT>AAT	p.H182N	CCDC73_uc001mtw.1_Missense_Mutation_p.H182N	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	182	Potential.									ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					AACTTTTCATGATTCTCTTTT	0.289													80	455	---	---	---	---	PASS
SYT12	91683	broad.mit.edu	37	11	66813240	66813240	+	Silent	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66813240G>T	uc009yrl.2	+	7	1214	c.984G>T	c.(982-984)CTG>CTT	p.L328L	SYT12_uc001oju.2_Silent_p.L328L	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII	328	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						TGTACCTGCTGCAGGATGGGA	0.587													8	34	---	---	---	---	PASS
CLEC2A	387836	broad.mit.edu	37	12	10069302	10069302	+	Missense_Mutation	SNP	C	T	T	rs526680	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10069302C>T	uc009zhc.2	-	4	459	c.407G>A	c.(406-408)GGT>GAT	p.G136D	CLEC2A_uc009zhb.2_Missense_Mutation_p.G136D	NM_001130711	NP_001124183	Q6UVW9	CLC2A_HUMAN	C-type lectin domain family 2, member A	136	Extracellular (Potential).|C-type lectin.				natural killer cell mediated cytotoxicity	integral to membrane|plasma membrane	protein homodimerization activity|receptor activity|sugar binding				0						AACTCACCAACCATTGAATGT	0.343													12	407	---	---	---	---	PASS
IRAK4	51135	broad.mit.edu	37	12	44176279	44176279	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44176279T>C	uc001rnu.3	+	10	1241	c.1111T>C	c.(1111-1113)TAC>CAC	p.Y371H	IRAK4_uc001rnt.3_Missense_Mutation_p.Y371H|IRAK4_uc001rnx.3_Missense_Mutation_p.Y247H|IRAK4_uc001rny.3_Missense_Mutation_p.Y247H|IRAK4_uc010sky.1_Missense_Mutation_p.Y247H|IRAK4_uc001rnv.3_Missense_Mutation_p.Y247H|IRAK4_uc001rnw.3_Missense_Mutation_p.Y247H	NM_001114182	NP_001107654	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	371	Protein kinase.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0	all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		ATCTGATATTTACAGCTTTGG	0.348													19	121	---	---	---	---	PASS
USP15	9958	broad.mit.edu	37	12	62798002	62798002	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62798002G>C	uc001src.1	+	22	2802	c.2793G>C	c.(2791-2793)CAG>CAC	p.Q931H	USP15_uc001srb.1_Missense_Mutation_p.Q902H	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	931					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		TCTTCTACCAGAGACAAGACA	0.378													28	136	---	---	---	---	PASS
C13orf37	440145	broad.mit.edu	37	13	73284303	73284303	+	3'UTR	SNP	C	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73284303C>A	uc001viu.2	-	3						NM_001071775	NP_001065243	Q08AG7	MZT1_HUMAN	hypothetical protein LOC440145						gamma-tubulin complex localization	centrosome|gamma-tubulin ring complex|spindle	protein binding				0						AGCCACTTTCCACTGATTTAT	0.303													4	36	---	---	---	---	PASS
C15orf33	196951	broad.mit.edu	37	15	49869034	49869034	+	Silent	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49869034G>A	uc001zxl.2	-	7	744	c.450C>T	c.(448-450)AGC>AGT	p.S150S	C15orf33_uc001zxm.2_Silent_p.S150S	NM_152647	NP_689860	Q96M60	CO033_HUMAN	hypothetical protein LOC196951	150										ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)		ATCCTGTGAAGCTGCAACCCT	0.323													12	170	---	---	---	---	PASS
USP8	9101	broad.mit.edu	37	15	50791105	50791105	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50791105C>G	uc001zym.3	+	21	3677	c.3177C>G	c.(3175-3177)CAC>CAG	p.H1059Q	USP8_uc001zyl.3_Missense_Mutation_p.H1059Q|USP8_uc001zyn.3_Missense_Mutation_p.H1059Q|USP8_uc010ufh.1_Missense_Mutation_p.H953Q|USP8_uc001zyp.3_Missense_Mutation_p.H226Q	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	1059					cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		CACAGAATCACTACGGTGGGC	0.358													22	113	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21128547	21128547	+	Silent	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21128547C>T	uc010vbe.1	-	12	1791	c.1791G>A	c.(1789-1791)CAG>CAA	p.Q597Q	DNAH3_uc002die.2_Silent_p.Q537Q	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	597	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CTTGATTTTTCTGAAATACCT	0.348													9	280	---	---	---	---	PASS
POLR3E	55718	broad.mit.edu	37	16	22330177	22330177	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22330177G>A	uc002dkk.2	+	13	1052	c.896G>A	c.(895-897)AGC>AAC	p.S299N	POLR3E_uc002dkj.1_Missense_Mutation_p.S299N|POLR3E_uc002dkm.2_Missense_Mutation_p.S263N|POLR3E_uc010vbr.1_Missense_Mutation_p.S299N|POLR3E_uc002dkl.2_Missense_Mutation_p.S299N|POLR3E_uc010vbs.1_Missense_Mutation_p.S263N|POLR3E_uc010vbt.1_Missense_Mutation_p.S243N	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E	299					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		AACTTGATGAGCCTCCTGGGC	0.597													6	110	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61689474	61689474	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61689474G>C	uc002eog.1	-	11	2058	c.1806C>G	c.(1804-1806)GAC>GAG	p.D602E		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	602	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GGACGACACCGTCATTGCTGC	0.448													10	132	---	---	---	---	PASS
CDH5	1003	broad.mit.edu	37	16	66430033	66430033	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66430033A>T	uc002eom.3	+	8	1445	c.1289A>T	c.(1288-1290)GAG>GTG	p.E430V		NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	430	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		ATTTACAATGAGAAAGAACTG	0.522													21	86	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268081	70268081	+	RNA	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268081G>A	uc010cfp.1	-	3		c.334C>T								Homo sapiens cDNA, FLJ98908.																		TCTTACTGTTGGCTAAAAGGC	0.373													3	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268158	70268158	+	RNA	SNP	A	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268158A>C	uc010cfp.1	-	3		c.257T>G								Homo sapiens cDNA, FLJ98908.																		TTCTTCATTAAAACAGCTACT	0.333													3	46	---	---	---	---	PASS
PIRT	644139	broad.mit.edu	37	17	10728777	10728777	+	Silent	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10728777G>A	uc010col.2	-	2	481	c.186C>T	c.(184-186)GGC>GGT	p.G62G		NM_001101387	NP_001094857	P0C851	PIRT_HUMAN	phosphoinositide-interacting regulator of	62	Helical; (Potential).					integral to membrane				ovary(1)	1						GGATGGCACCGCCCACTGACA	0.567													5	21	---	---	---	---	PASS
ULK2	9706	broad.mit.edu	37	17	19705159	19705159	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19705159C>T	uc002gwm.3	-	16	1881	c.1372G>A	c.(1372-1374)GAC>AAC	p.D458N	ULK2_uc002gwn.2_Missense_Mutation_p.D458N	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	458					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TGTGCTGTGTCTGCTGGTACT	0.498													13	99	---	---	---	---	PASS
TADA2A	6871	broad.mit.edu	37	17	35804809	35804809	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35804809T>G	uc002hnt.2	+	8	700	c.543T>G	c.(541-543)AAT>AAG	p.N181K	TADA2A_uc002hnu.1_Missense_Mutation_p.N181K|TADA2A_uc002hnv.2_Missense_Mutation_p.N181K|TADA2A_uc010wdd.1_Missense_Mutation_p.N181K|TADA2A_uc002hnw.2_Missense_Mutation_p.N80K|TADA2A_uc010cvb.2_5'UTR	NM_001488	NP_001479	O75478	TAD2A_HUMAN	transcriptional adaptor 2A isoform a	181					histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4						AATTTGACAATTATGCAGAAT	0.338													71	415	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	39566058	39566058	+	RNA	SNP	A	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39566058A>C	uc002hwo.1	+	2		c.1479A>C								Homo sapiens cDNA FLJ41849 fis, clone NT2RI3003409.																		TCCCCATCCAACCCCAACTCT	0.512													7	14	---	---	---	---	PASS
MYST2	11143	broad.mit.edu	37	17	47904994	47904994	+	3'UTR	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47904994G>T	uc002ipm.2	+	15					MYST2_uc010wma.1_3'UTR|MYST2_uc010wmb.1_3'UTR|MYST2_uc010wmc.1_3'UTR|MYST2_uc010wmd.1_3'UTR|MYST2_uc010wme.1_3'UTR|MYST2_uc010wmf.1_3'UTR|MYST2_uc010wmg.1_3'UTR	NM_007067	NP_008998	O95251	MYST2_HUMAN	MYST histone acetyltransferase 2						DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TCCCCCTCAGGACTGTCCTGG	0.522													3	18	---	---	---	---	PASS
SAMD14	201191	broad.mit.edu	37	17	48191586	48191586	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48191586A>G	uc002iqg.2	-	8	1206	c.907T>C	c.(907-909)TAC>CAC	p.Y303H	SAMD14_uc002iqd.2_Missense_Mutation_p.Y86H|SAMD14_uc002iqe.2_Missense_Mutation_p.Y86H|SAMD14_uc002iqf.2_Missense_Mutation_p.Y331H	NM_174920	NP_777580	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	303											0						TGGTAGGGGTAAGAACATTTG	0.592													4	33	---	---	---	---	PASS
KIF19	124602	broad.mit.edu	37	17	72342609	72342609	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72342609G>T	uc002jkm.3	+	8	1008	c.870G>T	c.(868-870)AAG>AAT	p.K290N	KIF19_uc002jkj.2_Missense_Mutation_p.K290N|KIF19_uc002jkk.2_Missense_Mutation_p.K248N|KIF19_uc002jkl.2_Missense_Mutation_p.K248N	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	290					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						TGAGCGACAAGGGTAGCAACA	0.597													3	34	---	---	---	---	PASS
STX10	8677	broad.mit.edu	37	19	13260325	13260325	+	Silent	SNP	T	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13260325T>C	uc010xnb.1	-	3	288	c.288A>G	c.(286-288)CGA>CGG	p.R96R	STX10_uc002mwn.2_5'UTR|STX10_uc002mwo.2_5'UTR|STX10_uc010xna.1_Intron|STX10_uc010xnc.1_Intron|IER2_uc002mwr.2_5'Flank	NM_003765	NP_003756	O60499	STX10_HUMAN	syntaxin 10	96	Cytoplasmic (Potential).				Golgi vesicle transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane	SNAP receptor activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			GGACTGCCTCTCGCATCCGCT	0.488													5	57	---	---	---	---	PASS
PDE4C	5143	broad.mit.edu	37	19	18328978	18328978	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18328978G>T	uc010xqc.1	-	11	1791	c.1311C>A	c.(1309-1311)AAC>AAA	p.N437K	PDE4C_uc002nik.3_Missense_Mutation_p.N437K|PDE4C_uc002nil.3_Missense_Mutation_p.N437K|PDE4C_uc002nif.3_Missense_Mutation_p.N206K|PDE4C_uc002nig.3_Missense_Mutation_p.N152K|PDE4C_uc002nih.3_Missense_Mutation_p.N207K|PDE4C_uc010ebk.2_Missense_Mutation_p.N331K|PDE4C_uc002nii.3_Missense_Mutation_p.N405K|PDE4C_uc010ebl.2_Missense_Mutation_p.N151K|PDE4C_uc010xqd.1_Missense_Mutation_p.N206K	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2	437					signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)	TCAGAAACTGGTTGGAGACCC	0.577													14	74	---	---	---	---	PASS
ZNF792	126375	broad.mit.edu	37	19	35449369	35449369	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35449369C>T	uc002nxh.1	-	4	1777	c.1390G>A	c.(1390-1392)GAC>AAC	p.D464N		NM_175872	NP_787068	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	464	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TTCATGAGGTCAGAGCTTCGG	0.522													9	38	---	---	---	---	PASS
HNRNPUL1	11100	broad.mit.edu	37	19	41811645	41811645	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41811645C>G	uc002oqb.3	+	14	2616	c.2327C>G	c.(2326-2328)CCT>CGT	p.P776R	CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Missense_Mutation_p.P676R|HNRNPUL1_uc002oqa.3_Missense_Mutation_p.P686R|HNRNPUL1_uc010ehm.2_Intron|HNRNPUL1_uc002oqc.3_Missense_Mutation_p.P672R|HNRNPUL1_uc002oqe.3_Missense_Mutation_p.P85R|HNRNPUL1_uc002oqd.3_Missense_Mutation_p.P676R|HNRNPUL1_uc010ehn.2_Missense_Mutation_p.P686R|HNRNPUL1_uc010eho.2_Missense_Mutation_p.P676R|HNRNPUL1_uc010xvy.1_Missense_Mutation_p.P676R|HNRNPUL1_uc010ehp.2_Intron|HNRNPUL1_uc002oqf.3_Missense_Mutation_p.P310R	NM_007040	NP_008971	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	776	Tyr-rich.|Pro-rich.|Necessary for interaction with TP53.				nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2						GCCCCACCGCCTCCACCTCCA	0.612													6	20	---	---	---	---	PASS
POLD1	5424	broad.mit.edu	37	19	50906786	50906786	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50906786G>A	uc002psb.3	+	10	1230	c.1174G>A	c.(1174-1176)GTG>ATG	p.V392M	POLD1_uc002psc.3_Missense_Mutation_p.V392M|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Missense_Mutation_p.V392M	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	392					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		GGACCCCGACGTGATCACCGG	0.607								DNA_polymerases_(catalytic_subunits)					7	50	---	---	---	---	PASS
MYBPC2	4606	broad.mit.edu	37	19	50939919	50939919	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50939919C>T	uc002psf.2	+	5	442	c.391C>T	c.(391-393)CGT>TGT	p.R131C		NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	131	Ig-like C2-type 1.				cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		ACTGGGGGACCGTGGGTATTA	0.622													7	32	---	---	---	---	PASS
SIGLEC8	27181	broad.mit.edu	37	19	51958703	51958703	+	Silent	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51958703G>A	uc002pwt.2	-	4	1087	c.1020C>T	c.(1018-1020)TCC>TCT	p.S340S	SIGLEC8_uc010yda.1_Silent_p.S231S|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Silent_p.S247S	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	340	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		AGAGGCTCAGGGAAATGTGCT	0.632													3	19	---	---	---	---	PASS
VN1R2	317701	broad.mit.edu	37	19	53762336	53762336	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53762336C>A	uc002qbi.2	+	1	792	c.708C>A	c.(706-708)AGC>AGA	p.S236R		NM_173856	NP_776255	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	236	Extracellular (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0				GBM - Glioblastoma multiforme(134;0.00301)		GCAAATGGAGCAACAACAACA	0.423													12	59	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	9769054	9769054	+	RNA	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9769054G>A	uc011abu.1	+	10		c.1029G>A								Homo sapiens, clone IMAGE:4720764, mRNA.																		TTGATAACAAGAACAGCATTC	0.333													2	5	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11026737	11026737	+	3'UTR	SNP	C	G	G	rs7278465		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11026737C>G	uc002yit.1	-	8					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGCAATACAACAGCTCCGATT	0.463													3	11	---	---	---	---	PASS
TMEM50B	757	broad.mit.edu	37	21	34841149	34841149	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34841149C>T	uc002yrt.1	-	2	222	c.44G>A	c.(43-45)TGT>TAT	p.C15Y	TMEM50B_uc002yrs.1_RNA|TMEM50B_uc010gmb.1_RNA	NM_006134	NP_006125	P56557	TM50B_HUMAN	transmembrane protein 50B	15						endoplasmic reticulum|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CCAGTCAATACATTCACATTC	0.383													39	205	---	---	---	---	PASS
PRDM15	63977	broad.mit.edu	37	21	43230601	43230601	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43230601T>A	uc002yzq.1	-	28	3770	c.3659A>T	c.(3658-3660)GAC>GTC	p.D1220V	PRDM15_uc002yzo.2_Missense_Mutation_p.D891V|PRDM15_uc002yzp.2_Missense_Mutation_p.D911V|PRDM15_uc002yzr.1_Missense_Mutation_p.D911V	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	1220					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTCCACCTTGTCGTGTGTGAG	0.617													4	16	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42609019	42609019	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42609019C>A	uc003bcj.1	-	1	2427	c.2293G>T	c.(2293-2295)GAC>TAC	p.D765Y	TCF20_uc003bck.1_Missense_Mutation_p.D765Y|TCF20_uc003bnt.2_Missense_Mutation_p.D765Y	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	765					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						TATCTCCTGTCAGGGTGGTGG	0.483													27	118	---	---	---	---	PASS
FAM118A	55007	broad.mit.edu	37	22	45726594	45726594	+	Silent	SNP	T	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45726594T>C	uc003bfz.3	+	6	1249	c.633T>C	c.(631-633)ACT>ACC	p.T211T	FAM118A_uc003bga.3_Silent_p.T211T|FAM118A_uc011aqr.1_Silent_p.T29T	NM_001104595	NP_001098065	Q9NWS6	F118A_HUMAN	hypothetical protein LOC55007	211						integral to membrane					0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		AAGACGTCACTCAAGACGCAG	0.592													11	49	---	---	---	---	PASS
FAM118A	55007	broad.mit.edu	37	22	45726595	45726595	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45726595C>T	uc003bfz.3	+	6	1250	c.634C>T	c.(634-636)CAA>TAA	p.Q212*	FAM118A_uc003bga.3_Nonsense_Mutation_p.Q212*|FAM118A_uc011aqr.1_Nonsense_Mutation_p.Q30*	NM_001104595	NP_001098065	Q9NWS6	F118A_HUMAN	hypothetical protein LOC55007	212						integral to membrane					0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		AGACGTCACTCAAGACGCAGA	0.587													9	48	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46725168	46725168	+	Intron	SNP	C	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46725168C>T	uc011aqy.1	+						GTSE1_uc011aqz.1_Intron|GTSE1_uc003bhn.2_RNA|uc011ara.1_5'Flank|uc003bho.3_5'Flank	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CGCCAGCCCACCTGGAACATG	0.557													8	37	---	---	---	---	PASS
ZCCHC5	203430	broad.mit.edu	37	X	77913714	77913714	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77913714C>A	uc004edc.1	-	2	500	c.204G>T	c.(202-204)ATG>ATT	p.M68I		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	68	Pro-rich.						nucleic acid binding|zinc ion binding			ovary(1)	1						CTGGGGGATTCATGTGCTCTG	0.587													8	13	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130409967	130409967	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130409967T>C	uc004ewd.2	-	15	3102	c.2864A>G	c.(2863-2865)TAT>TGT	p.Y955C	IGSF1_uc004ewe.3_Missense_Mutation_p.Y949C|IGSF1_uc004ewf.2_Missense_Mutation_p.Y935C	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	955	Extracellular (Potential).|Ig-like C2-type 9.				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						CATACTGAGATATGACCCCCT	0.502													4	7	---	---	---	---	PASS
GPR101	83550	broad.mit.edu	37	X	136112591	136112591	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136112591A>T	uc011mwh.1	-	1	1243	c.1243T>A	c.(1243-1245)TAC>AAC	p.Y415N		NM_054021	NP_473362	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	415	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					AAAAAGCAGTAGGGCCCCAGG	0.517													20	61	---	---	---	---	PASS
HCFC1	3054	broad.mit.edu	37	X	153222975	153222975	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153222975G>A	uc004fjp.2	-	13	2671	c.2143C>T	c.(2143-2145)CCC>TCC	p.P715S		NM_005334	NP_005325	P51610	HCFC1_HUMAN	host cell factor 1	715	Interaction with SIN3A.				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)	2	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCTGGCAGGGGCCCTTTGGTC	0.637													5	33	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16900067	16900068	+	Intron	INS	-	G	G	rs5772689		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16900067_16900068insG	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ACATGAAACACACATGATAGAT	0.243													5	3	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16900070	16900070	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16900070delA	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGAAACACACATGATAGATAA	0.234													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30760814	30760814	+	IGR	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30760814delC								None (None upstream) : MATN1 (423312 downstream)																							gaaacatgctccctcgccaac	0.060													4	2	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45392004	45392005	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45392004_45392005insT	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					ttttttaccacTTTTTTTTTTA	0.203													6	3	---	---	---	---	
NFIA	4774	broad.mit.edu	37	1	61657127	61657127	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61657127delT	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						TCTAGCCTGGTTTTTTTTTGC	0.468													4	2	---	---	---	---	
ANKRD13C	81573	broad.mit.edu	37	1	70728658	70728659	+	Intron	INS	-	AG	AG	rs150975244	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70728658_70728659insAG	uc001dex.3	-						ANKRD13C_uc009wbk.2_Intron	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C						protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						CAAGAACCAGAAGAATTCAAAT	0.302													6	4	---	---	---	---	
AK5	26289	broad.mit.edu	37	1	77806435	77806435	+	Intron	DEL	A	-	-	rs5775390		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77806435delA	uc001dhn.2	+						AK5_uc001dho.2_Intron	NM_174858	NP_777283	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1						ATGtttttttaaaaaaacttt	0.269													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	102621787	102621787	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102621787delA								OLFM3 (158997 upstream) : COL11A1 (720237 downstream)																							ggtctatttgaaaaaaaaata	0.000													4	2	---	---	---	---	
MAGI3	260425	broad.mit.edu	37	1	113963632	113963632	+	Intron	DEL	T	-	-	rs111998040		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113963632delT	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGATTAAAACTTTTTTTTTTT	0.303													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144528213	144528214	+	Intron	INS	-	CACT	CACT	rs148652392		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144528213_144528214insCACT	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						gcccaatgatacactgatctat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148898509	148898510	+	Intron	DEL	TG	-	-	rs150514410	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148898509_148898510delTG	uc009wkv.1	+											Homo sapiens cDNA, FLJ17483.																		ttttaccccatgttttttttat	0.000													4	2	---	---	---	---	
ATF6	22926	broad.mit.edu	37	1	161882353	161882353	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161882353delT	uc001gbr.2	+							NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			AAAAAATTACTACATCCCTAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	162460830	162460830	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162460830delA								SH2D1B (78902 upstream) : UHMK1 (6134 downstream)																							ATGCCACCTTAATGGGAAAGT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	163235927	163235928	+	IGR	INS	-	CT	CT	rs148816018	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163235927_163235928insCT								RGS5 (63055 upstream) : NUF2 (55795 downstream)																							gggatctgctcctgtttttatt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	173270943	173270943	+	Intron	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173270943delC	uc001gix.1	-											Homo sapiens cDNA FLJ45305 fis, clone BRHIP3004193.																		TCTGCTACCACCCATGCACCC	0.398													4	2	---	---	---	---	
ENAH	55740	broad.mit.edu	37	1	225758061	225758061	+	Intron	DEL	G	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225758061delG	uc001hpc.1	-						ENAH_uc001hpd.1_Intron	NM_001008493	NP_001008493	Q8N8S7	ENAH_HUMAN	enabled homolog isoform a						axon guidance|intracellular transport|T cell receptor signaling pathway	cytosol|filopodium|focal adhesion|lamellipodium|synapse	actin binding|SH3 domain binding|WW domain binding			ovary(1)|skin(1)	2	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		tgaacaacatgggaactgcgc	0.279													6	3	---	---	---	---	
CDC42BPA	8476	broad.mit.edu	37	1	227296111	227296111	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227296111delT	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				gcattccaggttttttttttc	0.000													6	3	---	---	---	---	
ARV1	64801	broad.mit.edu	37	1	231128090	231128090	+	Intron	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231128090delC	uc009xfl.1	+						ARV1_uc001huh.2_Intron	NM_022786	NP_073623	Q9H2C2	ARV1_HUMAN	ARV1 homolog						sphingolipid metabolic process	integral to membrane				breast(2)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)		gaatgcctgtccccctgatgc	0.000													4	2	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	2215817	2215817	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2215817delT	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		agcctctgcattTCAGACTGT	0.219													4	2	---	---	---	---	
GALNT14	79623	broad.mit.edu	37	2	31246963	31246964	+	Intron	INS	-	A	A	rs143799487	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31246963_31246964insA	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					cagccttgaacaaggcatcacc	0.000													8	11	---	---	---	---	
XDH	7498	broad.mit.edu	37	2	31567840	31567840	+	Intron	DEL	C	-	-	rs68180352		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31567840delC	uc002rnv.1	-							NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	tgagttgtctccccagcccag	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37966211	37966212	+	IGR	INS	-	AGC	AGC	rs149422408	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37966211_37966212insAGC								CDC42EP3 (66885 upstream) : FAM82A1 (186250 downstream)																							CAGCGTCTCAGAGCTCTGCTTA	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	39713568	39713568	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39713568delT	uc002rrq.2	+						uc002rrr.1_Intron					Homo sapiens cDNA FLJ33477 fis, clone BRAMY2002604.																		CCCAATCCCCTTTGCCTGTTT	0.502													4	2	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	45880795	45880795	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45880795delT	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			ACCTTACATATTTTTTTCAAG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	56386062	56386062	+	Intron	DEL	A	-	-	rs111318970		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56386062delA	uc002rzk.2	+											Homo sapiens, clone IMAGE:3873411, mRNA.																		cagcttggggaaaaaaaaaaa	0.000													6	5	---	---	---	---	
TBC1D8	11138	broad.mit.edu	37	2	101624051	101624052	+	3'UTR	INS	-	GTAA	GTAA			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101624051_101624052insGTAA	uc010fiv.2	-	20					RPL31_uc010yvu.1_Intron|RPL31_uc010yvv.1_Intron|RPL31_uc010fiu.1_Intron|TBC1D8_uc002tau.3_3'UTR	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8						blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						CGGTAAAAATTGTAAGTTGGCA	0.431													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	107249015	107249015	+	IGR	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107249015delC								RGPD3 (164214 upstream) : ST6GAL2 (169043 downstream)																							gctgtataaacccccaatttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	150982580	150982580	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150982580delA								MMADHC (538250 upstream) : RND3 (342132 downstream)																							CTTATGAGACAAAAAAAAAAT	0.463													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156532796	156532797	+	IGR	DEL	TG	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156532796_156532797delTG								KCNJ3 (819782 upstream) : NR4A2 (648149 downstream)																							TGTGGGCTTATGTGTGTGTGTC	0.173													4	3	---	---	---	---	
SCN9A	6335	broad.mit.edu	37	2	167054934	167054935	+	3'UTR	INS	-	AATC	AATC	rs143461219	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167054934_167054935insAATC	uc010fpl.2	-	27					uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	CCAAAAAACTGAATCACTTTTG	0.332													10	6	---	---	---	---	
EPHA4	2043	broad.mit.edu	37	2	222317431	222317432	+	Intron	INS	-	T	T	rs142389648	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222317431_222317432insT	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGGAAGTGACATTTTTTTTTTA	0.421													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	222809530	222809530	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222809530delA								EPHA4 (370608 upstream) : PAX3 (255077 downstream)																							TCTTTGATACAAAAAAAAAAA	0.294													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235490736	235490736	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235490736delT								ARL4C (85043 upstream) : SH3BP4 (369892 downstream)																							CTTGACTAACTTTTTTTTTTC	0.418													6	6	---	---	---	---	
ARL13B	200894	broad.mit.edu	37	3	93717285	93717286	+	Intron	DEL	TT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93717285_93717286delTT	uc003drc.2	+						ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1								GTP binding				0						CCCCATTCTCTTTTTGTCCTTC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112794702	112794702	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112794702delA								C3orf17 (56147 upstream) : BOC (135710 downstream)																							cacacacaataaaaagagaaa	0.000													4	2	---	---	---	---	
C3orf1	51300	broad.mit.edu	37	3	119232801	119232802	+	Intron	INS	-	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119232801_119232802insA	uc003ecn.2	+						C3orf1_uc003eco.2_Intron|C3orf1_uc003ecp.2_Intron	NM_016589	NP_057673	Q9NPL8	TIDC1_HUMAN	hypothetical protein LOC51300							integral to membrane|mitochondrial inner membrane	protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.186)		CAATAAATAACATTGACTCAAT	0.287													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	122063256	122063256	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122063256delA								CSTA (2443 upstream) : CCDC58 (15181 downstream)																							accctgtctcaaaaaaaaaga	0.000													4	2	---	---	---	---	
SLC41A3	54946	broad.mit.edu	37	3	125774693	125774693	+	Intron	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125774693delC	uc003eij.2	-						SLC41A3_uc003eii.2_Intron|SLC41A3_uc003eil.2_Intron|SLC41A3_uc003eik.2_Intron|SLC41A3_uc011bkh.1_Intron|SLC41A3_uc010hsd.1_Intron	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3 isoform 1							integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(114;0.167)		CAAACCTTGTCCTTTTTTACC	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	136899816	136899818	+	IGR	DEL	CAT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136899816_136899818delCAT								IL20RB (169896 upstream) : SOX14 (583761 downstream)																							CTATGGtaaacatcatcatttaa	0.128													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	141589537	141589537	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141589537delA								GRK7 (53647 upstream) : ATP1B3 (5933 downstream)																							gtaaaatcagaaggttatggt	0.000													4	2	---	---	---	---	
DLG1	1739	broad.mit.edu	37	3	196864850	196864851	+	Intron	INS	-	A	A	rs149558826	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196864850_196864851insA	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron|DLG1_uc010ian.2_Intron	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		ctcaaaaaaacaaacaaaaaaa	0.144													5	4	---	---	---	---	
JAKMIP1	152789	broad.mit.edu	37	4	6191930	6191930	+	Intron	DEL	G	-	-	rs67203558		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6191930delG	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						AGCAGGCCATGGGGGGGGCTG	0.368													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13252001	13252002	+	IGR	DEL	AC	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13252001_13252002delAC								None (None upstream) : HSP90AB2P (83035 downstream)																							ATGAacacatacacacacacat	0.243													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21001932	21001932	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21001932delA	uc003gqf.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_147183	NP_671712	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 4							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				tattctacagaaaaaaaagat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	24382004	24382004	+	IGR	DEL	G	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24382004delG								PPARGC1A (490304 upstream) : MIR573 (139811 downstream)																							gagcttcactggagcaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	27250348	27250349	+	IGR	DEL	TC	-	-	rs3069149		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27250348_27250349delTC								STIM2 (224540 upstream) : None (None downstream)																							tcttttttcatctctctctctc	0.000													3	6	---	---	---	---	
RELL1	768211	broad.mit.edu	37	4	37641143	37641144	+	Intron	INS	-	A	A	rs111790394		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37641143_37641144insA	uc003gsz.2	-						RELL1_uc010ifc.2_Intron	NM_001085399	NP_001078868	Q8IUW5	RELL1_HUMAN	receptor expressed in lymphoid tissues like 1							cytoplasm|integral to membrane|microtubule cytoskeleton|plasma membrane					0						TCAACAAAAGCAAAAAAAAAAA	0.376													4	2	---	---	---	---	
GDEP	118425	broad.mit.edu	37	4	80781058	80781058	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80781058delA	uc003hlw.3	+							NR_026555				Homo sapiens GDEP mRNA, complete cds.												0						CCCATTGGTTAAAAAAAAAAA	0.353													2	4	---	---	---	---	
FAM190A	401145	broad.mit.edu	37	4	91823608	91823609	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91823608_91823609insT	uc003hsv.3	+						FAM190A_uc010ikv.2_Intron|FAM190A_uc003hsx.2_Intron	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2						tggatggaagatttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	113034623	113034623	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113034623delT								None (None upstream) : C4orf32 (31930 downstream)																							ctggacacaatttaagttctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	135832356	135832356	+	IGR	DEL	C	-	-	rs74594213		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135832356delC								PABPC4L (709453 upstream) : None (None downstream)																							TGTTTTTTTTCCCCCAAATCC	0.358													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	161279857	161279857	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161279857delT								RAPGEF2 (998558 upstream) : None (None downstream)																							CAGTCATCTATTTTTTTTTCC	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	181493366	181493366	+	IGR	DEL	A	-	-	rs72046326		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181493366delA								None (None upstream) : None (None downstream)																							GTGTGAAGAGAAAAAAAAAAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190549436	190549437	+	IGR	INS	-	C	C	rs139581965		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190549436_190549437insC								None (None upstream) : FRG1 (312537 downstream)																							CTCTACTCAGACCCCTCATCGC	0.307													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3960705	3960705	+	IGR	DEL	T	-	-	rs35443358		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3960705delT								IRX1 (359189 upstream) : None (None downstream)																							AGATATTCTCTTTTTTTTTTT	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28290270	28290270	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28290270delT								None (None upstream) : None (None downstream)																							GTTTAGGACATTCCCTCTTCT	0.333													4	2	---	---	---	---	
NNT	23530	broad.mit.edu	37	5	43676068	43676068	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43676068delT	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	TCATTGGTAATTTTTGGGCCC	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	128607412	128607412	+	IGR	DEL	T	-	-	rs139591937		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128607412delT								ISOC1 (157695 upstream) : ADAMTS19 (188691 downstream)																							ttttcttttcttttttttttt	0.368													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134361303	134361303	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134361303delA								CATSPER3 (13918 upstream) : PITX1 (2122 downstream)																							gcgtgcaggtaaaggggctca	0.259													4	2	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137346440	137346441	+	Intron	DEL	GG	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137346440_137346441delGG	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						ATAAACAATAGGAAAAGAAACA	0.317													4	2	---	---	---	---	
BRD8	10902	broad.mit.edu	37	5	137496058	137496058	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137496058delT	uc003lcf.1	-						BRD8_uc003lcc.1_Intron|BRD8_uc011cyl.1_Intron|BRD8_uc003lcg.2_Intron|BRD8_uc003lci.2_Intron|BRD8_uc003lch.2_Intron|BRD8_uc011cym.1_Intron|BRD8_uc010jer.1_Intron|BRD8_uc011cyn.1_Intron	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2						cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CAGCCCTAACTTTTTTTTGCT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	139431560	139431561	+	IGR	DEL	AC	-	-	rs68026708		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139431560_139431561delAC								NRG2 (8681 upstream) : PURA (62147 downstream)																							CTTGATTCTTacacacacacac	0.351													4	2	---	---	---	---	
TCERG1	10915	broad.mit.edu	37	5	145889056	145889056	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145889056delT	uc003lob.2	+						TCERG1_uc003loc.2_Intron	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATACATACCTTTTTTTTTTT	0.299													3	3	---	---	---	---	
ATP10B	23120	broad.mit.edu	37	5	160174822	160174823	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160174822_160174823insT	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTGTCTTTCATTTTTTGTTCT	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	160328350	160328351	+	IGR	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160328350_160328351insT								ATP10B (49131 upstream) : LOC285629 (30437 downstream)																							TCCCCACTTGATTTTGAATCAG	0.287													4	2	---	---	---	---	
FGF18	8817	broad.mit.edu	37	5	170850691	170850691	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170850691delT	uc003mbk.2	+							NM_003862	NP_003853	O76093	FGF18_HUMAN	fibroblast growth factor 18 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GTTTAGACCCTTTCTTTAAGC	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	1324740	1324741	+	IGR	INS	-	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1324740_1324741insC								FOXQ1 (9748 upstream) : FOXF2 (65328 downstream)																							TTAAAGGAGATACAGCTTTATT	0.431													4	2	---	---	---	---	
TFAP2A	7020	broad.mit.edu	37	6	10418542	10418542	+	Intron	DEL	G	-	-	rs9350396		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10418542delG	uc003myt.2	-						TFAP2A_uc011dii.1_Intron	NM_001042425	NP_001035890	P05549	AP2A_HUMAN	transcription factor AP-2 alpha isoform c						ectoderm development|positive regulation of bone mineralization|positive regulation of tooth mineralization|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	centrosome|Golgi apparatus|nucleus	chromatin binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GCACTTCTCAGAACTTTACTT	0.408													4	2	---	---	---	---	
E2F3	1871	broad.mit.edu	37	6	20425462	20425462	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20425462delT	uc003nda.2	+						E2F3_uc003ncz.2_Intron	NM_001949	NP_001940	O00716	E2F3_HUMAN	E2F transcription factor 3						G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			TACCCAGTGCTTTTTTTTAAT	0.433													4	2	---	---	---	---	
ACOT13	55856	broad.mit.edu	37	6	24667828	24667828	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24667828delT	uc003nek.2	+						TDP2_uc003nei.2_5'Flank|TDP2_uc003nej.2_5'Flank|TDP2_uc010jpu.1_5'Flank|ACOT13_uc010jpv.2_Intron	NM_018473	NP_060943	Q9NPJ3	ACO13_HUMAN	acyl-CoA thioesterase 13 isoform 1						protein homotetramerization	mitochondrion	acyl-CoA thioesterase activity				0						TGGGAGGGACTTTGGAGTTTG	0.448													4	2	---	---	---	---	
SCAND3	114821	broad.mit.edu	37	6	28548811	28548811	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28548811delT	uc003nlo.2	-							NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3						DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CTGGGTTTGATTTTTTTTAAC	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	71084595	71084596	+	IGR	DEL	TG	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71084595_71084596delTG								COL9A1 (71809 upstream) : FAM135A (38511 downstream)																							gcctagctgttggaggaagaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	80584518	80584518	+	IGR	DEL	G	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80584518delG								RNY4 (132849 upstream) : ELOVL4 (40018 downstream)																							atttggtgctggggtgctgag	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85139228	85139228	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85139228delT								KIAA1009 (201893 upstream) : TBX18 (257853 downstream)																							GGAGAATTTCTTTTACCATTG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95969164	95969165	+	IGR	INS	-	T	T	rs143142974	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95969164_95969165insT								None (None upstream) : MANEA (56248 downstream)																							CAGTGAAGGGATTTTTTTTCCT	0.411													3	4	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	102190858	102190858	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102190858delT	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	ttatttttggtttaGAGAGAT	0.015													4	2	---	---	---	---	
NT5DC1	221294	broad.mit.edu	37	6	116526762	116526763	+	Intron	INS	-	G	G	rs140260731	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116526762_116526763insG	uc003pwj.2	+						NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_152729	NP_689942	Q5TFE4	NT5D1_HUMAN	5'-nucleotidase, cytosolic II-like 1 protein								hydrolase activity|metal ion binding				0		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)		TGGAATAAATTGGGGGGGAAAA	0.376													3	4	---	---	---	---	
C6orf58	352999	broad.mit.edu	37	6	127902599	127902599	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127902599delA	uc003qbh.2	+							NM_001010905	NP_001010905	Q6P5S2	CF058_HUMAN	hypothetical protein LOC352999 precursor							extracellular region					0				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		GATCAGGCTTAAAAAAGTGTT	0.274													4	2	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151286429	151286429	+	Intron	DEL	T	-	-	rs1625684	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151286429delT	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		AAAAAAAAAATTTTTAAGTGT	0.199													5	5	---	---	---	---	
SLC22A2	6582	broad.mit.edu	37	6	160663652	160663653	+	Intron	INS	-	T	T	rs149830895	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160663652_160663653insT	uc003qtf.2	-						SLC22A2_uc003qte.1_Intron	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2						body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		taaaaaagatattttttttaga	0.158													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22106191	22106192	+	IGR	DEL	TG	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22106191_22106192delTG								CDCA7L (120649 upstream) : RAPGEF5 (51717 downstream)																							TTCATGCTTTTGTGTGTGTGTG	0.475													4	2	---	---	---	---	
OSBPL3	26031	broad.mit.edu	37	7	24888444	24888444	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24888444delA	uc003sxf.2	-						OSBPL3_uc003sxd.2_Intron|OSBPL3_uc003sxe.2_Intron|OSBPL3_uc003sxg.2_Intron|OSBPL3_uc003sxh.2_Intron|OSBPL3_uc003sxi.2_Intron|OSBPL3_uc003sxj.1_Intron|OSBPL3_uc003sxk.1_Intron	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform						lipid transport		lipid binding|protein binding			skin(1)	1						ACAGAAATATAAAAAAAAAAG	0.408													4	2	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	32675073	32675073	+	Intron	DEL	A	-	-	rs10707407		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32675073delA	uc011kai.1	+						uc003tcw.2_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						GTTATAACACAAACCTAAACA	0.299													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41019750	41019751	+	IGR	DEL	AG	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41019750_41019751delAG								C7orf10 (119393 upstream) : INHBA (708852 downstream)																							agagagagcaagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61835361	61835361	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61835361delA								None (None upstream) : LOC643955 (916311 downstream)																							AATAAAGTTTAAATGTTATTT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68655436	68655436	+	IGR	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68655436delC								None (None upstream) : AUTS2 (408469 downstream)																							ccatctgaggcccagactcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	77080648	77080658	+	IGR	DEL	TTCCATCATAG	-	-	rs67486350		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77080648_77080658delTTCCATCATAG								PION (34931 upstream) : PTPN12 (86115 downstream)																							CAGCCATTCCTTCCATCATAGTTCCATCATA	0.327													3	3	---	---	---	---	
SEMA3E	9723	broad.mit.edu	37	7	83131521	83131521	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83131521delA	uc003uhy.1	-							NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				tggaccactgaatgttcttcc	0.000													4	2	---	---	---	---	
KIAA1324L	222223	broad.mit.edu	37	7	86541073	86541073	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86541073delA	uc011kha.1	-						KIAA1324L_uc003uif.1_Intron|KIAA1324L_uc011kgz.1_Intron|KIAA1324L_uc003uie.2_Intron	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					CTTCCTGCCTAAAGAGGTAAG	0.348													4	2	---	---	---	---	
SLC26A5	375611	broad.mit.edu	37	7	103053779	103053780	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103053779_103053780insT	uc003vbz.2	-						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Intron|SLC26A5_uc003vby.2_Intron|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						CCAGTGGGTGATTTTTTTTTCT	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152637570	152637587	+	IGR	DEL	GGTCTTCATCATTAGATA	-	-	rs79727726		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152637570_152637587delGGTCTTCATCATTAGATA								ACTR3B (85107 upstream) : DPP6 (946832 downstream)																							tggagtttctggtcttcatcattagatagaatggattg	0.000													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4649377	4649377	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4649377delA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACTTTTTTTCAAAAAAAAATT	0.303													4	2	---	---	---	---	
AGPAT5	55326	broad.mit.edu	37	8	6589881	6589881	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6589881delT	uc003wqo.2	+						AGPAT5_uc011kwm.1_Intron	NM_018361	NP_060831	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5						phospholipid biosynthetic process	integral to membrane|mitochondrion	1-acylglycerol-3-phosphate O-acyltransferase activity				0			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		TCACATGCAGTTTTTTTGAAT	0.254													4	2	---	---	---	---	
TUSC3	7991	broad.mit.edu	37	8	15517410	15517410	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15517410delA	uc003wwt.2	+						TUSC3_uc003wwr.2_Intron|TUSC3_uc003wws.2_Intron|TUSC3_uc003wwu.2_Intron|TUSC3_uc003wwv.2_Intron|TUSC3_uc003www.2_Intron|TUSC3_uc003wwx.2_Intron|TUSC3_uc003wwy.2_Intron	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a						cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		TTCAGAGGCTAAAAAACGTTT	0.194													4	2	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40625475	40625476	+	Intron	DEL	GT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40625475_40625476delGT	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			AATGAAGAAGGTGAAGGCATTG	0.243													4	2	---	---	---	---	
POTEA	340441	broad.mit.edu	37	8	43154214	43154214	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43154214delT	uc003xpz.1	+						POTEA_uc003xqa.1_Intron	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2											ovary(1)	1						tctttctttctttctttcttt	0.060													6	3	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	68981075	68981075	+	Intron	DEL	T	-	-	rs35256634		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68981075delT	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						AACTGtaatatttttaaataa	0.219													3	6	---	---	---	---	
TRAM1	23471	broad.mit.edu	37	8	71507073	71507073	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71507073delT	uc003xyo.1	-						TRAM1_uc011lfc.1_Intron	NM_014294	NP_055109	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1						cotranslational protein targeting to membrane|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity			ovary(1)	1			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			GCTATTGACATGTAAGCCAGT	0.433													4	2	---	---	---	---	
TRPA1	8989	broad.mit.edu	37	8	72963342	72963342	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72963342delA	uc003xza.2	-						uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TGGCTATTATAATCATTGTTC	0.373													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	91161283	91161284	+	IGR	INS	-	C	C	rs141798332	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91161283_91161284insC								CALB1 (53596 upstream) : TMEM64 (472939 downstream)																							cgctgctatatgtctttgtggc	0.000													3	5	---	---	---	---	
FAM92A1	137392	broad.mit.edu	37	8	94719943	94719944	+	Intron	DEL	GA	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94719943_94719944delGA	uc010maq.2	+						FAM92A1_uc003yfv.3_Intron|FAM92A1_uc003yfx.3_5'Flank|FAM92A1_uc003yfw.3_5'Flank|FAM92A1_uc010mar.2_5'Flank	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392												0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AAATGTTTTTGATTCCTGGTTA	0.287													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	110140857	110140870	+	IGR	DEL	GACATTCAAAAAAT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110140857_110140870delGACATTCAAAAAAT								TRHR (9047 upstream) : NUDCD1 (112279 downstream)																							CAGAAAAGGAGACATTCAAAAAATGCCTGAGCTA	0.379													5	3	---	---	---	---	
FAM49B	51571	broad.mit.edu	37	8	130975353	130975354	+	Intron	DEL	TT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130975353_130975354delTT	uc003ysw.2	-						FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			aacagtggcctttttttACCTC	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	18014692	18014692	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18014692delA								SH3GL2 (217572 upstream) : ADAMTSL1 (459412 downstream)																							ATCATGTTGGATCAGTGGGAA	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	22530296	22530296	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22530296delA								DMRTA1 (77824 upstream) : None (None downstream)																							TCCAAAATGGAAAAAAAAATA	0.463													5	3	---	---	---	---	
DNAJA1	3301	broad.mit.edu	37	9	33027167	33027168	+	Intron	DEL	TC	-	-	rs60033892		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33027167_33027168delTC	uc003zsd.1	+						DNAJA1_uc011lnt.1_Intron|DNAJA1_uc003zse.1_Intron|APTX_uc003zrz.2_5'Flank	NM_001539	NP_001530	P31689	DNJA1_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 1						protein folding|response to heat|response to unfolded protein	membrane	ATP binding|heat shock protein binding|low-density lipoprotein particle receptor binding|metal ion binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.102)		tttttttttttcttgagacgga	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68421071	68421072	+	IGR	INS	-	TTTG	TTTG	rs144603656		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68421071_68421072insTTTG								FAM27B (626882 upstream) : MIR1299 (581167 downstream)																							ATATCTAAACCTTTGTTTTTTA	0.337													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68427298	68427298	+	IGR	DEL	A	-	-	rs112435263		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68427298delA								FAM27B (633109 upstream) : MIR1299 (574941 downstream)																							GAGTTTCCCCAGTACTACTCT	0.478													4	2	---	---	---	---	
CBWD3	445571	broad.mit.edu	37	9	70490889	70490890	+	5'Flank	INS	-	C	C	rs147596955	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70490889_70490890insC	uc004aga.3	-						CBWD3_uc004agc.3_5'Flank|CBWD3_uc004afy.3_5'Flank|CBWD3_uc011lrm.1_5'Flank|CBWD3_uc011lrn.1_5'Flank|CBWD3_uc004agb.3_5'Flank|CBWD3_uc010moe.1_5'Flank|CBWD3_uc004agd.1_Intron|CBWD3_uc004age.2_5'Flank	NM_201453	NP_958861	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding				0				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		ccaatccacagcctgccccata	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	81282561	81282561	+	IGR	DEL	A	-	-	rs34737164		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81282561delA								PSAT1 (337554 upstream) : TLE4 (904317 downstream)																							AGTGCATTGGAAAAAAAATTC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	89029575	89029576	+	IGR	DEL	CT	-	-	rs34822560		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89029575_89029576delCT								ZCCHC6 (60197 upstream) : GAS1 (529703 downstream)																							TGGGGCAGAActctctctctcc	0.322													3	4	---	---	---	---	
DAPK1	1612	broad.mit.edu	37	9	90317794	90317794	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90317794delA	uc004apc.2	+						DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						ctaaaaaaagaaaaaaaaACG	0.224									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				6	3	---	---	---	---	
FAM120A	23196	broad.mit.edu	37	9	96326385	96326385	+	Intron	DEL	G	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96326385delG	uc004atw.2	+						FAM120A_uc004aty.2_Intron|FAM120A_uc004atz.2_Intron|FAM120A_uc010mrg.2_Intron|FAM120A_uc004aua.1_RNA	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator							cytoplasm|plasma membrane	RNA binding				0						GACAGGGTTAGAAGGACCCAG	0.488													4	2	---	---	---	---	
TMOD1	7111	broad.mit.edu	37	9	100294780	100294780	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100294780delT	uc004axk.1	+						TMOD1_uc004axl.1_Intron	NM_003275	NP_003266	P28289	TMOD1_HUMAN	tropomodulin 1						muscle filament sliding	cytosol	actin binding				0		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		TCCTATTTGATTTTGACATGT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	116819327	116819328	+	IGR	DEL	GT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116819327_116819328delGT								ZNF618 (453 upstream) : AMBP (3082 downstream)																							CCCCTAAATGGTGTGTGTGTGT	0.525													4	2	---	---	---	---	
COL27A1	85301	broad.mit.edu	37	9	117052738	117052739	+	Intron	INS	-	T	T	rs145703833	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117052738_117052739insT	uc011lxl.1	+						COL27A1_uc004bii.2_Intron	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor						cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						ACATCCAGAAGTTCTCTGGGGT	0.584													8	4	---	---	---	---	
PTGS1	5742	broad.mit.edu	37	9	125145487	125145487	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125145487delT	uc004bmg.1	+						PTGS1_uc011lys.1_Intron|PTGS1_uc010mwb.1_Intron|PTGS1_uc004bmf.1_Intron|PTGS1_uc004bmh.1_Intron|PTGS1_uc011lyt.1_Intron	NM_000962	NP_000953	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 isoform 1						cyclooxygenase pathway|hormone biosynthetic process|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum membrane|Golgi apparatus|microsome|plasma membrane	heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|skin(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dipyrone(DB04817)|Etodolac(DB00749)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Mesalazine(DB00244)|Minoxidil(DB00350)|Nabumetone(DB00461)|Naproxen(DB00788)|Phenacetin(DB03783)|Piroxicam(DB00554)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Tolmetin(DB00500)	tttttttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	137406037	137406037	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137406037delT								RXRA (73606 upstream) : COL5A1 (127615 downstream)																							acatgcctgatttctttagta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3791260	3791260	+	RNA	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3791260delA	uc001igy.1	+	2		c.543delA								Homo sapiens cDNA clone IMAGE:5278070.																		CCACATTATGAAAAAAAATAT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19017762	19017762	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19017762delA								ARL5B (50822 upstream) : None (None downstream)																							tttgaaagccaaaaaaaaacc	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38817956	38817957	+	IGR	INS	-	A	A	rs74778516		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38817956_38817957insA								LOC399744 (76876 upstream) : None (None downstream)																							gaatggaaaggaatggattcga	0.000													4	4	---	---	---	---	
ZNF365	22891	broad.mit.edu	37	10	64414274	64414275	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64414274_64414275insT	uc001jmd.1	+						ZNF365_uc001jmc.2_Intron|ZNF365_uc001jme.1_Intron|ZNF365_uc001jmf.1_Intron|ZNF365_uc009xpg.1_Intron	NM_199452	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform D											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					GCGTTCAACAAttttttttttt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	74056023	74056023	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74056023delT								DDIT4 (20226 upstream) : DNAJB12 (36565 downstream)																							gtagattccctttttagcata	0.020													4	2	---	---	---	---	
ADK	132	broad.mit.edu	37	10	75935742	75935742	+	Intron	DEL	T	-	-	rs11320887		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75935742delT	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_5'Flank|ADK_uc010qlc.1_5'Flank	NM_006721	NP_006712	P55263	ADK_HUMAN	adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)	TCTTAGATTCTTTTTTTTTTA	0.378													0	6	---	---	---	---	
DLG5	9231	broad.mit.edu	37	10	79661680	79661680	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79661680delT	uc001jzk.2	-							NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5						cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TCTTATGACATTAGTAAGAGA	0.498													4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87893082	87893083	+	Intron	DEL	TG	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87893082_87893083delTG	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	catgtgtgcatgtgtgtgtgtg	0.243										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87893408	87893408	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87893408delT	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	GCTGACCCCATTTCTATTGGA	0.279										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	114637850	114637850	+	IGR	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114637850delC								LOC143188 (22723 upstream) : TCF7L2 (72159 downstream)																							ctctctcctgcctcccagcac	0.080													4	2	---	---	---	---	
WDR11	55717	broad.mit.edu	37	10	122640169	122640169	+	Intron	DEL	A	-	-	rs72385528		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122640169delA	uc010qtf.1	+						WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_Intron	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2							integral to membrane					0						agaccatctcaaaaaaaaaaa	0.179													14	7	---	---	---	---	
MTG1	92170	broad.mit.edu	37	10	135225378	135225379	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135225378_135225379insT	uc001lnd.2	+						MTG1_uc010qve.1_Intron	NM_138384	NP_612393	Q9BT17	MTG1_HUMAN	GTP_binding protein precursor							mitochondrion	GTP binding|protein binding			skin(1)	1		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		agtttgctgagtttttttttaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	8306336	8306336	+	IGR	DEL	G	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8306336delG								LMO1 (16154 upstream) : STK33 (107082 downstream)																							ttctcctcctgcctgccccag	0.000													4	2	---	---	---	---	
ZNF143	7702	broad.mit.edu	37	11	9493098	9493099	+	Intron	INS	-	T	T	rs149381506	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9493098_9493099insT	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		AGGTGTTTTGGTGttttttttt	0.139													7	5	---	---	---	---	
PRR5L	79899	broad.mit.edu	37	11	36340071	36340072	+	Intron	DEL	AT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36340071_36340072delAT	uc001mwo.3	+							NM_001160167	NP_001153639	Q6MZQ0	PRR5L_HUMAN	protor-2 isoform a											ovary(1)	1						AGAGGGATGGATATGTGGAGCT	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	51583500	51583500	+	IGR	DEL	G	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51583500delG								OR4C46 (67291 upstream) : None (None downstream)																							gcgtttcaaaggtgctgtatc	0.000													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	88141505	88141505	+	IGR	DEL	G	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88141505delG								CTSC (70564 upstream) : GRM5 (96240 downstream)																							TGAAGTTGGAGGAGACTACCA	0.502													4	2	---	---	---	---	
ATM	472	broad.mit.edu	37	11	108200141	108200141	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108200141delT	uc001pkb.1	+						ATM_uc009yxr.1_Intron|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Intron|ATM_uc001pkg.1_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		ttgttttttgttttttttttt	0.149			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119364446	119364446	+	Intron	DEL	C	-	-	rs115824275	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119364446delC	uc001pwo.2	+						uc001pwp.1_Intron					Homo sapiens cDNA FLJ40501 fis, clone TESTI2045171.																		CGATTTTAGGCCCAGGGGATA	0.443													4	2	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120577301	120577301	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120577301delA	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	CTGACATTTTAGGGGCACAGG	0.517													4	2	---	---	---	---	
LOC399959	399959	broad.mit.edu	37	11	122130015	122130016	+	Intron	INS	-	TCAACAATTAT	TCAACAATTAT	rs143580598	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122130015_122130016insTCAACAATTAT	uc009zbb.1	-											Homo sapiens cDNA FLJ34394 fis, clone HCHON2000676.												0						tcactagccagtcatccagctc	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127187402	127187402	+	Intron	DEL	T	-	-	rs147468357		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127187402delT	uc001qeh.2	+											Homo sapiens cDNA clone IMAGE:4794631.																		aagttctgggttttttttttt	0.000													3	3	---	---	---	---	
KLRF1	51348	broad.mit.edu	37	12	9985253	9985254	+	Intron	DEL	GT	-	-	rs150922814		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9985253_9985254delGT	uc010sgw.1	+						KLRF1_uc009zgw.2_Intron|KLRF1_uc009zgx.2_Intron|KLRF1_uc001qwm.2_Intron|KLRF1_uc009zgy.2_Intron|KLRF1_uc009zgz.2_Intron|KLRF1_uc009zha.2_Intron	NM_016523	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F,						cell surface receptor linked signaling pathway	integral to plasma membrane	MHC class I receptor activity|sugar binding			large_intestine(1)	1						tatgtgtagagtgtgtgtgtgt	0.233													5	3	---	---	---	---	
PRR4	11272	broad.mit.edu	37	12	11000107	11000107	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11000107delT	uc001qyz.3	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRR4_uc001qza.3_Intron	NM_007244	NP_009175	Q16378	PROL4_HUMAN	proline rich 4 (lacrimal) isoform 2						visual perception	extracellular space					0						GTGCCCACTGTTTTTTTTTTC	0.388													6	3	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	24595420	24595421	+	Intron	INS	-	AG	AG			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24595420_24595421insAG	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						taaagcaaagaagagagagaga	0.000													4	2	---	---	---	---	
FAR2	55711	broad.mit.edu	37	12	29464415	29464416	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29464415_29464416insT	uc001ris.3	+						FAR2_uc001rit.2_Intron|FAR2_uc009zjm.2_Intron|uc001riu.1_Intron	NM_018099	NP_060569	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2						ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor				0						AAATGACAGAATTTTTTTTTAA	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	46502786	46502787	+	IGR	INS	-	C	C			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46502786_46502787insC								SFRS2IP (116883 upstream) : SLC38A1 (74056 downstream)																							cctggagtttacccccttactc	0.129													4	2	---	---	---	---	
ANKRD52	283373	broad.mit.edu	37	12	56641131	56641131	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56641131delA	uc001skm.3	-							NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52								protein binding			ovary(2)	2						accctgtctcaaaaaaaaaaa	0.189													4	2	---	---	---	---	
POC1B	282809	broad.mit.edu	37	12	89890784	89890785	+	Intron	INS	-	A	A	rs145059145	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89890784_89890785insA	uc001tbc.2	-						POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc010sun.1_Intron|POC1B_uc009zsp.2_Intron|POC1B_uc009zsq.2_Intron	NM_172240	NP_758440	Q8TC44	POC1B_HUMAN	WD repeat domain 51B						cell projection organization	centriole|microtubule basal body				ovary(1)	1						TAATTTTGAGGAAAAAAATTGT	0.366													3	3	---	---	---	---	
SLC5A8	160728	broad.mit.edu	37	12	101568056	101568056	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101568056delT	uc001thz.3	-							NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),						apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						cgatgtctccttttctgttca	0.075													4	2	---	---	---	---	
DIABLO	56616	broad.mit.edu	37	12	122692666	122692666	+	3'UTR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122692666delA	uc010tab.1	-	7					DIABLO_uc010taa.1_3'UTR|DIABLO_uc010tac.1_RNA|DIABLO_uc010tad.1_3'UTR|VPS33A_uc001ucc.2_RNA	NM_019887	NP_063940	Q9NR28	DBLOH_HUMAN	diablo isoform 1 precursor						activation of caspase activity by cytochrome c|induction of apoptosis via death domain receptors	CD40 receptor complex|cytosol|internal side of plasma membrane|mitochondrial intermembrane space	protein binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000302)|Epithelial(86;0.00051)|BRCA - Breast invasive adenocarcinoma(302;0.223)		GGTGTGAGGTAAAAAAAATGG	0.473													4	2	---	---	---	---	
HSPH1	10808	broad.mit.edu	37	13	31721632	31721632	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31721632delA	uc001utj.2	-						HSPH1_uc001utk.2_Intron|HSPH1_uc010aaw.2_Intron|HSPH1_uc001utl.2_Intron|HSPH1_uc010tds.1_Intron	NM_006644	NP_006635	Q92598	HS105_HUMAN	heat shock 105kD						positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding				0		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		AATATGTACCAAAAAAAACTT	0.373													4	2	---	---	---	---	
TRPC4	7223	broad.mit.edu	37	13	38274089	38274090	+	Intron	INS	-	TG	TG	rs138761262	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38274089_38274090insTG	uc001uws.2	-						TRPC4_uc010abv.2_Intron|TRPC4_uc001uwt.2_Intron|TRPC4_uc010tey.1_Intron|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Intron|TRPC4_uc010aby.2_Intron	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,						axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		GAAATAAAGCATGTGTGTGGGT	0.381													5	3	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	48922817	48922817	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48922817delT	uc001vcb.2	+						RB1_uc010acs.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(5)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTTTTCTTAATTTTTTTTTTT	0.204		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			4	3	---	---	---	---	
THSD1P1	374500	broad.mit.edu	37	13	52754797	52754797	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52754797delA	uc001vgk.2	-						THSD1P1_uc001vgm.1_Intron|THSD1P1_uc010adx.1_Intron|THSD1P1_uc010ady.1_Intron|THSD1P1_uc001vgl.1_Intron					Homo sapiens cDNA FLJ14630 fis, clone NT2RP2000459.												0						TTCCTAAGACaaaaaaaaaaa	0.234													8	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	54393091	54393091	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54393091delT								OLFM4 (766905 upstream) : MIR1297 (493016 downstream)																							TAAATTGGCATTTTTTTTCTG	0.279													6	3	---	---	---	---	
KLF12	11278	broad.mit.edu	37	13	74275337	74275339	+	Intron	DEL	GCT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74275337_74275339delGCT	uc001vjf.2	-						KLF12_uc010aeq.2_Intron	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		CAGGGCCTGGGCTGCTGCTGCAC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79668173	79668173	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79668173delA								RNF219 (433473 upstream) : RBM26 (225927 downstream)																							gtatagtaataaaaaaaaaaG	0.154													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	84382797	84382797	+	IGR	DEL	G	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84382797delG								None (None upstream) : SLITRK1 (68547 downstream)																							aaaaaaaaaaGGAATTCTTAT	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	89394176	89394177	+	IGR	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89394176_89394177insT								None (None upstream) : None (None downstream)																							ttctcaactgatttttccctac	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19435155	19435157	+	IGR	DEL	ACC	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19435155_19435157delACC								OR11H12 (56583 upstream) : POTEG (118208 downstream)																							aaacaaaAAAaccaccaccacca	0.236													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22632811	22632811	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22632811delA	uc001wbw.2	+						uc010aiv.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		cgagggcagcaggggagggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	29489054	29489055	+	IGR	DEL	TT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29489054_29489055delTT								C14orf23 (225055 upstream) : PRKD1 (556634 downstream)																							acatttaagcttagacctaaag	0.000													4	2	---	---	---	---	
SOS2	6655	broad.mit.edu	37	14	50628516	50628517	+	Intron	INS	-	C	C	rs112699778		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50628516_50628517insC	uc001wxs.3	-						SOS2_uc010tql.1_Intron|SOS2_uc010tqm.1_5'Flank|SOS2_uc001wxt.2_Intron	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					TCttttttttttttttttttga	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	54572601	54572602	+	IGR	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54572601_54572602insT								BMP4 (149047 upstream) : CDKN3 (291071 downstream)																							TTTAAATTGAATTTTTTTTCAA	0.386													3	3	---	---	---	---	
RTN1	6252	broad.mit.edu	37	14	60320160	60320160	+	Intron	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60320160delC	uc001xen.1	-							NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A						neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		gacaacccttcatgtattttt	0.000													4	2	---	---	---	---	
TTLL5	23093	broad.mit.edu	37	14	76358335	76358335	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76358335delA	uc001xrx.2	+						TTLL5_uc001xsa.2_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTTTCCTACTAAAAGAAATCA	0.338													4	2	---	---	---	---	
ALKBH1	8846	broad.mit.edu	37	14	78149924	78149924	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78149924delT	uc001xuc.1	-						ALKBH1_uc001xud.1_Intron	NM_006020	NP_006011	Q13686	ALKB1_HUMAN	alkylated DNA repair protein alkB homolog						DNA dealkylation involved in DNA repair|DNA demethylation|oxidative demethylation|RNA repair	mitochondrion	DNA-(apurinic or apyrimidinic site) lyase activity|ferrous iron binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(1)|skin(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		ATCATCCTCCtttttttttga	0.219													4	3	---	---	---	---	
ADCK1	57143	broad.mit.edu	37	14	78353262	78353272	+	Intron	DEL	CACACACACAC	-	-	rs35621906	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78353262_78353272delCACACACACAC	uc001xui.2	+						ADCK1_uc010tvo.1_Intron|ADCK1_uc001xuj.2_Intron|ADCK1_uc001xuk.1_Intron	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a							extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		cacacacacacacacacacacacacacacac	0.180													4	2	---	---	---	---	
GALC	2581	broad.mit.edu	37	14	88368692	88368692	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88368692delT	uc010tvw.1	-							NM_000153		P54803	GALC_HUMAN	galactosylceramidase isoform a precursor						carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						CATCATTGTCTTTTTTTTAAT	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20867705	20867706	+	IGR	INS	-	A	A	rs140790708	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20867705_20867706insA								GOLGA8C (86679 upstream) : BCL8 (2350 downstream)																							TCAAGTTAATTAAGTAAATATT	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22424757	22424757	+	IGR	DEL	A	-	-	rs113707514		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22424757delA								OR4N3P (10372 upstream) : MIR1268 (88472 downstream)																							gaagtaattcaaacctcagtg	0.169													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23409435	23409436	+	Intron	INS	-	TT	TT			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23409435_23409436insTT	uc010uab.1	-						uc002ceb.2_5'Flank	NM_001001413	NP_001001413			golgi autoantigen, golgin subfamily a, 6-like 1																		ttctttctttcttttttttttt	0.183													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	30140373	30140373	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30140373delA								TJP1 (25667 upstream) : FAM7A3 (255562 downstream)																							tgagtgcttgaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39177590	39177590	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39177590delT								C15orf53 (185351 upstream) : C15orf54 (365295 downstream)																							ATGAAAAGCATTTTTTTTCCT	0.353													4	2	---	---	---	---	
TMEM62	80021	broad.mit.edu	37	15	43473707	43473707	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43473707delT	uc001zqr.2	+						TMEM62_uc010bda.2_Intron|TMEM62_uc001zqt.2_Intron	NM_024956	NP_079232	Q0P6H9	TMM62_HUMAN	transmembrane protein 62							integral to membrane				ovary(1)|breast(1)	2		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		CTAAAATACAtttttttttcc	0.179													4	3	---	---	---	---	
ADAM10	102	broad.mit.edu	37	15	58938056	58938056	+	Intron	DEL	C	-	-	rs55966169		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58938056delC	uc002afd.1	-						ADAM10_uc010bgc.1_Intron|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor						cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		CATTGTCTTACCCCTCTCTTT	0.358													1	7	---	---	---	---	
GLCE	26035	broad.mit.edu	37	15	69454251	69454252	+	Intron	INS	-	TG	TG	rs142220141	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69454251_69454252insTG	uc002ary.1	+						GLCE_uc002arw.2_Intron|GLCE_uc002arx.2_Intron	NM_015554	NP_056369	O94923	GLCE_HUMAN	D-glucuronyl C5-epimerase						heparan sulfate proteoglycan biosynthetic process|heparin biosynthetic process	Golgi membrane|integral to membrane	UDP-glucuronate 5'-epimerase activity			ovary(2)	2						GTGGGGAAGACTGATTTTGGCT	0.525											OREG0023231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1	7	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	71953255	71953255	+	Intron	DEL	A	-	-	rs34436025		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71953255delA	uc002atb.1	+						THSD4_uc002atd.1_Intron|THSD4_uc010ukg.1_Intron|THSD4_uc002ate.2_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						GGAGAACGTTAAAAAAAAAGT	0.448													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	75758520	75758520	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75758520delT								SIN3A (10396 upstream) : PTPN9 (943 downstream)																							tgtctctcaatttttttcttc	0.015													4	2	---	---	---	---	
UBE2Q2P1	388165	broad.mit.edu	37	15	85077207	85077208	+	Intron	INS	-	A	A			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85077207_85077208insA	uc002bkn.1	-							NR_003661				Homo sapiens cDNA FLJ43276 fis, clone KIDNE2011532, moderately similar to Homo sapiens melanoma-associated chondroitin sulfate proteoglycan 4.												0						cacactATATTAAAAAAAAAAA	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93981424	93981425	+	Intron	INS	-	CTT	CTT	rs147416227	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93981424_93981425insCTT	uc002bsu.1	+											Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																		gtgcctgactccttgagtgagg	0.045													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	2701922	2701922	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2701922delA								FLJ42627 (5794 upstream) : KCTD5 (30573 downstream)																							TTTCTCTACTAAAAAAaaaat	0.055													4	3	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15075692	15075692	+	Intron	DEL	T	-	-	rs66615912		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15075692delT	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	cttttgtttcttttttttttt	0.199													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33491209	33491211	+	IGR	DEL	GAG	-	-	rs147067680		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33491209_33491211delGAG								SLC6A10P (594746 upstream) : MIR1826 (474297 downstream)																							atggaactatgaggtctcaacag	0.256													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33561825	33561829	+	IGR	DEL	TGAGA	-	-	rs3866596		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33561825_33561829delTGAGA								SLC6A10P (665362 upstream) : MIR1826 (403679 downstream)																							CAAACAATACTGAGATGAGATTATA	0.205													4	2	---	---	---	---	
MYLK3	91807	broad.mit.edu	37	16	46737996	46737997	+	3'UTR	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46737996_46737997insT	uc002eei.3	-	13					MYLK3_uc010vge.1_3'UTR	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3						cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				gaattgacaggtttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48096342	48096343	+	IGR	DEL	TC	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48096342_48096343delTC								PHKB (360909 upstream) : ABCC12 (20541 downstream)																							GTGATCTCTGTCTCTCTCTCTC	0.381													4	2	---	---	---	---	
MMP2	4313	broad.mit.edu	37	16	55517479	55517479	+	Intron	DEL	A	-	-	rs17859867		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55517479delA	uc002ehz.3	+						MMP2_uc010vhd.1_Intron|MMP2_uc010ccc.2_Intron	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a						angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	TGGGTTTAGCAGCCCAATTGG	0.408													3	3	---	---	---	---	
CHST6	4166	broad.mit.edu	37	16	75512296	75512297	+	3'UTR	INS	-	C	C	rs146724437	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75512296_75512297insC	uc002fef.2	-	3					CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_3'UTR	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)						keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						CCCAGAGGAGGAGGGGCAAGAG	0.515													2	5	---	---	---	---	
FBXO31	79791	broad.mit.edu	37	16	87390850	87390851	+	Intron	DEL	AA	-	-	rs78341337		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87390850_87390851delAA	uc002fjw.2	-						FBXO31_uc010vot.1_Intron|FBXO31_uc002fjv.2_Intron	NM_024735	NP_079011	Q5XUX0	FBX31_HUMAN	F-box protein 31						cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)		accctgtctcaaaaaaaaaaaG	0.134													4	2	---	---	---	---	
ANKRD11	29123	broad.mit.edu	37	16	89516578	89516578	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89516578delT	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron|uc002fnh.1_Intron	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGACCCTGACTTCCTCTTAAC	0.468													4	2	---	---	---	---	
PRPSAP2	5636	broad.mit.edu	37	17	18812312	18812312	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18812312delA	uc002gup.1	+						PRPSAP2_uc002guo.1_Intron|PRPSAP2_uc010vyi.1_Intron|PRPSAP2_uc010vyj.1_Intron|PRPSAP2_uc010vyk.1_Intron	NM_002767	NP_002758	O60256	KPRB_HUMAN	phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|magnesium ion binding|ribose phosphate diphosphokinase activity			skin(1)	1						TTCAACATTCaaaaaaaaaga	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20629195	20629195	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20629195delT								LGALS9B (258347 upstream) : CCDC144NL (137515 downstream)																							TTTCATAttctttttttttaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25288870	25288872	+	IGR	DEL	AAT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25288870_25288872delAAT								None (None upstream) : WSB1 (332234 downstream)																							CTGCAAATAGAATATTCATGAGC	0.345													4	2	---	---	---	---	
TAOK1	57551	broad.mit.edu	37	17	27778449	27778450	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27778449_27778450insT	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			CCTTTTCTGACTTTTTTTTTCT	0.332													9	5	---	---	---	---	
TMEM98	26022	broad.mit.edu	37	17	31258255	31258256	+	Intron	INS	-	AAC	AAC	rs145302669	by1000genomes	TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31258255_31258256insAAC	uc002hhq.2	+						TMEM98_uc002hhr.2_Intron	NM_015544	NP_056359	Q9Y2Y6	TMM98_HUMAN	transmembrane protein 98							endoplasmic reticulum|integral to membrane					0		Ovarian(249;0.182)|Breast(31;0.244)	BRCA - Breast invasive adenocarcinoma(9;0.0769)			aacaaacaaaAAATTTTAGTCC	0.213													5	3	---	---	---	---	
EZH1	2145	broad.mit.edu	37	17	40875923	40875923	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40875923delT	uc002iaz.2	-						EZH1_uc002iba.2_Intron|EZH1_uc010wgt.1_Intron|EZH1_uc010wgu.1_Intron|EZH1_uc010wgv.1_Intron|EZH1_uc010wgw.1_Intron|EZH1_uc010cyp.2_Intron|EZH1_uc010cyq.2_Intron|EZH1_uc010cys.2_Intron|EZH1_uc010cyo.1_5'Flank	NM_001991	NP_001982	Q92800	EZH1_HUMAN	enhancer of zeste homolog 1						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		GTCTCAGTTGTTTTTGTAGCA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	53327491	53327491	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53327491delA								STXBP4 (86042 upstream) : HLF (14830 downstream)																							cagttactttaaaaagcatgc	0.000													4	2	---	---	---	---	
PITPNC1	26207	broad.mit.edu	37	17	65633404	65633406	+	Intron	DEL	TTT	-	-	rs79219203		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65633404_65633406delTTT	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			TCAGAGTTCCTTTTTTTTTTTAA	0.399													4	2	---	---	---	---	
BPTF	2186	broad.mit.edu	37	17	65925160	65925161	+	Intron	INS	-	G	G			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65925160_65925161insG	uc002jgf.2	+						BPTF_uc002jge.2_Intron	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCACTATGGCAGGAAAAGTAAT	0.455													4	2	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	6946135	6946135	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6946135delA	uc002knm.2	-						LAMA1_uc002knk.2_Intron|LAMA1_uc002knl.2_Intron|LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTTCTACATTAAAAAAAAATT	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	53417156	53417157	+	IGR	DEL	AC	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53417156_53417157delAC								TCF4 (113971 upstream) : TXNL1 (852898 downstream)																							gcatacactgacacacacacac	0.203													4	2	---	---	---	---	
TNFRSF11A	8792	broad.mit.edu	37	18	60015136	60015136	+	Intron	DEL	A	-	-	rs72159032		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60015136delA	uc002lin.2	+						TNFRSF11A_uc010dpv.2_Intron	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,						adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity			breast(2)|lung(1)	3		Colorectal(73;0.188)				gactctgtctaaaaaaaaaaa	0.005									Paget_Disease_of_Bone				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6554529	6554529	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6554529delT								TNFSF9 (18590 upstream) : CD70 (28606 downstream)																							tcttaaacaatttttttttga	0.139													5	3	---	---	---	---	
ASPDH	554235	broad.mit.edu	37	19	51015274	51015277	+	Intron	DEL	AGAA	-	-	rs35220044		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51015274_51015277delAGAA	uc010enz.2	-						JOSD2_uc002psn.1_5'Flank|JOSD2_uc002pso.1_5'Flank|JOSD2_uc002psp.1_5'Flank|JOSD2_uc002psq.1_5'Flank|ASPDH_uc002psr.3_Intron	NM_001114598	NP_001108070	A6ND91	ASPD_HUMAN	aspartate dehydrogenase isoform 1						NAD biosynthetic process|NADP catabolic process		aspartate dehydrogenase activity|NADP binding				0						AATAAAGGTCAGAAAGAAAGAAAG	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	21004341	21004342	+	IGR	DEL	TG	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21004341_21004342delTG								RALGAPA2 (311075 upstream) : PLK1S1 (102282 downstream)																							Agtgtgtgtctgtgtgtgtgtg	0.342													3	3	---	---	---	---	
C20orf132	140699	broad.mit.edu	37	20	35747911	35747914	+	Intron	DEL	GGAG	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35747911_35747914delGGAG	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)				aaggaaggaaggagagaaaagaaa	0.000													4	2	---	---	---	---	
CHD6	84181	broad.mit.edu	37	20	40188526	40188527	+	Intron	DEL	AC	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40188526_40188527delAC	uc002xka.1	-						CHD6_uc002xkd.2_Intron|CHD6_uc002xkc.2_Intron	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				acgcacacatacacacacacac	0.000													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41335822	41335822	+	Intron	DEL	T	-	-	rs74798123		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41335822delT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				ttgtttgttgttttttttgcc	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10760890	10760891	+	IGR	DEL	AG	-	-	rs138985880		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10760890_10760891delAG								None (None upstream) : TPTE (145852 downstream)																							ttctacaaacagagagtttcaa	0.000													5	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11058732	11058733	+	Intron	DEL	TT	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11058732_11058733delTT	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CATATTACTATTTTTTACCCTG	0.257													4	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11061508	11061510	+	Intron	DEL	CAC	-	-	rs60979732		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061508_11061510delCAC	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATCTATAAAACACAACAGAATGA	0.236													8	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11071011	11071013	+	Intron	DEL	GAA	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11071011_11071013delGAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ttaaatgcttgaagaagaaaaac	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11071942	11071942	+	Intron	DEL	G	-	-	rs150796084		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11071942delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		acatacacctgggagtagtaa	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11118088	11118091	+	IGR	DEL	ATAG	-	-	rs145295825		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11118088_11118091delATAG								BAGE (19151 upstream) : None (None downstream)																							tagatagataatagatagatggaA	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11151911	11151912	+	IGR	INS	-	A	A	rs77036193		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11151911_11151912insA								BAGE (52974 upstream) : None (None downstream)																							AGGAGAAAGAGAAAAAAAATGA	0.371													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	16516825	16516825	+	IGR	DEL	C	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16516825delC								NRIP1 (79699 upstream) : USP25 (585671 downstream)																							tcctcaaaaacaaaaaaagtc	0.000													4	2	---	---	---	---	
TMPRSS15	5651	broad.mit.edu	37	21	19711317	19711317	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19711317delT	uc002ykw.2	-							NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TCTGCTCACATTTTTTTTTTC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40345351	40345351	+	IGR	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40345351delT								ETS2 (148475 upstream) : PSMG1 (202039 downstream)																							GCAGAGTGGGTTTGATGCAGC	0.299													4	2	---	---	---	---	
MPPED1	758	broad.mit.edu	37	22	43845776	43845776	+	Intron	DEL	G	-	-	rs135043		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43845776delG	uc011apv.1	+						MPPED1_uc011apw.1_Intron|MPPED1_uc011apx.1_Intron|MPPED1_uc011apy.1_Intron|MPPED1_uc011apz.1_Intron	NM_001044370	NP_001037835	O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1								hydrolase activity				0		all_neural(38;0.0244)|Ovarian(80;0.0694)				AGTTCCAGGCGGATGCAGCAT	0.289													3	5	---	---	---	---	
MOV10L1	54456	broad.mit.edu	37	22	50581272	50581272	+	Intron	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50581272delA	uc003bjj.2	+						MOV10L1_uc003bjk.3_Intron|MOV10L1_uc011arp.1_Intron|MOV10L1_uc011arq.1_Intron	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1						germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		ctcaaaaaagaaaaaaaaaaT	0.219													3	3	---	---	---	---	
DOCK11	139818	broad.mit.edu	37	X	117761299	117761299	+	Intron	DEL	T	-	-	rs78788801		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117761299delT	uc004eqp.2	+						DOCK11_uc004eqq.2_Intron	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation	cytosol	GTP binding			ovary(3)	3						TGCTAGTAGCTTTTTTTTTTT	0.318													9	5	---	---	---	---	
THOC2	57187	broad.mit.edu	37	X	122757353	122757353	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122757353delT	uc004etu.2	-						THOC2_uc010nqt.1_5'Flank|THOC2_uc004etw.1_5'Flank	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						CTAAGATGGCTTTTTTTTTTT	0.249													4	2	---	---	---	---	
FAM122C	159091	broad.mit.edu	37	X	133979589	133979590	+	Intron	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133979589_133979590insT	uc004exz.1	+						FAM122C_uc011mvq.1_Intron|FAM122C_uc004exy.1_Intron	NM_138819	NP_620174	Q6P4D5	F222C_HUMAN	hypothetical protein LOC159091												0	Acute lymphoblastic leukemia(192;0.000127)					GCTCtttttaattttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	136059145	136059145	+	Intron	DEL	T	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136059145delT	uc004fai.1	+											Homo sapiens cDNA FLJ31132 fis, clone IMR322000953.																		TTTCTTGTCCTTTTTTTTTTA	0.363													7	4	---	---	---	---	
TSPY1	7258	broad.mit.edu	37	Y	9307257	9307258	+	3'UTR	INS	-	T	T			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9307257_9307258insT	uc004frw.3	+	6					TSPY1_uc004frx.3_3'UTR|TSPY1_uc010nwp.1_Intron	NM_003308	NP_003299	Q01534	TSPY1_HUMAN	testis specific protein, Y-linked 1						cell differentiation|cell proliferation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus	identical protein binding				0						TCAGCATGGTCTTATGCACAGG	0.386													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9939798	9939798	+	IGR	DEL	T	-	-	rs78282484		TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9939798delT								TTTY22 (288944 upstream) : None (None downstream)																							acttaaaaaatgtttgttgaa	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	23476565	23476565	+	IGR	DEL	A	-	-			TCGA-B0-5080-01A-01D-1501-10	TCGA-B0-5080-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:23476565delA								RPS4Y2 (533649 upstream) : RBMY2EP (80469 downstream)																							TTTGTATGACAAAAAAATGAG	0.318													4	2	---	---	---	---	
