Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MKNK1	8569	broad.mit.edu	37	1	47028508	47028508	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47028508G>C	uc001cqb.2	-	11	1020	c.776C>G	c.(775-777)TCT>TGT	p.S259C	MKNK1_uc010omd.1_Missense_Mutation_p.S123C|MKNK1_uc001cqc.2_Missense_Mutation_p.S218C|MKNK1_uc009vyi.2_Missense_Mutation_p.S218C|MKNK1_uc010ome.1_Missense_Mutation_p.S123C|MKNK1_uc009vyj.2_Missense_Mutation_p.S163C	NM_003684	NP_003675	Q9BUB5	MKNK1_HUMAN	MAP kinase-interacting serine/threonine kinase 1	259	Protein kinase.				intracellular protein kinase cascade|peptidyl-serine phosphorylation|regulation of translation	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2	Acute lymphoblastic leukemia(166;0.155)					GTATTCTGCAGAGCCACACTG	0.602													4	16	---	---	---	---	PASS
CYP4A11	1579	broad.mit.edu	37	1	47401233	47401233	+	Silent	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47401233C>T	uc001cqp.3	-	5	648	c.597G>A	c.(595-597)AAG>AAA	p.K199K	CYP4A11_uc001cqq.2_Silent_p.K199K|CYP4A11_uc010omm.1_RNA	NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	199					long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	TGAAGGCACACTTCATGATGG	0.562													58	115	---	---	---	---	PASS
SLC22A15	55356	broad.mit.edu	37	1	116574219	116574219	+	Intron	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116574219G>A	uc001egb.3	+						SLC22A15_uc001ega.2_3'UTR	NM_018420	NP_060890	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15						ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		ATACTAAGGCGTGTTCTGTTG	0.448													10	116	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	145039633	145039633	+	5'UTR	SNP	C	T	T	rs2762750		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145039633C>T	uc001elx.3	-	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_5'UTR|PDE4DIP_uc001eln.3_5'UTR|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCCTTAGTCTCAGGACGCTCC	0.597			T	PDGFRB	MPD								7	62	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285874	152285874	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285874G>T	uc001ezu.1	-	3	1524	c.1488C>A	c.(1486-1488)CAC>CAA	p.H496Q	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	496	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGCTCGTGGTGCGATCCTT	0.607									Ichthyosis				133	274	---	---	---	---	PASS
APCS	325	broad.mit.edu	37	1	159558513	159558513	+	3'UTR	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159558513G>A	uc001ftv.2	+	2						NM_001639	NP_001630	P02743	SAMP_HUMAN	serum amyloid P component precursor						acute-phase response|chaperone-mediated protein complex assembly|protein folding	extracellular space	metal ion binding|sugar binding|unfolded protein binding			ovary(1)|breast(1)	2	all_hematologic(112;0.0429)					TTGACTCAACGAGAGCACTTG	0.433													30	64	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186017962	186017962	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186017962A>C	uc001grq.1	+	42	6797	c.6568A>C	c.(6568-6570)AAC>CAC	p.N2190H		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2190	Ig-like C2-type 19.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CTACAATGTCAACATTTGGGG	0.348													42	71	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200586908	200586908	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200586908T>A	uc010ppk.1	-	2	1383	c.944A>T	c.(943-945)CAA>CTA	p.Q315L	KIF14_uc010ppj.1_5'UTR	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	315	Required for PRC1-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						TTTTGGTCTTTGTTTAACTTG	0.403													83	129	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25967152	25967152	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25967152G>C	uc002rgs.2	-	12	2275	c.2054C>G	c.(2053-2055)TCA>TGA	p.S685*	ASXL2_uc002rgt.1_Nonsense_Mutation_p.S425*	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	685					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCTCCAACTGAGGCGGCTGC	0.622													41	79	---	---	---	---	PASS
VAMP5	10791	broad.mit.edu	37	2	85820299	85820299	+	3'UTR	SNP	A	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85820299A>T	uc002spu.1	+	3					RNF181_uc002spv.1_5'Flank	NM_006634	NP_006625	O95183	VAMP5_HUMAN	vesicle-associated membrane protein 5						cell differentiation|vesicle-mediated transport	endomembrane system					0						GTCCTGAAGGAGAAGCCAAAT	0.602													7	15	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109103098	109103098	+	Silent	SNP	T	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109103098T>A	uc002tec.2	+	16	4078	c.3924T>A	c.(3922-3924)GCT>GCA	p.A1308A	GCC2_uc002ted.2_Silent_p.A1207A	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1308	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						AGTGCCGTGCTGCCAAGGTGC	0.512													16	32	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183872	10183872	+	Splice_Site	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183872G>A	uc003bvc.2	+	1	553	c.340_splice	c.e1+1	p.G114_splice	VHL_uc003bvd.2_Splice_Site_p.V114_splice	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1						anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(9)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGCTACCGAGGTACGGGCCCG	0.622		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				5	2	---	---	---	---	PASS
GADL1	339896	broad.mit.edu	37	3	30769765	30769765	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30769765T>C	uc003cep.2	-	15	1582	c.1535A>G	c.(1534-1536)GAT>GGT	p.D512G		NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	512					carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	GTCTATCTCATCCAGGAGGAA	0.537													14	139	---	---	---	---	PASS
ZNF148	7707	broad.mit.edu	37	3	125032327	125032327	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125032327G>T	uc003ehx.3	-	4	644	c.158C>A	c.(157-159)CCT>CAT	p.P53H	ZNF148_uc003ehz.3_Missense_Mutation_p.P53H|ZNF148_uc010hsa.2_Missense_Mutation_p.P53H|ZNF148_uc003eia.3_Missense_Mutation_p.P53H|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	53					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						CTCCTGGTGAGGCATACTTCG	0.453													107	194	---	---	---	---	PASS
MRPS22	56945	broad.mit.edu	37	3	139074556	139074556	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139074556A>G	uc003etb.2	+	7	919	c.911A>G	c.(910-912)TAT>TGT	p.Y304C	MRPS22_uc003etc.2_RNA|MRPS22_uc003etd.2_Missense_Mutation_p.Y303C|MRPS22_uc003ete.2_Missense_Mutation_p.Y263C	NM_020191	NP_064576	P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	304						mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(2)|skin(1)	3						GTCCAGCTGTATCACGTGCTC	0.413													34	72	---	---	---	---	PASS
PLSCR5	389158	broad.mit.edu	37	3	146311927	146311927	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146311927A>C	uc003ewb.2	-	4	1237	c.233T>G	c.(232-234)ATG>AGG	p.M78R	PLSCR5_uc010hvb.2_Missense_Mutation_p.M66R|PLSCR5_uc010hvc.2_Missense_Mutation_p.M78R	NM_001085420	NP_001078889	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	78											0						ACCAAGTATCACTAATGGAAC	0.303													79	106	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160254590	160254590	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160254590T>G	uc003fdn.2	-	2	414	c.108A>C	c.(106-108)TTA>TTC	p.L36F		NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4	36	IBB.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TCACCTTCCTTAATTCAACTA	0.204													18	236	---	---	---	---	PASS
LPP	4026	broad.mit.edu	37	3	188426268	188426268	+	Intron	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188426268G>A	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_3'UTR|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		CAGCTCCACTGGTAAAGTATT	0.408			T	HMGA2|MLL|C12orf9	lipoma|leukemia								13	37	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13602085	13602085	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13602085T>C	uc003gmz.1	-	10	6556	c.6439A>G	c.(6439-6441)AGC>GGC	p.S2147G	BOD1L_uc010idr.1_Missense_Mutation_p.S1484G	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	2147							DNA binding			ovary(5)|breast(1)	6						TCCCCTATGCTTGTGGAAATC	0.502													40	68	---	---	---	---	PASS
UTP3	57050	broad.mit.edu	37	4	71555786	71555786	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71555786A>C	uc003hfo.2	+	1	1591	c.1392A>C	c.(1390-1392)GAA>GAC	p.E464D		NM_020368	NP_065101	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit processome component	464					brain development|chromatin modification|gene silencing	nucleolus					0			Lung(101;0.235)			ATAGTGGTGAATTATCTGGCA	0.373													60	133	---	---	---	---	PASS
HNRPDL	9987	broad.mit.edu	37	4	83350567	83350567	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83350567T>C	uc003hmr.2	-	1	812	c.277A>G	c.(277-279)AGC>GGC	p.S93G	ENOPH1_uc003hmv.2_5'Flank|ENOPH1_uc003hmw.2_5'Flank|ENOPH1_uc003hmx.2_5'Flank|HNRPDL_uc003hmq.2_RNA|HNRPDL_uc003hms.2_RNA|HNRPDL_uc003hmt.2_Missense_Mutation_p.S93G	NM_031372	NP_112740	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	93					regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|heterogeneous nuclear ribonucleoprotein complex	double-stranded DNA binding|nucleotide binding|poly(A) RNA binding|protein binding|single-stranded DNA binding			skin(1)	1		Hepatocellular(203;0.114)				TGTATGGAGCTGGATTTAAAA	0.677													20	37	---	---	---	---	PASS
INTU	27152	broad.mit.edu	37	4	128605608	128605608	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128605608A>T	uc003ifk.1	+	7	1296	c.1226A>T	c.(1225-1227)CAA>CTA	p.Q409L	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	409										ovary(1)	1						AATGTCATCCAAACCTTAAAA	0.279													21	61	---	---	---	---	PASS
DHX29	54505	broad.mit.edu	37	5	54552206	54552206	+	3'UTR	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54552206G>A	uc003jpx.2	-	27					DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29								ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTAATGGCTAGTACCAACATT	0.289													4	10	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140255597	140255597	+	Silent	SNP	T	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140255597T>G	uc003lic.2	+	1	667	c.540T>G	c.(538-540)CTT>CTG	p.L180L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.L180L	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	180	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTTGAGCTTAAAATAAAAA	0.373													77	50	---	---	---	---	PASS
C5orf25	375484	broad.mit.edu	37	5	175772242	175772242	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175772242C>T	uc003mds.3	+	12	2820	c.2413C>T	c.(2413-2415)CCC>TCC	p.P805S	C5orf25_uc003mdt.3_Missense_Mutation_p.P390S|C5orf25_uc003mdr.3_RNA|C5orf25_uc003mdv.2_Missense_Mutation_p.P266S			Q8NDZ2	CE025_HUMAN	RecName: Full=Uncharacterized protein C5orf25;	805											0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		AAGGATTAAGCCCAAACCCCA	0.493													105	100	---	---	---	---	PASS
MICA	4276	broad.mit.edu	37	6	31379000	31379000	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31379000G>T	uc003ntk.1	+	3	516	c.477G>T	c.(475-477)CAG>CAT	p.Q159H	MICA_uc003rxz.1_Intron					RecName: Full=MHC class I polypeptide-related sequence A;          Short=MIC-A; Flags: Precursor;												0		Ovarian(999;0.0253)				CCAGAGCTCAGACCTTGGCCA	0.537													7	16	---	---	---	---	PASS
TINAG	27283	broad.mit.edu	37	6	54212217	54212217	+	Silent	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54212217T>C	uc003pcj.2	+	6	947	c.801T>C	c.(799-801)AAT>AAC	p.N267N	TINAG_uc010jzt.2_Intron	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	267					cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			ACACGGCCAATCTATCCCCTC	0.433													34	54	---	---	---	---	PASS
HERPUD2	64224	broad.mit.edu	37	7	35733856	35733856	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35733856A>C	uc003tet.2	-	1	890	c.85T>G	c.(85-87)TTC>GTC	p.F29V	HERPUD2_uc003tes.3_Missense_Mutation_p.F29V|uc003teu.3_5'Flank	NM_022373	NP_071768	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	29	Ubiquitin-like.				response to unfolded protein	integral to membrane				ovary(3)	3						CAGTTCAAGAAGCAGCTAATA	0.478													8	254	---	---	---	---	PASS
TNS3	64759	broad.mit.edu	37	7	47384579	47384579	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47384579T>C	uc003tnv.2	-	19	2876	c.2509A>G	c.(2509-2511)AGC>GGC	p.S837G	TNS3_uc003tnw.2_Missense_Mutation_p.S837G	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	837						focal adhesion	protein binding			ovary(4)	4						GACTCCTTGCTACTTAAAATT	0.483													40	76	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48313955	48313955	+	Silent	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48313955C>T	uc003toq.2	+	17	4717	c.4692C>T	c.(4690-4692)AAC>AAT	p.N1564N	ABCA13_uc010kyr.2_Silent_p.N1067N	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	1564					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TTTACTTTAACATCCTGGAAA	0.313													82	148	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732843	52732843	+	3'UTR	SNP	C	T	T	rs116069210	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732843C>T	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTCTTTTAACTCCTAACAAA	0.284													3	24	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732871	52732871	+	3'UTR	SNP	T	C	C	rs77261625	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732871T>C	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTTTCAAGACTAAAGGAATTA	0.313													4	46	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62588827	62588827	+	Intron	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62588827A>G	uc003xuj.2	-						ASPH_uc011leg.1_Intron|ASPH_uc003xuo.2_Intron|ASPH_uc011leh.1_Intron|ASPH_uc003xul.2_Intron|ASPH_uc011lei.1_Intron|ASPH_uc011lej.1_Intron|ASPH_uc003xun.2_Intron|ASPH_uc011lek.1_Intron|ASPH_uc003xum.2_Intron|ASPH_uc011lel.1_Intron|ASPH_uc011lem.1_Intron|ASPH_uc003xur.2_Missense_Mutation_p.L140P|ASPH_uc003xus.2_3'UTR	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TAAAATATTAAGGACTTCCTC	0.348													5	18	---	---	---	---	PASS
TRMT12	55039	broad.mit.edu	37	8	125464604	125464604	+	3'UTR	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125464604C>T	uc003yra.3	+	1						NM_017956	NP_060426	Q53H54	TYW2_HUMAN	homolog of yeast tRNA methyltransferase 12						tRNA processing		methyltransferase activity			upper_aerodigestive_tract(1)	1	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTTTTGTCCCCTGGTGATCAG	0.408													6	11	---	---	---	---	PASS
UCK1	83549	broad.mit.edu	37	9	134405914	134405914	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134405914T>G	uc004cay.2	-	2	328	c.227A>C	c.(226-228)AAG>ACG	p.K76T	UCK1_uc010mzk.2_Missense_Mutation_p.K67T|UCK1_uc004cba.2_Missense_Mutation_p.K76T|UCK1_uc004caz.2_RNA	NM_031432	NP_113620	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1 isoform a	76					pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		GGCCTTGGCCTTCTGCTCTGC	0.577													43	95	---	---	---	---	PASS
RAPGEF1	2889	broad.mit.edu	37	9	134612882	134612882	+	Translation_Start_Site	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134612882C>T	uc004cbc.2	-	1	50	c.-80G>A	c.(-82--78)AAGTG>AAATG		RAPGEF1_uc010mzn.2_Intron|RAPGEF1_uc004cbd.2_Intron	NM_005312	NP_005303	Q13905	RPGF1_HUMAN	guanine nucleotide-releasing factor 2 isoform a						activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GGAGCAGGCACTTTCATCTAC	0.542													19	43	---	---	---	---	PASS
C9orf96	169436	broad.mit.edu	37	9	136260828	136260828	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136260828A>C	uc004cdk.2	+	9	865	c.804A>C	c.(802-804)GAA>GAC	p.E268D	C9orf96_uc004cdl.2_RNA	NM_153710	NP_714921	Q8NE28	SGK71_HUMAN	hypothetical protein LOC169436	268	Protein kinase.						ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CGGATGTGGAAACCTTCAGGA	0.542													30	76	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50738880	50738880	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50738880A>C	uc001jhs.3	-	3	583	c.429T>G	c.(427-429)TGT>TGG	p.C143W	PGBD3_uc009xoe.2_Missense_Mutation_p.C143W|PGBD3_uc001jhu.2_Missense_Mutation_p.C143W	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	143					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						GGGATGTCGTACATGACCTGA	0.338								Direct_reversal_of_damage|NER					53	99	---	---	---	---	PASS
VCL	7414	broad.mit.edu	37	10	75860838	75860838	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75860838C>G	uc001jwd.2	+	14	2099	c.2005C>G	c.(2005-2007)CGA>GGA	p.R669G	VCL_uc009xrr.2_Missense_Mutation_p.R418G|VCL_uc010qky.1_Missense_Mutation_p.R576G|VCL_uc001jwe.2_Missense_Mutation_p.R669G|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL	669	N-terminal globular head.				adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					GAAGACGGCCCGAGAACTCAC	0.458													12	32	---	---	---	---	PASS
SMPD1	6609	broad.mit.edu	37	11	6415569	6415569	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6415569A>T	uc001mcw.2	+	6	1802	c.1628A>T	c.(1627-1629)GAA>GTA	p.E543V	SMPD1_uc001mcv.1_RNA|SMPD1_uc009yex.2_RNA|SMPD1_uc001mcx.2_Missense_Mutation_p.E499V|SMPD1_uc009yew.2_Missense_Mutation_p.E542V	NM_000543	NP_000534	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid	541					cell death|ceramide biosynthetic process|negative regulation of MAP kinase activity|nervous system development|positive regulation of protein dephosphorylation|signal transduction|sphingomyelin catabolic process|termination of signal transduction	lysosome	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Desipramine(DB01151)	AGGGCTCGAGAAACCTATGGG	0.557													27	53	---	---	---	---	PASS
MTCH2	23788	broad.mit.edu	37	11	47652589	47652589	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47652589A>G	uc010rho.1	-	7	667	c.478T>C	c.(478-480)TGT>CGT	p.C160R	MTCH2_uc001nge.2_Missense_Mutation_p.C33R|MTCH2_uc010rhp.1_Missense_Mutation_p.C12R	NM_014342	NP_055157	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	160	Solcar 2.				transport	integral to membrane|mitochondrial inner membrane					0						AATACTTACCAGTACTTGGAT	0.254													41	66	---	---	---	---	PASS
KDM5A	5927	broad.mit.edu	37	12	442728	442728	+	Silent	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:442728A>G	uc001qif.1	-	12	1941	c.1578T>C	c.(1576-1578)TTT>TTC	p.F526F	KDM5A_uc001qie.1_Silent_p.F526F|KDM5A_uc010sdn.1_Silent_p.F485F|KDM5A_uc010sdo.1_Silent_p.F145F	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	526	JmjC.				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						GCTGGGATTCAAATAACTCGG	0.502			T 	NUP98	AML								51	83	---	---	---	---	PASS
TAS2R13	50838	broad.mit.edu	37	12	11060895	11060895	+	3'UTR	SNP	A	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11060895A>T	uc001qzg.1	-	1					PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron	NM_023920	NP_076409	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13						sensory perception of taste	integral to membrane	taste receptor activity			breast(1)|skin(1)	2						GGGGAAGCATAAAATATCTTT	0.308													8	20	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32949147	32949147	+	Silent	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32949147G>A	uc001rlj.3	-	12	2500	c.2385C>T	c.(2383-2385)GCC>GCT	p.A795A	PKP2_uc001rlk.3_Silent_p.A751A|PKP2_uc010skj.1_Silent_p.A748A	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	795	ARM 7.				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					ATGTGTAACAGGCAGAGGCTG	0.443													31	36	---	---	---	---	PASS
ESPL1	9700	broad.mit.edu	37	12	53682952	53682952	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53682952T>C	uc001sck.2	+	21	4878	c.4787T>C	c.(4786-4788)CTC>CCC	p.L1596P	ESPL1_uc001scj.2_Missense_Mutation_p.L1271P	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	1596					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						CCTAGTGGGCTCTATGCCCAC	0.567													43	98	---	---	---	---	PASS
MYL6	4637	broad.mit.edu	37	12	56554166	56554166	+	Intron	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56554166T>C	uc001sjw.1	+						MYL6_uc001sjv.2_3'UTR|MYL6_uc001sjx.1_Intron|MYL6_uc010sqd.1_3'UTR|MYL6_uc001sjz.2_3'UTR|MYL6_uc010sqe.1_Intron	NM_021019	NP_066299	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and						axon guidance|muscle filament sliding|skeletal muscle tissue development	cytosol|unconventional myosin complex	actin-dependent ATPase activity|calcium ion binding|motor activity|structural constituent of muscle			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			AAGTATAGTGTCTGGGGCTTT	0.572													10	11	---	---	---	---	PASS
RDH16	8608	broad.mit.edu	37	12	57346629	57346629	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57346629C>T	uc001smi.3	-	3	890	c.718G>A	c.(718-720)GAG>AAG	p.E240K	RDH16_uc009zpa.2_Missense_Mutation_p.E95K	NM_003708	NP_003699	O75452	RDH16_HUMAN	retinol dehydrogenase 16	240	Cytoplasmic (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	binding|electron carrier activity|retinol dehydrogenase activity				0						ACAAACTTCTCGCCATAGGCC	0.502													53	105	---	---	---	---	PASS
FGD6	55785	broad.mit.edu	37	12	95475264	95475264	+	3'UTR	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95475264T>C	uc001tdp.3	-	21					FGD6_uc009zsx.2_3'UTR	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						TTCCACCTCTTTGGAATCACA	0.348													48	57	---	---	---	---	PASS
P2RX2	22953	broad.mit.edu	37	12	133198270	133198270	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133198270G>T	uc001ukj.1	+	11	1128	c.1128G>T	c.(1126-1128)AAG>AAT	p.K376N	P2RX2_uc001uki.1_Missense_Mutation_p.K376N|P2RX2_uc001ukk.1_Missense_Mutation_p.K402N|P2RX2_uc001ukl.1_Missense_Mutation_p.K352N|P2RX2_uc001ukm.1_Missense_Mutation_p.K304N|P2RX2_uc001ukn.1_Missense_Mutation_p.K284N|P2RX2_uc009zyt.1_3'UTR|P2RX2_uc001uko.1_Missense_Mutation_p.K342N	NM_170682	NP_733782	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X2 isoform A	376	Cytoplasmic (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		ACAGCCATAAGAAATTTGACA	0.587													18	47	---	---	---	---	PASS
PCID2	55795	broad.mit.edu	37	13	113854792	113854792	+	Silent	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113854792A>G	uc010tju.1	-	2	156	c.75T>C	c.(73-75)TGT>TGC	p.C25C	PCID2_uc010tjv.1_Silent_p.C25C|PCID2_uc010tjw.1_Silent_p.C25C|PCID2_uc001vte.2_5'UTR|PCID2_uc001vtd.2_5'UTR|PCID2_uc001vtf.2_5'UTR|PCID2_uc001vtg.1_RNA	NM_001127203	NP_001120675	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	25					negative regulation of apoptosis|negative regulation of cysteine-type endopeptidase activity|positive regulation of mitotic cell cycle spindle assembly checkpoint|positive regulation of transcription, DNA-dependent|regulation of mRNA stability|spleen development		protein binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			CCAACTCTGCACAAGATGCTC	0.423													27	70	---	---	---	---	PASS
MNAT1	4331	broad.mit.edu	37	14	61435200	61435200	+	3'UTR	SNP	G	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61435200G>T	uc001xfd.2	+	8					MNAT1_uc001xfe.2_3'UTR	NM_002431	NP_002422	P51948	MAT1_HUMAN	menage a trois 1 (CAK assembly factor)						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein complex assembly|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cytoplasm|holo TFIIH complex	protein N-terminus binding|zinc ion binding			ovary(1)|lung(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		TATTTATAAGGAGAAAATTTC	0.328								Direct_reversal_of_damage|NER					5	2	---	---	---	---	PASS
PRKCH	5583	broad.mit.edu	37	14	61789073	61789073	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61789073C>T	uc001xfn.2	+	1	559	c.254C>T	c.(253-255)GCC>GTC	p.A85V	PRKCH_uc010tsa.1_Intron|uc001xfm.2_Intron	NM_006255	NP_006246	P24723	KPCL_HUMAN	protein kinase C, eta	85	C2.				intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTCGAGTTGGCCGTCTTCCAC	0.642													3	28	---	---	---	---	PASS
HSP90AA1	3320	broad.mit.edu	37	14	102551690	102551690	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102551690A>G	uc001yku.3	-	4	798	c.608T>C	c.(607-609)ATA>ACA	p.I203T	HSP90AA1_uc001ykv.3_Missense_Mutation_p.I325T|HSP90AA1_uc001ykw.1_Missense_Mutation_p.I24T|HSP90AA1_uc001ykx.1_Missense_Mutation_p.I192T	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	203					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)	AATCTCCTTTATTCTTCGTTC	0.363													31	22	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105410662	105410662	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105410662C>T	uc010axc.1	-	7	11246	c.11126G>A	c.(11125-11127)GGC>GAC	p.G3709D	AHNAK2_uc001ypx.2_Missense_Mutation_p.G3609D	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3709						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGCACCTGGCCCTCCGGGAG	0.632													75	63	---	---	---	---	PASS
MSLN	10232	broad.mit.edu	37	16	816775	816775	+	Silent	SNP	C	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:816775C>G	uc002cjw.1	+	13	1413	c.1362C>G	c.(1360-1362)CCC>CCG	p.P454P	MSLN_uc002cjt.1_Silent_p.P446P|MSLN_uc002cju.1_Silent_p.P446P|MSLN_uc010brd.1_Silent_p.P445P|MSLN_uc002cjv.1_Silent_p.P446P|MSLN_uc002cjx.1_Silent_p.P446P|MSLN_uc002cjy.1_Silent_p.P111P	NM_013404	NP_037536	Q13421	MSLN_HUMAN	mesothelin isoform 2 preproprotein	454					cell adhesion	anchored to membrane|extracellular region|Golgi apparatus|plasma membrane				pancreas(1)	1		Hepatocellular(780;0.00335)				CCCTCAGCCCCGAGGAGCTGA	0.647													45	133	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15872668	15872668	+	Silent	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15872668C>T	uc002ddy.2	-	7	866	c.759G>A	c.(757-759)ACG>ACA	p.T253T	MYH11_uc002ddv.2_Silent_p.T260T|MYH11_uc002ddw.2_Silent_p.T253T|MYH11_uc002ddx.2_Silent_p.T260T|MYH11_uc010bvg.2_Silent_p.T85T|MYH11_uc002dea.1_5'UTR	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	253	Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						CGATGTAACCCGTGACGTCGA	0.562			T	CBFB	AML								35	110	---	---	---	---	PASS
METTL9	51108	broad.mit.edu	37	16	21611123	21611123	+	Silent	SNP	G	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21611123G>C	uc002dje.2	+	1	268	c.69G>C	c.(67-69)ACG>ACC	p.T23T	uc002diq.3_Intron|METTL9_uc002djf.2_Silent_p.T23T	NM_016025	NP_057109	Q9H1A3	METL9_HUMAN	methyltransferase like 9 isoform 1	23										ovary(1)	1				GBM - Glioblastoma multiforme(48;0.0759)		GGATGTGGACGCTGCGGAGCC	0.567													9	3	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	64984852	64984852	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64984852G>A	uc002eoi.2	-	12	2146	c.1712C>T	c.(1711-1713)CCC>CTC	p.P571L	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Missense_Mutation_p.P571L|CDH11_uc010vin.1_Missense_Mutation_p.P445L	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	571	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GATCACTATGGGCAGAAGGTA	0.617			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			19	82	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904197	21904197	+	RNA	SNP	C	T	T	rs9904223	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904197C>T	uc002gza.2	+	1		c.136C>T				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						ctcaggcctgccaggacggtg	0.000													5	52	---	---	---	---	PASS
IFI35	3430	broad.mit.edu	37	17	41158865	41158865	+	5'UTR	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41158865A>G	uc010whj.1	+	1						NM_005533	NP_005524	P80217	IN35_HUMAN	interferon-induced protein 35						response to virus|type I interferon-mediated signaling pathway	nucleus	protein binding			ovary(1)	1		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		GAGAGAGACCACAGCCCTTTG	0.547													29	66	---	---	---	---	PASS
IFI35	3430	broad.mit.edu	37	17	41158866	41158866	+	5'UTR	SNP	C	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41158866C>A	uc010whj.1	+	1						NM_005533	NP_005524	P80217	IN35_HUMAN	interferon-induced protein 35						response to virus|type I interferon-mediated signaling pathway	nucleus	protein binding			ovary(1)	1		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		AGAGAGACCACAGCCCTTTGG	0.542													29	67	---	---	---	---	PASS
HLF	3131	broad.mit.edu	37	17	53345085	53345085	+	Intron	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53345085T>C	uc002iug.1	+						HLF_uc010dce.1_Intron|HLF_uc002iuh.2_5'UTR|HLF_uc010wni.1_5'UTR	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor						multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						TCTTTTTTTTTAAGTCCAGCT	0.428			T	TCF3	ALL								21	33	---	---	---	---	PASS
TMEM49	81671	broad.mit.edu	37	17	57915760	57915760	+	Splice_Site	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57915760T>C	uc002ixu.3	+	11	1350	c.1077_splice	c.e11+2	p.Q359_splice	TMEM49_uc010wog.1_Splice_Site_p.Q167_splice|TMEM49_uc010woh.1_Splice_Site_p.Q303_splice|TMEM49_uc010woi.1_Splice_Site_p.Q262_splice|TMEM49_uc010woj.1_Splice_Site_p.Q225_splice|TMEM49_uc002ixv.2_5'Flank|MIR21_hsa-mir-21|MI0000077_5'Flank	NM_030938	NP_112200	Q96GC9	VMP1_HUMAN	transmembrane protein 49						autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)			ACACCACAGGTAAGACTTTAA	0.483													35	55	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9211598	9211598	+	Silent	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9211598T>C	uc002knv.2	+	6	725	c.468T>C	c.(466-468)CAT>CAC	p.H156H	ANKRD12_uc010wzn.1_Silent_p.H156H|ANKRD12_uc002knw.2_Silent_p.H133H|ANKRD12_uc002knx.2_Silent_p.H133H	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	156						nucleus				ovary(2)|central_nervous_system(1)	3						CACCAAATCATCCATCACAAA	0.333													27	59	---	---	---	---	PASS
THEG	51298	broad.mit.edu	37	19	375870	375870	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:375870C>T	uc002lol.2	-	1	140	c.101G>A	c.(100-102)AGC>AAC	p.S34N	THEG_uc002lom.2_Missense_Mutation_p.S34N	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	34					cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTACACAGAGCTCTGGAGGCC	0.667													31	51	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2214517	2214517	+	Silent	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2214517G>A	uc002lvb.3	+	19	1881	c.1845G>A	c.(1843-1845)TCG>TCA	p.S615S	DOT1L_uc002lvc.1_5'UTR|uc002lvd.1_RNA|DOT1L_uc002lve.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	615						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACGCTGTCGCTGGAGAAGC	0.647													18	28	---	---	---	---	PASS
VAV1	7409	broad.mit.edu	37	19	6828883	6828883	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6828883T>C	uc002mfu.1	+	13	1334	c.1237T>C	c.(1237-1239)TCG>CCG	p.S413P	VAV1_uc010xjh.1_Missense_Mutation_p.S381P|VAV1_uc010dva.1_Missense_Mutation_p.S413P|VAV1_uc002mfv.1_Missense_Mutation_p.S358P	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	413	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						CAAGATCACCTCGGTGGAACG	0.602													19	39	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8996442	8996442	+	Silent	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8996442G>A	uc002mkp.2	-	61	41334	c.41130C>T	c.(41128-41130)CAC>CAT	p.H13710H	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.H527H|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGGGGTCAGGGTGGTGGGTGC	0.562													5	86	---	---	---	---	PASS
EMR3	84658	broad.mit.edu	37	19	14749072	14749072	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14749072G>T	uc002mzi.3	-	11	1477	c.1329C>A	c.(1327-1329)CAC>CAA	p.H443Q	EMR3_uc010dzp.2_Missense_Mutation_p.H391Q|EMR3_uc010xnv.1_Missense_Mutation_p.H317Q	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor	443	Cytoplasmic (Potential).				neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						TGAGGAAGAGGTGCACACCCT	0.562													42	82	---	---	---	---	PASS
BLVRB	645	broad.mit.edu	37	19	40971626	40971626	+	5'UTR	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40971626G>A	uc002onw.2	-	1					SPTBN4_uc002onx.2_5'Flank|SPTBN4_uc002ony.2_5'Flank|SPTBN4_uc002onz.2_5'Flank|BLVRB_uc010egw.1_RNA	NM_000713	NP_000704	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase						heme catabolic process	cytosol	biliverdin reductase activity|binding|flavin reductase activity				0			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		NADH(DB00157)|Riboflavin(DB00140)	CAAGGCCTCAGAGTCTCGGCA	0.687													5	10	---	---	---	---	PASS
KDELR1	10945	broad.mit.edu	37	19	48893820	48893820	+	Intron	SNP	C	G	G	rs75517639		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48893820C>G	uc002pjb.1	-						KDELR1_uc002pja.1_5'UTR	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum						intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		gagagagagacagagagagag	0.358													3	35	---	---	---	---	PASS
SIGLEC11	114132	broad.mit.edu	37	19	50461806	50461806	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50461806G>A	uc010ybh.1	-	8	1476	c.1385C>T	c.(1384-1386)CCC>CTC	p.P462L	SIGLEC11_uc010ybi.1_Intron	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	462	Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		GGAGCAGGAGGGGCCCAGCAG	0.697													8	28	---	---	---	---	PASS
CHGB	1114	broad.mit.edu	37	20	5903114	5903114	+	Silent	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5903114G>A	uc002wmg.2	+	4	630	c.324G>A	c.(322-324)GGG>GGA	p.G108G	CHGB_uc010zqz.1_Intron	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	108						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						GAGCCCCAGGGGAGGAGGACA	0.577													23	31	---	---	---	---	PASS
PHF20	51230	broad.mit.edu	37	20	34487450	34487450	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34487450A>T	uc002xek.1	+	10	1552	c.1441A>T	c.(1441-1443)AAG>TAG	p.K481*	PHF20_uc002xei.1_Nonsense_Mutation_p.K481*|PHF20_uc010gfo.1_Nonsense_Mutation_p.K481*|PHF20_uc002xej.1_Nonsense_Mutation_p.K365*	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	481					regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					TGGAATGGAGAAGTCACTGGA	0.493													33	66	---	---	---	---	PASS
MC3R	4159	broad.mit.edu	37	20	54824097	54824097	+	Silent	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54824097C>T	uc002xxb.2	+	1	310	c.198C>T	c.(196-198)AAC>AAT	p.N66N		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	103	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding	p.N103N(1)		ovary(2)|breast(2)	4			Colorectal(105;0.202)			TGGTCAGGAACGGCAACCTGC	0.562													32	53	---	---	---	---	PASS
GRPR	2925	broad.mit.edu	37	X	16142010	16142010	+	5'UTR	SNP	G	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16142010G>A	uc004cxj.2	+	1						NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor						cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)|lung(1)	4	Hepatocellular(33;0.183)					ATCTTCACTCGGTTGCAAAAT	0.348											OREG0019682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	112	68	---	---	---	---	PASS
WAS	7454	broad.mit.edu	37	X	48549645	48549645	+	3'UTR	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48549645A>G	uc004dkm.3	+	12						NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein						blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				CTCCTCTTCCAGGCCCCCAAC	0.592			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				2	11	---	---	---	---	PASS
TSPYL2	64061	broad.mit.edu	37	X	53113886	53113886	+	Intron	SNP	G	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53113886G>T	uc004drw.2	+						TSPYL2_uc004drv.2_Missense_Mutation_p.V323L|TSPYL2_uc004drx.1_5'UTR	NM_022117	NP_071400	Q9H2G4	TSYL2_HUMAN	TSPY-like 2						cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding				0						GGGAAGGGCCGTGGTGTGTTG	0.542													30	15	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91133909	91133909	+	Silent	SNP	A	G	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133909A>G	uc004efk.1	+	2	3515	c.2670A>G	c.(2668-2670)GAA>GAG	p.E890E	PCDH11X_uc004efl.1_Silent_p.E890E|PCDH11X_uc004efo.1_Silent_p.E890E|PCDH11X_uc010nmv.1_Silent_p.E890E|PCDH11X_uc004efm.1_Silent_p.E890E|PCDH11X_uc004efn.1_Silent_p.E890E|PCDH11X_uc004efh.1_Silent_p.E890E|PCDH11X_uc004efj.1_Silent_p.E890E	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	890	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CTATTGAAGAAACTAAGGCAG	0.338													5	115	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107909822	107909822	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107909822C>T	uc004enz.1	+	39	3753	c.3551C>T	c.(3550-3552)CCA>CTA	p.P1184L	COL4A5_uc011mso.1_Missense_Mutation_p.P1184L	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	1184	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						AAGGGTGAACCAGGTGCTGTA	0.433									Alport_syndrome_with_Diffuse_Leiomyomatosis				10	16	---	---	---	---	PASS
TMEM201	199953	broad.mit.edu	37	1	9647987	9647988	+	5'Flank	DEL	TC	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9647987_9647988delTC	uc001apz.2	+						TMEM201_uc001apy.2_5'Flank	NM_001130924	NP_001124396	Q5SNT2	TM201_HUMAN	transmembrane protein 201 isoform 1							integral to membrane|nuclear inner membrane					0	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		cttccttctttctctctctctc	0.059													9	4	---	---	---	---	
CASZ1	54897	broad.mit.edu	37	1	10845186	10845187	+	Intron	INS	-	TTCCTTCT	TTCCTTCT	rs140440931	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10845186_10845187insTTCCTTCT	uc001aro.2	-						CASZ1_uc001arp.1_Intron	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		tctttcctttcttccttccttc	0.000													4	3	---	---	---	---	
NECAP2	55707	broad.mit.edu	37	1	16785155	16785155	+	Intron	DEL	A	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16785155delA	uc001ayo.2	+						NECAP2_uc001ayp.3_Intron|NECAP2_uc010ocd.1_Intron|NECAP2_uc001ayq.2_Intron	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1						endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TTAACTATTTAAAAAAAAAAA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30196436	30196436	+	IGR	DEL	C	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30196436delC								PTPRU (543121 upstream) : MATN1 (987690 downstream)																							ccaccaccatcaccactacca	0.000													6	3	---	---	---	---	
TXNDC12	51060	broad.mit.edu	37	1	52520880	52520880	+	5'UTR	DEL	T	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52520880delT	uc001cti.2	-	1					BTF3L4_uc001ctk.2_5'Flank|BTF3L4_uc001ctl.2_5'Flank|BTF3L4_uc010onh.1_5'Flank	NM_015913	NP_056997	O95831	AIFM1_HUMAN	thioredoxin domain containing 12 precursor						activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(1)	1						ACTTCCCAGATTTTTTTTTTT	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	76412548	76412549	+	IGR	INS	-	CTTC	CTTC	rs56952079		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76412548_76412549insCTTC								ASB17 (14432 upstream) : ST6GALNAC3 (127840 downstream)																							agctgatttatcttccttcctt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	100288464	100288466	+	IGR	DEL	ACC	-	-	rs79614284		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100288464_100288466delACC								FRRS1 (57115 upstream) : AGL (27174 downstream)																							tacctcctctacctcctctacct	0.059													6	3	---	---	---	---	
FAM102B	284611	broad.mit.edu	37	1	109167068	109167069	+	Intron	INS	-	AC	AC	rs78911235		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109167068_109167069insAC	uc010ouy.1	+							NM_001010883	NP_001010883	Q5T8I3	F102B_HUMAN	hypothetical protein LOC284611											large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		AAAAAAAAAAAAAACCCTTTTC	0.356													3	3	---	---	---	---	
F5	2153	broad.mit.edu	37	1	169515419	169515420	+	Intron	DEL	AC	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169515419_169515420delAC	uc001ggg.1	-							NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	ATGTCTGTGTacacacacacac	0.361													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184081582	184081602	+	IGR	DEL	GGAAGGAAGGAAGGAAGGAGG	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184081582_184081602delGGAAGGAAGGAAGGAAGGAGG								TSEN15 (38241 upstream) : C1orf21 (274548 downstream)																							aaggaaggaaggaaggaaggaaggaaggaggggaggggagg	0.140													3	4	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235945480	235945480	+	Intron	DEL	C	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235945480delC	uc001hxj.2	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ATGGGGAAttctttttttttt	0.139									Chediak-Higashi_syndrome				5	3	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241901461	241901463	+	Intron	DEL	CTG	-	-	rs35933135		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241901461_241901463delCTG	uc001hze.1	+						WDR64_uc001hzf.1_Intron			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			AAAGTAATCACTGCTGCTATTTT	0.305													3	4	---	---	---	---	
GRHL1	29841	broad.mit.edu	37	2	10101687	10101687	+	Intron	DEL	T	-	-	rs138724700		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10101687delT	uc002raa.2	+						GRHL1_uc002rab.2_Intron|GRHL1_uc002rad.2_Intron|GRHL1_uc010yjb.1_Intron	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1						cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		GAATAAAAGATTTTTTTTTTA	0.363													9	4	---	---	---	---	
PNPT1	87178	broad.mit.edu	37	2	55914573	55914574	+	Intron	INS	-	A	A	rs11386711		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55914573_55914574insA	uc002rzf.2	-						PNPT1_uc002rzg.2_Intron	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1						mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			gagtccacctcaaaaaaaaaaa	0.158													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108061691	108061698	+	IGR	DEL	AGGAAGGA	-	-	rs10530423		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108061691_108061698delAGGAAGGA								ST6GAL2 (558128 upstream) : LOC729121 (377822 downstream)																							CAATAGAACCaggaaggaaggaaggaag	0.163													6	3	---	---	---	---	
C2orf60	129450	broad.mit.edu	37	2	200803934	200803935	+	Intron	DEL	TC	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200803934_200803935delTC	uc002uvi.3	-						C2orf60_uc002uvj.3_Intron|C2orf60_uc002uvk.3_Intron|C2orf60_uc010fss.2_Intron	NM_001039693	NP_001034782	A2RUC4	TYW5_HUMAN	hypothetical protein LOC129450						wybutosine biosynthetic process		iron ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein homodimerization activity|tRNA binding				0						tctctatctttctctctctctc	0.153													5	3	---	---	---	---	
CXCR7	57007	broad.mit.edu	37	2	237475361	237475362	+	Intron	INS	-	CCTT	CCTT			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237475361_237475362insCCTT	uc010fyq.2	+							NM_020311	NP_064707	P25106	CXCR7_HUMAN	chemokine orphan receptor 1						interspecies interaction between organisms	integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3		Breast(86;0.000182)|Renal(207;0.00339)|all_hematologic(139;0.0048)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|all_lung(227;0.147)|all_neural(83;0.223)		Epithelial(121;8.35e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.09e-11)|Kidney(56;1.11e-07)|KIRC - Kidney renal clear cell carcinoma(57;3.03e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000176)|Lung(119;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.118)		tcctttccttcccttccttcct	0.054													6	3	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52662911	52662911	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52662911delT	uc003des.2	-	12	1454	c.1442delA	c.(1441-1443)CAGfs	p.Q481fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.Q481fs|PBRM1_uc003der.2_Frame_Shift_Del_p.Q449fs|PBRM1_uc003det.2_Frame_Shift_Del_p.Q481fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.Q481fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.Q481fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.Q481fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.Q481fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.Q481fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.Q379fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	481					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AAATCACACCTGCATAACTTG	0.363			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								50	43	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	87543497	87543498	+	IGR	DEL	AG	-	-	rs146116458		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87543497_87543498delAG								POU1F1 (217760 upstream) : HTR1F (488228 downstream)																							aaagagaaaaagaaagaagaag	0.000													11	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128937733	128937736	+	IGR	DEL	CTTC	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128937733_128937736delCTTC								CNBP (34923 upstream) : COPG (30717 downstream)																							cattctttctcttccttccttcct	0.235													8	5	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176787605	176787606	+	Intron	INS	-	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176787605_176787606insA	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron|TBL1XR1_uc003fiy.2_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			aggaaggaaggaaggaaggaag	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	149728799	149728799	+	IGR	DEL	A	-	-	rs55707547		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149728799delA								NR3C2 (365156 upstream) : None (None downstream)																							ggaaggaaggaaaggaaggaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2681739	2681740	+	IGR	INS	-	AAGG	AAGG	rs139363319	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2681739_2681740insAAGG								IRX4 (798859 upstream) : IRX2 (64541 downstream)																							aaagagagagaaaggaaggaag	0.000													6	3	---	---	---	---	
PARP8	79668	broad.mit.edu	37	5	49962737	49962738	+	Intron	INS	-	CCT	CCT	rs151280834	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49962737_49962738insCCT	uc003jon.3	+						PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_5'Flank|PARP8_uc003jop.2_5'Flank	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				GCCGAcctccccctcctcctcc	0.450													4	2	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94805757	94805757	+	Intron	DEL	T	-	-	rs72469885		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94805757delT	uc003klb.2	-							NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						ctcggctcacttgcaagctct	0.020													4	2	---	---	---	---	
CHD1	1105	broad.mit.edu	37	5	98204056	98204056	+	Intron	DEL	G	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98204056delG	uc003knf.2	-						CHD1_uc010jbn.2_Intron	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	aaaaaaaaaaGACACCCTTCA	0.129													11	6	---	---	---	---	
REEP5	7905	broad.mit.edu	37	5	112237915	112237915	+	Intron	DEL	G	-	-	rs141436136		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112237915delG	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		gcATTtttttgtttttgtttt	0.104													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166706520	166706523	+	IGR	DEL	TTCC	-	-	rs56332524		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166706520_166706523delTTCC								None (None upstream) : ODZ2 (5320 downstream)																							cttccttcctttccttccttcctt	0.000													1	6	---	---	---	---	
NOP16	51491	broad.mit.edu	37	5	175814066	175814069	+	Intron	DEL	TCTC	-	-	rs145796794		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175814066_175814069delTCTC	uc011dfl.1	-						NOP16_uc003med.2_Intron|NOP16_uc003mee.2_Intron|NOP16_uc011dfm.1_Intron|HIGD2A_uc003meg.2_5'Flank	NM_016391	NP_057475	Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein homolog							nucleolus				ovary(1)|central_nervous_system(1)	2						GGAGGCTTTTTCTCTCTCtctctc	0.245													2	5	---	---	---	---	
PAK1IP1	55003	broad.mit.edu	37	6	10703035	10703035	+	Intron	DEL	T	-	-	rs79574852		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10703035delT	uc003mzg.2	+							NM_017906	NP_060376	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1						negative regulation of signal transduction	nucleolus|plasma membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				Gttttctttcttttttttttg	0.164													4	2	---	---	---	---	
MAPK13	5603	broad.mit.edu	37	6	36098497	36098498	+	Intron	INS	-	GGGGGGC	GGGGGGC	rs146539855	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36098497_36098498insGGGGGGC	uc003ols.2	+						MAPK13_uc003olt.2_Intron	NM_002754	NP_002745	O15264	MK13_HUMAN	mitogen-activated protein kinase 13						cell cycle|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|positive regulation of interleukin-6 production|Ras protein signal transduction|response to stress		ATP binding|MAP kinase activity|protein binding			breast(2)|central_nervous_system(1)	3						CCTgggccgctggggggcgggg	0.599													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127384124	127384125	+	Intron	DEL	GT	-	-	rs146490292		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127384124_127384125delGT	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		Ttgtgtgtgcgtgtgtgtgtgt	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	132472514	132472515	+	Intron	INS	-	GT	GT	rs143810167		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132472514_132472515insGT	uc003qdd.2	+											Homo sapiens full length insert cDNA clone ZC30H06.																		tgtgtctaaaagtgtgtgtgtg	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65083820	65083821	+	IGR	INS	-	T	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65083820_65083821insT								ZNF92 (217823 upstream) : INTS4L2 (28956 downstream)																							TTTGTTATGTGTTTTTTTTTCT	0.351													8	5	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74129040	74129040	+	Intron	DEL	T	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74129040delT	uc003uau.2	+						GTF2I_uc003uat.2_Intron|GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|uc003uaz.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						CTTGTCAGTCttttttttttt	0.294													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131319326	131319331	+	IGR	DEL	CTTTCT	-	-	rs66806444		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131319326_131319331delCTTTCT								PODXL (77950 upstream) : PLXNA4 (488761 downstream)																							tccttccttcctttctctctctctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141494467	141494468	+	IGR	DEL	TG	-	-	rs80234856		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141494467_141494468delTG								TAS2R5 (3301 upstream) : PRSS37 (41618 downstream)																							GCTGGATCCAtgtgtgcgtgtg	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149588495	149588497	+	IGR	DEL	CTT	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149588495_149588497delCTT								ATP6V0E2 (10709 upstream) : ACTR3C (355805 downstream)																							TAAAGGTCTCCTTCTCATTGCAG	0.355													24	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33472755	33472758	+	IGR	DEL	CTTC	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33472755_33472758delCTTC								DUSP26 (15316 upstream) : None (None downstream)																							ttccttccttcttccttccttcct	0.137													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	86890674	86890675	+	IGR	DEL	AC	-	-	rs34454718		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86890674_86890675delAC								REXO1L1 (315406 upstream) : PSKH2 (170018 downstream)																							ctcacacacaacacacacacac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	83063954	83063977	+	IGR	DEL	AAGGAAGGAAGGAAGGAAGGAAGA	-	-	rs148606659	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83063954_83063977delAAGGAAGGAAGGAAGGAAGGAAGA								TLE4 (722297 upstream) : None (None downstream)																							ggaaggaaggaaggaaggaaggaaggaaggaagaaaggaaggaa	0.134													5	3	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136798852	136798853	+	Intron	INS	-	TGGATGGA	TGGATGGA	rs149852975	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136798852_136798853insTGGATGGA	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		tggatggatggtggatgaatgg	0.000													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6815047	6815050	+	IGR	DEL	TTCC	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6815047_6815050delTTCC								PRKCQ (192809 upstream) : SFMBT2 (389199 downstream)																							CTTGTACtctttccttccttcctt	0.225													4	3	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	57298158	57298161	+	Intron	DEL	CTTC	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57298158_57298161delCTTC	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				tccttcctttcttccttccttcct	0.137										HNSCC(58;0.16)			11	5	---	---	---	---	
DDX50	79009	broad.mit.edu	37	10	70689049	70689050	+	Intron	DEL	CT	-	-	rs71187036		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70689049_70689050delCT	uc001jou.2	+						DDX50_uc010qjc.1_Intron	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						tccttccttcctctctctctct	0.015													4	2	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72245966	72245967	+	Intron	DEL	TT	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72245966_72245967delTT	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						AGTCAATATCTTTTTTTTTTTT	0.431													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	72397905	72397906	+	IGR	INS	-	TCCT	TCCT	rs143397937	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72397905_72397906insTCCT								PRF1 (35374 upstream) : ADAMTS14 (34653 downstream)																							ACAGCTTATGAtccttccttcc	0.020													4	2	---	---	---	---	
ABCC2	1244	broad.mit.edu	37	10	101579171	101579172	+	Intron	DEL	TG	-	-	rs5787360		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101579171_101579172delTG	uc001kqf.2	+							NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	TTCTGGGTTCTGTGTCTCTTTG	0.416													6	3	---	---	---	---	
IFITM1	8519	broad.mit.edu	37	11	314534	314534	+	Intron	DEL	T	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:314534delT	uc001loy.3	+							NM_003641	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1						negative regulation of cell proliferation|regulation of immune response|response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding|receptor signaling protein activity				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGTGTGTGGCTTTGGGGAATC	0.567													10	6	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17452095	17452095	+	Intron	DEL	T	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17452095delT	uc001mnc.2	-							NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	tcaacaCTGGTTTTTTTTTTT	0.244													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43198738	43198739	+	IGR	INS	-	TG	TG	rs34466463	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43198738_43198739insTG								None (None upstream) : API5 (134766 downstream)																							Atgtgtgtgtctgtgtgtgtgt	0.139													4	2	---	---	---	---	
DLAT	1737	broad.mit.edu	37	11	111897046	111897047	+	Intron	DEL	AA	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111897046_111897047delAA	uc001pmo.2	+						DLAT_uc009yyk.1_Intron|DLAT_uc010rwr.1_Intron	NM_001931	NP_001922	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase precursor						glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial pyruvate dehydrogenase complex	dihydrolipoyllysine-residue acetyltransferase activity|protein binding				0		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)	NADH(DB00157)	ttttttttttaattaatttatt	0.193													6	3	---	---	---	---	
KDM5A	5927	broad.mit.edu	37	12	492921	492921	+	Intron	DEL	T	-	-	rs71839973		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:492921delT	uc001qif.1	-						KDM5A_uc001qie.1_Intron|KDM5A_uc010sdn.1_Intron|KDM5A_uc010sdo.1_Intron	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TTCATTGTCCttttttttttt	0.109			T 	NUP98	AML								4	2	---	---	---	---	
BCL2L14	79370	broad.mit.edu	37	12	12243579	12243580	+	Intron	DEL	AT	-	-	rs71913876		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12243579_12243580delAT	uc001rac.2	+						ETV6_uc001raa.1_Intron|BCL2L14_uc001raf.1_Intron|BCL2L14_uc001rad.2_Intron|BCL2L14_uc001rae.2_Intron	NM_138723	NP_620049	Q9BZR8	B2L14_HUMAN	BCL2-like 14 isoform 1						apoptosis|regulation of apoptosis	cytosol|endomembrane system|intracellular organelle|membrane	protein binding			skin(1)	1		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		aaaataaaaaataaaaaaaaaa	0.173													4	2	---	---	---	---	
TMBIM4	51643	broad.mit.edu	37	12	66539380	66539381	+	Intron	INS	-	T	T	rs75752811		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66539380_66539381insT	uc001stc.2	-						LLPH_uc010ssx.1_Intron|TMBIM4_uc001std.2_Intron|TMBIM4_uc009zqr.2_Intron|TMBIM4_uc001ste.2_Intron|TMBIM4_uc001stf.2_Intron|TMBIM4_uc009zqs.2_Intron	NM_016056	NP_057140	Q9HC24	TMBI4_HUMAN	transmembrane BAX inhibitor motif containing 4							integral to membrane	protein binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(28;0.0745)		TGGAAAGCTTATTTTTTTTTTT	0.342													4	2	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120194922	120194922	+	Intron	DEL	A	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120194922delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		agactctcttaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	83421151	83421154	+	IGR	DEL	AAGG	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83421151_83421154delAAGG								None (None upstream) : None (None downstream)																							ggaagaaacaaaggaaggaaggaa	0.000													4	3	---	---	---	---	
C14orf179	112752	broad.mit.edu	37	14	76527155	76527156	+	Intron	INS	-	CCTCCCTC	CCTCCCTC	rs142190540	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76527155_76527156insCCTCCCTC	uc010asm.1	+						C14orf179_uc001xsf.2_Intron|C14orf179_uc010asl.1_Intron|C14orf179_uc001xsg.2_Intron|C14orf179_uc010tve.1_Intron	NM_001102564	NP_001096034	Q96FT9	IFT43_HUMAN	hypothetical protein LOC112752 isoform 2						cilium morphogenesis|intraflagellar retrograde transport						0				BRCA - Breast invasive adenocarcinoma(234;0.0199)		ttccctcccttcctccctccct	0.000													5	3	---	---	---	---	
ATXN3	4287	broad.mit.edu	37	14	92548993	92548993	+	Intron	DEL	C	-	-	rs74619884		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92548993delC	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron|ATXN3_uc010twl.1_Intron	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		ttttccgtttctttttttttt	0.114													3	3	---	---	---	---	
GALK2	2585	broad.mit.edu	37	15	49470575	49470576	+	Intron	INS	-	AT	AT	rs150435365	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49470575_49470576insAT	uc001zxj.1	+						GALK2_uc001zxi.1_Intron|GALK2_uc010ufb.1_Intron|GALK2_uc001zxk.2_Intron|GALK2_uc010ufc.1_Intron	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1						galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		tatatatgtaCATATATATATA	0.208													1	5	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85449760	85449775	+	Intron	DEL	TTTCTTTCTTTCTTTC	-	-	rs71694770		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85449760_85449775delTTTCTTTCTTTCTTTC	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			tgtttgtttgtttctttctttctttctttctttctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	91577398	91577398	+	Intron	DEL	G	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91577398delG	uc002bqs.1	+											Homo sapiens cDNA FLJ30789 fis, clone FEBRA2000937.																		TCCTGCTGCCGGTTCAGGTGA	0.627													0	7	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													9	4	---	---	---	---	
AMFR	267	broad.mit.edu	37	16	56443637	56443637	+	Intron	DEL	G	-	-	rs56335174		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56443637delG	uc002eiy.2	-							NM_001144	NP_001135	Q9UKV5	AMFR2_HUMAN	autocrine motility factor receptor						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2						Caagaaaacagaaaaaaaaaa	0.338													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74419886	74419887	+	Intron	DEL	TC	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74419886_74419887delTC	uc010vmt.1	+											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GGTtttcctttctctctttttt	0.173													6	3	---	---	---	---	
GLG1	2734	broad.mit.edu	37	16	74576658	74576659	+	Intron	INS	-	G	G	rs71789990		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74576658_74576659insG	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						gaaggaaggaaggaaggaagga	0.074													5	3	---	---	---	---	
ZCCHC14	23174	broad.mit.edu	37	16	87500638	87500638	+	Intron	DEL	A	-	-	rs11313581		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87500638delA	uc002fjz.1	-						ZCCHC14_uc002fka.1_Intron	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14						cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GTTTTTCATGAAAAAAAAAAA	0.219													3	3	---	---	---	---	
FNDC8	54752	broad.mit.edu	37	17	33449007	33449007	+	Intron	DEL	T	-	-	rs67915235		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33449007delT	uc002hix.2	+						RFFL_uc002hiq.2_5'Flank|RAD51L3_uc002hir.2_5'Flank|RAD51L3_uc010wcd.1_5'Flank|RAD51L3_uc002his.2_5'Flank|RAD51L3_uc010ctk.2_5'Flank|RAD51L3_uc010wce.1_5'Flank|RAD51L3_uc002hit.2_5'Flank|RAD51L3_uc002hiu.2_5'Flank|RAD51L3_uc010wcf.1_5'Flank|RAD51L3_uc002hiw.1_5'Flank|RAD51L3_uc002hiv.1_5'Flank|RAD51L3_uc010ctl.1_5'Flank|RAD51L3_uc010ctm.1_5'Flank	NM_017559	NP_060029	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8											ovary(2)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		ccttccttccttttttttttt	0.065													7	4	---	---	---	---	
MED1	5469	broad.mit.edu	37	17	37596356	37596357	+	Intron	DEL	AG	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37596356_37596357delAG	uc002hrv.3	-						MED1_uc010wee.1_Intron|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1						androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		aaagaaagaaagaaaaaagaaa	0.119										HNSCC(31;0.082)			4	5	---	---	---	---	
RNF126P1	376412	broad.mit.edu	37	17	55120288	55120289	+	5'Flank	DEL	TT	-	-	rs71363880		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55120288_55120289delTT	uc002iuw.2	+							NR_002818				Homo sapiens ring finger protein 126 pseudogene 1, mRNA (cDNA clone IMAGE:5166840), with apparent retained intron.												0						tttcctttccttttccttcctt	0.015													4	2	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50764079	50764080	+	Intron	INS	-	GT	GT	rs140241247	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50764079_50764080insGT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		tgtgtgtgcaagtgtgtgtgca	0.094													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29647428	29647429	+	Intron	INS	-	A	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29647428_29647429insA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						tatccagtGGCAAAAAAATGAG	0.045													4	2	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32339915	32339915	+	Intron	DEL	C	-	-	rs11477069		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32339915delC	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						tgcaagcaagccCCCCCCCCT	0.164													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62604561	62604562	+	IGR	DEL	GT	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62604561_62604562delGT								ZNF512B (3343 upstream) : SAMD10 (904 downstream)																							tgtgtgtgtggtgtgtgtgtgt	0.208													4	2	---	---	---	---	
CBR3	874	broad.mit.edu	37	21	37518259	37518259	+	Intron	DEL	A	-	-	rs66890326		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37518259delA	uc002yve.2	+						uc002yvc.1_Intron|uc002yvd.1_Intron|uc002yvf.1_Intron	NM_001236	NP_001227	O75828	CBR3_HUMAN	carbonyl reductase 3							cytosol|nucleus	carbonyl reductase (NADPH) activity|NADPH binding				0						actctgtctcaaaaaaaaaaa	0.139													5	3	---	---	---	---	
DNMT3L	29947	broad.mit.edu	37	21	45666581	45666581	+	Intron	DEL	A	-	-	rs141091443	by1000genomes	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45666581delA	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		GGTGCCTAAGACCCCCCCCCC	0.672													6	3	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33176966	33176969	+	Intron	DEL	TCCT	-	-	rs68188956		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33176966_33176969delTCCT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						cttccttccctccttccttcctct	0.064													3	4	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467572	1467573	+	Intron	DEL	TT	-	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467572_1467573delTT	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tctttctttctttctttctttc	0.045													2	6	---	---	---	---	
