Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TNFRSF9	3604	broad.mit.edu	37	1	7998781	7998781	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7998781C>A	uc001aot.2	-	3	336	c.208G>T	c.(208-210)GGT>TGT	p.G70C		NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,	70	TNFR-Cys 2.|Extracellular (Potential).				induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		GAACTCATACCTTTACACTGC	0.398													38	293	---	---	---	---	PASS
C1orf127	148345	broad.mit.edu	37	1	11008487	11008487	+	Missense_Mutation	SNP	C	A	A	rs143293968		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11008487C>A	uc010oao.1	-	8	1263	c.1258G>T	c.(1258-1260)GGG>TGG	p.G420W	C1orf127_uc001arr.1_Missense_Mutation_p.G402W|C1orf127_uc001ars.1_Missense_Mutation_p.G394W	NM_173507	NP_775778	B7ZLG7	B7ZLG7_HUMAN	hypothetical protein LOC148345	420										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		GCCACATCCCCGCTTGACAAG	0.632													3	46	---	---	---	---	PASS
ARHGEF10L	55160	broad.mit.edu	37	1	17990994	17990994	+	Silent	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17990994C>A	uc001ban.2	+	26	3072	c.2913C>A	c.(2911-2913)CCC>CCA	p.P971P	ARHGEF10L_uc009vpe.1_Silent_p.P932P|ARHGEF10L_uc001bao.2_Silent_p.P932P|ARHGEF10L_uc001bap.2_Silent_p.P927P|ARHGEF10L_uc001baq.2_Silent_p.P732P|ARHGEF10L_uc010ocs.1_Silent_p.P744P|ARHGEF10L_uc001bar.2_Silent_p.P674P|ARHGEF10L_uc009vpf.2_RNA	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	971					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CTGTGGGGCCCGGGCCTGTCC	0.692													4	46	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29638000	29638000	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29638000C>G	uc001bru.2	+	21	3030	c.2920C>G	c.(2920-2922)CGT>GGT	p.R974G	PTPRU_uc001brv.2_Missense_Mutation_p.R970G|PTPRU_uc001brw.2_Missense_Mutation_p.R964G|PTPRU_uc009vtq.2_Missense_Mutation_p.R970G|PTPRU_uc009vtr.2_Missense_Mutation_p.R964G	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	974	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		TGACTTCTGGCGTATGGTGTG	0.627													8	59	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74507303	74507303	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74507303C>T	uc001dfy.3	-	7	1504	c.1312G>A	c.(1312-1314)GAA>AAA	p.E438K	LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	438										ovary(2)	2						CTTACTTTTTCTTTATGGTAT	0.343													48	281	---	---	---	---	PASS
BCAR3	8412	broad.mit.edu	37	1	94057948	94057948	+	Silent	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94057948G>A	uc001dpz.2	-	4	635	c.360C>T	c.(358-360)TTC>TTT	p.F120F	BCAR3_uc001dqa.2_Silent_p.F120F|BCAR3_uc001dqb.2_Silent_p.F120F|BCAR3_uc001dpy.2_Silent_p.F29F|uc009wdn.2_RNA	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3	120					response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		TCTCCTTGGAGAACTGCAACA	0.592													17	110	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803734	142803734	+	Intron	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803734C>A	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		gttaaataaacaactatggat	0.000													3	13	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	145074882	145074882	+	3'UTR	SNP	G	T	T	rs3845334		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145074882G>T	uc001emk.2	-	2					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q5VU43	MYOME_HUMAN	SubName: Full=Phosphodiesterase 4D interacting protein;						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TAAAAAGCCTGCAGCACAATC	0.303			T	PDGFRB	MPD								3	23	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154029322	154029322	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154029322C>T	uc001fdw.2	-	23	3281	c.3209G>A	c.(3208-3210)AGA>AAA	p.R1070K	NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Missense_Mutation_p.R1070K	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	1070						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TGTGTATTTTCTTCCCATCTT	0.378													32	120	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186327744	186327744	+	Silent	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186327744G>A	uc001grv.2	-	13	1725	c.1428C>T	c.(1426-1428)AAC>AAT	p.N476N	TPR_uc010pop.1_Silent_p.N552N	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	476	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ATGATTGCTTGTTGGCTTTAT	0.313			T	NTRK1	papillary thyroid								26	162	---	---	---	---	PASS
NUAK2	81788	broad.mit.edu	37	1	205272654	205272654	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205272654C>T	uc001hce.2	-	7	1938	c.1811G>A	c.(1810-1812)TGC>TAC	p.C604Y		NM_030952	NP_112214	Q9H093	NUAK2_HUMAN	NUAK family, SNF1-like kinase, 2	604					actin cytoskeleton organization|apoptosis|cellular response to glucose starvation|negative regulation of apoptosis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|stomach(1)|breast(1)	5	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CAGGGAAAAGCAGCTGTCCCC	0.632													21	89	---	---	---	---	PASS
TRAF5	7188	broad.mit.edu	37	1	211545865	211545865	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211545865T>A	uc001hih.2	+	11	1555	c.1495T>A	c.(1495-1497)TTC>ATC	p.F499I	TRAF5_uc001hii.2_Missense_Mutation_p.F499I|TRAF5_uc010psx.1_Missense_Mutation_p.F510I|TRAF5_uc010psy.1_Missense_Mutation_p.F393I|TRAF5_uc001hij.2_Missense_Mutation_p.F499I	NM_004619	NP_004610	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	499	MATH.				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(2)|ovary(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TATGGAGACCTTCAAACCTGA	0.498													15	126	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240370231	240370231	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240370231G>T	uc010pyd.1	+	5	2344	c.2119G>T	c.(2119-2121)GGT>TGT	p.G707C	FMN2_uc010pye.1_Missense_Mutation_p.G711C	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	707					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGTGGCCAGTGGTCATCAAGG	0.483													13	97	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33482567	33482567	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33482567C>T	uc002ros.2	+	12	2384	c.2384C>T	c.(2383-2385)GCG>GTG	p.A795V	LTBP1_uc002rot.2_Missense_Mutation_p.A469V|LTBP1_uc002rou.2_Missense_Mutation_p.A469V|LTBP1_uc002rov.2_Missense_Mutation_p.A416V|LTBP1_uc010ymz.1_Missense_Mutation_p.A469V|LTBP1_uc010yna.1_Missense_Mutation_p.A416V	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	795					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CCAGGAGTGGCGGAGCCAGAA	0.502													4	60	---	---	---	---	PASS
EML4	27436	broad.mit.edu	37	2	42472705	42472705	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42472705C>A	uc002rsi.2	+	2	348	c.86C>A	c.(85-87)TCA>TAA	p.S29*	EML4_uc002rsh.3_Nonsense_Mutation_p.S29*|EML4_uc010fap.2_Nonsense_Mutation_p.S29*	NM_019063	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	29					microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(246)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250						GCTCTTGAGTCACGAGTTCAG	0.388			T	ALK	NSCLC								18	102	---	---	---	---	PASS
C2orf86	51057	broad.mit.edu	37	2	63631341	63631341	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63631341A>T	uc002sch.2	-	10	1723	c.1277T>A	c.(1276-1278)CTG>CAG	p.L426Q	C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Missense_Mutation_p.L267Q|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Missense_Mutation_p.L234Q|C2orf86_uc002sci.1_Missense_Mutation_p.L402Q|C2orf86_uc010fcr.1_Missense_Mutation_p.L316Q	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	426					cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						ACTGAATTGCAGAGTCTCCCT	0.438													48	175	---	---	---	---	PASS
CYP26B1	56603	broad.mit.edu	37	2	72371136	72371136	+	Silent	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72371136G>T	uc002sih.1	-	2	411	c.411C>A	c.(409-411)ATC>ATA	p.I137I	CYP26B1_uc010yra.1_Silent_p.I120I|CYP26B1_uc010yrb.1_Intron	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,	137					cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2						TGTTGCGGTGGATGTCGCCAA	0.373													11	54	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73746997	73746997	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73746997C>A	uc002sje.1	+	13	9749	c.9638C>A	c.(9637-9639)ACC>AAC	p.T3213N	ALMS1_uc002sjf.1_Missense_Mutation_p.T3169N|ALMS1_uc002sjg.2_Missense_Mutation_p.T2599N|ALMS1_uc002sjh.1_Missense_Mutation_p.T2599N|ALMS1_uc010fev.1_Missense_Mutation_p.T28N	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3211					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CCAGAAAAGACCCTATTTTCA	0.403													30	153	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98853240	98853240	+	Intron	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98853240C>T	uc002syo.2	+						VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_3'UTR|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron|VWA3B_uc002syp.1_Intron|VWA3B_uc002syq.1_Intron|VWA3B_uc002syr.1_Intron|VWA3B_uc010fih.1_Intron	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6						TTTTCATTTTCTGCTCAAATA	0.403													16	137	---	---	---	---	PASS
MRPL30	51263	broad.mit.edu	37	2	99812127	99812127	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99812127T>G	uc002szu.2	+	6	607	c.445T>G	c.(445-447)TGG>GGG	p.W149G	MRPL30_uc002szl.1_RNA|MRPL30_uc002szt.1_RNA|MRPL30_uc002szv.2_Missense_Mutation_p.W149G	NM_145213	NP_660214	Q8TCC3	RM30_HUMAN	RecName: Full=39S ribosomal protein L30, mitochondrial;          Short=L30mt; AltName: Full=MRP-L30; AltName: Full=MRP-L28; Flags: Precursor;	149					translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1						AGTAGTGCAGTGGCATCTGAA	0.458													35	208	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100625302	100625302	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100625302C>G	uc002tag.2	-	4	382	c.146G>C	c.(145-147)AGT>ACT	p.S49T	AFF3_uc002taf.2_Missense_Mutation_p.S74T|AFF3_uc010fiq.1_Missense_Mutation_p.S49T|AFF3_uc010yvr.1_Missense_Mutation_p.S203T|AFF3_uc002tah.1_Missense_Mutation_p.S74T|AFF3_uc010fir.1_Missense_Mutation_p.S126T|AFF3_uc002tai.2_5'Flank	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	49					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						GAGAGAGTAACTAGAATTAAA	0.428													6	39	---	---	---	---	PASS
DDX11L2	84771	broad.mit.edu	37	2	114357557	114357557	+	Nonstop_Mutation	SNP	A	G	G	rs115341812	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114357557A>G	uc010yxx.1	-	3	709	c.382T>C	c.(382-384)TAG>CAG	p.*128Q						SubName: Full=DEAD/H box polypeptide 11 like 2;												0						GCCTACTTCTAGTGAAACTGG	0.567													3	44	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	115200295	115200295	+	5'UTR	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115200295T>C	uc002tla.1	+	1						NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TAGAGGAGACTTGATCTCTAG	0.353													4	25	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	115200296	115200296	+	5'UTR	SNP	T	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115200296T>A	uc002tla.1	+	1						NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AGAGGAGACTTGATCTCTAGT	0.348													4	28	---	---	---	---	PASS
LOC440905	440905	broad.mit.edu	37	2	130785949	130785949	+	RNA	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130785949C>A	uc002tpz.2	-	11		c.2919G>T			LOC440905_uc002tpy.1_RNA	NR_026758				Homo sapiens cDNA FLJ43933 fis, clone TESTI4013685.												0						TGGCTGATGGCATTCCAGTAC	0.488													3	27	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198540336	198540336	+	5'UTR	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198540336C>A	uc002uuo.3	-	1						NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2							plasma membrane					0						aaagcaaaaaccaaaaaaaaa	0.239													4	5	---	---	---	---	PASS
SGOL2	151246	broad.mit.edu	37	2	201437495	201437495	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201437495G>T	uc002uvw.2	+	7	2539	c.2426G>T	c.(2425-2427)AGA>ATA	p.R809I	SGOL2_uc010zhd.1_Missense_Mutation_p.R809I|SGOL2_uc010zhe.1_Missense_Mutation_p.R809I	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	809					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						AAGAAGCCTAGACTAAATGTA	0.338													23	147	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228884663	228884663	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228884663C>T	uc002vpq.2	-	7	954	c.907G>A	c.(907-909)GCC>ACC	p.A303T	SPHKAP_uc002vpp.2_Missense_Mutation_p.A303T|SPHKAP_uc010zlx.1_Missense_Mutation_p.A303T	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	303						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GATGGCTTGGCTGAGGGATCT	0.403													13	463	---	---	---	---	PASS
ECEL1	9427	broad.mit.edu	37	2	233349705	233349705	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233349705G>C	uc002vsv.2	-	4	1157	c.952C>G	c.(952-954)CAG>GAG	p.Q318E	ECEL1_uc010fya.1_Missense_Mutation_p.Q318E|ECEL1_uc010fyb.1_Missense_Mutation_p.Q25E	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	318	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GCCAGCTGCTGCTCCACTTGC	0.617													24	85	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124215189	124215189	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124215189G>A	uc003ehg.2	+	33	4985	c.4858G>A	c.(4858-4860)GAT>AAT	p.D1620N	KALRN_uc010hrv.1_Missense_Mutation_p.D1611N|KALRN_uc003ehf.1_Missense_Mutation_p.D1620N|KALRN_uc011bjy.1_Missense_Mutation_p.D1611N	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	1620					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						CAGCCAGGGGGATGGGAGCAG	0.542													17	134	---	---	---	---	PASS
SDHAP2	727956	broad.mit.edu	37	3	195400728	195400728	+	Silent	SNP	A	G	G	rs12107841	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195400728A>G	uc003fuw.2	+	9	1218	c.24A>G	c.(22-24)CCA>CCG	p.P8P	SDHAP2_uc011btb.1_Missense_Mutation_p.S156G|SDHAP2_uc011btc.1_RNA|SDHAP2_uc003fuv.2_RNA					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						GATTGTGCCCAGCCTGTACGC	0.587													3	37	---	---	---	---	PASS
SLC30A9	10463	broad.mit.edu	37	4	42072678	42072678	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42072678C>G	uc003gwl.2	+	15	1534	c.1388C>G	c.(1387-1389)ACT>AGT	p.T463S	SLC30A9_uc011byx.1_Missense_Mutation_p.T223S	NM_006345	NP_006336	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter),	463	LXXLL motif.				nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3						CAACGGCTCACTGAACTCCTG	0.448													28	113	---	---	---	---	PASS
ANXA3	306	broad.mit.edu	37	4	79518556	79518556	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79518556C>A	uc003hld.2	+	10	1028	c.718C>A	c.(718-720)CTG>ATG	p.L240M	ANXA3_uc003hle.2_Missense_Mutation_p.L201M|ANXA3_uc010ijk.2_Missense_Mutation_p.L201M	NM_005139	NP_005130	P12429	ANXA3_HUMAN	annexin A3	240	Annexin 3.				defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity				0						TGAAGACTTACTGTTGGCCAT	0.358													18	127	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85654653	85654653	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85654653T>A	uc003hpd.2	-	44	7511	c.7103A>T	c.(7102-7104)AAG>ATG	p.K2368M	WDFY3_uc003hpe.1_Translation_Start_Site	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	2368						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAGCATCCACTTGTCGAGGTG	0.537													55	237	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100521758	100521758	+	Silent	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100521758C>T	uc003hvc.3	+	10	1360	c.1104C>T	c.(1102-1104)ACC>ACT	p.T368T	MTTP_uc011cej.1_Silent_p.T395T	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	368	Vitellogenin.				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	CTGCTCAGACCTCAGACTCAT	0.413													38	311	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160273880	160273880	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160273880T>A	uc003iqg.3	+	21	3736	c.3426T>A	c.(3424-3426)GAT>GAA	p.D1142E		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	1142	Ser-rich.				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		ATTTTTCAGATTCTGGTCACA	0.423													31	172	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31423045	31423045	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31423045C>A	uc003jhg.2	-	28	3627	c.3268G>T	c.(3268-3270)GAG>TAG	p.E1090*	RNASEN_uc003jhh.2_Nonsense_Mutation_p.E1053*|RNASEN_uc003jhi.2_Nonsense_Mutation_p.E1053*	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	1090	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						GTATTTGGCTCTTGTAGCTAC	0.308													3	25	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113698884	113698884	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113698884G>T	uc003kqo.2	+	1	869	c.412G>T	c.(412-414)GCG>TCG	p.A138S		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	138	Helical; Name=Segment S1; (Potential).					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		CAGCGACTACGCGCTCATCTT	0.577													15	67	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127497486	127497486	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127497486G>C	uc003kus.2	+	17	2774	c.2610G>C	c.(2608-2610)TTG>TTC	p.L870F	SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Missense_Mutation_p.L870F|SLC12A2_uc003kut.1_Missense_Mutation_p.L77F	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12	870	Extracellular (Potential).				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CACAGTATTTGATGCAGGTAA	0.318													9	95	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	152873521	152873521	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152873521A>G	uc003lva.3	+	2	481	c.116A>G	c.(115-117)CAT>CGT	p.H39R	GRIA1_uc003luy.3_Missense_Mutation_p.H39R|GRIA1_uc003luz.3_5'UTR|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Missense_Mutation_p.H39R|GRIA1_uc011dcx.1_5'UTR|GRIA1_uc011dcy.1_Missense_Mutation_p.H49R|GRIA1_uc011dcz.1_Missense_Mutation_p.H49R|GRIA1_uc010jia.1_Missense_Mutation_p.H19R	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	39	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCACAGGAACATGCTGCTTTT	0.453													32	203	---	---	---	---	PASS
SH3PXD2B	285590	broad.mit.edu	37	5	171780973	171780973	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171780973C>A	uc003mbr.2	-	9	875	c.704G>T	c.(703-705)CGG>CTG	p.R235L		NM_001017995	NP_001017995	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	235	SH3 2.				adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATCCTGGTCCCGAGCTGTGTA	0.567													4	108	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180048667	180048667	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180048667C>A	uc003mma.3	-	13	1974	c.1895G>T	c.(1894-1896)CGC>CTC	p.R632L	FLT4_uc003mlz.3_Missense_Mutation_p.R632L|FLT4_uc003mmb.1_Missense_Mutation_p.R165L|FLT4_uc011dgy.1_Missense_Mutation_p.R632L	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	632	Ig-like C2-type 6.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CGTGGCGTGGCGCGCCCCAGG	0.677									Congenital_Hereditary_Lymphedema				3	56	---	---	---	---	PASS
C6orf145	221749	broad.mit.edu	37	6	3723939	3723939	+	Silent	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3723939G>A	uc003mvt.2	-	5	1091	c.610C>T	c.(610-612)CTG>TTG	p.L204L		NM_183373	NP_899229	Q5TGL8	CF145_HUMAN	hypothetical protein LOC221749	204					cell communication		phosphatidylinositol binding			breast(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				CCGTCCTCCAGCTCTGAGGGA	0.537													21	66	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25779371	25779371	+	Silent	SNP	A	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25779371A>T	uc003nfe.2	+	12	1568	c.1449A>T	c.(1447-1449)GCA>GCT	p.A483A	SLC17A4_uc011djx.1_Silent_p.A253A|SLC17A4_uc003nfg.2_Silent_p.A420A|SLC17A4_uc010jqa.2_3'UTR	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),	483					phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						TTGGCCGAGCAGATGTGCAGG	0.483													61	225	---	---	---	---	PASS
BAT3	7917	broad.mit.edu	37	6	31611899	31611899	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31611899C>A	uc003nvg.3	-	12	1852	c.1538G>T	c.(1537-1539)CGG>CTG	p.R513L	BAT3_uc003nvf.3_Missense_Mutation_p.R507L|BAT3_uc003nvh.3_Missense_Mutation_p.R507L|BAT3_uc003nvi.3_Missense_Mutation_p.R507L|BAT3_uc011dnw.1_Missense_Mutation_p.R507L|BAT3_uc011dnx.1_Missense_Mutation_p.R507L	NM_004639	NP_004630	P46379	BAG6_HUMAN	HLA-B associated transcript-3 isoform a	513	Pro-rich.|4 X 29 AA approximate repeats.				apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0						ATGGGAAGGCCGAGCCTGTGG	0.627													5	47	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38889260	38889260	+	Missense_Mutation	SNP	A	T	T	rs147713611		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38889260A>T	uc003ooe.1	+	69	10589	c.9989A>T	c.(9988-9990)GAT>GTT	p.D3330V	uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GCAAAATTTGATGCAGCAATG	0.423													5	50	---	---	---	---	PASS
KLHL32	114792	broad.mit.edu	37	6	97587192	97587192	+	3'UTR	SNP	A	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97587192A>C	uc010kcm.1	+	11					KLHL32_uc011ead.1_3'UTR|KLHL32_uc003poz.2_3'UTR|KLHL32_uc011eae.1_3'UTR|KLHL32_uc003ppa.2_RNA	NM_052904	NP_443136	Q96NJ5	KLH32_HUMAN	kelch-like 32											ovary(3)|skin(1)	4		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		AGGAAAACATAGCTCTGACTG	0.408													12	77	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23775341	23775341	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23775341A>T	uc003sws.3	+	7	735	c.668A>T	c.(667-669)GAA>GTA	p.E223V	STK31_uc003swt.3_Missense_Mutation_p.E200V|STK31_uc011jze.1_Missense_Mutation_p.E223V|STK31_uc010kuq.2_Missense_Mutation_p.E200V	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	223							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						ATCTGTGAGGAAAAAAAATTG	0.473													23	143	---	---	---	---	PASS
OGDH	4967	broad.mit.edu	37	7	44733560	44733560	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44733560C>A	uc003tln.2	+	11	1581	c.1472C>A	c.(1471-1473)GCC>GAC	p.A491D	OGDH_uc011kbx.1_Missense_Mutation_p.A487D|OGDH_uc011kby.1_Missense_Mutation_p.A341D|OGDH_uc003tlp.2_Missense_Mutation_p.A502D|OGDH_uc011kbz.1_Missense_Mutation_p.A286D|OGDH_uc003tlo.1_Missense_Mutation_p.A324D	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	491					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	AAAGTGGCGGCCGAGTGGAGG	0.602													7	28	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82474757	82474757	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82474757C>T	uc003uhx.2	-	13	14165	c.13876G>A	c.(13876-13878)GCA>ACA	p.A4626T	PCLO_uc003uhv.2_Missense_Mutation_p.A4626T|PCLO_uc003uht.1_Missense_Mutation_p.A77T|PCLO_uc003uhu.1_Missense_Mutation_p.A56T	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4514					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGGAGTTCTGCTGCCAACTGC	0.433													6	34	---	---	---	---	PASS
EPHB4	2050	broad.mit.edu	37	7	100417900	100417900	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100417900A>C	uc003uwn.1	-	5	1318	c.827T>G	c.(826-828)TTC>TGC	p.F276C	EPHB4_uc003uwm.1_Missense_Mutation_p.F183C|EPHB4_uc010lhj.1_Missense_Mutation_p.F276C|EPHB4_uc011kkf.1_Missense_Mutation_p.F276C|EPHB4_uc011kkg.1_Intron|EPHB4_uc011kkh.1_Missense_Mutation_p.F276C	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor	276	Extracellular (Potential).|Cys-rich.				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					CAGGGGCTTGAAGGTGCCCTG	0.488													28	228	---	---	---	---	PASS
DEFA1B	728358	broad.mit.edu	37	8	6873414	6873414	+	3'UTR	SNP	A	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6873414A>G	uc003wqz.1	-	3						NM_005217	NP_005208	P59665	DEF1_HUMAN	defensin, alpha 3 preproprotein						chemotaxis|defense response to bacterium|defense response to fungus|immune response|killing of cells of other organism|response to virus	extracellular space					0						CATTTATTTGAGATGAGGAAA	0.383													3	18	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732871	52732871	+	3'UTR	SNP	T	C	C	rs77261625	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732871T>C	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTTTCAAGACTAAAGGAATTA	0.313													3	60	---	---	---	---	PASS
SLC45A4	57210	broad.mit.edu	37	8	142222393	142222393	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142222393G>A	uc003ywd.1	-	7	2359	c.2051C>T	c.(2050-2052)GCC>GTC	p.A684V	SLC45A4_uc003ywc.1_Missense_Mutation_p.A684V|SLC45A4_uc010meq.1_Missense_Mutation_p.A682V	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4	735					transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GCCTTCGCCGGCCAACGGGGA	0.637													3	47	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144996079	144996079	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144996079G>C	uc003zaf.1	-	32	8491	c.8321C>G	c.(8320-8322)GCG>GGG	p.A2774G	PLEC_uc003zab.1_Missense_Mutation_p.A2637G|PLEC_uc003zac.1_Missense_Mutation_p.A2641G|PLEC_uc003zad.2_Missense_Mutation_p.A2637G|PLEC_uc003zae.1_Missense_Mutation_p.A2605G|PLEC_uc003zag.1_Missense_Mutation_p.A2615G|PLEC_uc003zah.2_Missense_Mutation_p.A2623G|PLEC_uc003zaj.2_Missense_Mutation_p.A2664G	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2774	Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						TGCCTCTGCCGCGGGGCCATC	0.687													6	30	---	---	---	---	PASS
JAK2	3717	broad.mit.edu	37	9	5022145	5022145	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5022145A>C	uc010mhm.2	+	2	271	c.158A>C	c.(157-159)GAT>GCT	p.D53A	JAK2_uc003ziw.2_Missense_Mutation_p.D53A	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	53	Interaction with cytokine/interferon/growth hormone receptors (By similarity).|FERM.				actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		TCTGAGGCAGATTATCTGACC	0.368		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				49	232	---	---	---	---	PASS
SLC24A2	25769	broad.mit.edu	37	9	19550217	19550217	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19550217T>A	uc003zoa.1	-	7	1459	c.1397A>T	c.(1396-1398)GAA>GTA	p.E466V	SLC24A2_uc003zob.1_Missense_Mutation_p.E449V	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN	solute carrier family 24	466	Cytoplasmic (Potential).				visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(3)	3				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CTTGCGGGTTTCAGAAGGCCA	0.423													46	201	---	---	---	---	PASS
TMEM215	401498	broad.mit.edu	37	9	32784268	32784268	+	Silent	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32784268C>A	uc003zri.3	+	2	452	c.87C>A	c.(85-87)GTC>GTA	p.V29V		NM_212558	NP_997723	Q68D42	TM215_HUMAN	transmembrane protein 215	29	Helical; (Potential).					integral to membrane					0						TGTTCACCGTCTCTGGGATGA	0.577													6	160	---	---	---	---	PASS
C9orf3	84909	broad.mit.edu	37	9	97823038	97823038	+	Silent	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97823038C>T	uc004ava.2	+	13	2313	c.2178C>T	c.(2176-2178)CCC>CCT	p.P726P	C9orf3_uc004auy.2_Silent_p.P627P|C9orf3_uc004auz.1_Silent_p.P627P|C9orf3_uc004avc.2_Silent_p.P181P|C9orf3_uc011luj.1_Silent_p.P88P|C9orf3_uc011luk.1_Silent_p.P67P|C9orf3_uc004avd.2_Silent_p.P88P	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O	726					leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		CTCTGAGCCCCCGAACTCTGC	0.512													18	130	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101829277	101829277	+	Silent	SNP	T	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101829277T>G	uc004azb.1	+	40	3971	c.3765T>G	c.(3763-3765)TCT>TCG	p.S1255S		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	1255	Nonhelical region 10 (NC10).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				CATTCTTATCTTCCCATTTGC	0.463													42	159	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123222946	123222946	+	Splice_Site	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123222946C>T	uc004bkf.2	-	19	2288	c.2107_splice	c.e19-1	p.L703_splice	CDK5RAP2_uc004bke.2_Intron|CDK5RAP2_uc004bkg.2_Splice_Site_p.L703_splice|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_Splice_Site|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Intron|CDK5RAP2_uc004bki.2_Intron	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						TAGCCAGAAGCTACATGGAGC	0.408													9	75	---	---	---	---	PASS
ZNF79	7633	broad.mit.edu	37	9	130187130	130187130	+	Intron	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130187130C>A	uc004bqw.3	+						ZNF79_uc011maf.1_Intron|ZNF79_uc011mag.1_5'UTR	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						GCTGCTGCTTCGTTTGCCCAC	0.502													3	22	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140695437	140695437	+	Splice_Site	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140695437G>A	uc011mfc.1	+	18	2749	c.2712_splice	c.e18+1	p.N904_splice		NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CCGAGACAACGTAAGTTCGTC	0.597													8	71	---	---	---	---	PASS
PPYR1	5540	broad.mit.edu	37	10	47087494	47087494	+	Silent	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47087494C>T	uc001jee.2	+	3	1130	c.711C>T	c.(709-711)ATC>ATT	p.I237I	ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_Silent_p.I237I	NM_005972	NP_005963	P50391	NPY4R_HUMAN	pancreatic polypeptide receptor 1	237	Cytoplasmic (Potential).				blood circulation|digestion|feeding behavior	integral to plasma membrane				ovary(1)|skin(1)	2						ATGCACGCATCTACCGGCGCC	0.607													13	238	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61868693	61868693	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61868693C>G	uc001jky.2	-	27	3260	c.3068G>C	c.(3067-3069)CGT>CCT	p.R1023P	ANK3_uc001jkw.2_Missense_Mutation_p.R157P|ANK3_uc009xpa.2_Missense_Mutation_p.R157P|ANK3_uc001jkx.2_Missense_Mutation_p.R201P|ANK3_uc010qih.1_Missense_Mutation_p.R1024P|ANK3_uc001jkz.3_Missense_Mutation_p.R1017P|ANK3_uc001jla.1_Missense_Mutation_p.R89P|ANK3_uc001jlb.1_Missense_Mutation_p.R541P	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1023	ZU5.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						CTTTACCAAACGGCAGGTGAT	0.562													26	122	---	---	---	---	PASS
WAPAL	23063	broad.mit.edu	37	10	88230845	88230845	+	Silent	SNP	A	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88230845A>T	uc001kdo.2	-	8	2488	c.2046T>A	c.(2044-2046)GCT>GCA	p.A682A	WAPAL_uc009xsv.2_5'UTR|WAPAL_uc001kdn.2_Silent_p.A719A|WAPAL_uc009xsw.2_Silent_p.A676A	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	682	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						CACATTTAGTAGCCAAGCTAA	0.423													19	101	---	---	---	---	PASS
LOC440040	440040	broad.mit.edu	37	11	49830092	49830092	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49830092G>T	uc010rhy.1	+	6	1410	c.932G>T	c.(931-933)AGT>ATT	p.S311I	LOC440040_uc009ymb.2_Missense_Mutation_p.S311I	NR_027044				SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;												0						CCTTCCAGAAGTGAGTCCGTG	0.438													7	40	---	---	---	---	PASS
TMEM138	51524	broad.mit.edu	37	11	61135328	61135328	+	Intron	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61135328T>C	uc001nrl.1	+						TMEM138_uc010rli.1_Intron|TMEM138_uc001nrm.2_3'UTR	NM_016464	NP_057548	Q9NPI0	TM138_HUMAN	transmembrane protein 138							integral to membrane					0						TCTCTGCAGCTAACCAAGTTG	0.438													34	197	---	---	---	---	PASS
C11orf9	745	broad.mit.edu	37	11	61545943	61545943	+	Silent	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61545943C>T	uc001nsc.1	+	14	2091	c.1995C>T	c.(1993-1995)AAC>AAT	p.N665N	C11orf9_uc001nse.1_Silent_p.N656N|C11orf9_uc010rll.1_Silent_p.N56N	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	665					central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						CCATAGAGAACTTCCTGGTGG	0.562													16	128	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63449001	63449001	+	5'UTR	SNP	C	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63449001C>G	uc001nxq.2	+	1					RTN3_uc001nxo.2_5'UTR|RTN3_uc001nxm.2_5'UTR|RTN3_uc001nxn.2_5'UTR|RTN3_uc001nxp.2_5'UTR|RTN3_uc009yov.2_5'UTR|RTN3_uc010rmt.1_RNA|RTN3_uc010rmu.1_5'UTR	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						TCGGAGCAGGCGGAGTAAAGG	0.632													9	16	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88300984	88300984	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88300984C>A	uc001pcq.2	-	7	2067	c.1867G>T	c.(1867-1869)GCT>TCT	p.A623S	GRM5_uc009yvm.2_Missense_Mutation_p.A623S	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	623	Helical; Name=2; (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	CAGATGCCAGCAAGGATAATG	0.493													14	75	---	---	---	---	PASS
BCO2	83875	broad.mit.edu	37	11	112064374	112064374	+	Silent	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112064374T>C	uc001pnf.2	+	3	588	c.471T>C	c.(469-471)GTT>GTC	p.V157V	BCO2_uc001pne.1_5'UTR|BCO2_uc001png.2_Silent_p.V157V|BCO2_uc001pnh.2_Silent_p.V123V|BCO2_uc010rwt.1_Silent_p.V52V|BCO2_uc009yyn.2_Silent_p.V123V|BCO2_uc001pni.2_Silent_p.V123V	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN	beta-carotene dioxygenase 2 isoform a	157					carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GCAAGAATGTTTTTGAACGTT	0.388													12	49	---	---	---	---	PASS
RDH5	5959	broad.mit.edu	37	12	56115023	56115023	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56115023A>G	uc001shk.2	+	2	238	c.55A>G	c.(55-57)AGG>GGG	p.R19G	BLOC1S1_uc001shj.3_Intron|RDH5_uc010spt.1_Missense_Mutation_p.R19G|RDH5_uc010spu.1_Intron|RDH5_uc001shl.2_Missense_Mutation_p.R19G	NM_002905	NP_002896	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis and 9-cis)	19					response to stimulus|visual perception	membrane	binding|retinol dehydrogenase activity			ovary(1)	1					NADH(DB00157)|Vitamin A(DB00162)	GTGGTTGCTCAGGGACCGGCA	0.622											OREG0021907	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	119	---	---	---	---	PASS
B4GALNT1	2583	broad.mit.edu	37	12	58020623	58020623	+	Silent	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58020623G>A	uc001spg.1	-	11	1938	c.1506C>T	c.(1504-1506)GCC>GCT	p.A502A	B4GALNT1_uc010sru.1_Silent_p.A447A	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	502	Lumenal (Potential).				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AACGGTACCGGGCGTAAGTCT	0.587													27	125	---	---	---	---	PASS
SLC24A6	80024	broad.mit.edu	37	12	113742186	113742186	+	Silent	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113742186G>A	uc001tvc.2	-	15	1707	c.1497C>T	c.(1495-1497)ATC>ATT	p.I499I	SLC24A6_uc001tuz.2_Silent_p.I204I|SLC24A6_uc001tva.2_RNA|SLC24A6_uc001tvb.2_Silent_p.I237I	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor	499	Helical; Name=11; (Potential).				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						CACCCACGAGGATGTCTGCAG	0.537													24	185	---	---	---	---	PASS
SLC24A6	80024	broad.mit.edu	37	12	113758188	113758188	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113758188G>T	uc001tvc.2	-	7	852	c.642C>A	c.(640-642)TTC>TTA	p.F214L	SLC24A6_uc001tuz.2_5'Flank|SLC24A6_uc001tva.2_RNA|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor	214	Helical; Name=4; (Potential).				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						GGAAGGTCAGGAACACAGCCA	0.602													58	307	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133233985	133233985	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133233985G>T	uc001uks.1	-	28	3453	c.3409C>A	c.(3409-3411)CTG>ATG	p.L1137M	POLE_uc001ukr.1_Translation_Start_Site|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Missense_Mutation_p.L1110M	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1137					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		GCGCTTCCCAGCCGCTCAATG	0.547								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					20	65	---	---	---	---	PASS
GJB6	10804	broad.mit.edu	37	13	20797015	20797015	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20797015C>A	uc001umz.3	-	3	1158	c.605G>T	c.(604-606)TGC>TTC	p.C202F	GJB6_uc001unc.3_Missense_Mutation_p.C202F|GJB6_uc001una.3_Missense_Mutation_p.C202F|GJB6_uc001und.3_Missense_Mutation_p.C202F|GJB6_uc001unb.3_Missense_Mutation_p.C202F	NM_006783	NP_006774	O95452	CXB6_HUMAN	gap junction protein, beta 6	202	Helical; (Potential).				cell communication|sensory perception of sound	connexon complex|integral to membrane|intracellular membrane-bounded organelle				ovary(1)	1		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		AAGCAGCATGCAAATCACAGA	0.458													10	96	---	---	---	---	PASS
C13orf31	144811	broad.mit.edu	37	13	44462991	44462991	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44462991C>A	uc010acg.2	+	5	1491	c.1006C>A	c.(1006-1008)CCT>ACT	p.P336T	C13orf31_uc001uzf.3_Missense_Mutation_p.P336T	NM_001128303	NP_001121775	Q8IV20	CM031_HUMAN	hypothetical protein LOC144811	336											0		Lung NSC(96;0.000163)|all_hematologic(4;0.0127)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Breast(139;0.0364)|Lung SC(185;0.0367)|Acute lymphoblastic leukemia(4;0.138)		GBM - Glioblastoma multiforme(144;0.000573)|BRCA - Breast invasive adenocarcinoma(63;0.121)		TGTACTTGGACCTTCAGTAGG	0.418													46	233	---	---	---	---	PASS
ZC3H13	23091	broad.mit.edu	37	13	46577388	46577388	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46577388C>T	uc010tfw.1	-	7	836	c.830G>A	c.(829-831)GGG>GAG	p.G277E	ZC3H13_uc001vas.1_Missense_Mutation_p.G277E|ZC3H13_uc001vat.1_Missense_Mutation_p.G277E	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	277							nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		GTATTTTTTCCCCAGAGCGAT	0.368													51	265	---	---	---	---	PASS
CTAGE5	4253	broad.mit.edu	37	14	39782629	39782629	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39782629G>A	uc001wvg.3	+	14	1615	c.1279G>A	c.(1279-1281)GAG>AAG	p.E427K	CTAGE5_uc010tqe.1_Missense_Mutation_p.E389K|CTAGE5_uc001wuz.3_Missense_Mutation_p.E415K|CTAGE5_uc001wuy.3_Missense_Mutation_p.E347K|CTAGE5_uc001wvb.3_Missense_Mutation_p.E398K|CTAGE5_uc001wvc.3_Missense_Mutation_p.E372K|CTAGE5_uc001wva.3_Missense_Mutation_p.E398K|CTAGE5_uc001wvh.3_Missense_Mutation_p.E427K|CTAGE5_uc001wvf.3_Missense_Mutation_p.E352K|CTAGE5_uc001wvi.3_Missense_Mutation_p.E432K|CTAGE5_uc010amz.2_Missense_Mutation_p.E43K|CTAGE5_uc001wvj.3_Missense_Mutation_p.E398K	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	427	Potential.						enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TGCCACTGAAGAGCTGGAGAC	0.299													20	109	---	---	---	---	PASS
HIF1A	3091	broad.mit.edu	37	14	62211422	62211422	+	Splice_Site	SNP	G	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62211422G>C	uc001xfq.2	+	13	2498	c.2094_splice	c.e13-1	p.R698_splice	HIF1A_uc001xfr.2_Splice_Site_p.R698_splice|HIF1A_uc001xfs.2_Splice_Site_p.R699_splice	NM_001530	NP_001521	Q16665	HIF1A_HUMAN	hypoxia-inducible factor 1, alpha subunit						cellular response to hypoxia|collagen metabolic process|connective tissue replacement involved in inflammatory response wound healing|elastin metabolic process|epithelial to mesenchymal transition|oxygen homeostasis|positive regulation of chemokine production|positive regulation of epithelial cell migration|positive regulation of hormone biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|regulation of transforming growth factor-beta2 production	cytoplasm|nucleolus|transcription factor complex	histone acetyltransferase binding|Hsp90 protein binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			kidney(3)|lung(1)	4				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)		TTTCTTTTCAGAACTACAGTT	0.303													11	74	---	---	---	---	PASS
MIR544	664613	broad.mit.edu	37	14	101515030	101515030	+	RNA	SNP	T	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101515030T>G	hsa-mir-544|MI0003515	+			c.36T>G			MIR655_hsa-mir-655|MI0003677_5'Flank																	0						aaaaagcagattctgattcag	0.104													15	57	---	---	---	---	PASS
COPS2	9318	broad.mit.edu	37	15	49429387	49429387	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49429387T>C	uc001zxf.2	-	6	579	c.500A>G	c.(499-501)AAG>AGG	p.K167R	COPS2_uc001zxh.2_Missense_Mutation_p.K174R|COPS2_uc010ufa.1_Missense_Mutation_p.K103R	NM_004236	NP_004227	P61201	CSN2_HUMAN	COP9 constitutive photomorphogenic homolog	167					cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity			lung(1)	1		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		TTTTTGAAGCTTTCCATATTC	0.303													15	76	---	---	---	---	PASS
CSK	1445	broad.mit.edu	37	15	75091783	75091783	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75091783T>A	uc010bkb.1	+	6	596	c.413T>A	c.(412-414)CTC>CAC	p.L138H	CSK_uc002ays.2_Missense_Mutation_p.L138H|CSK_uc010bkc.1_5'UTR	NM_001127190	NP_001120662	P41240	CSK_HUMAN	c-src tyrosine kinase	138	SH2.				blood coagulation|epidermal growth factor receptor signaling pathway|T cell costimulation|T cell receptor signaling pathway	centrosome|cytosol|Golgi apparatus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein C-terminus binding			lung(2)|central_nervous_system(1)	3						GCCAGCAAGCTCAGCATCGAC	0.602													7	63	---	---	---	---	PASS
RBL2	5934	broad.mit.edu	37	16	53495738	53495738	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53495738G>T	uc002ehi.3	+	10	1550	c.1432G>T	c.(1432-1434)GAG>TAG	p.E478*	RBL2_uc010vgv.1_Nonsense_Mutation_p.E404*|RBL2_uc002ehj.2_Nonsense_Mutation_p.E188*|RBL2_uc010vgw.1_Nonsense_Mutation_p.E262*	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	478	Domain A.|Pocket; binds E1A.				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						CCAGCCAGACGAGGATTTCAG	0.338													21	95	---	---	---	---	PASS
SLC38A8	146167	broad.mit.edu	37	16	84063144	84063144	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84063144C>A	uc002fhg.1	-	5	645	c.645G>T	c.(643-645)TGG>TGT	p.W215C		NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	215					amino acid transport|sodium ion transport	integral to membrane					0						ACACAGAGGTCCAGGAGGCAG	0.502													8	70	---	---	---	---	PASS
AIPL1	23746	broad.mit.edu	37	17	6331788	6331788	+	Silent	SNP	C	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6331788C>T	uc002gcp.2	-	3	410	c.315G>A	c.(313-315)AGG>AGA	p.R105R	AIPL1_uc002gcq.2_Silent_p.R45R|AIPL1_uc002gcr.2_Intron|AIPL1_uc010clk.2_Silent_p.R83R|AIPL1_uc010cll.2_Silent_p.R105R|AIPL1_uc002gcs.2_Silent_p.R105R	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting	105	PPIase FKBP-type.				protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding				0				COAD - Colon adenocarcinoma(228;0.141)		GGGCCATCTGCCTCAGGCTCC	0.632													27	133	---	---	---	---	PASS
WRAP53	55135	broad.mit.edu	37	17	7605730	7605730	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7605730T>C	uc010vuh.1	+	8	1179	c.1024T>C	c.(1024-1026)TGT>CGT	p.C342R	WRAP53_uc010vui.1_Missense_Mutation_p.C342R|WRAP53_uc002gip.2_Missense_Mutation_p.C342R|WRAP53_uc002gir.2_Missense_Mutation_p.C342R|WRAP53_uc002giq.2_RNA|WRAP53_uc010cnl.2_Missense_Mutation_p.C309R|WRAP53_uc010vuj.1_3'UTR|EFNB3_uc002gis.2_5'Flank	NM_001143990	NP_001137462	Q9BUR4	WAP53_HUMAN	WD repeat domain 79 isoform 2	342	WD 4.				positive regulation of telomerase activity|telomere formation via telomerase	Cajal body|cytoplasm|telomerase holoenzyme complex	protein binding|RNA binding				0						CCTCTATGCCTGTGGCTCCTA	0.627													3	54	---	---	---	---	PASS
RCVRN	5957	broad.mit.edu	37	17	9801316	9801316	+	3'UTR	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9801316T>C	uc002gme.1	-	3						NM_002903	NP_002894	P35243	RECO_HUMAN	recoverin						visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						tgtgtgtgtgtgcgcgcgcgt	0.443													4	55	---	---	---	---	PASS
ZNF286B	729288	broad.mit.edu	37	17	18575547	18575547	+	Intron	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18575547G>T	uc010vyd.1	-						FOXO3B_uc010vye.1_RNA	NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCCACCAAGAGCTCTTGCCAG	0.567													13	54	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35936539	35936539	+	Intron	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35936539G>A	uc002hoa.2	-						SYNRG_uc010wde.1_Intron|SYNRG_uc010wdf.1_Intron|SYNRG_uc002hoc.2_Intron|SYNRG_uc002hoe.2_Intron|SYNRG_uc002hod.2_Intron|SYNRG_uc010wdg.1_Intron|SYNRG_uc002hob.2_Intron|SYNRG_uc002hof.2_5'UTR|SYNRG_uc010cvd.1_Intron|SYNRG_uc002hog.1_Intron|SYNRG_uc010wdh.1_Intron	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1						endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						AAACATTAATGTATATAGTGG	0.418													7	39	---	---	---	---	PASS
KRTAP4-8	728224	broad.mit.edu	37	17	39253956	39253956	+	Silent	SNP	G	A	A	rs139720993	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39253956G>A	uc010wfo.1	-	1	420	c.381C>T	c.(379-381)CCC>CCT	p.P127P		NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4.8	127	21.|25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].					keratin filament					0						tgctgcagctggggcggcagc	0.104													3	2	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41349125	41349125	+	Splice_Site	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41349125T>C	uc010czd.2	+	16	2166	c.2026_splice	c.e16+2	p.M676_splice	NBR1_uc010diz.2_Splice_Site_p.M676_splice|NBR1_uc010whu.1_Splice_Site_p.M676_splice|NBR1_uc010whv.1_Splice_Site_p.M676_splice|NBR1_uc010whw.1_Splice_Site_p.M655_splice	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1						macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		CCTTGCAGAGTGAGTGTCCTT	0.517													16	57	---	---	---	---	PASS
CLTC	1213	broad.mit.edu	37	17	57758814	57758814	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57758814T>C	uc002ixq.1	+	20	3667	c.3224T>C	c.(3223-3225)TTT>TCT	p.F1075S	CLTC_uc002ixp.2_Missense_Mutation_p.F1075S|CLTC_uc002ixr.1_Missense_Mutation_p.F1079S	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	1075	Heavy chain arm.|Proximal segment.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTCCGGAAATTTGATGTCAAT	0.408			T	ALK|TFE3	ALCL|renal 								30	160	---	---	---	---	PASS
MIR1250	100302229	broad.mit.edu	37	17	79107042	79107042	+	RNA	SNP	A	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79107042A>T	hsa-mir-1250|MI0006385	-			c.67A>T			AATK_uc010dia.2_Intron																	0						TGGGCTGGAAAATGTGGCCTT	0.617													3	7	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42532845	42532845	+	Silent	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42532845C>A	uc010dni.2	+	4	3836	c.3540C>A	c.(3538-3540)GGC>GGA	p.G1180G		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	1180						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAGCCACAGGCTTCTCCAGCC	0.522									Schinzel-Giedion_syndrome				8	91	---	---	---	---	PASS
ATP8B1	5205	broad.mit.edu	37	18	55361849	55361849	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55361849T>C	uc002lgw.2	-	10	994	c.994A>G	c.(994-996)AAA>GAA	p.K332E	uc002lgv.1_Intron	NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1	332	Cytoplasmic (Potential).				ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)				TAATCAATTTTAGTTCTTTTA	0.308									Byler_disease				22	63	---	---	---	---	PASS
ZBTB7A	51341	broad.mit.edu	37	19	4048233	4048233	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4048233C>A	uc002lzh.2	-	3	1347	c.1272G>T	c.(1270-1272)AAG>AAT	p.K424N	ZBTB7A_uc002lzi.2_Missense_Mutation_p.K424N	NM_015898	NP_056982	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	424	C2H2-type 2.				cell differentiation|multicellular organismal development|transcription, DNA-dependent	nucleus	DNA binding|histone acetyltransferase binding|zinc ion binding			pancreas(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACCTTCAGCTTGTCCTGCC	0.692													7	28	---	---	---	---	PASS
ZSWIM4	65249	broad.mit.edu	37	19	13941977	13941977	+	3'UTR	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13941977C>A	uc002mxh.1	+	13					ZSWIM4_uc010xng.1_3'UTR	NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4								zinc ion binding			central_nervous_system(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			GGAAGGAGCCCGGCTGGAGAT	0.607													3	18	---	---	---	---	PASS
PDE4C	5143	broad.mit.edu	37	19	18331077	18331077	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18331077G>A	uc010xqc.1	-	7	1241	c.761C>T	c.(760-762)TCC>TTC	p.S254F	PDE4C_uc002nik.3_Missense_Mutation_p.S254F|PDE4C_uc002nil.3_Missense_Mutation_p.S254F|PDE4C_uc002nif.3_Missense_Mutation_p.S23F|PDE4C_uc002nig.3_Missense_Mutation_p.S24F|PDE4C_uc002nih.3_Missense_Mutation_p.S24F|PDE4C_uc010ebk.2_Missense_Mutation_p.S148F|PDE4C_uc002nii.3_Missense_Mutation_p.S222F|PDE4C_uc010ebl.2_5'UTR|PDE4C_uc010xqd.1_Missense_Mutation_p.S23F|PDE4C_uc010ebm.1_RNA	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2	254					signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)	CTGGTTCCCGGAGCGGCTGGT	0.567													52	235	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38572298	38572298	+	Silent	SNP	A	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38572298A>G	uc002ohk.2	+	3	602	c.93A>G	c.(91-93)ACA>ACG	p.T31T		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	31					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GGCCACACACAGGGGACTACG	0.557													9	55	---	---	---	---	PASS
ZNF211	10520	broad.mit.edu	37	19	58153167	58153167	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58153167C>G	uc002qpq.2	+	3	1493	c.1313C>G	c.(1312-1314)TCC>TGC	p.S438C	ZNF211_uc010yhb.1_Missense_Mutation_p.S442C|ZNF211_uc002qpp.2_Missense_Mutation_p.S451C|ZNF211_uc002qpr.2_Missense_Mutation_p.S502C|ZNF211_uc002qps.2_Missense_Mutation_p.S503C|ZNF211_uc002qpt.2_Missense_Mutation_p.S450C|ZNF211_uc010yhc.1_Missense_Mutation_p.S450C|ZNF211_uc010yhd.1_Missense_Mutation_p.S377C|ZNF211_uc010yhe.1_Missense_Mutation_p.S429C	NM_198855	NP_942152	Q13398	ZN211_HUMAN	zinc finger protein 211 isoform 2	438	C2H2-type 8.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAGCAAAGCTCCAGCTTCAGT	0.488													27	131	---	---	---	---	PASS
JAG1	182	broad.mit.edu	37	20	10627597	10627597	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10627597G>T	uc002wnw.2	-	14	2391	c.1875C>A	c.(1873-1875)TAC>TAA	p.Y625*	JAG1_uc010gcd.1_Nonsense_Mutation_p.Y183*	NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	625	Extracellular (Potential).|EGF-like 10.				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						TTTCATGGCAGTATGTTCCCG	0.572									Alagille_Syndrome				29	210	---	---	---	---	PASS
SEMG2	6407	broad.mit.edu	37	20	43851911	43851911	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43851911C>A	uc010ggz.2	+	2	1695	c.1638C>A	c.(1636-1638)TAC>TAA	p.Y546*	SEMG2_uc002xnk.2_Nonsense_Mutation_p.Y546*|SEMG2_uc002xnl.2_Nonsense_Mutation_p.Y426*	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	546	Repeat-rich region.|3-2.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				AAGGCAGATACAAACAGGAAT	0.378													5	108	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19701513	19701513	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19701513C>A	uc002ykw.2	-	15	1784	c.1753G>T	c.(1753-1755)GGT>TGT	p.G585C		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	585	Extracellular (Potential).|CUB 2.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						GCTTCTTCACCATCTCTTATT	0.328													25	148	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36702092	36702092	+	Silent	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36702092G>T	uc003apg.2	-	17	2274	c.2043C>A	c.(2041-2043)GGC>GGA	p.G681G	MYH9_uc003aph.1_Silent_p.G545G	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	681	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GGTCCAGCTTGCCGGCCTGGA	0.597			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				6	99	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148203	34148203	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148203G>T	uc004ddg.2	-	1	2226	c.2193C>A	c.(2191-2193)GAC>GAA	p.D731E		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	731										ovary(4)|central_nervous_system(1)	5						CATAAAGATCGTCAAGAACGT	0.433													4	151	---	---	---	---	PASS
TGIF2LY	90655	broad.mit.edu	37	Y	3447542	3447542	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:3447542T>A	uc004fqk.2	+	2	321	c.257T>A	c.(256-258)CTG>CAG	p.L86Q		NM_139214	NP_631960	Q8IUE0	TF2LY_HUMAN	TGFB-induced factor homeobox 2-like, Y-linked	86	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AAGCAAATGCTGTCAGAGAAG	0.478													6	196	---	---	---	---	PASS
CCDC30	728621	broad.mit.edu	37	1	43011397	43011398	+	Intron	DEL	CG	-	-	rs112575083		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43011397_43011398delCG	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						gcaggcagatcgcttgagctca	0.045													9	6	---	---	---	---	
ZFYVE9	9372	broad.mit.edu	37	1	52721716	52721717	+	Intron	DEL	TC	-	-	rs71645776		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52721716_52721717delTC	uc001cto.2	+						ZFYVE9_uc001ctn.2_Intron|ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						tttctttctttctctctctctc	0.000													4	2	---	---	---	---	
C1orf168	199920	broad.mit.edu	37	1	57233358	57233359	+	Intron	INS	-	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57233358_57233359insA	uc001cym.3	-						C1orf168_uc009vzu.1_Intron	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920											ovary(3)|skin(2)	5						ACCAGACACAGAAAAAAAAAAG	0.356													3	3	---	---	---	---	
MCOLN2	255231	broad.mit.edu	37	1	85417779	85417779	+	Intron	DEL	G	-	-	rs679961	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85417779delG	uc001dkm.2	-						MCOLN2_uc001dkn.2_Intron	NM_153259	NP_694991	Q8IZK6	MCLN2_HUMAN	mucolipin 2							integral to membrane	ion channel activity			ovary(3)|upper_aerodigestive_tract(1)	4				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		tagaaaaaaagaaaaGAGTAT	0.159													4	2	---	---	---	---	
C1orf52	148423	broad.mit.edu	37	1	85725354	85725360	+	5'UTR	DEL	CCGGAAA	-	-	rs112918702		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85725354_85725360delCCGGAAA	uc001dkv.2	-	1					C1orf52_uc001dkw.2_5'UTR|C1orf52_uc001dkx.3_5'UTR|C1orf52_uc009wcn.2_5'UTR	NM_198077	NP_932343	Q8N6N3	CA052_HUMAN	hypothetical protein LOC148423											ovary(1)	1				all cancers(265;0.0105)|Epithelial(280;0.0293)		CCGCCGGAAGCCGGAAACCGGAAACCG	0.671											OREG0013580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88342444	88342445	+	IGR	INS	-	TG	TG	rs112790722		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88342444_88342445insTG								LMO4 (527841 upstream) : PKN2 (807477 downstream)																							gttgttgttgttgtgtgtgtgt	0.000													4	2	---	---	---	---	
TBX15	6913	broad.mit.edu	37	1	119436237	119436240	+	Intron	DEL	AGAG	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119436237_119436240delAGAG	uc001ehl.1	-						TBX15_uc009whj.1_Intron	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		aaagaaagaaagagagagagaaag	0.118													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855824	148855826	+	IGR	DEL	GGG	-	-	rs59129261		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855824_148855826delGGG								NBPF16 (97513 upstream) : LOC645166 (72460 downstream)																							gcgggggggcgggaaaaagccgc	0.360													4	2	---	---	---	---	
SPTA1	6708	broad.mit.edu	37	1	158613927	158613927	+	Intron	DEL	A	-	-	rs77912388		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158613927delA	uc001fst.1	-							NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					actccatctcaaaaaaaaaaa	0.030													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161716375	161716376	+	IGR	DEL	CT	-	-	rs151003373		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161716375_161716376delCT								FCRLB (18443 upstream) : DUSP12 (3205 downstream)																							tccttccttccttcTCTCTCTC	0.035													4	2	---	---	---	---	
SFTPB	6439	broad.mit.edu	37	2	85893617	85893618	+	Intron	DEL	TG	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85893617_85893618delTG	uc002sqh.2	-						SFTPB_uc002sqi.2_Intron|SFTPB_uc002sqj.2_Intron	NM_198843	NP_942140	P07988	PSPB_HUMAN	surfactant, pulmonary-associated protein B						organ morphogenesis|respiratory gaseous exchange|sphingolipid metabolic process	extracellular space|lysosome				ovary(1)|central_nervous_system(1)	2						GCTTGGGTGCtgtgtgtgtgtg	0.515													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221574971	221574972	+	IGR	DEL	TG	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221574971_221574972delTG								None (None upstream) : EPHA4 (707777 downstream)																							taagccagcttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
RBM6	10180	broad.mit.edu	37	3	50095020	50095021	+	Intron	INS	-	AA	AA	rs72297787		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50095020_50095021insAA	uc003cyc.2	+						RBM6_uc011bdh.1_Intron|RBM6_uc010hlc.1_Intron|RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6						RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		aactccgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	58216894	58216897	+	IGR	DEL	AGGA	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58216894_58216897delAGGA								DNASE1L3 (16041 upstream) : ABHD6 (6362 downstream)																							AGagaaagagaggaaggaaggaag	0.083													4	5	---	---	---	---	
WDR1	9948	broad.mit.edu	37	4	10089380	10089380	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10089380delA	uc003gmf.2	-	8	1185	c.902delT	c.(901-903)ATCfs	p.I301fs	WDR1_uc003gmg.2_Frame_Shift_Del_p.I161fs|WDR1_uc003gmh.1_RNA|WDR1_uc011bwu.1_Frame_Shift_Del_p.I136fs	NM_017491	NP_059830	O75083	WDR1_HUMAN	WD repeat-containing protein 1 isoform 1	301					platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding			ovary(2)|pancreas(1)	3				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CAGATAGTTGATGTACCCGGA	0.602													16	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	42386168	42386169	+	IGR	DEL	CT	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42386168_42386169delCT								BEND4 (231273 upstream) : SHISA3 (13687 downstream)																							ctctccctccctctctctctct	0.000													8	5	---	---	---	---	
ATP8A1	10396	broad.mit.edu	37	4	42557859	42557860	+	Intron	INS	-	TAAA	TAAA	rs145505019	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42557859_42557860insTAAA	uc003gwr.2	-						ATP8A1_uc003gws.2_Intron|ATP8A1_uc011byz.1_Intron	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),						ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	aactaactaactaaataaataa	0.104													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	67801570	67801573	+	IGR	DEL	ACAC	-	-	rs72393997		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67801570_67801573delACAC								MIR1269 (658924 upstream) : CENPC1 (536416 downstream)																							acacaggcatacacacacacacac	0.049													6	3	---	---	---	---	
CBR4	84869	broad.mit.edu	37	4	169911113	169911113	+	3'UTR	DEL	A	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169911113delA	uc003iry.2	-	5					CBR4_uc011cjy.1_Intron	NM_032783	NP_116172	Q8N4T8	CBR4_HUMAN	carbonic reductase 4						fatty acid biosynthetic process|protein homotetramerization	mitochondrial matrix	NADPH binding|NADPH dehydrogenase (quinone) activity|protein binding|quinone binding				0		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		AACTTAGACCAAAAAAAAAAA	0.189													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	187396516	187396517	+	Intron	INS	-	AA	AA	rs75413796	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187396516_187396517insAA	uc003izb.1	-						uc003izc.2_Intron					Homo sapiens coagulation factor XI (plasma thromboplastin antecedent), mRNA (cDNA clone IMAGE:4831055).																		aagaaagaaagaaagaaagaaa	0.000													6	6	---	---	---	---	
PAPD4	167153	broad.mit.edu	37	5	78937261	78937261	+	Intron	DEL	T	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78937261delT	uc010jae.1	+						PAPD4_uc003kgb.2_Intron|PAPD4_uc010jaf.1_Intron|PAPD4_uc003kga.2_Intron|PAPD4_uc003kfz.2_Intron	NM_001114393	NP_001107865	Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4						histone mRNA catabolic process|mRNA processing|RNA polyadenylation	cytoplasm	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity			ovary(1)	1		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		TCACTATGTGTTTTTTTTTTT	0.303													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122554046	122554047	+	IGR	DEL	GT	-	-	rs112928698		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122554046_122554047delGT								PRDM6 (30302 upstream) : CEP120 (126533 downstream)																							tgtgtgtgtggtgtgtgtgtgt	0.337													3	4	---	---	---	---	
CSNK1G3	1456	broad.mit.edu	37	5	122862573	122862576	+	Intron	DEL	TGTA	-	-	rs3064348		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122862573_122862576delTGTA	uc003ktm.2	+						CSNK1G3_uc003ktl.2_Intron|CSNK1G3_uc003ktn.2_Intron|CSNK1G3_uc003kto.2_Intron|CSNK1G3_uc011cwr.1_Intron|CSNK1G3_uc011cws.1_Intron	NM_004384	NP_004375	Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3 isoform 1						Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		tgtgtgtgtgtgtatgaacataat	0.000													2	4	---	---	---	---	
CYFIP2	26999	broad.mit.edu	37	5	156819613	156819615	+	Intron	DEL	GTG	-	-	rs57047471	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156819613_156819615delGTG	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron|CYFIP2_uc003lwv.2_Intron	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			cagtgccacagtgttgttgatta	0.108													5	4	---	---	---	---	
PDLIM7	9260	broad.mit.edu	37	5	176917953	176917953	+	Intron	DEL	G	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176917953delG	uc003mhc.1	-						PDLIM7_uc003mha.1_Intron|PDLIM7_uc003mhb.1_Intron|PDLIM7_uc003mhd.1_Intron|PDLIM7_uc003mhe.1_Intron|PDLIM7_uc003mhf.2_Intron|PDLIM7_uc003mhg.1_Intron	NM_005451	NP_005442	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 isoform 1						cell differentiation|multicellular organismal development|ossification|receptor-mediated endocytosis	cytoplasm|focal adhesion	protein binding|zinc ion binding			breast(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACAGGGTCAGGGATCACGCC	0.602													86	37	---	---	---	---	
CAP2	10486	broad.mit.edu	37	6	17436298	17436299	+	Intron	INS	-	TCTT	TCTT			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17436298_17436299insTCTT	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357	P40123	CAP2_HUMAN	adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			AAACTAAGGAAtctttctttct	0.203													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	54275070	54275071	+	IGR	INS	-	TG	TG			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54275070_54275071insTG								TINAG (20120 upstream) : FAM83B (436498 downstream)																							gctttaatttctgtgtgtgtgt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	91375207	91375210	+	IGR	DEL	TCTT	-	-	rs67382099		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91375207_91375210delTCTT								MAP3K7 (78300 upstream) : None (None downstream)																							tttctttctatctttctttctttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	109610748	109610749	+	IGR	DEL	AA	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109610748_109610749delAA								C6orf182 (125635 upstream) : CD164 (76969 downstream)																							gactcgccttaaaaaaaaaaaa	0.178													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	123222043	123222050	+	IGR	DEL	CCTTCCTT	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123222043_123222050delCCTTCCTT								SMPDL3A (91181 upstream) : CLVS2 (95532 downstream)																							ATCTACTTTCccttccttccttccttcc	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	132083054	132083055	+	IGR	INS	-	TCCT	TCCT	rs4053155		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132083054_132083055insTCCT								ENPP3 (14505 upstream) : ENPP1 (46101 downstream)																							TTTTAAGTAGAtccttccttcc	0.158													4	5	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	28037690	28037691	+	Intron	INS	-	AGGCAGGC	AGGCAGGC	rs62449874	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28037690_28037691insAGGCAGGC	uc003szn.2	-							NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						ggaaggaaggaaggcaggcagg	0.054			T	SUZ12	endometrial stromal tumours								3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62701951	62701952	+	IGR	INS	-	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62701951_62701952insA								None (None upstream) : LOC643955 (49720 downstream)																							CTTTTTTGGAGAAAAAATATAT	0.337													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68106578	68106589	+	IGR	DEL	AAAAAAAAAAAA	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68106578_68106589delAAAAAAAAAAAA								None (None upstream) : AUTS2 (957316 downstream)																							GTATTAGGTGaaaaaaaaaaaaaaaaaaaaaa	0.387													4	2	---	---	---	---	
SPDYE2	441273	broad.mit.edu	37	7	102296867	102296867	+	Intron	DEL	C	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102296867delC	uc011kle.1	+						RASA4_uc011kld.1_Intron|POLR2J2_uc003vai.2_Intron|POLR2J2_uc003vah.2_Intron|SPDYE2_uc003val.1_Intron	NM_001146210	NP_001139682	Q495Y8	SPDE2_HUMAN	speedy homolog E6												0						CTCCTACAGtctttttttttt	0.294													5	3	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133539161	133539162	+	Intron	INS	-	CA	CA	rs139212578	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133539161_133539162insCA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				TGTTGAAAGAGcacacacacac	0.342											OREG0018331	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	4	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151936095	151936096	+	Intron	DEL	TT	-	-	rs3056723		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151936095_151936096delTT	uc003wla.2	-						MLL3_uc003wkz.2_5'Flank	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TAAGTATAACTTAAATGTTTGC	0.277			N		medulloblastoma								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	22557219	22557220	+	IGR	INS	-	AGAAAG	AGAAAG	rs13262232		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22557219_22557220insAGAAAG								EGR3 (6404 upstream) : PEBP4 (13545 downstream)																							gaagaaaggaaagaaagaaaga	0.010													4	2	---	---	---	---	
TEK	7010	broad.mit.edu	37	9	27204691	27204692	+	Intron	INS	-	T	T	rs72428264		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27204691_27204692insT	uc003zqi.3	+						TEK_uc011lno.1_Intron|TEK_uc011lnp.1_Intron|TEK_uc003zqj.1_Intron	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor						angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		acttttgcatgttttttttttt	0.099													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	33571222	33571222	+	IGR	DEL	T	-	-	rs143529725		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33571222delT								SUGT1P1 (60175 upstream) : ANXA2P2 (53001 downstream)																							attattattattttttttttt	0.249													4	5	---	---	---	---	
COL15A1	1306	broad.mit.edu	37	9	101712798	101712798	+	Intron	DEL	C	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101712798delC	uc004azb.1	+						COL15A1_uc004aza.2_Intron	NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				ttccttccttcccttcccttc	0.000													4	2	---	---	---	---	
SLC31A2	1318	broad.mit.edu	37	9	115923638	115923647	+	Intron	DEL	GAAGACAGTG	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115923638_115923647delGAAGACAGTG	uc004bgq.2	+						SLC31A2_uc011lxb.1_Intron	NM_001860	NP_001851	O15432	COPT2_HUMAN	solute carrier family 31 (copper transporters),							integral to plasma membrane	copper ion transmembrane transporter activity				0						AAAGTCTGGTGAAGACAGTGAAGAAGTTCG	0.519													20	9	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119265010	119265017	+	Intron	DEL	GAATGAAT	-	-	rs60618068		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119265010_119265017delGAATGAAT	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_Intron|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_Intron|uc004bju.1_5'Flank	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						aggaaggaaggaatgaatgaatgaatga	0.067													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	56582966	56582967	+	Intron	INS	-	AC	AC	rs150683086	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56582966_56582967insAC	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CACCAGCATAAacacacacaca	0.163										HNSCC(58;0.16)			6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81210254	81210255	+	IGR	INS	-	ACAC	ACAC	rs140447416	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81210254_81210255insACAC								ZCCHC24 (4871 upstream) : EIF5AL1 (62102 downstream)																							gtagttctgaaacacacacaca	0.064													3	3	---	---	---	---	
FAM190B	54462	broad.mit.edu	37	10	86215066	86215067	+	Intron	INS	-	ACTC	ACTC	rs137878977	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86215066_86215067insACTC	uc001kdh.1	+						FAM190B_uc010qmd.1_Intron|FAM190B_uc001kdi.1_Intron|FAM190B_uc010qme.1_Intron	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14											ovary(3)|skin(1)	4						gaaagagtctttgtcgcccaga	0.104													4	5	---	---	---	---	
NOLC1	9221	broad.mit.edu	37	10	103920995	103920996	+	Intron	INS	-	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103920995_103920996insT	uc001kuo.2	+						NOLC1_uc001kup.2_Intron|NOLC1_uc001kuq.2_Intron|NOLC1_uc009xxb.1_Intron|NOLC1_uc001kur.2_Intron	NM_004741	NP_004732	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1						mitosis|rRNA processing	cytoplasm|nucleolus	ATP binding|GTP binding|protein binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		AACTGGTTACCttttttttttt	0.257													4	2	---	---	---	---	
PTPRE	5791	broad.mit.edu	37	10	129732289	129732290	+	Intron	DEL	CA	-	-	rs7079516		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129732289_129732290delCA	uc001lkb.2	+						PTPRE_uc009yat.2_Intron	NM_006504	NP_006495	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)				ACCCCCCGCGcacacacacaca	0.292													5	3	---	---	---	---	
FRG2B	441581	broad.mit.edu	37	10	135439939	135439940	+	Intron	INS	-	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135439939_135439940insA	uc010qvg.1	-							NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B							nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ACACATTTCTCAAGTCCCCTGA	0.480													6	3	---	---	---	---	
DEAF1	10522	broad.mit.edu	37	11	654163	654167	+	Intron	DEL	CCCTT	-	-	rs56079259		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:654163_654167delCCCTT	uc001lqq.1	-						DEAF1_uc009ycf.1_Intron	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1						embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CCATTGGACCCCCtttttttttttt	0.337													4	2	---	---	---	---	
DIXDC1	85458	broad.mit.edu	37	11	111807569	111807570	+	5'Flank	INS	-	GT	GT	rs145794935	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111807569_111807570insGT	uc001pml.2	+						DIXDC1_uc001pmj.2_Intron|DIXDC1_uc001pmk.2_5'Flank	NM_001037954	NP_001033043	Q155Q3	DIXC1_HUMAN	DIX domain containing 1 isoform a						multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytosol|focal adhesion	actin binding|gamma-tubulin binding|signal transducer activity			ovary(1)	1		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		TTAAGTTAGCAgtgtgtgtgtg	0.490													5	3	---	---	---	---	
TMEM136	219902	broad.mit.edu	37	11	120199388	120199389	+	Intron	DEL	GT	-	-	rs36145001		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199388_120199389delGT	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		aacagtcatagtgtgtgtgtgt	0.045													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	133934967	133934970	+	IGR	DEL	ACAC	-	-	rs112389375		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133934967_133934970delACAC								LOC100128239 (23731 upstream) : JAM3 (3850 downstream)																							CTACTGAAAGacacacacacacac	0.338													5	3	---	---	---	---	
FOXM1	2305	broad.mit.edu	37	12	2970600	2970603	+	Intron	DEL	AAAT	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2970600_2970603delAAAT	uc001qlf.2	-						FOXM1_uc001qle.2_Intron|FOXM1_uc001qlg.2_Intron|FOXM1_uc009zea.2_Intron|FOXM1_uc009zeb.2_Intron	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	forkhead box M1 isoform 2						cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			aaaaatttaaaaataaataaataa	0.000													3	4	---	---	---	---	
C12orf11	55726	broad.mit.edu	37	12	27081488	27081490	+	Intron	DEL	AAA	-	-	rs79125248		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27081488_27081490delAAA	uc001rhk.3	-						C12orf11_uc010sjk.1_Intron	NM_018164	NP_060634	Q9NVM9	M89BB_HUMAN	hypothetical protein LOC55726						cell division|mitosis|regulation of mitotic cell cycle		protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	Colorectal(261;0.0847)					ATTAAAAGGCAAAAAAAAAAAAA	0.286													6	3	---	---	---	---	
PAN2	9924	broad.mit.edu	37	12	56726385	56726385	+	Intron	DEL	A	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56726385delA	uc001skx.2	-						PAN2_uc001skz.2_Intron|PAN2_uc001sky.2_Intron	NM_001127460	NP_001120932	Q504Q3	PAN2_HUMAN	PAN2 polyA specific ribonuclease subunit homolog						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6						ccctgtctcgaaaaaaaaaaa	0.194													8	4	---	---	---	---	
EEA1	8411	broad.mit.edu	37	12	93236124	93236125	+	Intron	INS	-	A	A			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93236124_93236125insA	uc001tck.2	-							NM_003566	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1, 162kD						early endosome to late endosome transport|synaptic vesicle to endosome fusion|vesicle fusion	cytosol|early endosome membrane|extrinsic to plasma membrane|membrane fraction	1-phosphatidylinositol binding|calmodulin binding|GTP-dependent protein binding|protein homodimerization activity|zinc ion binding			ovary(2)|skin(1)	3						tattaaacactaAAAAAAAAAA	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110072175	110072195	+	IGR	DEL	ACCGTCACCATCACCACCACT	-	-	rs111976531	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110072175_110072195delACCGTCACCATCACCACCACT								MVK (37105 upstream) : C12orf34 (79995 downstream)																							catcaccatcaccgtcaccatcaccaccactaccatcacca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21272380	21272381	+	IGR	INS	-	GGAA	GGAA	rs61955707		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21272380_21272381insGGAA								IFT88 (6806 upstream) : IL17D (5101 downstream)																							gacggaaggagggaaggaagga	0.000													4	2	---	---	---	---	
PRKD1	5587	broad.mit.edu	37	14	30091618	30091618	+	Intron	DEL	T	-	-	rs71437917		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30091618delT	uc001wqh.2	-							NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1						cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		Gtttttattattttttttttt	0.080													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106824931	106824932	+	Intron	INS	-	CT	CT	rs145829689	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106824931_106824932insCT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TAGAGCTGCCCGTTTTCAGTGG	0.559													4	3	---	---	---	---	
MKL2	57496	broad.mit.edu	37	16	14184737	14184740	+	Intron	DEL	GTGT	-	-	rs71986964		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14184737_14184740delGTGT	uc010uza.1	+						MKL2_uc002dcg.2_Intron	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						GTTCAGCATGgtgtgtgtgtgtgt	0.216													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	57454612	57454615	+	IGR	DEL	AAGG	-	-	rs113613565		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57454612_57454615delAAGG								CCL17 (4638 upstream) : CIAPIN1 (7472 downstream)																							aagaaaaagaaaggaaggaaggaa	0.000													4	4	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83541712	83541713	+	Intron	DEL	GG	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83541712_83541713delGG	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron|hsa-mir-3182|MI0014224_5'Flank	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		aaagaaggaaggaaaaggaagg	0.005													4	2	---	---	---	---	
TRPV1	7442	broad.mit.edu	37	17	3494199	3494200	+	Intron	INS	-	C	C	rs140971657	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3494199_3494200insC	uc010vrr.1	-						TRPV1_uc010vro.1_Intron|TRPV1_uc010vrp.1_Intron|TRPV1_uc010vrq.1_Intron|TRPV1_uc010vrs.1_Intron|TRPV1_uc010vrt.1_Intron|TRPV1_uc010vru.1_Intron	NM_080706	NP_542437	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel,						cell surface receptor linked signaling pathway|chemosensory behavior|thermoception	cell junction|dendritic spine membrane|integral to plasma membrane|postsynaptic membrane	ATP binding|calcium channel activity|calmodulin binding			ovary(1)	1				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	GGACAACCATGCCCCCCTGCTT	0.649													2	4	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10424898	10424899	+	Intron	DEL	AT	-	-	rs147245930		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10424898_10424899delAT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TATTGATGTCATatatatatat	0.248													6	3	---	---	---	---	
NLK	51701	broad.mit.edu	37	17	26516007	26516008	+	Intron	DEL	AC	-	-	rs72062341		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26516007_26516008delAC	uc010crj.2	+						NLK_uc010cri.1_Intron	NM_016231	NP_057315	Q9UBE8	NLK_HUMAN	nemo like kinase						intracellular protein kinase cascade|negative regulation of Wnt receptor signaling pathway|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|serine phosphorylation of STAT3 protein|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|MAP kinase activity|SH2 domain binding|transcription factor binding|ubiquitin protein ligase binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		acaaacacagacacacacacac	0.198													4	3	---	---	---	---	
CRLF3	51379	broad.mit.edu	37	17	29112800	29112800	+	Intron	DEL	A	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29112800delA	uc002hfr.3	-						CRLF3_uc010wbr.1_Intron	NM_015986	NP_057070	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3						negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				acttcataataaaaaaaaaaa	0.095													4	2	---	---	---	---	
ARL4D	379	broad.mit.edu	37	17	41476892	41476893	+	Intron	INS	-	A	A	rs3071190		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41476892_41476893insA	uc002idt.2	+							NM_001661	NP_001652	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D						protein secretion|small GTPase mediated signal transduction	cytoplasm|nucleolus|plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)	1		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		TGTTATGCCTTAAAAAAAAAAA	0.475													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47342483	47342484	+	IGR	INS	-	TTTCCTTCCTTCCTTCCTTCCTTCCTTC	TTTCCTTCCTTCCTTCCTTCCTTCCTTC			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47342483_47342484insTTTCCTTCCTTCCTTCCTTCCTTCCTTC								PHOSPHO1 (34355 upstream) : ZNF652 (24085 downstream)																							GCCGCTATTTAtttccttcctt	0.168													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	52506452	52506452	+	IGR	DEL	A	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52506452delA								KIF2B (603879 upstream) : TOM1L1 (471600 downstream)																							agaaagaaagagaggaaggaa	0.000													4	2	---	---	---	---	
DSC1	1823	broad.mit.edu	37	18	28723876	28723879	+	Intron	DEL	TATT	-	-	rs35474327		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28723876_28723879delTATT	uc002kwn.2	-						DSC1_uc002kwm.2_Intron	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein						homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ttcttttatatatttatttattta	0.123													3	3	---	---	---	---	
MRO	83876	broad.mit.edu	37	18	48335515	48335525	+	Intron	DEL	AAAAAAAAAAA	-	-	rs72245727		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48335515_48335525delAAAAAAAAAAA	uc002lew.3	-						MRO_uc010xdn.1_Intron|MRO_uc010dpa.2_Intron|MRO_uc010dpb.2_Intron|MRO_uc010dpc.2_Intron|MRO_uc002lex.3_Intron	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a							nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		actccgtctcaaaaaaaaaaaaaaaaaaaaa	0.156													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8230721	8230722	+	IGR	INS	-	GAAAGGG	GAAAGGG			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8230721_8230722insGAAAGGG								FBN3 (18340 upstream) : LASS4 (43495 downstream)																							gaaggaaggaaagaaaggaagg	0.153													4	2	---	---	---	---	
KCNN1	3780	broad.mit.edu	37	19	18076833	18076848	+	Intron	DEL	CCTTCCTTCCTTCCTT	-	-	rs7246976		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18076833_18076848delCCTTCCTTCCTTCCTT	uc002nht.2	+						KCNN1_uc010xqa.1_Intron	NM_002248	NP_002239	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance						synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0						tgcctgcctgccttccttccttccttccttccttcc	0.329													4	2	---	---	---	---	
CCDC123	84902	broad.mit.edu	37	19	33454848	33454849	+	Intron	DEL	AC	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33454848_33454849delAC	uc002nty.2	-						CCDC123_uc010edg.2_Intron|CCDC123_uc002ntz.1_Intron|CCDC123_uc002nua.2_Intron|CCDC123_uc002nub.1_Intron	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN	coiled-coil domain containing 123							centrosome|spindle pole					0	Esophageal squamous(110;0.137)					atgcacatgaacacacacacac	0.079													4	3	---	---	---	---	
BCAM	4059	broad.mit.edu	37	19	45318165	45318165	+	Intron	DEL	G	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45318165delG	uc002ozu.2	+						BCAM_uc002ozt.1_Intron	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1						cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				TTTTTTGGttgtttttttttt	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47265475	47265476	+	IGR	INS	-	GTGT	GTGT	rs112622467		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47265475_47265476insGTGT								FKRP (3643 upstream) : SLC1A5 (12666 downstream)																							actaaaaatacgtgtgtgtgtg	0.000													8	5	---	---	---	---	
RCN3	57333	broad.mit.edu	37	19	50046226	50046227	+	Intron	INS	-	AG	AG	rs140477388	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50046226_50046227insAG	uc002poj.2	+							NM_020650	NP_065701	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain							endoplasmic reticulum lumen	calcium ion binding|protein binding			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		gggaccaagacggggacagatt	0.213													2	4	---	---	---	---	
ZNF836	162962	broad.mit.edu	37	19	52667703	52667706	+	Intron	DEL	AAGG	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52667703_52667706delAAGG	uc010ydi.1	-						ZNF836_uc010ydj.1_Intron	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						agagagagaaaaggaaggaaggaa	0.000													4	2	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1332875	1332876	+	Intron	INS	-	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332875_1332876insT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron			P62942	FKB1A_HUMAN	Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	cctttccttccttcctttcctt	0.005													6	3	---	---	---	---	
RBM11	54033	broad.mit.edu	37	21	15585612	15585613	+	5'Flank	INS	-	TTCC	TTCC	rs145138104	by1000genomes	TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15585612_15585613insTTCC	uc002yjo.3	+						RBM11_uc002yjn.3_5'Flank|RBM11_uc002yjp.3_5'Flank	NM_144770	NP_658983	P57052	RBM11_HUMAN	RNA binding motif protein 11								nucleotide binding|RNA binding				0				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		GCCAAcctcctttccttccttc	0.144													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44755961	44755961	+	IGR	DEL	C	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755961delC								CRYAA (163048 upstream) : SIK1 (78437 downstream)																							accatcaccaccatcaccacc	0.000													4	2	---	---	---	---	
ENTHD1	150350	broad.mit.edu	37	22	40147067	40147067	+	Intron	DEL	A	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40147067delA	uc003ayg.2	-							NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1											ovary(2)|skin(1)	3	Melanoma(58;0.0749)					AGAGGAAAATAAAAAATTCAT	0.338													4	2	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467599	1467600	+	Intron	INS	-	TTTC	TTTC			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467599_1467600insTTTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ctttctttctgtttctgtttct	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1972733	1972740	+	IGR	DEL	AAGGAAGG	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1972733_1972740delAAGGAAGG								ASMT (210760 upstream) : DHRSX (164817 downstream)																							gaaagaaagaaaggaaggaaggaaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2498429	2498430	+	IGR	DEL	AC	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2498429_2498430delAC								DHRSX (79414 upstream) : CD99 (110798 downstream)																							GTGAGATTTTacacacacacac	0.272													4	2	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2729358	2729358	+	Intron	DEL	T	-	-			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2729358delT	uc011mhg.1	+						XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				ATGAGCTTGCTTTTTCTCCAC	0.348													14	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	53142508	53142509	+	Intron	INS	-	A	A	rs146094031		TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53142508_53142509insA	uc004dry.2	+											full-length cDNA clone CS0DC007YA11 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																		AACACACACACAAAAAAAAACC	0.262													2	4	---	---	---	---	
FAAH2	158584	broad.mit.edu	37	X	57368048	57368049	+	Intron	INS	-	T	T			TCGA-CJ-4918-01A-01D-1429-08	TCGA-CJ-4918-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57368048_57368049insT	uc004dvc.2	+							NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						tataatagttgttttttttttt	0.005										HNSCC(52;0.14)			4	2	---	---	---	---	
