Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
Unknown	0	broad.mit.edu	37	1	569343	569343	+	RNA	SNP	C	T	T	rs139706527	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:569343C>T	uc001abc.2	+	1		c.17C>T								full-length cDNA clone CS0DL012YI10 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human).																		ACTCCTGCCTCACTCATTTAC	0.428													4	13	---	---	---	---	PASS
CATSPER4	378807	broad.mit.edu	37	1	26524568	26524568	+	Silent	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26524568G>A	uc010oez.1	+	5	678	c.678G>A	c.(676-678)CTG>CTA	p.L226L	CATSPER4_uc010oey.1_Silent_p.L48L|CATSPER4_uc009vsf.2_RNA	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	226	Helical; Name=Segment S5; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		TCTTCATGCTGGTCAGTGCCT	0.602													72	100	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31447563	31447563	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31447563C>T	uc001bsi.1	-	10	1554	c.1441G>A	c.(1441-1443)GCC>ACC	p.A481T	PUM1_uc001bsf.1_Missense_Mutation_p.A147T|PUM1_uc001bsg.1_Missense_Mutation_p.A294T|PUM1_uc001bsh.1_Missense_Mutation_p.A481T|PUM1_uc001bsj.1_Missense_Mutation_p.A482T|PUM1_uc010oga.1_Missense_Mutation_p.A385T|PUM1_uc001bsk.1_Missense_Mutation_p.A517T|PUM1_uc010ogb.1_Missense_Mutation_p.A422T	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	481	Gln-rich.|Ala-rich.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GCTGCAGCGGCAGCGGCAGCT	0.507													66	182	---	---	---	---	PASS
C1orf122	127687	broad.mit.edu	37	1	38272900	38272900	+	5'UTR	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38272900G>A	uc001ccb.1	+	1					YRDC_uc001cca.1_Intron			Q6ZSJ8	CA122_HUMAN	SubName: Full=Chromosome 1 open reading frame 122;												0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0393)				GGGAAACACAGAAGAATAAAT	0.378													36	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	43439784	43439784	+	RNA	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43439784C>T	uc001cil.2	+	3		c.760C>T								Homo sapiens cDNA FLJ32224 fis, clone PLACE6004336.																		cACGGAACCACGCAAACTCCT	0.214													2	1	---	---	---	---	PASS
ZSWIM5	57643	broad.mit.edu	37	1	45484036	45484036	+	3'UTR	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45484036T>C	uc001cnd.2	-	14						NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5								zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					CTCAGAGTTCTCTCAGGGTGG	0.542											OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	23	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55642115	55642115	+	Silent	SNP	A	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55642115A>T	uc001cyg.3	-	2	156	c.156T>A	c.(154-156)GGT>GGA	p.G52G		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	164					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						ACTCGGAAAGACCTTAGTAAA	0.323													60	112	---	---	---	---	PASS
LOC400759	400759	broad.mit.edu	37	1	89875916	89875916	+	RNA	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89875916C>T	uc009wcy.1	+	2		c.138C>T				NR_003133				Homo sapiens cDNA, FLJ17004.												0						CAATGTGCCTCATTGAGAACA	0.502													25	35	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94544977	94544977	+	Missense_Mutation	SNP	A	T	T	rs61748549	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94544977A>T	uc001dqh.2	-	9	1244	c.1140T>A	c.(1138-1140)AAT>AAA	p.N380K	ABCA4_uc010otn.1_Missense_Mutation_p.N380K	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	380	Extracellular.		N -> K (in STGD1).		phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TGGTTAAAGGATTTGACTCCA	0.453													5	112	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117561137	117561137	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117561137G>T	uc010oxb.1	+	6	2030	c.1972G>T	c.(1972-1974)GCT>TCT	p.A658S	CD101_uc009whd.2_Missense_Mutation_p.A658S|CD101_uc010oxc.1_Missense_Mutation_p.A658S|CD101_uc010oxd.1_Missense_Mutation_p.A596S	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	658	Ig-like C2-type 6.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						CCCCCCGAGGGCTTCTGCCAT	0.448													27	32	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161518368	161518368	+	Silent	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161518368C>T	uc001gat.3	-	4	299	c.162G>A	c.(160-162)GAG>GAA	p.E54E	FCGR3A_uc001gar.2_Silent_p.E90E|FCGR3A_uc001gas.2_Silent_p.E89E|FCGR3A_uc009wuh.2_Silent_p.E53E|FCGR3A_uc009wui.2_Silent_p.E54E	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	54	Ig-like C2-type 1.|Extracellular (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGGAATTGTCCTCAGGGGAGT	0.542													15	269	---	---	---	---	PASS
FCGR3B	2215	broad.mit.edu	37	1	161599725	161599725	+	Silent	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161599725C>T	uc009wul.2	-	3	436	c.162G>A	c.(160-162)GAG>GAA	p.E54E		NM_000570	NP_000561	O75015	FCG3B_HUMAN	low affinity immunoglobulin gamma Fc region	54	Ig-like C2-type 1.				immune response	anchored to membrane|extracellular region|plasma membrane	IgG binding|receptor activity				0	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGGAATTGTCCTCAGGGGAGT	0.527													41	29	---	---	---	---	PASS
CENPL	91687	broad.mit.edu	37	1	173780412	173780412	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173780412G>C	uc001gje.3	-	2	240	c.26C>G	c.(25-27)TCA>TGA	p.S9*	CENPL_uc009wwg.2_5'UTR|CENPL_uc001gjg.3_Nonsense_Mutation_p.S9*|CENPL_uc001gjf.3_Nonsense_Mutation_p.S9*	NM_033319	NP_201576	Q8N0S6	CENPL_HUMAN	centromere protein L isoform 2	9					mitotic prometaphase	chromosome, centromeric region|cytosol|nucleus					0						ACTAGGAGTTGACTCTGGTGC	0.408													26	107	---	---	---	---	PASS
CFHR3	10878	broad.mit.edu	37	1	196749100	196749100	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196749100G>T	uc001gtl.2	+	3	514	c.427G>T	c.(427-429)GTC>TTC	p.V143F	CFHR3_uc001gtk.2_Missense_Mutation_p.V143F|CFHR3_uc010poy.1_Missense_Mutation_p.V143F|CFHR1_uc001gtm.2_Intron	NM_021023	NP_066303	Q02985	FHR3_HUMAN	complement factor H-related 3 precursor	143				V -> D (in Ref. 1; CAA48639).		extracellular space					0						ATGCATCCGTGTCAGTAAGTA	0.478													35	40	---	---	---	---	PASS
SRGAP2	23380	broad.mit.edu	37	1	206516309	206516309	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206516309A>G	uc001hdy.2	+	1	442	c.109A>G	c.(109-111)ATC>GTC	p.I37V	SRGAP2_uc009xbt.2_Translation_Start_Site|SRGAP2_uc010prt.1_Translation_Start_Site|SRGAP2_uc001hdx.2_Missense_Mutation_p.I37V|SRGAP2_uc010pru.1_Translation_Start_Site	NM_015326	NP_056141	O75044	FNBP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	124					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)					CCTGAATAATATCATTCCTCG	0.453													18	78	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848923	215848923	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848923G>T	uc001hku.1	-	63	12717	c.12330C>A	c.(12328-12330)TAC>TAA	p.Y4110*		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4110	Fibronectin type-III 26.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCAAACCAGAGTACTCCAGGA	0.488										HNSCC(13;0.011)			32	116	---	---	---	---	PASS
SPATA17	128153	broad.mit.edu	37	1	217947704	217947704	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217947704G>T	uc001hlh.1	+	7	574	c.548G>T	c.(547-549)AGA>ATA	p.R183I	SPATA17_uc009xdr.1_RNA|SPATA17_uc001hli.2_Missense_Mutation_p.R183I	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	183						cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TCACCCTTCAGAAAAGAGCCT	0.378													56	60	---	---	---	---	PASS
DEGS1	8560	broad.mit.edu	37	1	224363513	224363513	+	5'UTR	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224363513G>T	uc001hoi.2	+	1						NM_144780	NP_659004	O15121	DEGS1_HUMAN	degenerative spermatocyte homolog 1, lipid						sphingolipid metabolic process|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	electron carrier activity|protein binding|sphingolipid delta-4 desaturase activity				0	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		CATCGCTTGGGCCTCCTCCAC	0.701													16	37	---	---	---	---	PASS
TRIM11	81559	broad.mit.edu	37	1	228582654	228582654	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228582654A>T	uc001hss.2	-	6	1414	c.1159T>A	c.(1159-1161)TAC>AAC	p.Y387N	TRIM11_uc010pvx.1_Missense_Mutation_p.Y386N	NM_145214	NP_660215	Q96F44	TRI11_HUMAN	tripartite motif-containing 11	387	B30.2/SPRY.				response to virus	cytoplasm|nucleus	protein binding|zinc ion binding			lung(3)|ovary(1)	4		Prostate(94;0.0724)				GAGGAATTGTAATAGCTCCCC	0.617													47	72	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242287900	242287900	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242287900G>C	uc001hzn.1	-	6	930	c.803C>G	c.(802-804)GCT>GGT	p.A268G	PLD5_uc001hzl.3_Missense_Mutation_p.A206G|PLD5_uc001hzm.3_Missense_Mutation_p.A58G|PLD5_uc001hzo.1_Missense_Mutation_p.A176G			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	268						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			ACTATATAGAGCAAATATCCT	0.368													8	216	---	---	---	---	PASS
C1orf101	257044	broad.mit.edu	37	1	244715945	244715945	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244715945T>A	uc001iam.2	+	9	917	c.858T>A	c.(856-858)AGT>AGA	p.S286R	C1orf101_uc001iak.1_Intron|C1orf101_uc001ial.2_Missense_Mutation_p.S286R|C1orf101_uc010pym.1_Missense_Mutation_p.S135R|C1orf101_uc010pyn.1_Missense_Mutation_p.S219R	NM_001130957	NP_001124429	Q5SY80	CA101_HUMAN	hypothetical protein LOC257044 isoform 1	286	Extracellular (Potential).					integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			AAAGACGGAGTGTGGCTCATG	0.408													87	109	---	---	---	---	PASS
EMILIN1	11117	broad.mit.edu	37	2	27303623	27303623	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27303623G>A	uc002rii.3	+	3	742	c.314G>A	c.(313-315)CGC>CAC	p.R105H	EMILIN1_uc010eyq.1_Missense_Mutation_p.R105H|EMILIN1_uc002rik.3_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	105	EMI.				cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCGCCCTCGCTACCGTGTG	0.637											OREG0014513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	41	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32605236	32605236	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32605236T>C	uc010ezu.2	+	3	657	c.523T>C	c.(523-525)TCA>CCA	p.S175P		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	175					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GCAGCTCTTATCAGCATGTTT	0.299													38	51	---	---	---	---	PASS
EIF2AK2	5610	broad.mit.edu	37	2	37347219	37347219	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37347219C>G	uc010ynh.1	-	13	1688	c.1131G>C	c.(1129-1131)TGG>TGC	p.W377C	EIF2AK2_uc010fab.1_Missense_Mutation_p.W336C|EIF2AK2_uc010yng.1_Missense_Mutation_p.W377C|EIF2AK2_uc010fac.2_Missense_Mutation_p.W377C|EIF2AK2_uc010fad.2_Missense_Mutation_p.W324C	NM_002759	NP_002750	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha	377	Protein kinase.				evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity			ovary(2)|lung(2)|pancreas(1)	5		all_hematologic(82;0.248)				TTTTTTCAATCCATTGTTCCA	0.328													97	137	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44209499	44209499	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44209499G>T	uc002rtr.2	-	2	282	c.224C>A	c.(223-225)TCT>TAT	p.S75Y	LRPPRC_uc010yob.1_Intron|LRPPRC_uc010faw.1_Missense_Mutation_p.S49Y	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	75					mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTTCCTAGAAGAAAAAGTGGA	0.383													31	68	---	---	---	---	PASS
FOXN2	3344	broad.mit.edu	37	2	48573616	48573616	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48573616T>C	uc002rwh.1	+	3	578	c.263T>C	c.(262-264)ATA>ACA	p.I88T		NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor	88					embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			TTGTATGACATAGAGGGAGAT	0.433													11	196	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60780394	60780394	+	Silent	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60780394G>A	uc002sae.1	-	1	240	c.12C>T	c.(10-12)CGC>CGT	p.R4R	BCL11A_uc002sab.2_Silent_p.R4R|BCL11A_uc002sac.2_Silent_p.R4R|BCL11A_uc010ypi.1_5'UTR|BCL11A_uc010ypj.1_Silent_p.R4R|BCL11A_uc002saf.1_Silent_p.R4R|BCL11A_uc010fcg.2_Silent_p.R4R	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	4	Required for nuclear body formation and for SUMO1 recruitment (By similarity).				negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TGCCTTGCTTGCGGCGAGACA	0.448			T	IGH@	B-CLL								27	45	---	---	---	---	PASS
MGAT4A	11320	broad.mit.edu	37	2	99237792	99237792	+	3'UTR	SNP	C	T	T	rs11892744	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99237792C>T	uc002sze.2	-	16					C2orf64_uc002sza.2_Intron|MGAT4A_uc010yvm.1_3'UTR|MGAT4A_uc010fil.2_3'UTR	NM_012214	NP_036346	Q9UM21	MGT4A_HUMAN	alpha-1,3-mannosyl-glycoprotein						N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1						attcagttcccgtggctgtag	0.000													6	82	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112539971	112539971	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112539971C>G	uc002thi.2	-	43	5424	c.5177G>C	c.(5176-5178)AGG>ACG	p.R1726T		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1726					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						TTCAGAGTTCCTGTTAGCAAC	0.433													32	53	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122206531	122206531	+	Silent	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122206531T>C	uc002tnc.2	-	17	2079	c.1689A>G	c.(1687-1689)CTA>CTG	p.L563L	CLASP1_uc002tna.2_5'UTR|CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Silent_p.L563L|CLASP1_uc010yza.1_Silent_p.L563L|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tng.1_Silent_p.L563L	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	563	Ser-rich.				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					TCTCTTACTTTAGACTCTCTT	0.418													78	111	---	---	---	---	PASS
C2orf27A	29798	broad.mit.edu	37	2	132509139	132509139	+	Silent	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132509139C>T	uc002ttf.1	+	3	414	c.9C>T	c.(7-9)GTC>GTT	p.V3V		NM_013310	NP_037442	Q580R0	CB027_HUMAN	hypothetical protein LOC29798	3											0						CAATGACAGTCAAGTGGAAAC	0.373													70	133	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138434176	138434176	+	3'UTR	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138434176T>G	uc002tva.1	+	27						NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGACATGTAATCTGAAAAAGA	0.408													66	122	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179569401	179569401	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179569401G>A	uc010zfg.1	-	102	26290	c.26066C>T	c.(26065-26067)TCG>TTG	p.S8689L	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.S5350L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9616							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGTACCACGAAAGCTTGAT	0.338													65	90	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212587123	212587123	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212587123C>A	uc002veg.1	-	7	976	c.878G>T	c.(877-879)TGT>TTT	p.C293F	ERBB4_uc002veh.1_Missense_Mutation_p.C293F|ERBB4_uc010zji.1_Missense_Mutation_p.C293F|ERBB4_uc010zjj.1_Missense_Mutation_p.C293F|ERBB4_uc010fut.1_Missense_Mutation_p.C293F	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	293	Cys-rich.|Extracellular (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CTTACGTGGACATTTCTTGAC	0.323										TSP Lung(8;0.080)			110	201	---	---	---	---	PASS
CHCHD4	131474	broad.mit.edu	37	3	14157930	14157930	+	Silent	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14157930C>T	uc003byj.3	-	2	312	c.117G>A	c.(115-117)GAG>GAA	p.E39E	CHCHD4_uc003byi.3_Silent_p.E52E	NM_001098502	NP_001091972	Q8N4Q1	MIA40_HUMAN	coiled-coil-helix-coiled-coil-helix domain	39					protein transport|transmembrane transport	mitochondrial intermembrane space					0						ACTCACCATGCTCCTCGTATG	0.502													4	82	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33540105	33540105	+	3'UTR	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33540105T>G	uc003cfu.2	-	38					CLASP2_uc003cfs.2_3'UTR|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2											ovary(3)|central_nervous_system(1)	4						GAGACCTGGTTCGCTGTGATG	0.423													34	88	---	---	---	---	PASS
TDGF1	6997	broad.mit.edu	37	3	46620624	46620624	+	Silent	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46620624G>A	uc003cpv.2	+	2	355	c.75G>A	c.(73-75)CTG>CTA	p.L25L	LRRC2_uc003cpu.3_Intron	NM_003212	NP_003203	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1	25					activation of MAPK activity|anterior/posterior axis specification, embryo|mammary gland development|morphogenesis of a branching structure|negative regulation of apoptosis|peptidyl-serine phosphorylation|positive regulation of cell migration|positive regulation of peptidyl-tyrosine phosphorylation	anchored to membrane|cell surface|extrinsic to plasma membrane	growth factor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TCTTTGAACTGGGATTAGTTG	0.378													11	273	---	---	---	---	PASS
PROS1	5627	broad.mit.edu	37	3	93643084	93643084	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93643084C>T	uc003drb.3	-	3	600	c.259G>A	c.(259-261)GTT>ATT	p.V87I	PROS1_uc010hoo.2_5'UTR|PROS1_uc003dqz.3_5'UTR	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	87	Gla.		V -> L (in PROS1D).		leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	TTGAACTTACCTAAGTATTTT	0.164													24	107	---	---	---	---	PASS
DRD3	1814	broad.mit.edu	37	3	113858457	113858457	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113858457C>G	uc003ebd.2	-	6	1036	c.613G>C	c.(613-615)GTC>CTC	p.V205L	DRD3_uc010hqn.1_Missense_Mutation_p.V205L|DRD3_uc003ebb.1_Missense_Mutation_p.V205L|DRD3_uc003ebc.1_Missense_Mutation_p.V205L	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	205	Helical; Name=5.				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)	TAGACAAGGACAGTCACTCCA	0.507													75	104	---	---	---	---	PASS
GAP43	2596	broad.mit.edu	37	3	115395305	115395305	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115395305C>T	uc003ebq.2	+	2	862	c.476C>T	c.(475-477)GCC>GTC	p.A159V	GAP43_uc003ebr.2_Missense_Mutation_p.A195V	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	159					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		GCTGAAGATGCCCCAGCCAAG	0.413													4	39	---	---	---	---	PASS
C3orf1	51300	broad.mit.edu	37	3	119217644	119217644	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119217644G>C	uc003ecn.2	+	1	277	c.64G>C	c.(64-66)GTC>CTC	p.V22L	C3orf1_uc003eco.2_RNA|C3orf1_uc003ecp.2_5'Flank	NM_016589	NP_057673	Q9NPL8	TIDC1_HUMAN	hypothetical protein LOC51300	22						integral to membrane|mitochondrial inner membrane	protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.186)		ATTTCCCCGAGTCTTTGCTGC	0.582													55	70	---	---	---	---	PASS
PARP14	54625	broad.mit.edu	37	3	122437546	122437546	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122437546G>T	uc003efq.3	+	14	4607	c.4548G>T	c.(4546-4548)AAG>AAT	p.K1516N	PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Missense_Mutation_p.K1233N|PARP14_uc003efs.1_Missense_Mutation_p.K1233N	NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1516					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		CGATGATCAAGAGAGTTCGAT	0.388													77	136	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151161389	151161389	+	Silent	SNP	T	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151161389T>A	uc011bod.1	-	5	5346	c.5346A>T	c.(5344-5346)GCA>GCT	p.A1782A	IGSF10_uc011bob.1_5'Flank|IGSF10_uc011boc.1_5'Flank	NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1782	Ig-like C2-type 4.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTGTTTGGTTTGCAAGAATCC	0.493													57	116	---	---	---	---	PASS
VWA5B2	90113	broad.mit.edu	37	3	183951431	183951431	+	Missense_Mutation	SNP	C	T	T	rs902417	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183951431C>T	uc011bra.1	+	4	598	c.598C>T	c.(598-600)CCT>TCT	p.P200S	VWA5B2_uc003fnc.2_Missense_Mutation_p.P111S|VWA5B2_uc011brb.1_5'UTR|VWA5B2_uc003fnd.2_5'Flank	NM_138345	NP_612354	B9EGN7	B9EGN7_HUMAN	von Willebrand factor A domain containing 5B2	200											0						GCTGGCTGCCCCTCGGGACGT	0.662													4	36	---	---	---	---	PASS
BEND4	389206	broad.mit.edu	37	4	42127678	42127678	+	Silent	SNP	G	A	A	rs143808029	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42127678G>A	uc003gwn.2	-	4	1648	c.1068C>T	c.(1066-1068)ACC>ACT	p.T356T	BEND4_uc003gwm.2_Silent_p.T356T|BEND4_uc011byy.1_Silent_p.T356T	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	356											0						AATCTAAAACGGTCTGGCAGG	0.408													9	234	---	---	---	---	PASS
OCIAD2	132299	broad.mit.edu	37	4	48887578	48887578	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48887578A>G	uc003gyt.2	-	7	591	c.388T>C	c.(388-390)TGC>CGC	p.C130R	OCIAD2_uc003gyu.2_Silent_p.T90T	NM_001014446	NP_001014446	Q56VL3	OCAD2_HUMAN	OCIA domain containing 2 isoform 1	130						endosome					0						GTAAGGAGGCAGTGCCTAGAA	0.383													33	43	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62813877	62813877	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62813877G>A	uc010ihh.2	+	14	2657	c.2484G>A	c.(2482-2484)ATG>ATA	p.M828I	LPHN3_uc003hcq.3_Missense_Mutation_p.M828I|LPHN3_uc003hct.2_Missense_Mutation_p.M221I	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	815	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						AGCGTACAATGACAGGTTATT	0.393													39	102	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95496940	95496940	+	Silent	SNP	G	A	A	rs115743950	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95496940G>A	uc003hti.2	+	5	616	c.465G>A	c.(463-465)GCG>GCA	p.A155A	PDLIM5_uc003htf.2_Intron|PDLIM5_uc003htg.2_Intron|PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Silent_p.A33A	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	155					regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		CAGCCCATGCGACCACCTCAT	0.552													7	169	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134073481	134073481	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134073481T>G	uc003iha.2	+	1	3012	c.2186T>G	c.(2185-2187)TTC>TGC	p.F729C	PCDH10_uc003igz.2_Missense_Mutation_p.F729C	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	729	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		TCCTTCATCTTCCTGCTGGCC	0.592													19	39	---	---	---	---	PASS
LSM6	11157	broad.mit.edu	37	4	147110954	147110954	+	3'UTR	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147110954C>T	uc003ikq.3	+	4					LSM6_uc003ikp.3_RNA	NM_007080	NP_009011	P62312	LSM6_HUMAN	Sm protein F						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|mRNA processing|RNA splicing|rRNA processing|tRNA processing	cytosol|small nuclear ribonucleoprotein complex	protein binding|RNA binding				0	all_hematologic(180;0.151)					TAAATGTATACAATTGTGGAT	0.264													5	11	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32090803	32090803	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32090803T>G	uc003jhl.2	+	20	7637	c.7249T>G	c.(7249-7251)TCT>GCT	p.S2417A	PDZD2_uc003jhm.2_Missense_Mutation_p.S2417A	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	2417					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GATGGCCAAGTCTCCCTCAAT	0.557													30	38	---	---	---	---	PASS
KIF20A	10112	broad.mit.edu	37	5	137521998	137521998	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137521998C>T	uc003lcj.2	+	18	2729	c.2233C>T	c.(2233-2235)CGG>TGG	p.R745W	KIF20A_uc011cyo.1_Missense_Mutation_p.R727W	NM_005733	NP_005724	O95235	KI20A_HUMAN	kinesin family member 20A	745	Potential.				cytokinesis|M phase of mitotic cell cycle|microtubule-based movement|protein transport|vesicle-mediated transport	Golgi apparatus|microtubule|nucleoplasm	ATP binding|microtubule motor activity|protein binding|transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AAGGCTGTTGCGGACAGAGCT	0.483													7	138	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161580564	161580564	+	3'UTR	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161580564C>T	uc003lyz.3	+	9					GABRG2_uc010jjc.2_3'UTR|GABRG2_uc003lyy.3_3'UTR|GABRG2_uc011dej.1_3'UTR	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		GTACTTTGAACTTCGATGTTT	0.348													4	10	---	---	---	---	PASS
C6orf62	81688	broad.mit.edu	37	6	24706388	24706388	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24706388G>T	uc003nel.2	-	5	1174	c.667C>A	c.(667-669)CTC>ATC	p.L223I		NM_030939	NP_112201	Q9GZU0	CF062_HUMAN	hypothetical protein LOC81688	223						intracellular					0						TAAGGACGGAGGTGATCCTCT	0.443													6	136	---	---	---	---	PASS
C6orf191	253582	broad.mit.edu	37	6	130152440	130152440	+	3'UTR	SNP	C	T	T	rs9372948	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130152440C>T	uc003qbs.2	-	5						NM_001010876	NP_001010876	Q5VVB8	CF191_HUMAN	hypothetical protein LOC253582							integral to membrane				large_intestine(1)	1				GBM - Glioblastoma multiforme(226;0.0387)|all cancers(137;0.115)|OV - Ovarian serous cystadenocarcinoma(155;0.131)		TTCTATTTAACATTATTTCTG	0.269													4	47	---	---	---	---	PASS
ENPP3	5169	broad.mit.edu	37	6	131971248	131971248	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131971248G>C	uc003qcu.3	+	4	583	c.236G>C	c.(235-237)GGT>GCT	p.G79A	ENPP3_uc010kfn.1_RNA|ENPP3_uc011ecc.1_Missense_Mutation_p.G45A|ENPP3_uc010kfo.1_RNA|ENPP3_uc010kfp.1_RNA|ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Missense_Mutation_p.G79A	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	79	Extracellular (Potential).|Cell attachment site (Potential).|SMB 1.				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AAAGACCGAGGTGATTGCTGC	0.413													108	214	---	---	---	---	PASS
RMND1	55005	broad.mit.edu	37	6	151726969	151726969	+	Silent	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151726969G>T	uc003qoi.2	-	11	1383	c.1203C>A	c.(1201-1203)GTC>GTA	p.V401V	RMND1_uc011eeq.1_Silent_p.V190V	NM_017909	NP_060379	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog	401											0		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		TTTCATTCATGACCTATGTAA	0.368													38	72	---	---	---	---	PASS
POU6F2	11281	broad.mit.edu	37	7	39500265	39500265	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39500265G>T	uc003thb.1	+	9	1564	c.1522G>T	c.(1522-1524)GCT>TCT	p.A508S		NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1	508	POU-specific.				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						GGTGGGACAGGCTCTCAGTGC	0.592													6	38	---	---	---	---	PASS
SAMD9	54809	broad.mit.edu	37	7	92734124	92734124	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92734124A>T	uc003umf.2	-	3	1543	c.1287T>A	c.(1285-1287)GAT>GAA	p.D429E	SAMD9_uc003umg.2_Missense_Mutation_p.D429E	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	429						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CCTTCAGGAAATCTAAGTGTT	0.343													4	84	---	---	---	---	PASS
PDAP1	11333	broad.mit.edu	37	7	99001090	99001090	+	Silent	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99001090T>C	uc003uqe.2	-	3	265	c.144A>G	c.(142-144)GCA>GCG	p.A48A		NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1	48					cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)	TGGGGTCACCTGCAGCCCCAT	0.458													18	277	---	---	---	---	PASS
FBXO24	26261	broad.mit.edu	37	7	100184248	100184248	+	5'UTR	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100184248C>G	uc003uvm.1	+	1					LRCH4_uc003uvi.2_5'Flank|LRCH4_uc003uvj.2_5'Flank|LRCH4_uc011kjx.1_5'Flank|FBXO24_uc010lha.1_RNA|FBXO24_uc003uvl.1_5'UTR|FBXO24_uc003uvn.1_5'UTR|FBXO24_uc011kjz.1_5'Flank|FBXO24_uc011kka.1_5'Flank	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1							ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CTACCAATAGCATGGGCGAGA	0.567													36	152	---	---	---	---	PASS
MET	4233	broad.mit.edu	37	7	116411638	116411638	+	Silent	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116411638C>G	uc003vij.2	+	13	3004	c.2817C>G	c.(2815-2817)GTC>GTG	p.V939V	MET_uc010lkh.2_Silent_p.V957V|MET_uc011knj.1_Silent_p.V509V	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	939	Helical; (Potential).				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CTGGTGTTGTCTCAATATCAA	0.348			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				91	116	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123119948	123119948	+	Silent	SNP	A	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123119948A>C	uc003vkn.2	-	8	1888	c.1311T>G	c.(1309-1311)CTT>CTG	p.L437L	IQUB_uc003vko.2_Silent_p.L437L|IQUB_uc010lkt.2_Intron|IQUB_uc003vkp.1_Silent_p.L437L	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	437										ovary(3)|large_intestine(1)	4						CTTTTTCCAGAAGTTCACACA	0.398													124	158	---	---	---	---	PASS
ZC3HAV1	56829	broad.mit.edu	37	7	138764225	138764225	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138764225G>A	uc003vun.2	-	4	1850	c.1462C>T	c.(1462-1464)CTT>TTT	p.L488F	ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Missense_Mutation_p.L488F	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	488					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						CCGTTAACAAGTGCTACTCTT	0.443													43	68	---	---	---	---	PASS
DENND2A	27147	broad.mit.edu	37	7	140218464	140218464	+	3'UTR	SNP	C	A	A	rs6852	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140218464C>A	uc010lnj.2	-	18					DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_3'UTR|DENND2A_uc003vvw.2_3'UTR	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A											ovary(3)|breast(1)	4	Melanoma(164;0.00956)					GTTTTTAAAGCATAGGGCTGC	0.488													5	127	---	---	---	---	PASS
PDLIM2	64236	broad.mit.edu	37	8	22452072	22452072	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22452072A>T	uc003xcc.1	+	10	1145	c.1011A>T	c.(1009-1011)AGA>AGT	p.R337S		NM_176871	NP_789847	Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 isoform 1	Error:Variant_position_missing_in_Q96JY6_after_alignment						actin cytoskeleton|cell surface|cytoplasm|focal adhesion|nucleus	zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		AGGGAATGAGATTGTCACTGG	0.532													76	39	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110460595	110460595	+	Silent	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460595T>C	uc003yne.2	+	39	6104	c.6000T>C	c.(5998-6000)AAT>AAC	p.N2000N		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2000	Extracellular (Potential).|IPT/TIG 13.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACCCGCTTAATATTCAAAATA	0.373										HNSCC(38;0.096)			40	79	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125052244	125052244	+	Silent	SNP	A	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125052244A>T	uc003yqw.2	+	20	2792	c.2586A>T	c.(2584-2586)ACA>ACT	p.T862T	uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	862	Cytoplasmic (Potential).|C2 3.					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GCCAGACAACAAAGGTAACCA	0.527													10	54	---	---	---	---	PASS
FLJ43860	389690	broad.mit.edu	37	8	142444934	142444934	+	Silent	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142444934T>C	uc003ywi.2	-	30	3852	c.3771A>G	c.(3769-3771)ACA>ACG	p.T1257T	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_Intron	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	1257							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CTATGAAGAGTGTCACCCAGG	0.627													62	92	---	---	---	---	PASS
RANBP6	26953	broad.mit.edu	37	9	6013478	6013478	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6013478T>G	uc003zjr.2	-	1	2141	c.2130A>C	c.(2128-2130)CAA>CAC	p.Q710H	RANBP6_uc011lmf.1_Missense_Mutation_p.Q358H|RANBP6_uc003zjs.2_Missense_Mutation_p.Q298H	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	710					protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GCTTCACAACTTGTTCTGTAT	0.403													68	69	---	---	---	---	PASS
MLLT3	4300	broad.mit.edu	37	9	20414343	20414343	+	Silent	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414343A>G	uc003zoe.2	-	5	760	c.501T>C	c.(499-501)AGT>AGC	p.S167S	MLLT3_uc011lne.1_Silent_p.S135S|MLLT3_uc011lnf.1_Silent_p.S164S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Missense_Mutation_p.V129A	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	167	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.139			T	MLL	ALL								10	111	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	74622853	74622853	+	RNA	SNP	G	A	A	rs10120981	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74622853G>A	uc011lsc.1	-	1		c.200C>T				NR_024392				Homo sapiens heat shock 27kDa protein-like 2 pseudogene (HSPBL2), non-coding RNA.																		AGCTGGGCCCGCGACTCGAAG	0.652													3	33	---	---	---	---	PASS
FSD1L	83856	broad.mit.edu	37	9	108223895	108223895	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108223895A>G	uc011lvv.1	+	2	297	c.110A>G	c.(109-111)CAG>CGG	p.Q37R	FSD1L_uc011lvw.1_Intron|FSD1L_uc004bcq.2_Intron|FSD1L_uc004bcp.2_Intron	NM_001145313	NP_001138785	Q9BXM9	FSD1L_HUMAN	fibronectin type III and SPRY domain containing	37											0						AACTTGCAGCAGGTTGGTAGC	0.333													89	118	---	---	---	---	PASS
C5	727	broad.mit.edu	37	9	123719562	123719562	+	Splice_Site	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123719562C>T	uc004bkv.2	-	39	4792	c.4762_splice	c.e39+1	p.G1588_splice		NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	tgaatTCTCACCAGTTTTGTA	0.214													54	88	---	---	---	---	PASS
URM1	81605	broad.mit.edu	37	9	131151698	131151698	+	Intron	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131151698C>G	uc004buv.2	+						URM1_uc011may.1_Missense_Mutation_p.P116R|URM1_uc004buw.2_Intron	NM_030914	NP_112176	Q9BTM9	URM1_HUMAN	ubiquitin related modifier 1 homolog isoform a						tRNA thio-modification|tRNA wobble uridine modification		protein binding				0						AATCCTCCGCCCCACTCCAGC	0.607													19	21	---	---	---	---	PASS
BAT2L1	84726	broad.mit.edu	37	9	134350077	134350077	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134350077C>T	uc004can.3	+	15	2616	c.2561C>T	c.(2560-2562)CCA>CTA	p.P854L	BAT2L1_uc010mzj.1_Missense_Mutation_p.P437L|BAT2L1_uc004cao.3_Missense_Mutation_p.P212L	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	854							protein binding				0						AGGTGTTCCCCATTGGAGCCT	0.527													17	42	---	---	---	---	PASS
KIAA1984	84960	broad.mit.edu	37	9	139697161	139697161	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139697161G>A	uc004cjf.2	+	6	637	c.589G>A	c.(589-591)GTG>ATG	p.V197M		NM_001039374	NP_001034463	Q5T5S1	K1984_HUMAN	hypothetical protein LOC84960	197	Potential.									ovary(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GCAGAACCTCGTGGTCAACTA	0.567													30	81	---	---	---	---	PASS
USP6NL	9712	broad.mit.edu	37	10	11543102	11543102	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11543102T>C	uc001ikt.3	-	7	703	c.382A>G	c.(382-384)AGT>GGT	p.S128G	USP6NL_uc001iks.1_Missense_Mutation_p.S145G	NM_014688	NP_055503	Q92738	US6NL_HUMAN	USP6 N-terminal like isoform 1	128	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0						CTACTCACACTATACAGGTCC	0.358													17	73	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43318590	43318590	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43318590G>C	uc001jaj.2	+	20	3515	c.3157G>C	c.(3157-3159)GTG>CTG	p.V1053L		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	1053					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						TGCCTTGGAAGTGGCCAAATT	0.423													7	10	---	---	---	---	PASS
TMEM26	219623	broad.mit.edu	37	10	63212753	63212753	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63212753C>A	uc001jlo.2	-	1	456	c.87G>T	c.(85-87)GAG>GAT	p.E29D	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlq.2_RNA|uc001jlr.2_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	29						integral to membrane					0	Prostate(12;0.0112)					CCTTCTTCACCTCGGTCACTC	0.627													5	27	---	---	---	---	PASS
STAMBPL1	57559	broad.mit.edu	37	10	90698146	90698146	+	Intron	SNP	A	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90698146A>C	uc010qmx.1	+						ACTA2_uc001kfp.2_Intron|ACTA2_uc010qmy.1_Intron|ACTA2_uc001kfq.2_Intron|uc001kfo.1_RNA	NM_020799	NP_065850	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1								metal ion binding|metallopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		TCTGAGAGACAAAAGGGTCTT	0.483													9	7	---	---	---	---	PASS
PDLIM1	9124	broad.mit.edu	37	10	96997589	96997589	+	3'UTR	SNP	A	G	G	rs1049961	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96997589A>G	uc001kkh.2	-	7					PDLIM1_uc001kki.2_3'UTR|PDLIM1_uc009xuv.2_3'UTR	NM_020992	NP_066272	O00151	PDLI1_HUMAN	PDZ and LIM domain 1						response to oxidative stress	cytoplasm|cytoskeleton	zinc ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		AACCAAAGTAAGCAGAGAACT	0.498													3	19	---	---	---	---	PASS
CCNJ	54619	broad.mit.edu	37	10	97810064	97810064	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97810064C>T	uc001klm.2	+	3	480	c.121C>T	c.(121-123)CGG>TGG	p.R41W	uc001klg.1_Intron|uc001klj.1_Intron|uc009xvb.1_Intron|CCNJ_uc010qoq.1_Missense_Mutation_p.R41W|CCNJ_uc001kln.2_Missense_Mutation_p.R41W	NM_019084	NP_061957	Q5T5M9	CCNJ_HUMAN	cyclin J isoform 2	41	Cyclin N-terminal.					nucleus				ovary(1)	1				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		AAGTCTCAGACGGTATTTTGC	0.478													25	115	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1092095	1092095	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1092095G>A	uc001lsx.1	+	30	3941	c.3914G>A	c.(3913-3915)TGG>TAG	p.W1305*		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	1305						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGCTGCCTCTGGTCTGACTGG	0.592													16	57	---	---	---	---	PASS
LOC494141	494141	broad.mit.edu	37	11	18231915	18231915	+	RNA	SNP	T	C	C	rs2251440	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18231915T>C	uc009yhh.2	+	2		c.939T>C			LOC494141_uc001mnx.3_RNA|LOC494141_uc009yhi.1_RNA	NR_026541				Homo sapiens cDNA FLJ29025 fis, clone PRS03236.												0						TTCCTGTTTTTTCCAATTAAT	0.438													5	94	---	---	---	---	PASS
SLC15A3	51296	broad.mit.edu	37	11	60711236	60711236	+	Silent	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60711236G>A	uc001nqn.2	-	3	1155	c.921C>T	c.(919-921)ATC>ATT	p.I307I	SLC15A3_uc001nqo.2_Silent_p.I307I	NM_016582	NP_057666	Q8IY34	S15A3_HUMAN	solute carrier family 15, member 3	307					oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0						GGAAGTTGGCGATGTCCTCTT	0.592													18	59	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64453329	64453329	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64453329A>G	uc001oar.2	-	7	1380	c.941T>C	c.(940-942)ATC>ACC	p.I314T	NRXN2_uc001oas.2_Missense_Mutation_p.I290T|NRXN2_uc001oaq.2_5'UTR	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						GGCCAGTGTGATCTCATCAGT	0.577													193	201	---	---	---	---	PASS
EFEMP2	30008	broad.mit.edu	37	11	65635794	65635794	+	Missense_Mutation	SNP	C	T	T	rs113167523	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65635794C>T	uc001ofy.3	-	9	1140	c.946G>A	c.(946-948)GTG>ATG	p.V316M	EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.V316M	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	316	EGF-like 6; calcium-binding (Potential).				blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)		TAGGGCTCCACGCAGCGGTTG	0.587													10	13	---	---	---	---	PASS
PITPNM1	9600	broad.mit.edu	37	11	67265791	67265791	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67265791A>C	uc001olx.2	-	10	1676	c.1487T>G	c.(1486-1488)CTG>CGG	p.L496R	PITPNM1_uc001olw.2_5'UTR|PITPNM1_uc001oly.2_Missense_Mutation_p.L496R|PITPNM1_uc001olz.2_Missense_Mutation_p.L496R	NM_004910	NP_004901	O00562	PITM1_HUMAN	phosphatidylinositol transfer protein,	496					brain development|lipid metabolic process|phototransduction|protein transport	cleavage furrow|endoplasmic reticulum membrane|Golgi cisterna membrane|lipid particle|membrane fraction|midbody	metal ion binding|phosphatidylinositol transporter activity			lung(2)|central_nervous_system(1)	3						GTAAGGGCTCAGGCTGTAGGA	0.652													34	70	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118390456	118390456	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118390456A>G	uc001pta.2	+	32	11284	c.11261A>G	c.(11260-11262)AAT>AGT	p.N3754S	MLL_uc001ptb.2_Missense_Mutation_p.N3757S	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3754					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		GAGGAGGCCAATGAACCCCCC	0.507			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								55	126	---	---	---	---	PASS
CCND2	894	broad.mit.edu	37	12	4385304	4385304	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4385304C>G	uc001qmo.2	+	2	634	c.329C>G	c.(328-330)TCC>TGC	p.S110C		NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2	110	Cyclin N-terminal.				cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			TTCCTGGCCTCCAAACTCAAA	0.577			T	IGL@	NHL,CLL								27	46	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40689408	40689408	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40689408C>A	uc001rmg.3	+	23	3179	c.3058C>A	c.(3058-3060)CAG>AAG	p.Q1020K	LRRK2_uc001rmh.1_Missense_Mutation_p.Q642K|LRRK2_uc009zjw.2_5'UTR	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1020	LRR 2.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GGAGCTTCACCAGAATGCACT	0.358													41	53	---	---	---	---	PASS
PRICKLE1	144165	broad.mit.edu	37	12	42853975	42853975	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42853975T>G	uc010skv.1	-	8	2419	c.2132A>C	c.(2131-2133)AAA>ACA	p.K711T	PRICKLE1_uc001rnl.2_Missense_Mutation_p.K711T|PRICKLE1_uc010skw.1_Missense_Mutation_p.K711T|PRICKLE1_uc001rnm.2_Missense_Mutation_p.K711T|PRICKLE1_uc001rnk.1_5'Flank	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1	711					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		CTGTATAAATTTCTCATAGTT	0.478													68	71	---	---	---	---	PASS
LETMD1	25875	broad.mit.edu	37	12	51449970	51449970	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51449970T>G	uc001rxm.2	+	6	760	c.704T>G	c.(703-705)CTG>CGG	p.L235R	LETMD1_uc010smz.1_Missense_Mutation_p.L185R|LETMD1_uc010sna.1_Intron|LETMD1_uc001rxl.2_Missense_Mutation_p.L179R|LETMD1_uc009zlv.2_Intron|LETMD1_uc001rxs.2_Intron|LETMD1_uc009zlw.2_Missense_Mutation_p.L248R|LETMD1_uc001rxn.2_Missense_Mutation_p.L78R|LETMD1_uc001rxo.2_RNA|LETMD1_uc001rxp.2_Missense_Mutation_p.L118R|LETMD1_uc001rxq.2_Intron|LETMD1_uc001rxr.2_Intron|LETMD1_uc001rxt.2_Intron	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1	235	Mitochondrial intermembrane (Potential).|LETM1.					integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						ATCTTGGCTCTGAGAGAGTGT	0.473													71	121	---	---	---	---	PASS
SP1	6667	broad.mit.edu	37	12	53776832	53776832	+	Silent	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53776832T>G	uc001scw.2	+	3	1198	c.1101T>G	c.(1099-1101)GCT>GCG	p.A367A	SP1_uc010sog.1_Silent_p.A360A	NM_138473	NP_612482	P08047	SP1_HUMAN	Sp1 transcription factor isoform a	367	Transactivation domain B (Gln-rich).|Ser/Thr-rich.				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GGTCTGATGCTCTGAACATCC	0.498													77	97	---	---	---	---	PASS
TMTC3	160418	broad.mit.edu	37	12	88560118	88560118	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88560118C>T	uc001tau.2	+	7	1029	c.809C>T	c.(808-810)CCA>CTA	p.P270L	TMTC3_uc009zsm.2_RNA	NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	270						integral to membrane	binding			skin(1)	1						TTTGATAACCCAGCTGCTGTA	0.318													77	94	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100452921	100452921	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100452921T>G	uc001tgq.2	-	14	2363	c.2134A>C	c.(2134-2136)AAA>CAA	p.K712Q	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.K362Q	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	712										ovary(2)	2						GGCCGTCCTTTTCCACTTTTC	0.388													81	90	---	---	---	---	PASS
TDG	6996	broad.mit.edu	37	12	104374442	104374442	+	Intron	SNP	A	G	G	rs1866074	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104374442A>G	uc001tkg.2	+						TDG_uc010swh.1_3'UTR|TDG_uc009zuk.2_Intron|TDG_uc010swi.1_Intron|TDG_uc010swj.1_Intron	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase						depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		AAGGAGTCAAACTGGTTTTTT	0.383								BER_DNA_glycosylases					3	16	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132547141	132547141	+	Silent	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547141G>A	uc001ujn.2	+	46	8264	c.8229G>A	c.(8227-8229)CAG>CAA	p.Q2743Q	EP400_uc001ujl.2_Silent_p.Q2742Q|EP400_uc001ujm.2_Silent_p.Q2662Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2779	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacagcagcagcagc	0.323													6	88	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101717877	101717877	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101717877G>A	uc001vox.1	-	40	4672	c.4483C>T	c.(4483-4485)CGG>TGG	p.R1495W		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1495	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CGCAGTAGCCGCAGCAGGAAC	0.567													12	59	---	---	---	---	PASS
LOC643677	643677	broad.mit.edu	37	13	103388370	103388370	+	Missense_Mutation	SNP	C	T	T	rs9518825	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103388370C>T	uc001vpm.2	-	4	14817	c.14677G>A	c.(14677-14679)GGT>AGT	p.G4893S		NM_001146197	NP_001139669			hypothetical protein LOC643677												0						AGTATTCTACCTTCCCTGCCT	0.398													8	214	---	---	---	---	PASS
SLC7A8	23428	broad.mit.edu	37	14	23596350	23596350	+	3'UTR	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23596350G>T	uc001wiz.2	-	11					SLC7A8_uc001wiw.2_3'UTR|SLC7A8_uc001wix.2_3'UTR|SLC7A8_uc010tnk.1_3'UTR|SLC7A8_uc010tnl.1_3'UTR|SLC7A8_uc001wiy.2_RNA|SLC7A8_uc010akj.2_3'UTR	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid						blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GGATAAAAGGGGGAGGAAGGA	0.592													39	93	---	---	---	---	PASS
IL25	64806	broad.mit.edu	37	14	23842465	23842465	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23842465C>A	uc001wjr.2	+	1	448	c.138C>A	c.(136-138)GAC>GAA	p.D46E	IL25_uc001wjq.2_Missense_Mutation_p.D30E	NM_022789	NP_073626	Q9H293	IL25_HUMAN	interleukin 25 isoform 1 precursor	46					inflammatory response	extracellular space|membrane	cytokine activity|interleukin-17E receptor binding			ovary(1)	1	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		AAGGGCAGGACACCTCTGAGG	0.597													33	38	---	---	---	---	PASS
C14orf39	317761	broad.mit.edu	37	14	60938407	60938407	+	Missense_Mutation	SNP	T	A	A	rs1956551		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60938407T>A	uc001xez.3	-	6	484	c.374A>T	c.(373-375)TAC>TTC	p.Y125F	C14orf39_uc010apo.2_Intron	NM_174978	NP_777638	Q08AQ4	Q08AQ4_HUMAN	hypothetical protein LOC317761	125										ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTTTAGTTGGTACTGCTTCAA	0.289													50	130	---	---	---	---	PASS
RHOJ	57381	broad.mit.edu	37	14	63735887	63735887	+	Splice_Site	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63735887G>C	uc001xgb.1	+	2	680	c.237_splice	c.e2+1	p.Q79_splice		NM_020663	NP_065714	Q9H4E5	RHOJ_HUMAN	ras homolog gene family, member J precursor						actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		CGCGGGACAGGTACATTTTTA	0.398													32	98	---	---	---	---	PASS
CCPG1	9236	broad.mit.edu	37	15	55669238	55669238	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55669238T>G	uc002acv.1	-	5	528	c.363A>C	c.(361-363)GAA>GAC	p.E121D	CCPG1_uc002acy.2_Missense_Mutation_p.E121D|DYX1C1_uc010ugh.1_RNA|CCPG1_uc002acw.1_5'UTR|CCPG1_uc002acx.2_Missense_Mutation_p.E121D|CCPG1_uc010bfk.1_Missense_Mutation_p.E121D|CCPG1_uc002acz.1_Missense_Mutation_p.E121D	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2	121	Cytoplasmic (Potential).|Interaction with MCF2L and SRC (By similarity).				cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		CAATGACAACTTCTTGATTTC	0.393													79	120	---	---	---	---	PASS
RGMA	56963	broad.mit.edu	37	15	93616253	93616253	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93616253G>C	uc002bss.1	-	2	294	c.22C>G	c.(22-24)CTA>GTA	p.L8V	RGMA_uc002bsq.1_5'UTR|RGMA_uc010boi.1_5'UTR|RGMA_uc002bsr.1_5'UTR|RGMA_uc010urc.1_Missense_Mutation_p.L16V	NM_020211	NP_064596	Q96B86	RGMA_HUMAN	RGM domain family, member A precursor	8					axon guidance	anchored to membrane|endoplasmic reticulum|plasma membrane					0	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			GTTACCACTAGCCTCTCCCTG	0.592													33	56	---	---	---	---	PASS
NR2F2	7026	broad.mit.edu	37	15	96876611	96876611	+	Intron	SNP	T	A	A	rs7173047	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96876611T>A	uc010uri.1	+						NR2F2_uc002btp.2_Intron|NR2F2_uc010urj.1_Intron|NR2F2_uc010urk.1_5'UTR	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			CCTCGCCGGCTTTCCCCGGCC	0.522													4	62	---	---	---	---	PASS
PRSS41	360226	broad.mit.edu	37	16	2849515	2849515	+	Silent	SNP	C	T	T	rs117070691	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2849515C>T	uc010uwi.1	+	3	525	c.525C>T	c.(523-525)TTC>TTT	p.F175F		NM_001135086	NP_001128558	Q7RTY9	PRS41_HUMAN	testis-specific serine protease 1 precursor	175	Peptidase S1.				proteolysis	anchored to membrane|plasma membrane	serine-type endopeptidase activity				0						CCTTCAACTTCGTGCACCGGC	0.602													6	114	---	---	---	---	PASS
SEC14L5	9717	broad.mit.edu	37	16	5040871	5040871	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5040871A>G	uc002cye.2	+	5	629	c.449A>G	c.(448-450)AAG>AGG	p.K150R		NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5	150	PRELI/MSF1.					integral to membrane|intracellular	transporter activity				0						ATCGCCATGAAGCAGTACACC	0.443													19	21	---	---	---	---	PASS
C16orf62	57020	broad.mit.edu	37	16	19641134	19641134	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19641134C>G	uc002dgn.1	+	18	1558	c.1546C>G	c.(1546-1548)CAT>GAT	p.H516D	C16orf62_uc002dgo.1_Missense_Mutation_p.H449D|C16orf62_uc002dgp.1_Missense_Mutation_p.H265D	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020	516						integral to membrane				ovary(1)	1						CACCTGCAAGCATTTCACGGT	0.338													170	257	---	---	---	---	PASS
ATXN2L	11273	broad.mit.edu	37	16	28847500	28847500	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28847500G>A	uc002drc.2	+	22	3310	c.3142G>A	c.(3142-3144)GAG>AAG	p.E1048K	uc010vct.1_Intron|ATXN2L_uc002drb.2_Intron|ATXN2L_uc002dqy.2_Intron|ATXN2L_uc002dra.2_Intron|ATXN2L_uc002dqz.2_Intron|ATXN2L_uc010vdb.1_Intron|ATXN2L_uc002dre.2_Intron|ATXN2L_uc002drf.2_Missense_Mutation_p.E457K|ATXN2L_uc002drg.2_Missense_Mutation_p.E331K	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	1048						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						CAGGATTCGTGAGTTCTCATT	0.617													86	126	---	---	---	---	PASS
CBLN1	869	broad.mit.edu	37	16	49314951	49314951	+	Silent	SNP	T	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49314951T>A	uc002efq.2	-	2	606	c.267A>T	c.(265-267)GTA>GTT	p.V89V		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	89	C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).				nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)				TGTTCACTAGTACCTATAACG	0.552													6	157	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69951612	69951612	+	Silent	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69951612C>T	uc002exu.1	+	11	1094	c.1005C>T	c.(1003-1005)GGC>GGT	p.G335G	WWP2_uc002exv.1_Silent_p.G335G|WWP2_uc010vlm.1_Silent_p.G219G|WWP2_uc010vln.1_5'UTR	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	335	WW 2.				entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						CTATTTCCAGCTGGGAAAAAC	0.547													3	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90168789	90168789	+	RNA	SNP	C	T	T	rs4273797		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90168789C>T	uc002fqr.2	+	1		c.88C>T								Homo sapiens cDNA FLJ35239 fis, clone PROST2002212.																		CCTGTGGCCTCGCAAACAAAA	0.343													6	177	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7727491	7727491	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7727491G>C	uc002giu.1	+	75	11545	c.11531G>C	c.(11530-11532)GGT>GCT	p.G3844A	DNAH2_uc010cnm.1_Missense_Mutation_p.G782A	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	3844	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGTCCCCTGGTGTGGACCCC	0.637													11	35	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18055188	18055188	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18055188C>T	uc010vxh.1	+	40	8154	c.7816C>T	c.(7816-7818)CGG>TGG	p.R2606W	MYO15A_uc010vxi.1_5'Flank|MYO15A_uc010vxj.1_5'Flank|MYO15A_uc010vxk.1_5'Flank	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	2606	Tail.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GTTCATGAAGCGGCCAGACCC	0.577													34	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	37264555	37264555	+	3'UTR	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37264555G>T	uc002hrf.1	+	3					PLXDC1_uc002hrg.2_Intron|PLXDC1_uc002hrh.2_Intron|PLXDC1_uc002hri.2_Intron|PLXDC1_uc002hrj.1_Intron|PLXDC1_uc002hrk.1_Intron					SubName: Full=cDNA FLJ42226 fis, clone THYMU2040824;																		GGCCGCTTTGGGGGCCTTTTC	0.622													9	25	---	---	---	---	PASS
KRTAP1-1	81851	broad.mit.edu	37	17	39197549	39197549	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39197549G>C	uc002hvw.1	-	1	165	c.101C>G	c.(100-102)TCC>TGC	p.S34C		NM_030967	NP_112229	Q07627	KRA11_HUMAN	keratin associated protein 1-1	34			Missing (in allele KAP1.7).|PSCSTSGTCGSSCCQPSCCETSSCQPRCCETSCCQPSCCQT SFCGFP -> R (in allele KAP1.6).			extracellular region|keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCTGGCAGGAGCTGGTCTC	0.612													17	73	---	---	---	---	PASS
COASY	80347	broad.mit.edu	37	17	40715086	40715086	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40715086C>T	uc002hzz.2	+	2	603	c.446C>T	c.(445-447)TCG>TTG	p.S149L	COASY_uc010cyj.2_Missense_Mutation_p.S178L|COASY_uc002iab.2_5'UTR|COASY_uc002iad.2_Missense_Mutation_p.S149L|COASY_uc002iac.2_Missense_Mutation_p.S149L|COASY_uc002iae.2_5'Flank	NM_001042529	NP_001035994	Q13057	COASY_HUMAN	coenzyme A synthase isoform a	149					coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial outer membrane	ATP binding|dephospho-CoA kinase activity|pantetheine-phosphate adenylyltransferase activity				0		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CGACTGGCCTCGGTGCTGCTA	0.597													31	35	---	---	---	---	PASS
ADAM11	4185	broad.mit.edu	37	17	42854119	42854119	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42854119C>G	uc002ihh.2	+	19	1573	c.1573C>G	c.(1573-1575)CCT>GCT	p.P525A	ADAM11_uc010wjd.1_Missense_Mutation_p.P325A|ADAM11_uc002ihi.2_5'Flank	NM_002390	NP_002381	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11 preproprotein	525	Extracellular (Potential).|Disintegrin.				integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)				ACAGTGCCCGCCTAACCTGCA	0.622													44	90	---	---	---	---	PASS
BRIP1	83990	broad.mit.edu	37	17	59820468	59820468	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59820468C>T	uc002izk.1	-	16	2426	c.2285G>A	c.(2284-2286)CGT>CAT	p.R762H	BRIP1_uc002izl.1_Missense_Mutation_p.R143H	NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	762					DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						CACTTTACCACGACAAACTGC	0.388			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				22	145	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62029159	62029159	+	Silent	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62029159G>T	uc002jds.1	-	14	2555	c.2478C>A	c.(2476-2478)ATC>ATA	p.I826I		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	826					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	TGATGCGCCCGATGGCAATCT	0.607													12	28	---	---	---	---	PASS
C17orf99	100141515	broad.mit.edu	37	17	76162140	76162140	+	3'UTR	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76162140A>G	uc002jus.3	+	5					C17orf99_uc010wts.1_3'UTR|SYNGR2_uc002jut.2_5'Flank|SYNGR2_uc002juu.1_5'Flank|SYNGR2_uc002juv.1_5'Flank|SYNGR2_uc010dhi.1_5'Flank	NM_001163075	NP_001156547	Q6UX52	CQ099_HUMAN	hypothetical protein LOC100141515 precursor							extracellular region					0						tgaaccgtccagagagccaag	0.090													13	23	---	---	---	---	PASS
ACTG1	71	broad.mit.edu	37	17	79477820	79477820	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79477820C>T	uc002kaj.1	-	5	1049	c.1024G>A	c.(1024-1026)GGT>AGT	p.G342S	ACTG1_uc002kah.1_Missense_Mutation_p.G220S|ACTG1_uc002kai.1_Missense_Mutation_p.G299S|ACTG1_uc002kak.1_Missense_Mutation_p.G342S|ACTG1_uc010wun.1_Missense_Mutation_p.G342S|ACTG1_uc002kal.1_Missense_Mutation_p.G342S|ACTG1_uc002kag.2_RNA	NM_001614	NP_001605	P63261	ACTG_HUMAN	actin, gamma 1 propeptide	342					adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol	ATP binding|identical protein binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			ATGGAGCCACCGATCCACACC	0.612													3	37	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	7955120	7955120	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7955120A>T	uc002knn.3	+	7	1343	c.840A>T	c.(838-840)GAA>GAT	p.E280D	PTPRM_uc010dkv.2_Missense_Mutation_p.E280D|PTPRM_uc010wzl.1_Missense_Mutation_p.E67D	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	280	Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				GTCTTTCAGAACCACCCGTTC	0.443													27	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	74402256	74402256	+	RNA	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74402256T>C	uc002lmh.1	+	1		c.271T>C								Homo sapiens cDNA FLJ44881 fis, clone BRAMY2036254.																		TCATGTAAGTTGGCCTTAGTA	0.468													47	87	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1044699	1044699	+	Missense_Mutation	SNP	G	A	A	rs35732553		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1044699G>A	uc002lqw.3	+	11	1402	c.1171G>A	c.(1171-1173)GCT>ACT	p.A391T	ABCA7_uc010dsb.1_Missense_Mutation_p.A253T	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	391	Extracellular (By similarity).				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACGCACACGCTGATGTGGG	0.672													11	42	---	---	---	---	PASS
GTPBP3	84705	broad.mit.edu	37	19	17449208	17449208	+	Silent	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17449208G>A	uc010eas.2	+	3	401	c.336G>A	c.(334-336)GAG>GAA	p.E112E	GTPBP3_uc010xpo.1_Silent_p.E134E|GTPBP3_uc010ear.1_RNA|GTPBP3_uc002ngh.3_Silent_p.E112E|GTPBP3_uc002ngg.3_Silent_p.E112E|GTPBP3_uc002ngi.3_5'UTR	NM_032620	NP_116009	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial) isoform V	112					tRNA modification	mitochondrion	GTP binding|GTPase activity			skin(1)	1						ACTGCGTGGAGTTCCACGTGC	0.612													6	148	---	---	---	---	PASS
ZNF507	22847	broad.mit.edu	37	19	32843992	32843992	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32843992T>A	uc002nte.2	+	3	528	c.256T>A	c.(256-258)TGT>AGT	p.C86S	ZNF507_uc002ntc.2_Missense_Mutation_p.C86S|ZNF507_uc010xrn.1_Missense_Mutation_p.C86S|ZNF507_uc002ntd.2_Missense_Mutation_p.C86S	NM_001136156	NP_001129628	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	86					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(110;0.162)					CCAAGAACTTTGTGAGATTCC	0.423													56	51	---	---	---	---	PASS
CGB2	114336	broad.mit.edu	37	19	49535524	49535524	+	Intron	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49535524C>T	uc002plw.2	+						CGB_uc010yad.1_Intron|SNAR-G2_uc010yae.1_5'Flank|CGB2_uc010yaf.1_5'UTR|CGB2_uc010yag.1_5'Flank	NM_033378	NP_203696			chorionic gonadotropin, beta polypeptide 2												0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GAGCGTGACCCCCAGTAAGCT	0.597													11	38	---	---	---	---	PASS
PRPF31	26121	broad.mit.edu	37	19	54634954	54634954	+	3'UTR	SNP	A	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54634954A>C	uc002qdh.2	+	14					PRPF31_uc010yek.1_3'UTR	NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog						assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGCAGGGAGAACCTGCCCTGC	0.632													8	23	---	---	---	---	PASS
ZNF132	7691	broad.mit.edu	37	19	58948571	58948571	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58948571C>T	uc002qst.3	-	2	476	c.75G>A	c.(73-75)TGG>TGA	p.W25*		NM_003433	NP_003424	P52740	ZN132_HUMAN	zinc finger protein 132	25						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		AGCCACAGGGCCAAGAAGTAT	0.463													36	62	---	---	---	---	PASS
FERMT1	55612	broad.mit.edu	37	20	6069695	6069695	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6069695A>C	uc002wmr.2	-	10	1970	c.1181T>G	c.(1180-1182)TTT>TGT	p.F394C	FERMT1_uc002wmq.2_5'UTR|FERMT1_uc010gbt.2_Missense_Mutation_p.F137C|FERMT1_uc002wms.2_Missense_Mutation_p.F394C	NM_017671	NP_060141	Q9BQL6	FERM1_HUMAN	kindlin-1	394	PH.|FERM.				cell adhesion|establishment of epithelial cell polarity|keratinocyte migration|keratinocyte proliferation	cytosol|focal adhesion|ruffle membrane	binding			ovary(1)|pancreas(1)|skin(1)	3						TTTAAAGATAAACCAATATTG	0.353													135	204	---	---	---	---	PASS
PLK1S1	55857	broad.mit.edu	37	20	21143043	21143043	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21143043G>A	uc002wsb.2	+	5	1070	c.937G>A	c.(937-939)GAA>AAA	p.E313K	PLK1S1_uc010zsh.1_Missense_Mutation_p.E210K|PLK1S1_uc010zsi.1_Missense_Mutation_p.E180K|PLK1S1_uc010zsj.1_RNA|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_RNA	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1	313					spindle organization	centrosome	protein kinase binding				0						TGAAGTTGAGGAAAAAAGAGC	0.443													9	75	---	---	---	---	PASS
ATP5J	522	broad.mit.edu	37	21	27096945	27096945	+	3'UTR	SNP	A	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27096945A>C	uc002yls.2	-	4					ATP5J_uc002ylt.2_3'UTR|ATP5J_uc002ylu.2_3'UTR|ATP5J_uc002ylv.2_3'UTR|ATP5J_uc002ylw.2_3'UTR	NM_001685	NP_001676	P18859	ATP5J_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP catabolic process|respiratory electron transport chain		hydrogen ion transmembrane transporter activity				0						ATTTTACTTTATTTCTTCAGG	0.328													59	106	---	---	---	---	PASS
ATP5J	522	broad.mit.edu	37	21	27096949	27096949	+	3'UTR	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27096949C>T	uc002yls.2	-	4					ATP5J_uc002ylt.2_3'UTR|ATP5J_uc002ylu.2_3'UTR|ATP5J_uc002ylv.2_3'UTR|ATP5J_uc002ylw.2_3'UTR	NM_001685	NP_001676	P18859	ATP5J_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP catabolic process|respiratory electron transport chain		hydrogen ion transmembrane transporter activity				0						TACTTTATTTCTTCAGGCCTG	0.338													61	111	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38539860	38539860	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38539860T>A	uc002yvz.2	+	34	4510	c.4405T>A	c.(4405-4407)TCT>ACT	p.S1469T	TTC3_uc002ywa.2_Missense_Mutation_p.S1469T|TTC3_uc002ywb.2_Missense_Mutation_p.S1469T|TTC3_uc010gnf.2_Missense_Mutation_p.S1234T|TTC3_uc002ywc.2_Missense_Mutation_p.S1159T|TTC3_uc002ywd.1_Missense_Mutation_p.S533T	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1469					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				CCCACAGGTATCTTGGAACAT	0.323													28	72	---	---	---	---	PASS
SGSM3	27352	broad.mit.edu	37	22	40803186	40803186	+	Intron	SNP	G	T	T	rs2018393	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40803186G>T	uc003ayu.1	+						SGSM3_uc011aos.1_Intron|SGSM3_uc011aot.1_Intron|SGSM3_uc010gyd.1_Missense_Mutation_p.G451C	NM_015705	NP_056520	Q96HU1	SGSM3_HUMAN	small G protein signaling modulator 3						cell cycle arrest|Rap protein signal transduction	cytoplasm	Rab GTPase activator activity|Rab GTPase binding			ovary(2)	2						TGGTCACCATGGTTCTCTGGG	0.632													4	36	---	---	---	---	PASS
CSF2RA	1438	broad.mit.edu	37	X	1413322	1413322	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1413322G>T	uc010nct.2	+	9	1070	c.748G>T	c.(748-750)GAC>TAC	p.D250Y	CSF2RA_uc011mhb.1_Missense_Mutation_p.D250Y|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Missense_Mutation_p.D250Y|CSF2RA_uc004cpo.2_Missense_Mutation_p.D250Y|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Missense_Mutation_p.D117Y|CSF2RA_uc004cpp.2_Missense_Mutation_p.D250Y|CSF2RA_uc010ncv.2_Missense_Mutation_p.D250Y|CSF2RA_uc004cpr.2_Missense_Mutation_p.D250Y	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	250	Extracellular (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GTCGTACCTGGACTTTCAGTA	0.612													99	244	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148882	34148882	+	Missense_Mutation	SNP	C	T	T	rs5973089		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148882C>T	uc004ddg.2	-	1	1547	c.1514G>A	c.(1513-1515)CGC>CAC	p.R505H		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	505			Missing.							ovary(4)|central_nervous_system(1)	5						AGGCTCCGAGCGGAGACTGGA	0.647													10	62	---	---	---	---	PASS
PORCN	64840	broad.mit.edu	37	X	48378842	48378842	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48378842T>G	uc010nie.1	+	15	1522	c.1364T>G	c.(1363-1365)ATC>AGC	p.I455S	PORCN_uc004djr.1_Missense_Mutation_p.I450S|PORCN_uc004djs.1_Missense_Mutation_p.I444S|PORCN_uc004djt.1_Missense_Mutation_p.I373S|PORCN_uc011mlx.1_Missense_Mutation_p.I373S|PORCN_uc004dju.1_Missense_Mutation_p.I313S|PORCN_uc004djv.1_Missense_Mutation_p.I455S|PORCN_uc004djw.1_Missense_Mutation_p.I449S|EBP_uc004djx.3_5'Flank|EBP_uc004djy.3_5'Flank|EBP_uc004djz.2_5'Flank	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D	455	Cytoplasmic (Potential).				Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3						GGATGCTGGATCTTCTACCGT	0.562													77	79	---	---	---	---	PASS
OPHN1	4983	broad.mit.edu	37	X	67413751	67413751	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67413751G>C	uc004dww.3	-	14	1476	c.1182C>G	c.(1180-1182)ATC>ATG	p.I394M	OPHN1_uc011mpg.1_Missense_Mutation_p.I394M	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1	394	Rho-GAP.				axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						CAATAATATTGATGCACTTCC	0.408													42	246	---	---	---	---	PASS
TRMT2B	79979	broad.mit.edu	37	X	100297051	100297051	+	Silent	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100297051T>C	uc004egq.2	-	2	527	c.228A>G	c.(226-228)CTA>CTG	p.L76L	TRMT2B_uc004egp.2_RNA|TRMT2B_uc004egr.2_Silent_p.L76L|TRMT2B_uc004egs.2_Silent_p.L76L|TRMT2B_uc004egt.2_Silent_p.L76L|TRMT2B_uc004egu.2_Intron|TRMT2B_uc004egv.2_Silent_p.L76L	NM_024917	NP_079193	Q96GJ1	TRM2_HUMAN	TRM2 tRNA methyltransferase 2 homolog B	76							tRNA (uracil-5-)-methyltransferase activity			ovary(1)	1						AGGAACCATCTAGTGGTCCAA	0.458													25	172	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	1736	1736	+	5'Flank	SNP	A	G	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:1736A>G	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		ACCATTTACCCAAATAAAGTA	0.403													7	31	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3766	3766	+	RNA	SNP	T	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3766T>C	uc004cos.3	+	2		c.2059T>C			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		TACTATCAACATTACTAATAA	0.448													5	59	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	6308	6308	+	5'UTR	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6308C>T	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		TTAGCAGGGAACTACTCCCAC	0.517													5	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	8794	8794	+	RNA	SNP	C	T	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:8794C>T	uc011mfi.1	+	1		c.132C>T			uc004cov.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		GACTCCTGCCTCACTCATTTA	0.423													3	27	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8505745	8505745	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8505745delT	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc010nzx.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GAACCCCACCTtttttttttt	0.254													6	3	---	---	---	---	
LZIC	84328	broad.mit.edu	37	1	9995489	9995489	+	Intron	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9995489delC	uc001aqm.2	-						LZIC_uc001aqn.2_Intron|LZIC_uc001aqo.2_Intron|LZIC_uc009vmr.2_Intron|LZIC_uc010oah.1_Intron	NM_032368	NP_115744	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing								beta-catenin binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		gcatctcaaacaaaaacaaga	0.144													77	48	---	---	---	---	
FBXO2	26232	broad.mit.edu	37	1	11709051	11709052	+	Intron	INS	-	G	G	rs56192923		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11709051_11709052insG	uc001asj.2	-						FBXO2_uc009vna.2_Intron	NM_012168	NP_036300	Q9UK22	FBX2_HUMAN	F-box only protein 2						glycoprotein catabolic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|endoplasmic reticulum|membrane|microsome|SCF ubiquitin ligase complex	sugar binding|ubiquitin-protein ligase activity				0	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		agcccagcccaccccagcccag	0.559													14	8	---	---	---	---	
ZMYM6	9204	broad.mit.edu	37	1	35457576	35457576	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35457576delA	uc001byh.2	-						ZMYM6_uc001byf.1_Intron|ZMYM6_uc010oht.1_Intron|ZMYM6_uc009vup.2_Intron|ZMYM6_uc009vuq.1_3'UTR	NM_007167	NP_009098	O95789	ZMYM6_HUMAN	zinc finger protein 258						multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				CGCAGTATTTAAAAAAAAAAA	0.269													6	3	---	---	---	---	
COL9A2	1298	broad.mit.edu	37	1	40777201	40777201	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40777201delG	uc001cfh.1	-	10	560	c.490delC	c.(490-492)CAGfs	p.Q164fs	COL9A2_uc001cfi.1_5'UTR	NM_001852	NP_001843	Q14055	CO9A2_HUMAN	alpha 2 type IX collagen precursor	164	Nonhelical region 4 (NC4).				axon guidance|skeletal system development	collagen type IX				ovary(2)	2	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			TCCAGACCCTGGATGGTTCCC	0.652													79	41	---	---	---	---	
PCSK9	255738	broad.mit.edu	37	1	55505552	55505553	+	In_Frame_Ins	INS	-	CTG	CTG	rs67610340		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55505552_55505553insCTG	uc001cyf.1	+	1	333_334	c.42_43insCTG	c.(40-45)insCTG	p.23_24insL	PCSK9_uc010ool.1_RNA|PCSK9_uc010oom.1_5'Flank	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	23_24					cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						Ggccgctgccactgctgctgct	0.574													19	15	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	75688237	75688237	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75688237delT	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						TTTATGATTATTTCTGCCAAT	0.318													18	16	---	---	---	---	
SORT1	6272	broad.mit.edu	37	1	109911956	109911956	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109911956delA	uc001dxm.1	-						SORT1_uc010ovi.1_Intron|SORT1_uc009wfb.2_Intron	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ACCCCCCCGCAAAAAAGATGT	0.234													7	10	---	---	---	---	
MAGI3	260425	broad.mit.edu	37	1	113963632	113963632	+	Intron	DEL	T	-	-	rs111998040		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113963632delT	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGATTAAAACTTTTTTTTTTT	0.303													3	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144190344	144190347	+	Intron	DEL	TCTG	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144190344_144190347delTCTG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_5'Flank|uc001ejx.1_Intron|uc010oxv.1_Intron|uc010oxw.1_Intron|uc010oxx.1_Intron|uc010oxy.1_Intron|uc010oxz.1_Intron|uc010oya.1_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						TCTCTCTCTCTCtgtgtgtgtgtg	0.387													4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145020888	145020888	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145020888delA	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		tcccacctctaaaaaaaaata	0.035			T	PDGFRB	MPD								4	2	---	---	---	---	
BRP44	25874	broad.mit.edu	37	1	167887833	167887833	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167887833delT	uc001ges.2	-						BRP44_uc001get.2_Intron|BRP44_uc001geu.2_Intron	NM_015415	NP_056230	O95563	BR44_HUMAN	brain protein 44							mitochondrion					0	all_hematologic(923;0.215)			KIRC - Kidney renal clear cell carcinoma(1967;0.247)		TGCCAAAAACttttttttttt	0.199													4	2	---	---	---	---	
C1orf112	55732	broad.mit.edu	37	1	169768818	169768818	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169768818delA	uc001ggp.2	+						C1orf112_uc001ggj.2_Intron|C1orf112_uc001ggo.2_Intron|C1orf112_uc001ggq.2_Intron|C1orf112_uc009wvt.2_Intron|C1orf112_uc010plu.1_Intron|C1orf112_uc009wvu.1_Intron|C1orf112_uc001ggr.2_Intron	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732												0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					tcagtctcccaagtagctggg	0.000													16	7	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235993390	235993390	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235993390delT	uc001hxj.2	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron|LYST_uc001hxl.1_Intron|LYST_uc001hxm.2_Intron|LYST_uc001hxn.1_3'UTR	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ATAGGTCCACTTTTTTTTTAG	0.289									Chediak-Higashi_syndrome				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	246675118	246675119	+	IGR	INS	-	GTGCC	GTGCC	rs144976585	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246675118_246675119insGTGCC								SMYD3 (4504 upstream) : TFB2M (28749 downstream)																							TTGGTGTCACTGTGCCCTGCCC	0.639													4	6	---	---	---	---	
OR2L8	391190	broad.mit.edu	37	1	248112361	248112361	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248112361delA	uc001idt.1	+	1	202	c.202delA	c.(202-204)ATTfs	p.I68fs	OR2L13_uc001ids.2_Intron	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GCTCTCCCTCATTGACCTAAA	0.443													172	105	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11245891	11245898	+	Intron	DEL	TTGGTGGC	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11245891_11245898delTTGGTGGC	uc002raz.1	-						uc002rba.1_Intron					Homo sapiens cDNA FLJ33534 fis, clone BRAMY2007411.																		CCTGATACTTTTGGTGGCTGTGGATCTG	0.486													42	28	---	---	---	---	
NOTO	344022	broad.mit.edu	37	2	73435901	73435901	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73435901delA	uc010yrd.1	+							NM_001134462	NP_001127934	A8MTQ0	NOTO_HUMAN	notochord homeobox							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CTATATAATGAAAAAAAAAAG	0.398													4	3	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87113761	87113761	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87113761delT	uc002srs.3	+						uc010fgu.1_RNA			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						ATGAAAATTGTTTTCCTCAAT	0.368													98	54	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91924711	91924712	+	IGR	INS	-	GGTCTGAGAA	GGTCTGAGAA	rs60861855		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91924711_91924712insGGTCTGAGAA								LOC654342 (76736 upstream) : GGT8P (38656 downstream)																							CTTTGCATTTTGTAAGTGAGCA	0.470													4	2	---	---	---	---	
RFX8	731220	broad.mit.edu	37	2	102019046	102019047	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102019046_102019047insA	uc010yvx.1	-	11	1216_1217	c.1096_1097insT	c.(1096-1098)TCCfs	p.S366fs	RFX8_uc002tbb.1_Frame_Shift_Ins_p.S195fs	NM_001145664	NP_001139136	Q6ZV50	RFX8_HUMAN	regulatory factor X, 8	479					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						CGACAGTGAGGAATTCAGAGAA	0.535													46	34	---	---	---	---	
PSD4	23550	broad.mit.edu	37	2	113953973	113953974	+	Intron	INS	-	T	T	rs71385890		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113953973_113953974insT	uc002tjc.2	+						PSD4_uc002tjd.2_Intron|PSD4_uc002tje.2_Intron|PSD4_uc002tjf.2_Intron|PSD4_uc002tjg.2_5'Flank|PSD4_uc010yxs.1_5'Flank|PSD4_uc002tjh.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4						regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						GTGTGCAGAGAGACAGCCCGCG	0.599													7	4	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	116447242	116447243	+	Intron	DEL	AT	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116447242_116447243delAT	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						ATGATCAATAATGTTTCTTTTT	0.257													116	92	---	---	---	---	
LOC150786	150786	broad.mit.edu	37	2	132124153	132124153	+	5'Flank	DEL	G	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132124153delG	uc002tsr.2	-							NM_001077637	NP_001071105	Q53S08	Q53S08_HUMAN	RAB6C-like						protein transport|small GTPase mediated signal transduction		GTP binding				0				BRCA - Breast invasive adenocarcinoma(221;0.078)		CAGGGTCTGTGGGGGGCCCTC	0.667													4	2	---	---	---	---	
ORC2L	4999	broad.mit.edu	37	2	201806219	201806219	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201806219delA	uc002uwr.2	-						ORC2L_uc010zhj.1_Intron	NM_006190	NP_006181	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0						attaaaaaTTAAAAAAAAAAA	0.154													4	2	---	---	---	---	
LANCL1	10314	broad.mit.edu	37	2	211319720	211319720	+	Intron	DEL	G	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211319720delG	uc010zjh.1	-						LANCL1_uc002ved.2_Intron|LANCL1_uc010fuq.2_Intron	NM_001136574	NP_001130046	O43813	LANC1_HUMAN	lanthionine synthetase C-like protein 1							cytoplasm|integral to plasma membrane|microtubule cytoskeleton|nucleus	catalytic activity|G-protein coupled receptor activity|glutathione binding|low-density lipoprotein particle receptor binding|SH3 domain binding|zinc ion binding				0				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		ACAGCAGTGAGATTTATCTGC	0.313													6	3	---	---	---	---	
ABCA12	26154	broad.mit.edu	37	2	215876834	215876834	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215876834delT	uc002vew.2	-	16	2202	c.1982delA	c.(1981-1983)AAGfs	p.K661fs	ABCA12_uc002vev.2_Frame_Shift_Del_p.K343fs|ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	661					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTCTACTGGCTTTTGATCTTT	0.303													140	100	---	---	---	---	
ABCA12	26154	broad.mit.edu	37	2	216002611	216002611	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216002611delT	uc002vew.2	-						ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGTCATGTTCTTTTTTTTTTG	0.383													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238850980	238850980	+	IGR	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238850980delT								RAMP1 (30227 upstream) : UBE2F (24720 downstream)																							ggtctctcTCtttttttttga	0.005													3	3	---	---	---	---	
ILKAP	80895	broad.mit.edu	37	2	239079802	239079802	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239079802delT	uc002vxv.2	-						ILKAP_uc010zns.1_Intron|ILKAP_uc002vxw.2_Intron	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein							cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		ttcttttttcttttttttttt	0.129													4	4	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10191480	10191480	+	Frame_Shift_Del	DEL	T	-	-	rs121913346		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191480delT	uc003bvc.2	+	3	686	c.473delT	c.(472-474)CTGfs	p.L158fs	VHL_uc003bvd.2_Frame_Shift_Del_p.L117fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	158	Interaction with Elongin BC complex.		L -> V (in VHLD; type I).|L -> P (in VHLD; type I-II; abolishes release from chaperonin complex and the interaction with Elongin BC complex).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L158V(8)|p.L158Q(6)|p.L158P(3)|p.L158fs*16(3)|p.V155fs*15(2)|p.L158R(1)|p.L158_K159del(1)|p.L158fs*15(1)|p.T157_K159del(1)|p.Y156*(1)|p.L158fs*6(1)|p.L158fs*1(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTGTATACTCTGAAAGAGCGA	0.502		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				22	77	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47127833	47127838	+	Intron	DEL	AGAGCA	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47127833_47127838delAGAGCA	uc003cqs.2	-						SETD2_uc003cqv.2_Intron|SETD2_uc003cqt.1_5'Flank	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GACACGATGCAGAGCATTGGGAGGCA	0.442			N|F|S|Mis		clear cell renal carcinoma								14	38	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52696199	52696199	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52696199delC	uc003des.2	-	4	490	c.478delG	c.(478-480)GAAfs	p.E160fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.E160fs|PBRM1_uc003der.2_Frame_Shift_Del_p.E160fs|PBRM1_uc003det.2_Frame_Shift_Del_p.E160fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.E160fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.E160fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.E160fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.E160fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.E160fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.E58fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	160			E -> A (found in a malignant melanoma cell line).		chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCATCATCTTCGTCATCTGCT	0.453			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								70	148	---	---	---	---	
TSC22D2	9819	broad.mit.edu	37	3	150174827	150174827	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150174827delT	uc003exv.2	+						TSC22D2_uc003exw.2_Intron|TSC22D2_uc003exx.2_Intron	NM_014779	NP_055594	O75157	T22D2_HUMAN	TSC22 domain family, member 2								sequence-specific DNA binding transcription factor activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GGAGGTTAAATTTTTTAGAAT	0.299													77	45	---	---	---	---	
ETV5	2119	broad.mit.edu	37	3	185772409	185772409	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185772409delA	uc003fpz.2	-						ETV5_uc003fpy.2_Intron	NM_004454	NP_004445	P41161	ETV5_HUMAN	ets variant gene 5 (ets-related molecule)						cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|skin(2)|breast(1)	5	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TGCACAGTGTAATGGATATTA	0.458			T	TMPRSS2|SCL45A3	Prostate 								4	2	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2158274	2158275	+	Intron	DEL	GA	-	-	rs140938006		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2158274_2158275delGA	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron|POLN_uc011bvi.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			CTGCACACTGGAGTGCATGGGT	0.470								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					3	3	---	---	---	---	
G3BP2	9908	broad.mit.edu	37	4	76580126	76580138	+	Intron	DEL	CTTCTTTCATATA	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76580126_76580138delCTTCTTTCATATA	uc003hir.2	-						G3BP2_uc003his.2_Intron|G3BP2_uc003hit.2_Intron	NM_012297	NP_036429	Q9UN86	G3BP2_HUMAN	Ras-GTPase activating protein SH3 domain-binding						cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AACCCCACAGCTTCTTTCATATACATAAAATAA	0.324													16	11	---	---	---	---	
ANTXR2	118429	broad.mit.edu	37	4	80993003	80993003	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80993003delA	uc003hlz.3	-						ANTXR2_uc003hly.3_Intron|ANTXR2_uc003hlx.1_5'Flank|ANTXR2_uc010ijn.2_Intron	NM_001145794	NP_001139266	P58335	ANTR2_HUMAN	anthrax toxin receptor 2 isoform 2							endoplasmic reticulum membrane|extracellular region|integral to membrane|plasma membrane	metal ion binding|protein binding|receptor activity			ovary(1)	1						AGACTCCGTCAAAAAAAAAAA	0.443									Juvenile_Hyaline_Fibromatosis				4	2	---	---	---	---	
CENPE	1062	broad.mit.edu	37	4	104098310	104098311	+	Intron	INS	-	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104098310_104098311insA	uc003hxb.1	-						CENPE_uc003hxc.1_Intron	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E						blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GTAGAATTCTTATTAAGCCTAG	0.248													19	9	---	---	---	---	
SC4MOL	6307	broad.mit.edu	37	4	166254730	166254730	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166254730delT	uc003ire.2	+	2	338	c.208delT	c.(208-210)TTTfs	p.F70fs	SC4MOL_uc010irb.2_Frame_Shift_Del_p.F70fs|SC4MOL_uc003irf.2_Intron	NM_006745	NP_006736	Q15800	ERG25_HUMAN	sterol-C4-methyl oxidase-like isoform 1	70	Helical; (Potential).				cholesterol biosynthetic process|fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	C-4 methylsterol oxidase activity|iron ion binding				0	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0875)	NADH(DB00157)	TTTACCTGGATTTTTATTTCA	0.274													228	102	---	---	---	---	
BRD9	65980	broad.mit.edu	37	5	887247	887268	+	Intron	DEL	CTTAAGATCAAGAGATGCGGAA	-	-	rs115768028	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:887247_887268delCTTAAGATCAAGAGATGCGGAA	uc003jbq.2	-						BRD9_uc003jbl.2_Intron|BRD9_uc003jbm.2_Intron|BRD9_uc003jbn.2_Intron|BRD9_uc011cmb.1_Intron|BRD9_uc003jbo.2_Intron|BRD9_uc011cmc.1_Intron	NM_023924	NP_076413	Q9H8M2	BRD9_HUMAN	bromodomain containing 9 isoform 1								nucleic acid binding				0			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			GACACCCAGGCTTAAGATCAAGAGATGCGGAACTTTCCACCA	0.554													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2869272	2869272	+	IGR	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2869272delT								C5orf38 (113760 upstream) : IRX1 (726896 downstream)																							ACTGCGCTGATTCCTGAGCAT	0.582													4	2	---	---	---	---	
NSUN2	54888	broad.mit.edu	37	5	6632324	6632325	+	Intron	INS	-	T	T	rs142737800	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6632324_6632325insT	uc003jdu.2	-						NSUN2_uc011cmk.1_Intron|NSUN2_uc003jdv.2_Intron|SRD5A1_uc003jdw.2_5'Flank|SRD5A1_uc011cml.1_5'Flank|SRD5A1_uc011cmm.1_5'Flank	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2							cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TCCTACCGTTAAGTTTTACTTG	0.426													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34182134	34182134	+	IGR	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34182134delT								C1QTNF3 (138817 upstream) : RAI14 (474299 downstream)																							ataaaaaggattttttttttt	0.000													4	3	---	---	---	---	
GHR	2690	broad.mit.edu	37	5	42673381	42673381	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42673381delA	uc003jmt.2	+						GHR_uc011cpq.1_Intron	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	aaggctgcagaaaaaaaagtg	0.000													4	2	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94849082	94849082	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94849082delT	uc003klb.2	-							NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						taatttttaattttttttttt	0.000													5	3	---	---	---	---	
PGGT1B	5229	broad.mit.edu	37	5	114548448	114548448	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114548448delA	uc003kqw.3	-						PGGT1B_uc003kqx.3_Intron|PGGT1B_uc010jch.2_Intron	NM_005023	NP_005014	P53609	PGTB1_HUMAN	geranylgeranyltransferase type 1 beta						protein geranylgeranylation	CAAX-protein geranylgeranyltransferase complex	CAAX-protein geranylgeranyltransferase activity				0		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)	Pravastatin(DB00175)	AACACCAATTAAAAAAAAAAC	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	115106723	115106723	+	IGR	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115106723delA								TMED7-TICAM2 (144853 upstream) : CDO1 (33709 downstream)																							TTTCATTCTCAAAAAAAAAAA	0.353													3	3	---	---	---	---	
CDC23	8697	broad.mit.edu	37	5	137528539	137528539	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137528539delA	uc003lcl.2	-							NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CATTCCGGTTAAAAAAAAAAG	0.308													3	3	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170668309	170668309	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170668309delT	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc003mbd.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTATAGTGGCTTTTTTTTTTT	0.338			T	TRD@	ALL								4	2	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26465762	26465762	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26465762delA	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron|BTN2A1_uc010jqk.1_Intron	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						ctgtttaattaaaaaaaaaaa	0.199													4	2	---	---	---	---	
MARCKS	4082	broad.mit.edu	37	6	114181210	114181210	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114181210delA	uc003pvy.3	+	2	849	c.454delA	c.(454-456)AAAfs	p.K152fs		NM_002356	NP_002347	P29966	MARCS_HUMAN	myristoylated alanine-rich protein kinase C	152	Calmodulin-binding (PSD).				energy reserve metabolic process|regulation of insulin secretion	actin cytoskeleton|plasma membrane	actin filament binding|calmodulin binding				0		all_cancers(87;7.65e-05)|all_epithelial(87;0.000296)|all_hematologic(75;0.0172)|Colorectal(196;0.0317)|all_lung(197;0.198)		Epithelial(106;1.59e-07)|all cancers(137;9.85e-07)|OV - Ovarian serous cystadenocarcinoma(136;0.000322)		CGAGACCCCGAAAAAAAAAAA	0.612													4	3	---	---	---	---	
KPNA5	3841	broad.mit.edu	37	6	117037538	117037539	+	Intron	INS	-	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117037538_117037539insA	uc003pxh.2	+							NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		AGTTTCTATATAATAGCTTTTT	0.267													18	13	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117638600	117638600	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117638600delA	uc003pxp.1	-						ROS1_uc011ebi.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TGCTTACCTTAAAGAGGTAAT	0.358			T	GOPC|ROS1	glioblastoma|NSCLC								4	3	---	---	---	---	
BZW2	28969	broad.mit.edu	37	7	16720735	16720735	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16720735delA	uc003stl.2	+						BZW2_uc011jxx.1_Intron|BZW2_uc003stm.2_Intron|BZW2_uc003stj.2_Intron|BZW2_uc003stk.2_Intron|BZW2_uc003stn.1_Intron|BZW2_uc003sto.1_Intron|BZW2_uc003stp.2_Intron|BZW2_uc010kua.2_Intron	NM_001159767	NP_001153239	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2						cell differentiation|nervous system development|RNA metabolic process		protein binding			ovary(2)	2	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		actccatctcaaaaaaaagga	0.124													6	3	---	---	---	---	
SCRN1	9805	broad.mit.edu	37	7	29980329	29980330	+	Frame_Shift_Ins	INS	-	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29980329_29980330insC	uc010kvp.2	-	4	911_912	c.707_708insG	c.(706-708)GGTfs	p.G236fs	SCRN1_uc011jzy.1_Frame_Shift_Ins_p.G168fs|SCRN1_uc003tak.2_Frame_Shift_Ins_p.G236fs|SCRN1_uc011jzz.1_Frame_Shift_Ins_p.G236fs|SCRN1_uc011kaa.1_Frame_Shift_Ins_p.G256fs|SCRN1_uc011jzw.1_Intron|SCRN1_uc011jzx.1_Frame_Shift_Ins_p.G59fs	NM_001145515	NP_001138987	Q12765	SCRN1_HUMAN	secernin 1 isoform c	236					exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity			ovary(2)	2						CTTTGCCAGCACCGCAGTCTAG	0.480													81	80	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	39873126	39873127	+	5'UTR	INS	-	GCG	GCG			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39873126_39873127insGCG	uc010kxp.2	+	1										SubName: Full=Similar to sequence-specific single-stranded-DNA-binding protein;																		CCGGAGCGGTAGCGGCGGCGGC	0.649													1	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	45572536	45572536	+	IGR	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45572536delT								RAMP3 (348689 upstream) : ADCY1 (41203 downstream)																							gtggaaaaactcctactcatt	0.194													4	2	---	---	---	---	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72657208	72657208	+	3'UTR	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72657208delA	uc003txs.1	-	13					FKBP6_uc003twz.2_Intron	NR_002164				RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;												0						ctcaaaaaagaaaaaaaaatt	0.000													11	8	---	---	---	---	
DMTF1	9988	broad.mit.edu	37	7	86814123	86814123	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86814123delT	uc003uih.2	+						DMTF1_uc003uii.2_Intron|DMTF1_uc003uij.2_Intron|DMTF1_uc011khb.1_Intron|DMTF1_uc003uik.2_Intron|DMTF1_uc003uil.2_Intron|DMTF1_uc003uin.2_Intron	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					TGTTTGTTCCTTTTttttttt	0.174													8	4	---	---	---	---	
DPY19L2P2	349152	broad.mit.edu	37	7	102856887	102856887	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102856887delT	uc003vbh.3	-						DPY19L2P2_uc003vbg.3_Intron|DPY19L2P2_uc010lit.2_Intron	NR_003561				RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						agaacttttatgtttTAACTA	0.169													40	32	---	---	---	---	
LRRC69	100130742	broad.mit.edu	37	8	92231447	92231447	+	3'UTR	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92231447delA	uc010mal.1	+	8					SLC26A7_uc003yex.2_Intron|SLC26A7_uc003yey.2_Intron|LRRC69_uc003yev.1_3'UTR|LRRC69_uc003yew.1_3'UTR	NM_001129890	NP_001123362	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69												0						AAAAAAGTACAAAAAAAAATT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96231626	96231626	+	IGR	DEL	G	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96231626delG								PLEKHF2 (62715 upstream) : C8orf37 (26609 downstream)																							AGCACTGCCTGGCTCTTAAGG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96487114	96487114	+	IGR	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96487114delC								C8orf37 (205677 upstream) : GDF6 (667446 downstream)																							tgcttagattccccaagtttc	0.010													4	2	---	---	---	---	
UBR5	51366	broad.mit.edu	37	8	103358988	103358988	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103358988delA	uc003ykr.1	-						UBR5_uc003yks.1_Intron	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin						cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			ctctcaaaggaaaaaaaaaaa	0.164													3	5	---	---	---	---	
KHDRBS3	10656	broad.mit.edu	37	8	136526108	136526108	+	Intron	DEL	T	-	-	rs113324605		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136526108delT	uc003yuv.2	+						KHDRBS3_uc003yuw.2_Intron	NM_006558	NP_006549	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			TCTGCCCCTCTTTTTTTTTTC	0.353													4	2	---	---	---	---	
ZNF34	80778	broad.mit.edu	37	8	146004120	146004120	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146004120delT	uc003zdy.3	-						ZNF34_uc010mgb.2_Intron|ZNF34_uc003zdx.3_Intron	NM_030580	NP_085057	Q8IZ26	ZNF34_HUMAN	zinc finger protein 34						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		tttttctttctttttttttta	0.264													4	4	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386780	33386781	+	Intron	INS	-	A	A	rs144468472	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386780_33386781insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		aatggtaggtcggggggcccag	0.257													3	3	---	---	---	---	
IL11RA	3590	broad.mit.edu	37	9	34659560	34659561	+	Intron	DEL	CC	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34659560_34659561delCC	uc003zvi.2	+						IL11RA_uc011loq.1_Intron|IL11RA_uc003zvj.2_Intron|IL11RA_uc003zvk.2_Intron|IL11RA_uc010mke.2_Intron|IL11RA_uc003zvl.2_Intron	NM_004512	NP_004503	Q14626	I11RA_HUMAN	interleukin 11 receptor, alpha isoform 1							integral to plasma membrane	cytokine receptor activity			skin(1)	1	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.174)	Oprelvekin(DB00038)	gatgccacagcctctctaagta	0.213													2	4	---	---	---	---	
FXN	2395	broad.mit.edu	37	9	71668426	71668427	+	Intron	INS	-	GG	GG	rs58150402	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71668426_71668427insGG	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						gatggatggatagatagataga	0.059													4	2	---	---	---	---	
TMC1	117531	broad.mit.edu	37	9	75451137	75451137	+	3'UTR	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75451137delT	uc004aiz.1	+	24					TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_3'UTR|TMC1_uc010mpa.1_3'UTR	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1						ATTTCGTGACTTTTTTTTTTT	0.358													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	96330263	96330263	+	IGR	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96330263delA								FAM120A (1867 upstream) : PHF2 (8646 downstream)																							CTTCCTTTTCAAAAAAATAGG	0.269													4	2	---	---	---	---	
C9orf5	23731	broad.mit.edu	37	9	111795939	111795954	+	Intron	DEL	AATATTGAGATGCAAC	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111795939_111795954delAATATTGAGATGCAAC	uc004bdt.3	-						C9orf5_uc004bds.3_Intron|C9orf5_uc004bdr.3_Intron	NM_032012	NP_114401	Q9H330	CI005_HUMAN	hypothetical protein LOC23731							integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)		TGACTGCAATAATATTGAGATGCAACAATATTGAGA	0.329													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	43178983	43178983	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43178983delT	uc001jah.1	-											Homo sapiens cDNA FLJ41072 fis, clone 3NB692005439.																		GCTGTGAGAGTTTTTTTTACC	0.403													4	2	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61815229	61815229	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61815229delT	uc001jky.2	-						ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TACTTGGAACTTTTTTTTTTA	0.284													6	3	---	---	---	---	
TSPAN15	23555	broad.mit.edu	37	10	71263946	71263946	+	Intron	DEL	G	-	-	rs11306774		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71263946delG	uc001jpo.1	+							NM_012339	NP_036471	O95858	TSN15_HUMAN	transmembrane 4 superfamily member 15							integral to plasma membrane|membrane fraction					0						TGCTAGTGGAGGGGTGGTTCT	0.507													6	5	---	---	---	---	
ABCC2	1244	broad.mit.edu	37	10	101571087	101571087	+	Intron	DEL	A	-	-	rs112044854		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101571087delA	uc001kqf.2	+							NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	accatgactcaaaaaaaaaaa	0.214													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134824488	134824489	+	IGR	INS	-	TG	TG	rs149991263		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134824488_134824489insTG								C10orf93 (68424 upstream) : GPR123 (59944 downstream)																							AGCACGTGTGAtgtgtgttagt	0.030													4	2	---	---	---	---	
NUCB2	4925	broad.mit.edu	37	11	17353153	17353153	+	Intron	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17353153delC	uc001mmx.3	+						uc001mmy.1_5'Flank			P80303	NUCB2_HUMAN	Homo sapiens mRNA for Nucb2 splice variant, complete cds.							cytosol|ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|plasma membrane	calcium ion binding|DNA binding				0						TTTATCAGAACCAGGAAGAAA	0.294													5	4	---	---	---	---	
SLC5A12	159963	broad.mit.edu	37	11	26695022	26695022	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26695022delA	uc001mra.2	-	14	1947	c.1634delT	c.(1633-1635)TTAfs	p.L545fs	SLC5A12_uc001mrb.2_RNA	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	545	Cytoplasmic (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						AAAGCAAAATAAATTACAAAC	0.398													90	40	---	---	---	---	
MTL5	9633	broad.mit.edu	37	11	68517537	68517538	+	Intron	DEL	TG	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68517537_68517538delTG	uc001ooc.2	-						MTL5_uc001ood.1_Intron|MTL5_uc009ysi.1_Intron|MTL5_uc001ooe.2_Intron	NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform						cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			TCCGGTGGGCTGTGTGTGGTGT	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69656485	69656486	+	IGR	INS	-	C	C	rs143900439		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69656485_69656486insC								FGF3 (22293 upstream) : ANO1 (267922 downstream)																							aaccaccacaaaacaacagcaa	0.000													4	2	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892826	76892826	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892826delT	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						tttttttttgttttttttttt	0.274													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	94782489	94782489	+	IGR	DEL	A	-	-	rs142670152		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94782489delA								KDM4DL (21729 upstream) : SFRS2B (17567 downstream)																							AAGTATTTTGAAAAAACAAAG	0.453													11	6	---	---	---	---	
CUL5	8065	broad.mit.edu	37	11	107943929	107943929	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107943929delA	uc001pjv.2	+						CUL5_uc001pju.2_Intron	NM_003478	NP_003469	Q93034	CUL5_HUMAN	Vasopressin-activated calcium-mobilizing						cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		actccgtctcaaaaaaaaaaa	0.100													3	3	---	---	---	---	
BACE1	23621	broad.mit.edu	37	11	117164936	117164936	+	Intron	DEL	T	-	-	rs67342022		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117164936delT	uc001pqz.2	-						BACE1_uc001pqw.2_Intron|BACE1_uc001pqx.2_Intron|BACE1_uc001pqy.2_Intron|BACE1_uc001pra.1_Intron|BACE1_uc010rxg.1_Intron|BACE1_uc010rxh.1_Intron|BACE1_uc009yzo.1_5'Flank	NM_012104	NP_036236	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1 isoform A						beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding			ovary(1)	1	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		TTCATAGATCttttttttttt	0.229													4	2	---	---	---	---	
CD27	939	broad.mit.edu	37	12	6554090	6554090	+	5'UTR	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6554090delA	uc001qod.2	+	1					LOC678655_uc001qob.2_Intron|LOC678655_uc001qoc.2_Intron|LOC678655_uc009zel.1_Intron|CD27_uc001qoe.2_5'Flank	NM_001242	NP_001233	P26842	CD27_HUMAN	tumor necrosis factor receptor superfamily,						anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway|immunoglobulin mediated immune response|induction of apoptosis|positive regulation of B cell differentiation|positive regulation of JNK cascade|release of cytoplasmic sequestered NF-kappaB	extracellular region|integral to plasma membrane	caspase inhibitor activity|protein binding|transmembrane receptor activity				0						TATGAGAGAGAAAAAAAAAAC	0.517													6	3	---	---	---	---	
VAMP1	6843	broad.mit.edu	37	12	6573828	6573828	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6573828delA	uc001qok.2	-						TAPBPL_uc001qoi.1_Intron|VAMP1_uc001qoj.2_Intron|VAMP1_uc001qol.2_3'UTR	NM_014231	NP_055046	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 isoform 1						neurotransmitter secretion|vesicle-mediated transport	cell junction|endocytic vesicle membrane|integral to plasma membrane|mitochondrial outer membrane|synaptic vesicle membrane|synaptosome	protein binding				0					Botulinum Toxin Type B(DB00042)	ACTTCCTCAGAACAGGAGGCG	0.567													51	42	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	52499558	52499558	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52499558delA	uc009zme.1	+											Homo sapiens olfactory receptor, family 7, subfamily E, member 47 pseudogene, mRNA (cDNA clone IMAGE:5590288).																		aaacaaaaacaaaaaaaaaCT	0.179													3	3	---	---	---	---	
DCD	117159	broad.mit.edu	37	12	55038760	55038760	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55038760delA	uc001sgj.2	-						DCD_uc009znt.2_Intron|DCD_uc009znu.2_Intron	NM_053283	NP_444513	P81605	DCD_HUMAN	dermcidin preproprotein						defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular region	protein binding			ovary(1)	1		Myeloproliferative disorder(1001;0.0255)				CAAGAGCAATAAAAAAAAAAG	0.453													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	56294483	56294484	+	IGR	INS	-	A	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56294483_56294484insA								MMP19 (57748 upstream) : WIBG (713 downstream)																							GTTTCTAAGAGAAAAAAAAAAA	0.312													6	4	---	---	---	---	
TMTC3	160418	broad.mit.edu	37	12	88584363	88584363	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88584363delG	uc001tau.2	+	12	1890	c.1670delG	c.(1669-1671)AGCfs	p.S557fs		NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	557	TPR 4.					integral to membrane	binding			skin(1)	1						CAAGCAATAAGCATGAGGCCC	0.433													107	49	---	---	---	---	
GOLGA2B	55592	broad.mit.edu	37	12	100550450	100550451	+	3'UTR	INS	-	AT	AT			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100550450_100550451insAT	uc001tgs.2	-	6					GOLGA2B_uc001tgt.2_RNA|GOLGA2B_uc001tgu.2_3'UTR|uc001tgv.1_5'Flank|uc001tgx.2_5'Flank	NM_017600	NP_060070			golgi autoantigen, golgin subfamily a, 2-like 1												0						ACAAAAAAGGAATGCAAGGGCT	0.530													6	4	---	---	---	---	
GNPTAB	79158	broad.mit.edu	37	12	102224492	102224494	+	5'UTR	DEL	GCC	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102224492_102224494delGCC	uc001tit.2	-	1					GNPTAB_uc001tiu.1_5'UTR|GNPTAB_uc001tiw.2_RNA	NM_024312	NP_077288	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase						cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity			ovary(1)|skin(1)	2						AGGAGCCTGAgccgccgccgccg	0.596													10	9	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104127181	104127181	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104127181delT	uc001tjw.2	+						STAB2_uc009zug.2_Intron	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GACCTGCCAATTTTTTTTTTA	0.488													4	3	---	---	---	---	
TXNRD1	7296	broad.mit.edu	37	12	104732671	104732671	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104732671delT	uc010swk.1	+						TXNRD1_uc010swl.1_Intron|TXNRD1_uc010swm.1_Intron|TXNRD1_uc010swn.1_Intron|TXNRD1_uc010swo.1_Intron|TXNRD1_uc010swp.1_Intron|TXNRD1_uc010swq.1_Intron|TXNRD1_uc001tku.2_Intron|TXNRD1_uc009zun.2_Intron	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						attttttgtatttttagtaga	0.000													4	2	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109881707	109881707	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881707delA	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						actctggctcaaaaaaaaaaa	0.104													5	4	---	---	---	---	
SIRT4	23409	broad.mit.edu	37	12	120741212	120741212	+	Intron	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120741212delC	uc001tyc.2	+							NM_012240	NP_036372	Q9Y6E7	SIRT4_HUMAN	sirtuin 4						chromatin silencing|negative regulation of insulin secretion|protein ADP-ribosylation|protein deacetylation	mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|protein binding|zinc ion binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cgggaggcggcggttacagtg	0.005													8	5	---	---	---	---	
MLEC	9761	broad.mit.edu	37	12	121131184	121131185	+	Intron	DEL	TT	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121131184_121131185delTT	uc001tyy.1	+							NM_014730	NP_055545	Q14165	MLEC_HUMAN	malectin precursor						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	carbohydrate binding			ovary(1)	1						cagtggtgaCTTTTTTTTTCTG	0.262													4	2	---	---	---	---	
MORN3	283385	broad.mit.edu	37	12	122097447	122097447	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122097447delT	uc001uax.2	-						MORN3_uc001uay.2_Intron	NM_173855	NP_776254	Q6PF18	MORN3_HUMAN	MORN repeat containing 3												0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)		tctttctttcttttttttttt	0.204													4	3	---	---	---	---	
WDR66	144406	broad.mit.edu	37	12	122389632	122389632	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122389632delT	uc009zxk.2	+							NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66								calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		TTAAAAATAAttttttttttt	0.124													3	3	---	---	---	---	
KLHL1	57626	broad.mit.edu	37	13	70293349	70293350	+	Intron	INS	-	GAGC	GAGC	rs112153124		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70293349_70293350insGAGC	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		tgtgagagagagagagagagag	0.208													3	4	---	---	---	---	
GRK1	6011	broad.mit.edu	37	13	114426017	114426017	+	Intron	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114426017delC	uc010tkf.1	+							NM_002929	NP_002920	Q15835	RK_HUMAN	rhodopsin kinase precursor						regulation of G-protein coupled receptor protein signaling pathway|rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|rhodopsin kinase activity|signal transducer activity			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			TCCTGTGCAGCCAGGGGTGAC	0.398													13	12	---	---	---	---	
SLC39A9	55334	broad.mit.edu	37	14	69920240	69920240	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69920240delA	uc001xle.2	+						SLC39A9_uc010aqx.2_Intron|SLC39A9_uc001xlf.3_Intron|SLC39A9_uc001xlg.3_Intron	NM_018375	NP_060845	Q9NUM3	S39A9_HUMAN	solute carrier family 39 (zinc transporter),						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		ttaatggtttaaaaaaaaaaa	0.134													5	3	---	---	---	---	
SLC12A6	9990	broad.mit.edu	37	15	34550040	34550040	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34550040delT	uc001zhw.2	-						SLC12A6_uc001zhv.2_Intron|SLC12A6_uc001zhx.2_Intron|SLC12A6_uc001zhy.2_Intron|SLC12A6_uc001zhz.2_Intron|SLC12A6_uc001zia.2_Intron|SLC12A6_uc001zib.2_Intron|SLC12A6_uc001zic.2_Intron|SLC12A6_uc010bau.2_Intron|SLC12A6_uc001zid.2_Intron|SLC12A6_uc001zhu.2_Intron	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a						angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TAAAGAGAGGTTTTTATTCTT	0.348													14	14	---	---	---	---	
PPIP5K1	9677	broad.mit.edu	37	15	43864900	43864900	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43864900delT	uc001zrw.2	-						PPIP5K1_uc001zrx.1_Intron|PPIP5K1_uc001zru.2_Intron|PPIP5K1_uc001zry.3_Intron|PPIP5K1_uc001zrv.2_Intron|PPIP5K1_uc001zrz.1_Intron	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						GATAAGCAAGTTTTTTTTTTT	0.428													3	3	---	---	---	---	
SLC30A4	7782	broad.mit.edu	37	15	45803690	45803690	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45803690delT	uc001zvj.2	-						C15orf21_uc001zvk.2_Intron|C15orf21_uc010beg.1_Intron|C15orf21_uc010beh.1_Intron|C15orf21_uc010bei.1_Intron|C15orf21_uc010bej.1_Intron|C15orf21_uc001zvm.1_Intron|C15orf21_uc001zvn.1_Intron	NM_013309	NP_037441	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter),						regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity				0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		tctttttttcttttttttttg	0.040													4	2	---	---	---	---	
RASL12	51285	broad.mit.edu	37	15	65357830	65357830	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65357830delT	uc002aoi.1	-						RASL12_uc002aoj.1_Intron|RASL12_uc010uir.1_Intron	NM_016563	NP_057647	Q9NYN1	RASLC_HUMAN	RAS-like, family 12 protein						small GTPase mediated signal transduction	membrane	GTP binding|GTPase activity			skin(1)	1						ACCGTGGGAATTTTTTTTAAT	0.483													5	3	---	---	---	---	
PTPLAD1	51495	broad.mit.edu	37	15	65848798	65848799	+	Intron	INS	-	TGGAGAGCGAGTC	TGGAGAGCGAGTC	rs142295927	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65848798_65848799insTGGAGAGCGAGTC	uc002apc.2	+						PTPLAD1_uc002apb.1_Intron|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain						activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0						aatgcaagtgatggagagcgag	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76079339	76079339	+	5'Flank	DEL	A	-	-	rs77222978		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76079339delA	uc002bbb.1	-						uc002bbc.1_5'Flank					DQ577530																		TCAAGAAATTAAAAAAAAAAA	0.388													4	4	---	---	---	---	
AP3B2	8120	broad.mit.edu	37	15	83349701	83349701	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83349701delT	uc010uoh.1	-	7	836	c.659delA	c.(658-660)AACfs	p.N220fs	AP3B2_uc010uoi.1_Frame_Shift_Del_p.N220fs|AP3B2_uc010uoj.1_Frame_Shift_Del_p.N188fs|AP3B2_uc010uog.1_5'Flank	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	220					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			TTTCCGGTAGTTTTTGTGAAT	0.587													63	30	---	---	---	---	
VPS33B	26276	broad.mit.edu	37	15	91557599	91557599	+	Intron	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91557599delC	uc002bqp.1	-						VPS33B_uc002bqq.1_Intron|VPS33B_uc010uqu.1_Intron	NM_018668	NP_061138	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33B (yeast homolog))						cellular membrane fusion|lysosome localization|melanosome localization|platelet alpha granule organization|protein transport|vesicle docking involved in exocytosis	late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm|platelet alpha granule	protein binding			ovary(2)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)					ACACATAGTACCATGGCACAC	0.433													77	58	---	---	---	---	
ABAT	18	broad.mit.edu	37	16	8873124	8873125	+	Intron	DEL	GG	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8873124_8873125delGG	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	TGGTGGTGGTGGTTTTTTTCCT	0.188													2	4	---	---	---	---	
LOC440354	440354	broad.mit.edu	37	16	30278845	30278845	+	RNA	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30278845delA	uc010vep.1	-	2		c.2382delT								Homo sapiens mRNA; cDNA DKFZp686H21113 (from clone DKFZp686H21113).												0						TTTCTCTTACAAAAAAAAAAA	0.219													3	3	---	---	---	---	
VPS35	55737	broad.mit.edu	37	16	46694732	46694733	+	Intron	INS	-	A	A	rs33973421		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46694732_46694733insA	uc002eef.3	-						VPS35_uc002eed.2_3'UTR|VPS35_uc002eee.2_Intron	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TACTGACTATCAAAAAAAAAAA	0.203													4	2	---	---	---	---	
KCTD19	146212	broad.mit.edu	37	16	67351387	67351387	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67351387delA	uc002esu.2	-						KCTD19_uc002est.2_Intron|KCTD19_uc010vjj.1_Intron	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		tctccaaaagaaaaaaaaaaa	0.000													2	4	---	---	---	---	
CTCF	10664	broad.mit.edu	37	16	67655652	67655652	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67655652delT	uc002etl.2	+						CTCF_uc010cek.2_Intron	NM_006565	NP_006556	P49711	CTCF_HUMAN	CCCTC-binding factor						chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GCTTAGCTGCttttttttttt	0.308													4	2	---	---	---	---	
CDYL2	124359	broad.mit.edu	37	16	80709388	80709390	+	Intron	DEL	CAC	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80709388_80709390delCAC	uc002ffs.2	-							NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2							nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						TTGCTaccatcaccaccaccacc	0.350													4	2	---	---	---	---	
GLOD4	51031	broad.mit.edu	37	17	673201	673201	+	Intron	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:673201delC	uc002frv.2	-						GLOD4_uc002frt.2_Intron|GLOD4_uc002fru.2_Intron|GLOD4_uc010vqc.1_Intron	NM_016080	NP_057164	Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							mitochondrion					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CCGTCCTACACCAATAAAGAG	0.478													91	92	---	---	---	---	
TSR1	55720	broad.mit.edu	37	17	2228903	2228904	+	Intron	DEL	TT	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2228903_2228904delTT	uc002fuj.2	-							NM_018128	NP_060598	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation						ribosome assembly	nucleolus	protein binding			ovary(1)	1						TATCAGTAACtttttttttttc	0.198													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20397388	20397399	+	IGR	DEL	GCCGCCCCCGAT	-	-	rs71728273		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20397388_20397399delGCCGCCCCCGAT								LGALS9B (26540 upstream) : CCDC144NL (369311 downstream)																							TGCGGCTGGAgccgcccccgatgccgcccccg	0.580													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	27348209	27348210	+	IGR	INS	-	T	T	rs143520160	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27348209_27348210insT								SEZ6 (14751 upstream) : PIPOX (21708 downstream)																							tcttctttttgttttttttttA	0.262													6	3	---	---	---	---	
ZNF207	7756	broad.mit.edu	37	17	30689709	30689709	+	Intron	DEL	T	-	-	rs72079022		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30689709delT	uc002hhh.3	+						ZNF207_uc002hhj.3_Intron|ZNF207_uc002hhi.3_Intron|ZNF207_uc010csz.2_Intron|ZNF207_uc002hhk.1_Intron|ZNF207_uc002hhl.1_Intron	NM_003457	NP_003448	O43670	ZN207_HUMAN	zinc finger protein 207 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TTTGTCAACATTTTTTTTTTA	0.308													4	3	---	---	---	---	
TNS4	84951	broad.mit.edu	37	17	38638837	38638838	+	Intron	INS	-	AC	AC			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38638837_38638838insAC	uc010cxb.2	-						TNS4_uc002huu.3_5'Flank	NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor						apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			ctctactaaagacacacacaca	0.000													3	6	---	---	---	---	
BRCA1	672	broad.mit.edu	37	17	41247621	41247621	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41247621delA	uc002icq.2	-						BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Intron|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Intron|BRCA1_uc002ict.2_Intron|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Intron|BRCA1_uc002ide.1_Intron|BRCA1_uc010cyy.1_Intron|BRCA1_uc010whs.1_Intron|BRCA1_uc010cyz.2_Intron|BRCA1_uc010cza.2_Intron|BRCA1_uc010wht.1_Intron	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		acaaacaaacaaaaaaaaAAA	0.164			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			4	3	---	---	---	---	
PITPNC1	26207	broad.mit.edu	37	17	65627963	65627963	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65627963delT	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			TGGGAAGAGATTTTTTTTTTT	0.403													3	3	---	---	---	---	
ABCA9	10350	broad.mit.edu	37	17	67023453	67023454	+	Intron	INS	-	TTT	TTT			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67023453_67023454insTTT	uc002jhu.2	-						ABCA9_uc010dez.2_Intron	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9						transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					TTTCACCAGTAATTTTTGTTTG	0.292													55	28	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80882627	80882627	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80882627delA	uc002kfz.2	+						TBCD_uc002kfy.1_Intron|TBCD_uc002kgb.1_Intron|TBCD_uc002kgc.2_5'Flank	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			agactctctcaaaaaaaaaaT	0.224													4	2	---	---	---	---	
DSC2	1824	broad.mit.edu	37	18	28671382	28671382	+	Intron	DEL	A	-	-	rs34593516		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28671382delA	uc002kwl.3	-						DSC2_uc002kwk.3_Intron	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein						homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			AGCAAAACTGAAAAAAAAATT	0.373													3	3	---	---	---	---	
KLHL14	57565	broad.mit.edu	37	18	30349569	30349570	+	Intron	INS	-	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30349569_30349570insC	uc002kxm.1	-							NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14							cytosol|endoplasmic reticulum membrane				ovary(1)	1						ctctggctctacccccccctcc	0.366													5	3	---	---	---	---	
SMAD7	4092	broad.mit.edu	37	18	46447624	46447624	+	3'UTR	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46447624delA	uc002ldg.2	-	4					SMAD7_uc002ldf.2_3'UTR|SMAD7_uc010xde.1_3'UTR	NM_005904	NP_005895	O15105	SMAD7_HUMAN	SMAD family member 7						adherens junction assembly|artery morphogenesis|BMP signaling pathway|cellular protein complex localization|negative regulation of BMP signaling pathway|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of peptidyl-serine phosphorylation|negative regulation of peptidyl-threonine phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of ubiquitin-protein ligase activity|pathway-restricted SMAD protein phosphorylation|positive regulation of anti-apoptosis|positive regulation of cell-cell adhesion|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein stabilization|regulation of activin receptor signaling pathway|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	centrosome|cytosol|nucleolus|plasma membrane|transcription factor complex	activin binding|beta-catenin binding|I-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding				0	Colorectal(1;0.0518)					ACCAACAAACAAAAAAAAAAC	0.393													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	56835677	56835677	+	IGR	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56835677delT								SEC11C (9616 upstream) : GRP (51723 downstream)																							tgaaagaaagttttttttttt	0.000													4	2	---	---	---	---	
ODF3L2	284451	broad.mit.edu	37	19	465107	465108	+	Intron	INS	-	TGGA	TGGA	rs140185722	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:465107_465108insTGGA	uc002lor.2	-						ODF3L2_uc010drp.2_Intron	NM_182577	NP_872383	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2												0						gggtgagtgggtggatggatgg	0.000													5	4	---	---	---	---	
GRIN3B	116444	broad.mit.edu	37	19	1008812	1008813	+	Intron	INS	-	C	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1008812_1008813insC	uc002lqo.1	+						uc002lqp.1_RNA	NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,						ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	gggcggccccaccccccccgcc	0.569													30	13	---	---	---	---	
ZNF556	80032	broad.mit.edu	37	19	2873789	2873789	+	Intron	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2873789delA	uc002lwp.1	+						ZNF556_uc002lwq.2_Intron	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ttgtctctacaaaaaaaaaat	0.000													5	4	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7142022	7142022	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7142022delT	uc002mgd.1	-						INSR_uc002mge.1_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	tgcgTATAACttttttttttt	0.055													4	2	---	---	---	---	
C19orf45	374877	broad.mit.edu	37	19	7571121	7571135	+	Intron	DEL	CCCCATGGAGCCCCT	-	-	rs2878335		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7571121_7571135delCCCCATGGAGCCCCT	uc002mgm.2	+						C19orf45_uc010xjo.1_In_Frame_Del_p.PWSPS99del	NM_198534	NP_940936	Q8NA69	CS045_HUMAN	hypothetical protein LOC374877												0						aaagccccgcccccatggagcccctccccatggag	0.163													8	5	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	38997795	38997796	+	Intron	INS	-	AAG	AAG	rs149208626	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38997795_38997796insAAG	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GGGCGGGGCTTAAGCACAGGCG	0.663													4	2	---	---	---	---	
SAPS1	22870	broad.mit.edu	37	19	55752433	55752436	+	Frame_Shift_Del	DEL	ATGG	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55752433_55752436delATGG	uc002qjw.3	-	10	1415_1418	c.1173_1176delCCAT	c.(1171-1176)TTCCATfs	p.F391fs	SAPS1_uc002qjv.2_Frame_Shift_Del_p.F453fs	NM_014931	NP_055746	Q9UPN7	PP6R1_HUMAN	SAPS domain family, member 1	391_392	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity	cytoplasm	protein phosphatase binding				0		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		TGAAGACATAATGGAAGAAGAGGT	0.392													56	27	---	---	---	---	
HSPBP1	23640	broad.mit.edu	37	19	55790886	55790887	+	In_Frame_Ins	INS	-	GCCGCCGCC	GCCGCCGCC	rs149152800	by1000genomes	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55790886_55790887insGCCGCCGCC	uc002qjx.2	-	1	338_339	c.228_229insGGCGGCGGC	c.(226-231)insGGCGGCGGC	p.76_77insGGG	HSPBP1_uc002qjy.2_In_Frame_Ins_p.30_31insGGG|HSPBP1_uc002qkb.2_In_Frame_Ins_p.30_31insGGG|HSPBP1_uc002qka.2_In_Frame_Ins_p.30_31insGGG|HSPBP1_uc002qkd.2_In_Frame_Ins_p.30_31insGGG|HSPBP1_uc002qkc.2_In_Frame_Ins_p.30_31insGGG|BRSK1_uc002qkf.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein	30_34	Gly-rich.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCAGCCGAGGAGCCGCCGCCGC	0.713													15	10	---	---	---	---	
ADA	100	broad.mit.edu	37	20	43270414	43270414	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43270414delT	uc002xmj.2	-						ADA_uc010ggt.2_Intron	NM_000022	NP_000013	P00813	ADA_HUMAN	adenosine deaminase						adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding			pancreas(2)|ovary(1)	3		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	gttgttgttgttttttttttt	0.219									Adenosine_Deaminase_Deficiency				3	3	---	---	---	---	
NCOA5	57727	broad.mit.edu	37	20	44693576	44693577	+	Intron	DEL	AA	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44693576_44693577delAA	uc002xrd.2	-						NCOA5_uc002xrc.2_Intron|NCOA5_uc002xre.2_Intron	NM_020967	NP_066018	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5						regulation of transcription, DNA-dependent|transcription, DNA-dependent|translation	nucleus	aminoacyl-tRNA ligase activity|ATP binding			central_nervous_system(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				ACTGAGATATAAGAGTCATTTG	0.421													47	30	---	---	---	---	
BCAS4	55653	broad.mit.edu	37	20	49492868	49492875	+	Intron	DEL	CGGCTTTG	-	-	rs57778780		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49492868_49492875delCGGCTTTG	uc002xvq.2	+						BCAS4_uc002xvr.2_Intron|BCAS4_uc002xvs.2_Intron	NM_017843	NP_060313	Q8TDM0	BCAS4_HUMAN	breast carcinoma amplified sequence 4 isoform a							cytoplasm					0						TTTGGGTGGCCGGCTTTGGCTGTCACAG	0.495													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11093134	11093135	+	Intron	INS	-	C	C	rs141935972		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11093134_11093135insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTTCTCCCCTACCCCCCACAAC	0.401													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11126866	11126867	+	IGR	INS	-	G	G	rs71931427		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11126866_11126867insG								BAGE (27929 upstream) : None (None downstream)																							tttgtttgtttttttgtttttg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11126867	11126868	+	IGR	INS	-	TTG	TTG	rs71931427		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11126867_11126868insTTG								BAGE (27930 upstream) : None (None downstream)																							ttgtttgtttttttgtttttgt	0.005													4	2	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37649590	37649590	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37649590delT	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						AGGACTGCACttttttttttg	0.289													4	2	---	---	---	---	
IL17RA	23765	broad.mit.edu	37	22	17584678	17584679	+	Intron	DEL	GT	-	-	rs72290119		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17584678_17584679delGT	uc002zly.2	+						IL17RA_uc010gqt.2_Intron	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor						fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		caggtggagagtggtgtggacg	0.040													13	7	---	---	---	---	
TMPRSS6	164656	broad.mit.edu	37	22	37491398	37491398	+	Intron	DEL	C	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37491398delC	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron|TMPRSS6_uc003aqu.2_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						CACGTCGCCACCTCCTCTCCC	0.582													19	19	---	---	---	---	
ELFN2	114794	broad.mit.edu	37	22	37807445	37807445	+	Intron	DEL	G	-	-	rs34095607		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37807445delG	uc003asq.3	-							NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62							cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)					GATGATGCTTGGGGGTCCCTG	0.622													4	3	---	---	---	---	
MIOX	55586	broad.mit.edu	37	22	50927866	50927867	+	Frame_Shift_Ins	INS	-	C	C	rs140383906		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50927866_50927867insC	uc003bll.1	+	8	741_742	c.627_628insC	c.(625-630)CTGCCCfs	p.L209fs	MIOX_uc003blm.1_Frame_Shift_Ins_p.L209fs|MIOX_uc003bln.1_Intron	NM_017584	NP_060054	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	209_210					inositol catabolic process	cytoplasm|inclusion body	aldo-keto reductase (NADP) activity|ferric iron binding|inositol oxygenase activity				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGTTCTCACTGCCCCCTGAGGT	0.564													24	12	---	---	---	---	
KDM6A	7403	broad.mit.edu	37	X	44879876	44879878	+	In_Frame_Del	DEL	GGT	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44879876_44879878delGGT	uc004dge.3	+	6	840_842	c.465_467delGGT	c.(463-468)GAGGTG>GAG	p.V156del	KDM6A_uc010nhk.2_In_Frame_Del_p.V156del|KDM6A_uc011mkz.1_In_Frame_Del_p.V156del|KDM6A_uc011mla.1_In_Frame_Del_p.V156del|KDM6A_uc011mlb.1_In_Frame_Del_p.V156del|KDM6A_uc011mlc.1_Intron	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	156	TPR 2.				histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	p.0(4)|p.?(1)		kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						CATTTCAGGAGGTGCTTTATGTT	0.360			D|N|F|S		renal|oesophageal SCC|MM								181	121	---	---	---	---	
FAAH2	158584	broad.mit.edu	37	X	57480558	57480559	+	Intron	DEL	AG	-	-	rs75581747		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57480558_57480559delAG	uc004dvc.2	+							NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						gagccctgaaagagagtaggaa	0.000										HNSCC(52;0.14)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	57555533	57555533	+	IGR	DEL	A	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57555533delA								FAAH2 (39906 upstream) : ZXDB (62736 downstream)																							ggtccctgggaaaatgcttgg	0.000													4	2	---	---	---	---	
NCRNA00182	100302692	broad.mit.edu	37	X	73507434	73507434	+	Intron	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73507434delT	uc010nlq.1	-						NCRNA00182_uc004ebr.1_Intron|MIR545_hsa-mir-545|MI0003516_5'Flank|MIR374A_hsa-mir-374a|MI0000782_5'Flank|uc011mqm.1_5'Flank					Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0						AAATATGAGCTTTTTTTTTTC	0.408													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	103165612	103165612	+	IGR	DEL	T	-	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103165612delT								RAB9B (78454 upstream) : TMSB15B (7867 downstream)																							TTTGTCTCCGTTTTCAGTAGA	0.473													4	2	---	---	---	---	
