Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
CROCCL1	84809	broad.mit.edu	37	1	16946407	16946407	+	RNA	SNP	T	G	G	rs10796418	by1000genomes	TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr1:16946407T>G	uc010ocf.1	-	3		c.491A>C			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						AGCAATCTCCTCACTCAGCTG	0.672000													3	19	---	---	---	---	0	0	0.004672	0	0
GRIK3	2899	broad.mit.edu	37	1	37346338	37346338	+	Silent	SNP	G	A	A			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr1:37346338G>A	uc001caz.2	-	3	582	c.447C>T	c.(445-447)TAC>TAT	p.Y149Y	GRIK3_uc001cba.1_Silent_p.Y149Y	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	149	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	AGAGGTTCACGTAGAAGGTGT	0.602000													8	82	---	---	---	---	0	0	0.047766	0	0
CD1A	909	broad.mit.edu	37	1	158225840	158225840	+	Silent	SNP	A	G	G			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr1:158225840A>G	uc001frt.2	+	3	905	c.372A>G	c.(370-372)GGA>GGG	p.G124G		NM_001763	NP_001754	P06126	CD1A_HUMAN	CD1A antigen precursor	124	Extracellular (Potential).				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex				pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	TGCACTCTGGAAAGGTCTCAG	0.428000													4	79	---	---	---	---	0	0	0.014758	0	0
MYST4	23522	broad.mit.edu	37	10	76603076	76603076	+	Missense_Mutation	SNP	T	G	G			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr10:76603076T>G	uc001jwn.1	+	3	954	c.461T>G	c.(460-462)CTG>CGG	p.L154R	MYST4_uc001jwm.1_Missense_Mutation_p.L154R|MYST4_uc001jwo.1_Missense_Mutation_p.L154R|MYST4_uc001jwp.1_Missense_Mutation_p.L154R	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	154	H15.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					CGGCTGCGACTGGGGGCCAAA	0.522000			T	CREBBP	AML								3	63	---	---	---	---	0	0	0.004672	0	0
LOC653544	653544	broad.mit.edu	37	10	135491009	135491009	+	Missense_Mutation	SNP	G	T	T			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr10:135491009G>T	uc010qvi.1	+	1	731	c.620G>T	c.(619-621)AGG>ATG	p.R207M		NM_001127389	NP_001120861	F5GZ66	F5GZ66_HUMAN	double homeobox, 4-like	207						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CAGAATCGAAGGGCCAGGCAC	0.701000													5	101	---	---	---	---	0.000274275	0.000391822	0.047766	1	0
MSI1	4440	broad.mit.edu	37	12	120802533	120802533	+	Missense_Mutation	SNP	C	T	T			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr12:120802533C>T	uc001tye.1	-	5	357	c.293G>A	c.(292-294)CGG>CAG	p.R98Q		NM_002442	NP_002433	O43347	MSI1H_HUMAN	musashi 1	98	RRM 1.				nervous system development	cytoplasm|nucleus	nucleotide binding			central_nervous_system(2)|breast(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGTGCTCGCCGAGGGAAGGC	0.522000													46	90	---	---	---	---	0	0	0.048971	0	0
CDC6	990	broad.mit.edu	37	17	38451657	38451657	+	Missense_Mutation	SNP	G	A	A	rs4135016	byFrequency	TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr17:38451657G>A	uc002huj.1	+	8	1343	c.1133G>A	c.(1132-1134)CGC>CAC	p.R378H		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	378					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						TTCTGTGCCCGCAAAGTCTCT	0.403000													4	117	---	---	---	---	0	0	0.014758	0	0
ACLY	47	broad.mit.edu	37	17	40034394	40034394	+	Missense_Mutation	SNP	G	A	A			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr17:40034394G>A	uc002hyg.2	-	22	2612	c.2449C>T	c.(2449-2451)CCG>TCG	p.P817S	ACLY_uc002hyh.2_Missense_Mutation_p.P807S|ACLY_uc002hyi.2_Missense_Mutation_p.P871S|ACLY_uc010wfx.1_Missense_Mutation_p.P861S|ACLY_uc010wfy.1_Missense_Mutation_p.P546S	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1	817					ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				GTTGGGGGCGGCACCTCCTGG	0.522000													3	34	---	---	---	---	0	0	0.004672	0	0
ZC3H4	23211	broad.mit.edu	37	19	47570455	47570455	+	Missense_Mutation	SNP	G	A	A			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr19:47570455G>A	uc002pga.3	-	15	3108	c.3070C>T	c.(3070-3072)CGG>TGG	p.R1024W	ZC3H4_uc002pgb.1_RNA	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1024							nucleic acid binding|zinc ion binding			skin(4)|ovary(2)	6		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GGGCGCTGCCGGGCGTTGGGG	0.706000													12	9	---	---	---	---	0	0	0.105934	0	0
ANKRD20B	729171	broad.mit.edu	37	2	95522772	95522772	+	RNA	SNP	T	C	C			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr2:95522772T>C	uc010fhp.2	-	1		c.49A>G				NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0						GCGCTCCACCTCCGCGGCGTC	0.682000													3	42	---	---	---	---	0	0	0.004672	0	0
ANKRD20B	729171	broad.mit.edu	37	2	95522786	95522786	+	RNA	SNP	T	C	C			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr2:95522786T>C	uc010fhp.2	-	1		c.35A>G				NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0						CGGCGTCGCCTTTGACAGCTG	0.687000													3	49	---	---	---	---	0	0	0.004672	0	0
DNAH7	56171	broad.mit.edu	37	2	196913064	196913064	+	Missense_Mutation	SNP	T	C	C			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr2:196913064T>C	uc002utj.3	-	4	307	c.206A>G	c.(205-207)GAT>GGT	p.D69G		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	69	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TGGACTCTCATCATCCTGCTT	0.358000													6	37	---	---	---	---	0	0	0.021553	0	0
MKL1	57591	broad.mit.edu	37	22	40815091	40815091	+	Missense_Mutation	SNP	G	A	A			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr22:40815091G>A	uc003ayv.1	-	9	1558	c.1351C>T	c.(1351-1353)CCC>TCC	p.P451S	MKL1_uc003ayw.1_Missense_Mutation_p.P451S|MKL1_uc010gye.1_Missense_Mutation_p.P451S|MKL1_uc010gyf.1_Missense_Mutation_p.P401S	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	451					positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GACACGGGGGGCGTGGAGCCC	0.677000			T	RBM15	acute megakaryocytic leukemia								5	3	---	---	---	---	0	0	0.014758	0	0
ADAMTS3	9508	broad.mit.edu	37	4	73156663	73156663	+	Missense_Mutation	SNP	C	T	T			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr4:73156663C>T	uc003hgk.1	-	20	2877	c.2840G>A	c.(2839-2841)AGC>AAC	p.S947N		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	947	TSP type-1 3.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCAGTATTTGCTGTGCACAGA	0.582000													3	79	---	---	---	---	0	0	0.004672	0	0
ARHGAP26	23092	broad.mit.edu	37	5	142150381	142150381	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr5:142150381C>T	uc011dbj.1	+	1	90	c.55C>T	c.(55-57)CGA>TGA	p.R19*	ARHGAP26_uc003lmt.2_Nonsense_Mutation_p.R19*|ARHGAP26_uc003lmw.2_Nonsense_Mutation_p.R19*	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal	19					actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCGCACTTCCGAGAGACGCT	0.443000													5	23	---	---	---	---	0	0	0.014758	0	0
TNRC18	84629	broad.mit.edu	37	7	5399130	5399130	+	Missense_Mutation	SNP	C	G	G			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr7:5399130C>G	uc003soi.3	-	15	5081	c.4732G>C	c.(4732-4734)GGG>CGG	p.G1578R	TNRC18_uc003soj.2_5'Flank	NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1578							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TCCTCAGACCCCTTGTGTCTC	0.542000													30	139	---	---	---	---	0	0	0.037714	0	0
METTL2B	55798	broad.mit.edu	37	7	128119449	128119449	+	Missense_Mutation	SNP	G	A	A			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr7:128119449G>A	uc003vnf.2	+	3	477	c.440G>A	c.(439-441)AGC>AAC	p.S147N	METTL2B_uc003vng.2_Missense_Mutation_p.S82N|METTL2B_uc011kop.1_Missense_Mutation_p.S11N	NM_018396	NP_060866	Q6P1Q9	MTL2B_HUMAN	methyltransferase like 2B	147							methyltransferase activity			skin(1)	1						TCTTCGAAGAGCCTTGAACAT	0.418000													18	89	---	---	---	---	0	0	0.043863	0	0
OR1J2	26740	broad.mit.edu	37	9	125273560	125273560	+	Silent	SNP	C	T	T			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr9:125273560C>T	uc004bmj.1	+	4	1335	c.480C>T	c.(478-480)ACC>ACT	p.T160T	OR1J2_uc011lyv.1_Silent_p.T160T	NM_054107	NP_473448	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J,	160	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|pancreas(1)|breast(1)	5						TCTCTCACACCCTTCTCCTGA	0.537000													8	76	---	---	---	---	0	0	0.047766	0	0
Unknown	0	broad.mit.edu	37	13	21523814	21523815	+	IGR	INS	-	G	G	rs142431644	by1000genomes	TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr13:21523814_21523815insG								XPO4 (46901 upstream) : LATS2 (23363 downstream)																							Atttttttggtggggggcagag	0.198													5	5	---	---	---	---					
Unknown	0	broad.mit.edu	37	17	44337987	44337993	+	IGR	DEL	TTTTTTT	-	-			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr17:44337987_44337993delTTTTTTT								KIAA1267 (35270 upstream) : ARL17B (25870 downstream)																							CTCTAttctcttttttttttttttttt	0.290													2	4	---	---	---	---					
CD74	972	broad.mit.edu	37	5	149792481	149792481	+	5'Flank	DEL	G	-	-			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr5:149792481delG	uc003lsc.2	-						CD74_uc003lse.2_5'Flank|CD74_uc003lsd.2_5'Flank|CD74_uc003lsf.1_5'Flank	NM_001025159	NP_001020330	P04233	HG2A_HUMAN	CD74 antigen isoform a						antigen processing and presentation of endogenous antigen|cell proliferation|immunoglobulin mediated immune response|intracellular protein transport|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of peptide secretion|positive regulation of B cell proliferation|positive regulation of chemokine (C-X-C motif) ligand 2 production|positive regulation of cytokine-mediated signaling pathway|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of macrophage cytokine production|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|prostaglandin biosynthetic process|protein complex assembly|regulation of macrophage activation	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|lysosome|receptor complex	beta-amyloid binding|cytokine receptor activity|identical protein binding|MHC class II protein binding			breast(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATGTGGGGCGGGGGGGCTCC	0.587			T	ROS1	NSCLC								4	9	---	---	---	---					
DGKB	1607	broad.mit.edu	37	7	14378197	14378198	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr7:14378197_14378198insT	uc003ssz.2	-	22	2254_2255	c.2067_2068insA	c.(2065-2070)AAAGGGfs	p.K689fs	DGKB_uc011jxt.1_Frame_Shift_Ins_p.K670fs|DGKB_uc003sta.2_Frame_Shift_Ins_p.K689fs|DGKB_uc011jxu.1_Frame_Shift_Ins_p.K688fs	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	689_690					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	TTGTCAGACCCTTTTTTCTCTA	0.401													29	52	---	---	---	---					
Unknown	0	broad.mit.edu	37	9	90460010	90460015	+	IGR	DEL	TGTGTG	-	-	rs36046714		TCGA-EM-A1YE-01A-11D-A14W-08	TCGA-EM-A1YE-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	9d6e12e0-19a7-4e52-84a2-707bfc16568d	7b7c2ab5-956b-4389-8f0f-bcb0e5c95ccf	g.chr9:90460010_90460015delTGTGTG								CTSL3 (58211 upstream) : C9orf79 (37726 downstream)																							AGTCTTGCTCtgtgtgtgtgtgtgtg	0.301													2	4	---	---	---	---					
