Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	2371882	2371882	+	IGR	DEL	T	-	-	rs111269301		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2371882delT								PEX10 (27872 upstream) : PLCH2 (35872 downstream)																																			---	---	---	---
TNFRSF8	943	broad.mit.edu	37	1	12149979	12149982	+	Intron	DEL	CCAT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12149979_12149982delCCAT	uc001atq.2	+						TNFRSF8_uc010obc.1_Intron	NM_001243	NP_001234			tumor necrosis factor receptor superfamily,						cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	14736750	14736750	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14736750delC								PRDM2 (585178 upstream) : KAZ (188463 downstream)																																			---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16929465	16929468	+	Intron	DEL	TTTC	-	-	rs68021505		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16929465_16929468delTTTC	uc009vos.1	-						NBPF1_uc001aza.3_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16939998	16939998	+	5'Flank	DEL	C	-	-	rs79338600		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16939998delC	uc009vos.1	-						NBPF1_uc001aza.3_5'Flank|NBPF1_uc001azb.1_5'Flank|NBPF1_uc001azc.1_5'Flank	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17229819	17229820	+	Intron	INS	-	A	A	rs147278844		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17229819_17229820insA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
DHDDS	79947	broad.mit.edu	37	1	26782237	26782238	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26782237_26782238insA	uc001bml.2	+						DHDDS_uc001bmk.2_Intron|DHDDS_uc001bmm.2_Intron|DHDDS_uc001bmn.2_Intron|DHDDS_uc010ofd.1_Intron	NM_205861	NP_995583			dehydrodolichyl diphosphate synthase isoform b								protein binding|transferase activity, transferring alkyl or aryl (other than methyl) groups			breast(3)	3		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	34993290	34993291	+	IGR	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34993290_34993291delCA								C1orf94 (308561 upstream) : MIR552 (141909 downstream)																																			---	---	---	---
GRIK3	2899	broad.mit.edu	37	1	37464600	37464609	+	Intron	DEL	TGTGTGTGTA	-	-	rs945169		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37464600_37464609delTGTGTGTGTA	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822			glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---
INPP5B	3633	broad.mit.edu	37	1	38408584	38408585	+	Intron	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38408584_38408585delAG	uc001ccg.1	-						INPP5B_uc009vvk.1_Intron|INPP5B_uc001cch.2_Intron	NM_005540	NP_005531			inositol polyphosphate-5-phosphatase, 75kDa						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	38529535	38529536	+	IGR	DEL	GA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38529535_38529536delGA								POU3F1 (17085 upstream) : RRAGC (775479 downstream)																																			---	---	---	---
TSPAN1	10103	broad.mit.edu	37	1	46645637	46645638	+	Intron	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46645637_46645638delGT	uc001cpd.2	+						TSPAN1_uc009vyd.1_5'Flank	NM_005727	NP_005718			tetraspan 1							integral to membrane|lysosomal membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	59684920	59684921	+	IGR	DEL	CT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59684920_59684921delCT								LOC729467 (72441 upstream) : FGGY (77704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	83102891	83102893	+	IGR	DEL	GAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83102891_83102893delGAA								LPHN2 (644785 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	88935293	88935293	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88935293delA								None (None upstream) : PKN2 (214629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	112930465	112930466	+	IGR	INS	-	AGGAAGGAAGGAAGGA	AGGAAGGAAGGAAGGA			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112930465_112930466insAGGAAGGAAGGAAGGA								KCND3 (398688 upstream) : CTTNBP2NL (8334 downstream)																																			---	---	---	---
PTPN22	26191	broad.mit.edu	37	1	114370429	114370429	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114370429delC	uc001eds.2	-						PTPN22_uc009wgq.2_Intron|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Intron|PTPN22_uc009wgs.2_Intron	NM_015967	NP_057051			protein tyrosine phosphatase, non-receptor type						negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119846017	119846018	+	IGR	INS	-	AC	AC	rs142391161	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119846017_119846018insAC								WARS2 (162722 upstream) : HAO2 (65384 downstream)																																			---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120570923	120570923	+	Intron	DEL	C	-	-	rs11364041		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120570923delC	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	121119125	121119129	+	Intron	DEL	TTTTT	-	-	rs71742737		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121119125_121119129delTTTTT	uc001eis.2	+							NM_001042758	NP_001036223			SLIT-ROBO Rho GTPase activating protein 2																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142608175	142608176	+	IGR	DEL	TG	-	-	rs141317539		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142608175_142608176delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	144045995	144045996	+	Intron	INS	-	CC	CC	rs147099033	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144045995_144045996insCC	uc010oxm.1	+						uc001eju.1_5'Flank					SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144530894	144530895	+	Intron	INS	-	TTT	TTT	rs79314376	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144530894_144530895insTTT	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144536014	144536015	+	Intron	INS	-	A	A	rs143907098		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144536014_144536015insA	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145007452	145007453	+	Intron	INS	-	T	T	rs141963263		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145007452_145007453insT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145053941	145053941	+	Intron	DEL	A	-	-	rs71645749		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145053941delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145058201	145058201	+	Intron	DEL	A	-	-	rs11347217		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145058201delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	146217183	146217184	+	Intron	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146217183_146217184delAG	uc001emp.3	+						uc010ozi.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	148848203	148848205	+	IGR	DEL	TCA	-	-	rs144912987		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148848203_148848205delTCA								NBPF16 (89892 upstream) : LOC645166 (80081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148848809	148848809	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148848809delT								NBPF16 (90498 upstream) : LOC645166 (79477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149225582	149225584	+	IGR	DEL	CTC	-	-	rs137975262		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149225582_149225584delCTC								LOC645166 (272528 upstream) : LOC388692 (53892 downstream)																																			---	---	---	---
SNX27	81609	broad.mit.edu	37	1	151669128	151669128	+	3'UTR	DEL	T	-	-	rs71580402		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151669128delT	uc001eyn.1	+	12					SNX27_uc001eyo.2_3'UTR	NM_030918	NP_112180			sorting nexin family member 27						cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	152461107	152461108	+	IGR	INS	-	A	A	rs76955083		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152461107_152461108insA								CRNN (74357 upstream) : LCE5A (22212 downstream)																																			---	---	---	---
CRCT1	54544	broad.mit.edu	37	1	152485278	152485279	+	5'Flank	INS	-	GTGT	GTGT	rs10640044		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152485278_152485279insGTGT	uc001ezz.2	+							NM_019060	NP_061933			cysteine-rich C-terminal 1												0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
SPRR2D	6703	broad.mit.edu	37	1	153024872	153024875	+	Intron	DEL	ACAC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153024872_153024875delACAC	uc009wnz.2	-											Homo sapiens cDNA FLJ76407 complete cds, highly similar to Homo sapiens small proline-rich protein 2D (SPRR2D), mRNA.						keratinization	cornified envelope|cytoplasm					0	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	153419311	153419312	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153419311_153419312insT								S100A7L2 (6808 upstream) : S100A7 (10908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	153465514	153465514	+	IGR	DEL	T	-	-	rs67013817		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153465514delT								S100A7 (32377 upstream) : S100A6 (41562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	153529755	153529756	+	IGR	INS	-	AACT	AACT	rs143509387	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153529755_153529756insAACT								S100A3 (8021 upstream) : S100A2 (3831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	154605032	154605033	+	IGR	INS	-	A	A	rs140977732	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154605032_154605033insA								ADAR (4595 upstream) : KCNN3 (74884 downstream)																																			---	---	---	---
EFNA3	1944	broad.mit.edu	37	1	155048718	155048723	+	5'Flank	DEL	GTGTGT	-	-	rs67578081		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155048718_155048723delGTGTGT	uc001fhf.2	+						EFNA3_uc010pew.1_Intron|EFNA3_uc010pex.1_5'Flank	NM_004952	NP_004943			ephrin A3 precursor						cell-cell signaling	anchored to membrane|integral to plasma membrane	ephrin receptor binding|transmembrane-ephrin receptor activity				0	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		all cancers(21;5.67e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000284)|LUSC - Lung squamous cell carcinoma(543;0.193)															---	---	---	---
PMF1	11243	broad.mit.edu	37	1	156187518	156187519	+	Intron	INS	-	AA	AA	rs10659605		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156187518_156187519insAA	uc001fnq.2	+						PMF1_uc009wru.1_Intron|PMF1_uc001fnr.2_Intron|BGLAP_uc001fns.1_Intron	NM_007221	NP_009152			polyamine-modulated factor 1						cell division|chromosome segregation|mitotic prometaphase|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytosol|MIS12/MIND type complex|transcription factor complex	leucine zipper domain binding|transcription coactivator activity				0	Hepatocellular(266;0.158)																	---	---	---	---
PRCC	5546	broad.mit.edu	37	1	156755607	156755608	+	Intron	INS	-	T	T	rs11462889		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156755607_156755608insT	uc001fqa.2	+						PRCC_uc001fqb.2_Intron	NM_005973	NP_005964			papillary renal cell carcinoma						cell cycle|mitotic cell cycle checkpoint	nucleus	protein binding		PRCC/TFE3(25)	kidney(25)|central_nervous_system(2)	27	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)							T	TFE3	papillary renal 								---	---	---	---
Unknown	0	broad.mit.edu	37	1	157317690	157317690	+	IGR	DEL	A	-	-	rs56034311		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157317690delA								ETV3 (209307 upstream) : FCRL5 (165478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158082109	158082109	+	IGR	DEL	G	-	-	rs35198382		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158082109delG								KIRREL (16267 upstream) : CD1D (67628 downstream)																																			---	---	---	---
C1orf110	339512	broad.mit.edu	37	1	162814901	162814902	+	Intron	INS	-	GTGTGT	GTGTGT	rs146120566	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162814901_162814902insGTGTGT	uc009wuw.1	-											Homo sapiens cDNA, FLJ99661.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	164385410	164385411	+	IGR	DEL	AT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164385410_164385411delAT								None (None upstream) : PBX1 (143391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	164493161	164493162	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164493161_164493162delAC								None (None upstream) : PBX1 (35640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	164885395	164885396	+	IGR	DEL	AG	-	-	rs35144954		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164885395_164885396delAG								PBX1 (31095 upstream) : LMX1A (285709 downstream)																																			---	---	---	---
UCK2	7371	broad.mit.edu	37	1	165830370	165830370	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165830370delG	uc001gdp.2	+						UCK2_uc010plb.1_Intron	NM_012474	NP_036606			uridine-cytidine kinase 2						pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity			ovary(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	167014501	167014501	+	IGR	DEL	A	-	-	rs78148587		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167014501delA								MAEL (23054 upstream) : GPA33 (7581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	167591134	167591142	+	IGR	DEL	GAAAGAAAG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167591134_167591142delGAAAGAAAG								CREG1 (68078 upstream) : RCSD1 (8332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	168847324	168847324	+	IGR	DEL	T	-	-	rs78811893		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168847324delT								MGC4473 (85204 upstream) : ATP1B1 (228623 downstream)																																			---	---	---	---
BAT2L2	23215	broad.mit.edu	37	1	171480332	171480333	+	Intron	INS	-	CAAAAA	CAAAAA	rs143693711	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171480332_171480333insCAAAAA	uc010pmg.1	+						BAT2L2_uc001ghq.1_Intron|BAT2L2_uc001ghr.1_Intron	NM_015172	NP_055987			HBxAg transactivated protein 2								protein C-terminus binding				0																		---	---	---	---
BAT2L2	23215	broad.mit.edu	37	1	171551066	171551067	+	Intron	INS	-	AG	AG	rs151074152	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171551066_171551067insAG	uc010pmg.1	+						BAT2L2_uc010pmh.1_Intron|BAT2L2_uc010pmi.1_Intron|BAT2L2_uc010pmj.1_Intron	NM_015172	NP_055987			HBxAg transactivated protein 2								protein C-terminus binding				0																		---	---	---	---
DNM3	26052	broad.mit.edu	37	1	172362744	172362745	+	Intron	INS	-	AAG	AAG	rs145993082	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172362744_172362745insAAG	uc001gie.2	+						DNM3_uc001gif.2_Intron|DNM3_uc001gih.1_Intron|PIGC_uc001gii.1_RNA|PIGC_uc001gij.1_RNA	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
ANKRD45	339416	broad.mit.edu	37	1	173580716	173580717	+	Intron	DEL	AC	-	-	rs72222473		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173580716_173580717delAC	uc001gja.1	-							NM_198493	NP_940895			ankyrin repeat domain 45												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	175217918	175217919	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175217918_175217919delAC								KIAA0040 (55689 upstream) : TNR (74016 downstream)																																			---	---	---	---
SEC16B	89866	broad.mit.edu	37	1	177934535	177934536	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs142278748	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177934535_177934536insGTGTGTGTGT	uc001gli.1	-						SEC16B_uc001glk.1_Intron|SEC16B_uc009wwz.1_Intron|SEC16B_uc001glj.1_Intron|SEC16B_uc001gll.3_Intron	NM_033127	NP_149118			leucine zipper transcription regulator 2						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	178562853	178562853	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178562853delT								C1orf220 (44829 upstream) : RALGPS2 (131447 downstream)																																			---	---	---	---
XPR1	9213	broad.mit.edu	37	1	180803223	180803223	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180803223delT	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727			xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	181118613	181118618	+	IGR	DEL	TATGTT	-	-	rs111495002		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181118613_181118618delTATGTT								IER5 (58636 upstream) : CACNA1E (334098 downstream)																																			---	---	---	---
NPL	80896	broad.mit.edu	37	1	182759749	182759751	+	Intron	DEL	TTG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182759749_182759751delTTG	uc009wyb.2	+						NPL_uc010pnx.1_Intron|NPL_uc010pny.1_Intron|NPL_uc001gpo.1_Intron|NPL_uc009wyc.2_Intron|NPL_uc001gpp.3_Intron|NPL_uc001gpq.1_5'Flank	NM_030769	NP_110396			N-acetylneuraminate pyruvate lyase						carbohydrate metabolic process	cytoplasm	N-acetylneuraminate lyase activity			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
NMNAT2	23057	broad.mit.edu	37	1	183239667	183239668	+	Intron	DEL	AA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183239667_183239668delAA	uc001gqc.1	-						NMNAT2_uc009wye.1_Intron|NMNAT2_uc001gqb.1_Intron	NM_015039	NP_055854			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1																		---	---	---	---
NMNAT2	23057	broad.mit.edu	37	1	183302788	183302789	+	Intron	INS	-	T	T	rs143398685	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183302788_183302789insT	uc001gqc.1	-							NM_015039	NP_055854			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	183524638	183524639	+	IGR	INS	-	TGTT	TGTT	rs140052983	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183524638_183524639insTGTT								SMG7 (1313 upstream) : NCF2 (59 downstream)																																			---	---	---	---
RGL1	23179	broad.mit.edu	37	1	183849510	183849512	+	Intron	DEL	AAC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183849510_183849512delAAC	uc001gqo.2	+						RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron|RGL1_uc010poi.1_Intron	NM_015149	NP_055964			ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	184752947	184752947	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184752947delA								EDEM3 (28906 upstream) : FAM129A (7220 downstream)																																			---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	185854650	185854650	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185854650delT	uc001grq.1	+							NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	189849614	189849614	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189849614delA								None (None upstream) : FAM5C (217183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	193453940	193453942	+	IGR	DEL	ATG	-	-	rs71680156		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193453940_193453942delATG								CDC73 (230000 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	197942375	197942376	+	IGR	INS	-	A	A	rs138184393	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197942375_197942376insA								LHX9 (40660 upstream) : NEK7 (183732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	198980161	198980162	+	Intron	INS	-	AC	AC	rs150656124	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198980161_198980162insAC	uc001gva.3	-											Homo sapiens, clone IMAGE:5583320, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	199435486	199435487	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199435486_199435487delAC								MIR181A1 (607204 upstream) : NR5A2 (561283 downstream)																																			---	---	---	---
PTPN7	5778	broad.mit.edu	37	1	202131406	202131407	+	5'Flank	INS	-	C	C	rs142116715	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202131406_202131407insC	uc001gxm.1	-						PTPN7_uc001gxl.1_5'Flank|PTPN7_uc001gxn.1_5'Flank|PTPN7_uc010ppv.1_5'Flank|PTPN7_uc010ppw.1_5'Flank|PTPN7_uc010ppx.1_5'Flank|PTPN7_uc010ppy.1_5'Flank	NM_002832	NP_002823			protein tyrosine phosphatase, non-receptor type							cytosol|internal side of plasma membrane	protein binding|protein tyrosine phosphatase activity			skin(1)	1																		---	---	---	---
SYT2	127833	broad.mit.edu	37	1	202619568	202619568	+	Intron	DEL	G	-	-	rs111789922		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202619568delG	uc010pqb.1	-						SYT2_uc009xaf.2_Intron	NM_177402	NP_796376			synaptotagmin II						neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	203718976	203718976	+	IGR	DEL	A	-	-	rs113988069		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203718976delA								ATP2B4 (5769 upstream) : LAX1 (15308 downstream)																																			---	---	---	---
NFASC	23114	broad.mit.edu	37	1	204883875	204883876	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204883875_204883876insA	uc001hbj.2	+						NFASC_uc001hbh.2_Intron|NFASC_uc010pqz.1_Intron|NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc009xbg.1_Intron	NM_001005388	NP_001005388			neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	205437150	205437151	+	RNA	INS	-	GT	GT	rs147610079	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205437150_205437151insGT	uc001hco.1	+	3		c.1754_1755insGT								Homo sapiens cDNA FLJ38314 fis, clone FCBBF3022765.																														---	---	---	---
SLC26A9	115019	broad.mit.edu	37	1	205900594	205900596	+	Intron	DEL	TTT	-	-	rs71901128		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205900594_205900596delTTT	uc001hdq.2	-						SLC26A9_uc001hdp.2_Intron	NM_052934	NP_443166			solute carrier family 26, member 9 isoform a							integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)															---	---	---	---
SRGAP2	23380	broad.mit.edu	37	1	206583141	206583144	+	Intron	DEL	AAAA	-	-	rs113368415		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206583141_206583144delAAAA	uc001hdy.2	+						SRGAP2_uc010prt.1_Intron|SRGAP2_uc001hdx.2_Intron|SRGAP2_uc010pru.1_Intron|SRGAP2_uc010prv.1_Intron	NM_015326	NP_056141			SLIT-ROBO Rho GTPase activating protein 2						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)																	---	---	---	---
C4BPA	722	broad.mit.edu	37	1	207289854	207289861	+	Intron	DEL	TGTGTATA	-	-	rs67617522		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207289854_207289861delTGTGTATA	uc001hfo.2	+							NM_000715	NP_000706			complement component 4 binding protein, alpha						complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	209990040	209990041	+	IGR	INS	-	TGTGTG	TGTGTG	rs145643351	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209990040_209990041insTGTGTG								IRF6 (10558 upstream) : C1orf107 (11292 downstream)																																			---	---	---	---
RCOR3	55758	broad.mit.edu	37	1	211474255	211474256	+	Intron	INS	-	GT	GT	rs146843501	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211474255_211474256insGT	uc001hig.2	+						RCOR3_uc010psv.1_Intron|RCOR3_uc001hie.2_Intron|RCOR3_uc010psw.1_Intron|RCOR3_uc001hif.2_Intron	NM_018254	NP_060724			REST corepressor 3 isoform d						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212330903	212330905	+	IGR	DEL	CTC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212330903_212330905delCTC								DTL (52717 upstream) : PPP2R5A (127974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	212390620	212390620	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212390620delA								DTL (112434 upstream) : PPP2R5A (68259 downstream)																																			---	---	---	---
BATF3	55509	broad.mit.edu	37	1	212861407	212861408	+	Intron	INS	-	A	A	rs141441627		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212861407_212861408insA	uc001hjl.1	-							NM_018664	NP_061134			basic leucine zipper transcription factor,						transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0046)|all cancers(67;0.00785)|GBM - Glioblastoma multiforme(131;0.0731)|Epithelial(68;0.0781)														---	---	---	---
NSL1	25936	broad.mit.edu	37	1	212959463	212959466	+	Intron	DEL	TAGA	-	-	rs71147028		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212959463_212959466delTAGA	uc001hjn.2	-						NSL1_uc001hjm.2_Intron|NSL1_uc010pti.1_Intron	NM_015471	NP_056286			NSL1, MIND kinetochore complex component isoform						cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	213580556	213580557	+	IGR	DEL	CG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213580556_213580557delCG								RPS6KC1 (133749 upstream) : PROX1 (580729 downstream)																																			---	---	---	---
SMYD2	56950	broad.mit.edu	37	1	214502898	214502917	+	Intron	DEL	GCTGCCCTGCAGGATCAGGA	-	-	rs4655246	by1000genomes;by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214502898_214502917delGCTGCCCTGCAGGATCAGGA	uc010ptx.1	+						SMYD2_uc009xdj.2_Intron|SMYD2_uc010ptw.1_Intron|SMYD2_uc009xdl.1_Intron	NM_020197	NP_064582			SET and MYND domain containing 2						negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)												OREG0014249	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	214856997	214856998	+	IGR	INS	-	C	C	rs150268216	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214856997_214856998insC								CENPF (19085 upstream) : KCNK2 (321887 downstream)																																			---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216076193	216076193	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216076193delG	uc001hku.1	-							NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216374320	216374323	+	Intron	DEL	TCCC	-	-	rs11120741	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216374320_216374323delTCCC	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	217155043	217155044	+	Intron	DEL	AC	-	-	rs67827330		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217155043_217155044delAC	uc010puc.1	-						ESRRG_uc001hkz.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318			estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	220662899	220662899	+	IGR	DEL	A	-	-	rs146254159		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220662899delA								RAB3GAP2 (217056 upstream) : MARK1 (38669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	223249643	223249643	+	IGR	DEL	A	-	-	rs66547242		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223249643delA								DISP1 (70308 upstream) : TLR5 (33941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224152943	224152944	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224152943_224152944insA								TP53BP2 (119269 upstream) : FBXO28 (148847 downstream)																																			---	---	---	---
FBXO28	23219	broad.mit.edu	37	1	224314881	224314886	+	Intron	DEL	TGTGTA	-	-	rs148492967	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224314881_224314886delTGTGTA	uc001hoh.2	+						FBXO28_uc009xef.2_Intron|FBXO28_uc010pvc.1_Intron	NM_015176	NP_055991			F-box protein 28 isoform a											ovary(2)|kidney(2)|lung(1)	5	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	224957279	224957279	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224957279delA								CNIH3 (29030 upstream) : DNAH14 (160077 downstream)																																			---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225511529	225511529	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225511529delT	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225554109	225554110	+	Intron	DEL	TC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225554109_225554110delTC	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
LEFTY1	10637	broad.mit.edu	37	1	226075411	226075411	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226075411delC	uc001hpo.2	-						LEFTY1_uc010pvj.1_Intron|LEFTY1_uc009xej.1_3'UTR	NM_020997	NP_066277			left-right determination, factor B						cell growth|multicellular organismal development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	226241088	226241088	+	IGR	DEL	G	-	-	rs35461626		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226241088delG								C1orf55 (54022 upstream) : H3F3A (9333 downstream)																																			---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227494803	227494803	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227494803delA	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	228107388	228107389	+	IGR	DEL	AC	-	-	rs71974610		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228107388_228107389delAC								PRSS38 (73219 upstream) : WNT9A (1776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	231140309	231140310	+	IGR	DEL	AA	-	-	rs72746714		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231140309_231140310delAA								ARV1 (3838 upstream) : FAM89A (14394 downstream)																																			---	---	---	---
DISC1	27185	broad.mit.edu	37	1	231791642	231791642	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231791642delT	uc001huz.2	+						TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwo.1_Intron|DISC1_uc010pwp.1_Intron|DISC1_uc010pwq.1_Intron|DISC1_uc010pwr.1_Intron|DISC1_uc010pws.1_Intron|DISC1_uc010pwt.1_Intron|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_Intron|DISC1_uc010pww.1_Intron|DISC1_uc010pwx.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron|DISC1_uc010pwm.1_Intron|DISC1_uc001hux.1_Intron|DISC1_uc001hvc.3_Intron|DISC1_uc010pwn.1_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
DISC1	27185	broad.mit.edu	37	1	231831373	231831374	+	Intron	DEL	GT	-	-	rs112388176		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231831373_231831374delGT	uc001huz.2	+						TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwo.1_Intron|DISC1_uc010pwp.1_Intron|DISC1_uc010pwq.1_Intron|DISC1_uc010pwr.1_Intron|DISC1_uc010pws.1_Intron|DISC1_uc010pwt.1_Intron|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_Intron|DISC1_uc010pww.1_Intron|DISC1_uc010pwx.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron|DISC1_uc010pwm.1_Intron|DISC1_uc001hux.1_Intron|DISC1_uc001hvc.3_Intron|DISC1_uc010pwn.1_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234126360	234126361	+	Intron	INS	-	CTCGCCATA	CTCGCCATA	rs148965690	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234126360_234126361insCTCGCCATA	uc001hvy.1	+							NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234287004	234287005	+	Intron	INS	-	A	A	rs35828730		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234287004_234287005insA	uc001hvy.1	+							NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	234667973	234667974	+	5'Flank	DEL	AC	-	-	rs71759534		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234667973_234667974delAC	uc001hwe.2	-											Homo sapiens cDNA clone IMAGE:4816129.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	234707126	234707126	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234707126delT								TARBP1 (92277 upstream) : IRF2BP2 (32891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	235073901	235073902	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235073901_235073902insT								IRF2BP2 (328630 upstream) : TOMM20 (198758 downstream)																																			---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235438308	235438309	+	Intron	INS	-	TG	TG	rs141245110	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235438308_235438309insTG	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235463734	235463734	+	Intron	DEL	A	-	-	rs34888924		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235463734delA	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
B3GALNT2	148789	broad.mit.edu	37	1	235611535	235611536	+	3'UTR	INS	-	AAA	AAA	rs71576473		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235611535_235611536insAAA	uc001hxc.2	-	12					TBCE_uc001hwz.1_Intron|TBCE_uc001hxa.1_Intron|TBCE_uc010pxr.1_Intron|TBCE_uc001hxb.1_Intron	NM_152490	NP_689703			beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	236242583	236242586	+	IGR	DEL	TATC	-	-	rs149331543		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236242583_236242586delTATC								NID1 (14102 upstream) : GPR137B (63246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	238469662	238469663	+	IGR	INS	-	A	A	rs140253586	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238469662_238469663insA								LOC100130331 (378045 upstream) : LOC339535 (174023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	239341527	239341528	+	IGR	INS	-	ACT	ACT	rs10925835	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239341527_239341528insACT								LOC339535 (692210 upstream) : CHRM3 (208337 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240564105	240564106	+	Intron	DEL	CA	-	-	rs71784796		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240564105_240564106delCA	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
EXO1	9156	broad.mit.edu	37	1	242051712	242051715	+	Intron	DEL	CTGT	-	-	rs140295406		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242051712_242051715delCTGT	uc001hzh.2	+						EXO1_uc001hzi.2_Intron|EXO1_uc001hzj.2_Intron|EXO1_uc009xgq.2_Intron	NM_130398	NP_569082			exonuclease 1 isoform b						meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)										Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
Unknown	0	broad.mit.edu	37	1	242109163	242109163	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242109163delA								EXO1 (56116 upstream) : MAP1LC3C (49629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	242723029	242723029	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242723029delA								PLD5 (35031 upstream) : CEP170 (564702 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	244320040	244320041	+	IGR	INS	-	TC	TC	rs147984181	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244320040_244320041insTC								ZNF238 (99264 upstream) : C1orf100 (195896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	244379845	244379845	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244379845delT								ZNF238 (159069 upstream) : C1orf100 (136092 downstream)																																			---	---	---	---
C1orf101	257044	broad.mit.edu	37	1	244640306	244640307	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244640306_244640307insT	uc001iam.2	+						C1orf101_uc001iak.1_Intron|C1orf101_uc001ial.2_Intron|C1orf101_uc010pym.1_Intron|C1orf101_uc010pyn.1_Intron	NM_001130957	NP_001124429			hypothetical protein LOC257044 isoform 1							integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)															---	---	---	---
EFCAB2	84288	broad.mit.edu	37	1	245212289	245212289	+	Intron	DEL	T	-	-	rs140856489		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245212289delT	uc001ibd.2	+						EFCAB2_uc001ibc.2_Intron|EFCAB2_uc010pyo.1_Intron|EFCAB2_uc010pyp.1_Intron|EFCAB2_uc001ibe.2_Intron	NR_026586				RecName: Full=EF-hand calcium-binding domain-containing protein 2;								calcium ion binding				0	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)															---	---	---	---
CNST	163882	broad.mit.edu	37	1	246823962	246823963	+	Intron	DEL	TT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246823962_246823963delTT	uc001ibp.2	+							NM_152609	NP_689822			hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0																		---	---	---	---
ZNF496	84838	broad.mit.edu	37	1	247480873	247480873	+	Intron	DEL	C	-	-	rs112957108		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247480873delC	uc001ico.2	-						ZNF496_uc009xgv.2_Intron|ZNF496_uc001icp.2_Intron|ZNF496_uc010pyv.1_Intron	NM_032752	NP_116141			zinc finger protein 496						positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	247775419	247775419	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247775419delG								OR2G3 (5603 upstream) : OR13G1 (60001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	247780995	247780996	+	IGR	INS	-	GT	GT	rs142196088	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247780995_247780996insGT								OR2G3 (11179 upstream) : OR13G1 (54424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	249089098	249089098	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249089098delA								LOC646627 (185947 upstream) : SH3BP5L (15553 downstream)																																			---	---	---	---
SH3BP5L	80851	broad.mit.edu	37	1	249120081	249120081	+	5'UTR	DEL	C	-	-	rs28362662		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249120081delC	uc001iew.1	-	1					SH3BP5L_uc001iev.1_5'Flank|hsa-mir-3124|MI0014140_5'Flank	NM_030645	NP_085148			SH3-binding domain protein 5-like												0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)															---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1322570	1322570	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1322570delT	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	1817076	1817078	+	Intron	DEL	CTT	-	-	rs139157152		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1817076_1817078delCTT	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc010ewk.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	1961897	1961897	+	Intron	DEL	T	-	-	rs67935630		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1961897delT	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	2299366	2299367	+	Intron	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2299366_2299367delAG	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	3992616	3992616	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3992616delT								ALLC (242358 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5621573	5621574	+	IGR	INS	-	T	T	rs145759086	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5621573_5621574insT								None (None upstream) : SOX11 (211225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	9721994	9721994	+	IGR	DEL	T	-	-	rs34676677		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9721994delT								ADAM17 (26077 upstream) : YWHAQ (2113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	12078131	12078131	+	IGR	DEL	T	-	-	rs111855640		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12078131delT								LPIN1 (110600 upstream) : TRIB2 (778867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13355525	13355526	+	IGR	INS	-	A	A	rs143782153	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13355525_13355526insA								TRIB2 (472669 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14898670	14898670	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14898670delA								FAM84A (107737 upstream) : NBAS (408362 downstream)																																			---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15611196	15611196	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15611196delT	uc002rcc.1	-						NBAS_uc002rcd.1_Intron	NM_015909	NP_056993			neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	16179688	16179689	+	IGR	INS	-	TC	TC			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16179688_16179689insTC								MYCN (92560 upstream) : FAM49A (554212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20044807	20044807	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20044807delG								OSR1 (486435 upstream) : TTC32 (51711 downstream)																																			---	---	---	---
PUM2	23369	broad.mit.edu	37	2	20482559	20482560	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20482559_20482560insT	uc002rds.1	-						PUM2_uc002rdt.1_Intron|PUM2_uc002rdr.2_Intron|PUM2_uc010yjy.1_Intron|PUM2_uc002rdu.1_Intron|PUM2_uc010yjz.1_Intron	NM_015317	NP_056132			pumilio homolog 2						regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	26406590	26406593	+	Intron	DEL	CAAA	-	-	rs112073035		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26406590_26406593delCAAA	uc002rgw.1	+						uc002rgx.1_Intron					SubName: Full=Putative uncharacterized protein FAM59B;																														---	---	---	---
TRIM54	57159	broad.mit.edu	37	2	27504381	27504381	+	5'Flank	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27504381delT	uc002rjo.2	+						TRIM54_uc002rjn.2_5'Flank	NM_187841	NP_912730			ring finger protein 30 isoform 2						cell differentiation|microtubule-based process|multicellular organismal development|negative regulation of microtubule depolymerization	microtubule|sarcomere	signal transducer activity|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31208016	31208017	+	Intron	INS	-	TGAA	TGAA	rs138304703	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31208016_31208017insTGAA	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
SLC30A6	55676	broad.mit.edu	37	2	32433748	32433750	+	Intron	DEL	TTG	-	-	rs67067770		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32433748_32433750delTTG	uc002roe.1	+						SLC30A6_uc002rof.1_Intron|SLC30A6_uc010ymw.1_Intron|SLC30A6_uc010ezr.1_Intron|SLC30A6_uc002rog.1_Intron|SLC30A6_uc010ezs.1_Intron|SLC30A6_uc002roh.1_Intron	NM_017964	NP_060434			solute carrier family 30 (zinc transporter),							Golgi membrane|integral to membrane	zinc ion transmembrane transporter activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	35483782	35483783	+	IGR	INS	-	TTG	TTG	rs146570226	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35483782_35483783insTTG								None (None upstream) : None (None downstream)																																			---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40340833	40340833	+	3'UTR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40340833delC	uc002rrx.2	-	10					uc002rrw.2_Intron|SLC8A1_uc002rry.2_3'UTR|SLC8A1_uc002rrz.2_3'UTR|SLC8A1_uc002rsa.2_3'UTR|SLC8A1_uc002rsd.3_3'UTR	NM_021097	NP_066920			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
FBXO11	80204	broad.mit.edu	37	2	48084424	48084424	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48084424delT	uc010fbl.2	-						FBXO11_uc002rwe.2_Intron|FBXO11_uc002rwf.2_Intron|FBXO11_uc002rwg.1_Intron	NM_025133	NP_079409			F-box only protein 11 isoform 1						ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|ubiquitin ligase complex	protein binding|protein-arginine N-methyltransferase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	51384186	51384187	+	IGR	DEL	TA	-	-	rs71404988		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51384186_51384187delTA								NRXN1 (124512 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	51716323	51716338	+	IGR	DEL	TATTGGGTACAGAGGA	-	-	rs4522645		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51716323_51716338delTATTGGGTACAGAGGA								NRXN1 (456649 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53187591	53187591	+	IGR	DEL	A	-	-	rs112549446		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53187591delA								None (None upstream) : ASB3 (709527 downstream)																																			---	---	---	---
PSME4	23198	broad.mit.edu	37	2	54172610	54172610	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54172610delA	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429			proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)															---	---	---	---
EML6	400954	broad.mit.edu	37	2	55111363	55111364	+	Intron	INS	-	TTACAGAGGATG	TTACAGAGGATG	rs150786567	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55111363_55111364insTTACAGAGGATG	uc002ryb.3	+							NM_001039753	NP_001034842			echinoderm microtubule associated protein like							cytoplasm|microtubule					0																		---	---	---	---
EML6	400954	broad.mit.edu	37	2	55156830	55156835	+	Intron	DEL	CCTCCT	-	-	rs72189537		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55156830_55156835delCCTCCT	uc002ryb.3	+							NM_001039753	NP_001034842			echinoderm microtubule associated protein like							cytoplasm|microtubule					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	56313418	56313423	+	Intron	DEL	GTGTGT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56313418_56313423delGTGTGT	uc002rzk.2	+						uc002rzl.1_Intron					Homo sapiens, clone IMAGE:3873411, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	66232745	66232746	+	Intron	INS	-	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66232745_66232746insG	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	67591707	67591707	+	IGR	DEL	A	-	-	rs67888174		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67591707delA								MEIS1 (791817 upstream) : ETAA1 (32735 downstream)																																			---	---	---	---
SNRNP27	11017	broad.mit.edu	37	2	70120910	70120910	+	5'Flank	DEL	A	-	-	rs112156347		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70120910delA	uc002sfw.2	+						SNRNP27_uc002sfv.2_5'Flank|SNRNP27_uc002sfx.2_5'Flank	NM_006857	NP_006848			small nuclear ribonucleoprotein 27kDa						mRNA processing|RNA splicing	nucleus	nucleic acid binding				0																		---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72519665	72519666	+	Intron	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72519665_72519666delTG	uc010fep.2	-							NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	73838802	73838803	+	IGR	INS	-	C	C	rs143593180	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73838802_73838803insC								ALMS1 (1756 upstream) : NAT8 (29047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	74259575	74259578	+	IGR	DEL	TCTC	-	-	rs13032877		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74259575_74259578delTCTC								DGUOK (73489 upstream) : TET3 (13872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	79384018	79384018	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79384018delC								REG1P (18465 upstream) : REG3A (115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82816397	82816398	+	IGR	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82816397_82816398delCA								None (None upstream) : None (None downstream)																																			---	---	---	---
KDM3A	55818	broad.mit.edu	37	2	86717003	86717004	+	Intron	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86717003_86717004delTG	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903			jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88494917	88494917	+	IGR	DEL	A	-	-	rs67726769		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88494917delA								THNSL2 (8772 upstream) : FOXI3 (252809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	90474917	90474918	+	IGR	INS	-	TG	TG			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90474917_90474918insTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91797814	91797814	+	IGR	DEL	G	-	-	rs113127218		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91797814delG								None (None upstream) : LOC654342 (7378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91896230	91896231	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91896230_91896231insT								LOC654342 (48255 upstream) : GGT8P (67137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91984709	91984709	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91984709delA								GGT8P (14556 upstream) : FKSG73 (144450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	95532565	95532566	+	IGR	DEL	TC	-	-	rs35028272		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95532565_95532566delTC								ANKRD20B (9745 upstream) : TEKT4 (4666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	95720873	95720873	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95720873delT								MAL (1138 upstream) : MRPS5 (32080 downstream)																																			---	---	---	---
TMEM131	23505	broad.mit.edu	37	2	98537433	98537434	+	Intron	INS	-	GT	GT	rs143889589	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98537433_98537434insGT	uc002syh.3	-						TMEM131_uc010yvg.1_Intron	NM_015348	NP_056163			RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6																		---	---	---	---
TSGA10	80705	broad.mit.edu	37	2	99698903	99698903	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99698903delG	uc002szg.3	-						TSGA10_uc002szh.3_Intron|TSGA10_uc002szi.3_Intron|TSGA10_uc010fin.1_Intron|TSGA10_uc010yvn.1_Intron	NM_182911	NP_878915			testis specific, 10						spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	101798079	101798079	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101798079delT								TBC1D8 (30233 upstream) : C2orf29 (71266 downstream)																																			---	---	---	---
TMEM182	130827	broad.mit.edu	37	2	103417118	103417118	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103417118delT	uc010fjb.2	+						TMEM182_uc002tcc.3_Intron|TMEM182_uc002tcd.3_Intron|TMEM182_uc010ywe.1_Intron	NM_144632	NP_653233			transmembrane protein 182 precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	104791678	104791679	+	IGR	INS	-	AC	AC	rs148449279	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104791678_104791679insAC								None (None upstream) : LOC150568 (259126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105850722	105850722	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105850722delT								MRPS9 (134305 upstream) : GPR45 (7478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107844381	107844382	+	IGR	INS	-	GT	GT	rs140939969	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107844381_107844382insGT								ST6GAL2 (340818 upstream) : LOC729121 (595138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	111926790	111926791	+	IGR	DEL	GT	-	-	rs72091170		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111926790_111926791delGT								BCL2L11 (768 upstream) : LOC541471 (38568 downstream)																																			---	---	---	---
TMEM87B	84910	broad.mit.edu	37	2	112847957	112847960	+	Intron	DEL	TTGG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112847957_112847960delTTGG	uc002thm.2	+							NM_032824	NP_116213			transmembrane protein 87B precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	114850846	114850846	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114850846delT								ACTR3 (134679 upstream) : DPP10 (349053 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	117355302	117355302	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:117355302delA								DPP10 (753366 upstream) : None (None downstream)																																			---	---	---	---
PCDP1	200373	broad.mit.edu	37	2	120398483	120398483	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120398483delA	uc002tmb.2	+							NM_001029996	NP_001025167			primary ciliary dyskinesia protein 1							cilium	calmodulin binding				0	Colorectal(110;0.196)																	---	---	---	---
TFCP2L1	29842	broad.mit.edu	37	2	121989684	121989693	+	Intron	DEL	TTTTGTTTTG	-	-	rs3835787		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121989684_121989693delTTTTGTTTTG	uc002tmx.2	-						TFCP2L1_uc010flr.2_Intron|TFCP2L1_uc010flq.2_Intron	NM_014553	NP_055368			LBP-9						female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)																	---	---	---	---
CLASP1	23332	broad.mit.edu	37	2	122141068	122141069	+	Intron	INS	-	C	C	rs145161542	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122141068_122141069insC	uc002tnc.2	-						CLASP1_uc010yyv.1_Intron|CLASP1_uc002tmz.2_Intron|CLASP1_uc002tna.2_Intron|CLASP1_uc010yyw.1_Intron|CLASP1_uc002tnb.2_Intron|CLASP1_uc010yyx.1_Intron|CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tnf.2_Intron	NM_015282	NP_056097			CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	122706917	122706917	+	IGR	DEL	C	-	-	rs5833894		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122706917delC								TSN (181491 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124098566	124098594	+	IGR	DEL	GAGAGAGAAAGAAAGAGAGAGAGAGAGAA	-	-	rs72264858		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124098566_124098594delGAGAGAGAAAGAAAGAGAGAGAGAGAGAA								None (None upstream) : CNTNAP5 (684270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124191419	124191420	+	IGR	DEL	TG	-	-	rs140334029		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124191419_124191420delTG								None (None upstream) : CNTNAP5 (591444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126504132	126504133	+	IGR	INS	-	A	A	rs138099156	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126504132_126504133insA								CNTNAP5 (831271 upstream) : GYPC (909551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127204273	127204274	+	IGR	INS	-	A	A	rs142866015	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127204273_127204274insA								None (None upstream) : GYPC (209410 downstream)																																			---	---	---	---
AMMECR1L	83607	broad.mit.edu	37	2	128633924	128633924	+	Intron	DEL	A	-	-	rs66639424		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128633924delA	uc002tpl.2	-						AMMECR1L_uc002tpm.2_Intron	NM_031445	NP_113633			AMME chromosomal region gene 1-like											central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	132415482	132415483	+	IGR	INS	-	G	G	rs147219308	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132415482_132415483insG								CCDC74A (124245 upstream) : C2orf27A (64581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132773003	132773003	+	IGR	DEL	G	-	-	rs150347766	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132773003delG								C2orf27B (213769 upstream) : NCRNA00164 (132161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132790592	132790593	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132790592_132790593insA								C2orf27B (231358 upstream) : NCRNA00164 (114571 downstream)																																			---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132981723	132981723	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132981723delA	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132997560	132997561	+	Intron	INS	-	A	A	rs150378293		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132997560_132997561insA	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133010571	133010572	+	Intron	INS	-	T	T	rs148343784		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133010571_133010572insT	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133014827	133014828	+	Intron	INS	-	A	A	rs146639319		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133014827_133014828insA	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133047450	133047453	+	IGR	DEL	GTAA	-	-	rs148933193		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133047450_133047453delGTAA								NCRNA00164 (31908 upstream) : GPR39 (126694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133052693	133052694	+	IGR	INS	-	G	G	rs146511036	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133052693_133052694insG								NCRNA00164 (37151 upstream) : GPR39 (121453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133062601	133062604	+	Intron	DEL	CTCA	-	-	rs4063334	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133062601_133062604delCTCA	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	133107763	133107764	+	IGR	INS	-	C	C	rs143923523	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133107763_133107764insC								NCRNA00164 (92221 upstream) : GPR39 (66383 downstream)																																			---	---	---	---
GPR39	2863	broad.mit.edu	37	2	133319151	133319162	+	Intron	DEL	ACACACACACAC	-	-	rs72360408		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133319151_133319162delACACACACACAC	uc002ttl.2	+							NM_001508	NP_001499			G protein-coupled receptor 39							integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0																		---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133500648	133500649	+	Intron	DEL	CA	-	-	rs147128535		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133500648_133500649delCA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
MGAT5	4249	broad.mit.edu	37	2	135193955	135193956	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135193955_135193956insA	uc002ttv.1	+							NM_002410	NP_002401			N-acetylglucosaminyltransferase V						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)														---	---	---	---
ZRANB3	84083	broad.mit.edu	37	2	136203446	136203447	+	Intron	DEL	AA	-	-	rs111353917		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136203446_136203447delAA	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron|ZRANB3_uc002tun.1_Intron	NM_032143	NP_115519			zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	136981773	136981773	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136981773delC								CXCR4 (106048 upstream) : THSD7B (541342 downstream)																																			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141684080	141684080	+	Intron	DEL	A	-	-	rs76837019		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141684080delA	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
KYNU	8942	broad.mit.edu	37	2	143647134	143647134	+	Intron	DEL	A	-	-	rs67375866		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143647134delA	uc002tvl.2	+						KYNU_uc002tvk.2_Intron|KYNU_uc010fnm.2_Intron	NM_003937	NP_003928			kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	151761212	151761213	+	IGR	INS	-	AC	AC	rs141753599	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151761212_151761213insAC								RND3 (417032 upstream) : RBM43 (343516 downstream)																																			---	---	---	---
CACNB4	785	broad.mit.edu	37	2	152824755	152824756	+	Intron	INS	-	T	T	rs141675431	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152824755_152824756insT	uc002tya.2	-						CACNB4_uc002txy.2_Intron|CACNB4_uc002txz.2_Intron|CACNB4_uc010fnz.2_Intron|CACNB4_uc002tyb.2_Intron	NM_000726	NP_000717			calcium channel, voltage-dependent, beta 4						axon guidance|membrane depolarization|synaptic transmission	cytosol|internal side of plasma membrane|plasma membrane|synapse|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.156)	Verapamil(DB00661)													---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	155261143	155261144	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155261143_155261144insA	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_Intron|GALNT13_uc010fod.2_Intron	NM_052917	NP_443149			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	157821213	157821216	+	IGR	DEL	ATAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157821213_157821216delATAA								GPD2 (350966 upstream) : GALNT5 (293124 downstream)																																			---	---	---	---
ACVR1C	130399	broad.mit.edu	37	2	158405888	158405889	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158405888_158405889insA	uc002tzk.3	-						ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Intron	NM_145259	NP_660302			activin A receptor, type IC isoform 1						apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7																		---	---	---	---
RBMS1	5937	broad.mit.edu	37	2	161341008	161341010	+	Intron	DEL	ACA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161341008_161341010delACA	uc002ubo.2	-						RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Intron|RBMS1_uc002ubp.2_Intron|RBMS1_uc010fox.2_Intron	NM_016836	NP_058520			RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0																		---	---	---	---
KCNH7	90134	broad.mit.edu	37	2	163348089	163348089	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163348089delA	uc002uch.1	-						KCNH7_uc002uci.2_Intron	NM_033272	NP_150375			potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	165143467	165143470	+	IGR	DEL	GAGG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165143467_165143470delGAGG								FIGN (550954 upstream) : GRB14 (205863 downstream)																																			---	---	---	---
SCN9A	6335	broad.mit.edu	37	2	167231883	167231884	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167231883_167231884insA	uc010fpl.2	-							NM_002977	NP_002968			sodium channel, voltage-gated, type IX, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	168433307	168433307	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168433307delT								XIRP2 (317048 upstream) : B3GALT1 (241875 downstream)																																			---	---	---	---
UBR3	130507	broad.mit.edu	37	2	170768726	170768727	+	Intron	INS	-	A	A	rs144197484	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170768726_170768727insA	uc010zdi.1	+							NM_172070	NP_742067			E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	171739375	171739379	+	IGR	DEL	GGGAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171739375_171739379delGGGAA								GAD1 (21718 upstream) : GORASP2 (45603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	173929386	173929387	+	IGR	INS	-	GT	GT	rs138895402	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173929386_173929387insGT								RAPGEF4 (11768 upstream) : ZAK (11178 downstream)																																			---	---	---	---
ZAK	51776	broad.mit.edu	37	2	174050167	174050167	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174050167delA	uc002uhz.2	+						ZAK_uc002uhx.2_Intron|ZAK_uc002uhy.2_Intron|ZAK_uc010zei.1_Intron|ZAK_uc002uia.1_Intron	NM_016653	NP_057737			MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)															---	---	---	---
ZAK	51776	broad.mit.edu	37	2	174096688	174096688	+	Intron	DEL	A	-	-	rs144199038	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174096688delA	uc002uhz.2	+						uc002uib.2_Intron	NM_016653	NP_057737			MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)															---	---	---	---
OLA1	29789	broad.mit.edu	37	2	175012087	175012088	+	Intron	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175012087_175012088delAG	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473			Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2																		---	---	---	---
OLA1	29789	broad.mit.edu	37	2	175046362	175046363	+	Intron	INS	-	CAT	CAT	rs148033037	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175046362_175046363insCAT	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473			Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	176292996	176292997	+	IGR	DEL	AA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176292996_176292997delAA								ATP5G3 (246506 upstream) : KIAA1715 (497413 downstream)																																			---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178819667	178819667	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178819667delT	uc002ulq.2	-						PDE11A_uc002ulr.2_Intron|PDE11A_uc002ult.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
OSBPL6	114880	broad.mit.edu	37	2	179237428	179237430	+	Intron	DEL	CTG	-	-	rs72082672		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179237428_179237430delCTG	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_Intron	NM_032523	NP_115912			oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	186193781	186193781	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186193781delA								ZNF804A (389569 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	186203078	186203079	+	IGR	INS	-	A	A	rs145183335	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186203078_186203079insA								ZNF804A (398866 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	186220709	186220709	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186220709delC								ZNF804A (416497 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	188428444	188428444	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188428444delG								TFPI (9225 upstream) : GULP1 (728160 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	188788761	188788762	+	IGR	INS	-	A	A	rs75657964	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188788761_188788762insA								TFPI (369542 upstream) : GULP1 (367842 downstream)																																			---	---	---	---
WDR75	84128	broad.mit.edu	37	2	190307570	190307570	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190307570delA	uc002uql.1	+						WDR75_uc002uqm.1_Intron|WDR75_uc002uqn.1_Intron	NM_032168	NP_115544			WD repeat domain 75							nucleolus				ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	192448742	192448743	+	IGR	INS	-	G	G	rs144015704	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192448742_192448743insG								MYO1B (158627 upstream) : OBFC2A (94055 downstream)																																			---	---	---	---
TMEFF2	23671	broad.mit.edu	37	2	192921177	192921177	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192921177delA	uc002utc.2	-							NM_016192	NP_057276			transmembrane protein with EGF-like and two							extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)															---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	197903059	197903060	+	Intron	DEL	AA	-	-	rs72062884		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197903059_197903060delAA	uc002uua.1	-						ANKRD44_uc002utz.3_Intron	NM_153697	NP_710181			ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	199440995	199440995	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199440995delT								PLCL1 (426389 upstream) : SATB2 (693229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	203021708	203021708	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203021708delT	uc002uyy.1	+											RecName: Full=Uncharacterized protein KIAA2012;																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	204770421	204770421	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204770421delA								CTLA4 (31738 upstream) : ICOS (31050 downstream)																																			---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	206327869	206327870	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206327869_206327870insA	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
ZDBF2	57683	broad.mit.edu	37	2	207164467	207164467	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207164467delC	uc002vbp.2	+							NM_020923	NP_065974			zinc finger, DBF-type containing 2								nucleic acid binding|zinc ion binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	207235811	207235812	+	IGR	INS	-	AGA	AGA	rs145451824	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207235811_207235812insAGA								ZDBF2 (56663 upstream) : ADAM23 (72556 downstream)																																			---	---	---	---
ADAM23	8745	broad.mit.edu	37	2	207356086	207356086	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207356086delA	uc002vbq.2	+						ADAM23_uc010ziv.1_Intron	NM_003812	NP_003803			ADAM metallopeptidase domain 23 preproprotein						cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)														---	---	---	---
DYTN	391475	broad.mit.edu	37	2	207531463	207531464	+	Intron	DEL	GT	-	-	rs111347968		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207531463_207531464delGT	uc002vbr.1	-							NM_001093730	NP_001087199			dystrotelin							plasma membrane	zinc ion binding			ovary(1)|central_nervous_system(1)	2				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	208219223	208219224	+	IGR	INS	-	A	A	rs150535339	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208219223_208219224insA								MIR1302-4 (85075 upstream) : CREB1 (175392 downstream)																																			---	---	---	---
CRYGB	1419	broad.mit.edu	37	2	209009106	209009109	+	Intron	DEL	CGCA	-	-	rs12472511	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209009106_209009109delCGCA	uc002vcp.3	-							NM_005210	NP_005201			crystallin, gamma B						visual perception		structural constituent of eye lens				0				Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)														---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218322136	218322139	+	Intron	DEL	TGTG	-	-	rs2373062	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218322136_218322139delTGTG	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
PLCD4	84812	broad.mit.edu	37	2	219482813	219482816	+	Intron	DEL	AAAC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219482813_219482816delAAAC	uc002vij.1	+						PLCD4_uc010zkj.1_Intron	NM_032726	NP_116115			phospholipase C, delta 4						intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)	3		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	220745149	220745150	+	IGR	INS	-	AC	AC	rs142574383	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220745149_220745150insAC								SLC4A3 (238448 upstream) : None (None downstream)																																			---	---	---	---
NGEF	25791	broad.mit.edu	37	2	233753256	233753257	+	Intron	INS	-	ACAC	ACAC	rs75275251		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233753256_233753257insACAC	uc002vts.2	-						NGEF_uc010zmm.1_Intron|NGEF_uc010fyg.1_Intron	NM_019850	NP_062824			neuronal guanine nucleotide exchange factor						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	234700961	234700962	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234700961_234700962insT								UGT1A10 (19012 upstream) : HJURP (44525 downstream)																																			---	---	---	---
TRPM8	79054	broad.mit.edu	37	2	234859680	234859683	+	Intron	DEL	ACAA	-	-	rs67334712		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234859680_234859683delACAA	uc002vvh.2	+						TRPM8_uc010fyj.2_Intron	NM_024080	NP_076985			transient receptor potential cation channel,							integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)													---	---	---	---
RBM44	375316	broad.mit.edu	37	2	238711946	238711947	+	Intron	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238711946_238711947delAC	uc002vxi.3	+							NM_001080504	NP_001073973			RNA binding motif protein 44								nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)														---	---	---	---
RAMP1	10267	broad.mit.edu	37	2	238819397	238819408	+	Intron	DEL	AGTCACACACAC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238819397_238819408delAGTCACACACAC	uc002vxj.2	+							NM_005855	NP_005846			receptor activity-modifying protein 1 precursor						intracellular protein transport|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane	protein transporter activity				0		Breast(86;0.000596)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;9.56e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.49e-11)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.49e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00013)|Lung(119;0.0119)|LUSC - Lung squamous cell carcinoma(224;0.0288)	Pramlintide(DB01278)													---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240234760	240234760	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240234760delC	uc002vyk.3	-						HDAC4_uc010fza.2_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	240341261	240341262	+	IGR	DEL	AC	-	-	rs72336291		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240341261_240341262delAC								HDAC4 (17915 upstream) : NDUFA10 (558896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	475550	475551	+	IGR	INS	-	CCTTCCTT	CCTTCCTT	rs59629415		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:475550_475551insCCTTCCTT								CHL1 (24455 upstream) : CNTN6 (659069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	634034	634037	+	Intron	DEL	AGGT	-	-	rs147392177		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:634034_634037delAGGT	uc003boy.1	+											Homo sapiens cDNA FLJ44328 fis, clone TRACH3002871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	957435	957435	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:957435delT								CHL1 (506340 upstream) : CNTN6 (177185 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	1998973	1998973	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1998973delT								CNTN6 (553696 upstream) : CNTN4 (141577 downstream)																																			---	---	---	---
ITPR1	3708	broad.mit.edu	37	3	4621609	4621610	+	Intron	DEL	TA	-	-	rs34424630		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4621609_4621610delTA	uc003bqa.2	+						ITPR1_uc010hbz.2_Intron|ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Intron	NM_001099952	NP_001093422			inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	8273872	8273873	+	Intron	INS	-	TTCTCTCC	TTCTCTCC	rs147151343	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8273872_8273873insTTCTCTCC	uc003bqp.2	-											Homo sapiens cDNA FLJ42094 fis, clone TESOP2002489.																														---	---	---	---
IRAK2	3656	broad.mit.edu	37	3	10261011	10261012	+	Intron	INS	-	T	T	rs140332770	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10261011_10261012insT	uc003bve.1	+							NM_001570	NP_001561			interleukin-1 receptor-associated kinase 2						activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8																		---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10398649	10398650	+	Intron	DEL	GA	-	-	rs71812057		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10398649_10398650delGA	uc003bvt.2	-						ATP2B2_uc003bvv.2_Intron|ATP2B2_uc003bvw.2_Intron|ATP2B2_uc010hdo.2_Intron	NM_001001331	NP_001001331			plasma membrane calcium ATPase 2 isoform 1						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	11766764	11766766	+	IGR	DEL	CTT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11766764_11766766delCTT								VGLL4 (4544 upstream) : C3orf31 (65154 downstream)																																			---	---	---	---
IQSEC1	9922	broad.mit.edu	37	3	12976555	12976555	+	Intron	DEL	C	-	-	rs11328313		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12976555delC	uc003bxt.2	-						IQSEC1_uc003bxu.3_Intron|IQSEC1_uc011auw.1_Intron	NM_014869	NP_055684			IQ motif and Sec7 domain 1 isoform b						regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16018302	16018304	+	Intron	DEL	CTT	-	-	rs149831448		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16018302_16018304delCTT	uc003caq.3	+							NM_054110	NP_473451			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17355992	17355992	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17355992delA	uc003cbf.2	-						TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron|TBC1D5_uc010hew.1_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	18214914	18214914	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18214914delG	uc003cbg.2	+											Homo sapiens cDNA clone IMAGE:5584035.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	18774382	18774382	+	IGR	DEL	T	-	-	rs112332229		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18774382delT								SATB1 (294130 upstream) : KCNH8 (415635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	19121183	19121188	+	IGR	DEL	AACAAC	-	-	rs10575691		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19121183_19121188delAACAAC								SATB1 (640931 upstream) : KCNH8 (68829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	22937411	22937412	+	IGR	INS	-	A	A	rs138405666	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22937411_22937412insA								ZNF385D (523288 upstream) : UBE2E2 (307241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	23763546	23763546	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23763546delA								UBE2E2 (131250 upstream) : UBE2E1 (83893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	23780304	23780304	+	IGR	DEL	A	-	-	rs35882709		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23780304delA								UBE2E2 (148008 upstream) : UBE2E1 (67135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	28795962	28795963	+	IGR	INS	-	A	A	rs1585523	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28795962_28795963insA								ZCWPW2 (229332 upstream) : RBMS3 (526980 downstream)																																			---	---	---	---
TGFBR2	7048	broad.mit.edu	37	3	30734524	30734524	+	3'UTR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30734524delA	uc003ceo.2	+	7					TGFBR2_uc003cen.2_3'UTR	NM_003242	NP_003233			transforming growth factor, beta receptor II						activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	30757153	30757153	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30757153delA								TGFBR2 (21522 upstream) : GADL1 (10539 downstream)																																			---	---	---	---
OSBPL10	114884	broad.mit.edu	37	3	32022334	32022337	+	Intron	DEL	CACA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32022334_32022337delCACA	uc003cev.2	-						OSBPL10_uc011axf.1_Intron|ZNF860_uc011axg.1_5'Flank	NM_017784	NP_060254			oxysterol-binding protein-like protein 10						lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	34658639	34658640	+	IGR	DEL	GT	-	-	rs55738738		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34658639_34658640delGT								PDCD6IP (747445 upstream) : None (None downstream)																																			---	---	---	---
MOBP	4336	broad.mit.edu	37	3	39546018	39546019	+	Intron	INS	-	AG	AG	rs145855752	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39546018_39546019insAG	uc010hht.2	+						MOBP_uc003cju.2_Intron|MOBP_uc003cjv.2_Intron|MOBP_uc003cjw.2_Intron|MOBP_uc003cjx.2_Intron|MOBP_uc003cjy.2_Intron	NM_182935	NP_891980			myelin-associated oligodendrocyte basic protein						nervous system development	nucleolus|perinuclear region of cytoplasm|soluble fraction				ovary(1)|central_nervous_system(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.082)|Kidney(284;0.0998)														---	---	---	---
ABHD5	51099	broad.mit.edu	37	3	43736205	43736205	+	Intron	DEL	G	-	-	rs113835901		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43736205delG	uc003cmx.2	+							NM_016006	NP_057090			abhydrolase domain containing 5						cell differentiation|fatty acid metabolic process|negative regulation of sequestering of triglyceride|phosphatidic acid biosynthetic process|positive regulation of triglyceride catabolic process|triglyceride catabolic process	cytosol|lipid particle	1-acylglycerol-3-phosphate O-acyltransferase activity|lysophosphatidic acid acyltransferase activity			ovary(1)	1		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)														---	---	---	---
SLC6A20	54716	broad.mit.edu	37	3	45806444	45806444	+	Intron	DEL	C	-	-	rs34292888		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45806444delC	uc011bai.1	-						SLC6A20_uc003cow.2_Intron|SLC6A20_uc011baj.1_Intron	NM_020208	NP_064593			solute carrier family 6, member 20 isoform 1						cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)														---	---	---	---
SMARCC1	6599	broad.mit.edu	37	3	47650554	47650554	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47650554delT	uc003crq.2	-						SMARCC1_uc011bbc.1_Intron|SMARCC1_uc011bbd.1_Intron	NM_003074	NP_003065			SWI/SNF-related matrix-associated						chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)														---	---	---	---
CELSR3	1951	broad.mit.edu	37	3	48676310	48676310	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48676310delC	uc003cul.2	-						CELSR3_uc003cuf.1_Intron|CELSR3_uc010hkf.2_Intron|CELSR3_uc010hkg.2_Intron	NM_001407	NP_001398			cadherin EGF LAG seven-pass G-type receptor 3						homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	49479414	49479415	+	IGR	INS	-	AAAC	AAAC	rs139476763	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49479414_49479415insAAAC								NICN1 (12657 upstream) : DAG1 (28150 downstream)																																			---	---	---	---
BSN	8927	broad.mit.edu	37	3	49708575	49708578	+	3'UTR	DEL	GTGC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49708575_49708578delGTGC	uc003cxe.3	+	12					APEH_uc010hkw.1_5'Flank|APEH_uc003cxf.2_5'Flank	NM_003458	NP_003449			bassoon protein						synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)														---	---	---	---
MST1R	4486	broad.mit.edu	37	3	49932245	49932246	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49932245_49932246insT	uc003cxy.3	-						MST1R_uc011bdc.1_Intron	NM_002447	NP_002438			macrophage stimulating 1 receptor precursor						cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)														---	---	---	---
SEMA3B	7869	broad.mit.edu	37	3	50305432	50305432	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50305432delG	uc003cyu.2	+						SEMA3B_uc010hlh.1_Intron|SEMA3B_uc003cyt.2_Intron|SEMA3B_uc003cyv.2_5'Flank|SEMA3B_uc003cyw.2_5'Flank|SEMA3B_uc010hli.2_5'Flank|SEMA3B_uc003cyx.2_5'Flank	NM_004636	NP_004627			semaphorin 3B isoform 1 precursor						axon guidance|cell-cell signaling	endoplasmic reticulum|extracellular region|membrane	receptor activity			lung(2)|central_nervous_system(2)|kidney(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)														---	---	---	---
CACNA2D2	9254	broad.mit.edu	37	3	50444045	50444047	+	Intron	DEL	CAT	-	-	rs140248572		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50444045_50444047delCAT	uc003daq.2	-						CACNA2D2_uc003dap.2_Intron	NM_006030	NP_006021			calcium channel, voltage-dependent, alpha						energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	50574447	50574448	+	IGR	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50574447_50574448delCA								CACNA2D2 (33555 upstream) : C3orf18 (21015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	51941368	51941369	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51941368_51941369insA								IQCF1 (3982 upstream) : RRP9 (26077 downstream)																																			---	---	---	---
ITIH1	3697	broad.mit.edu	37	3	52825281	52825282	+	Intron	INS	-	C	C	rs147098813	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52825281_52825282insC	uc003dfs.2	+						ITIH1_uc010hmn.1_Intron|ITIH1_uc003dft.2_Intron|ITIH1_uc010hmo.1_Intron|ITIH1_uc003dfu.2_Intron	NM_002215	NP_002206			inter-alpha (globulin) inhibitor H1						hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)														---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54316878	54316879	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54316878_54316879insT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	55467771	55467771	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55467771delA								CACNA2D3 (359189 upstream) : WNT5A (31973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	58169816	58169816	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58169816delC								FLNB (11834 upstream) : DNASE1L3 (8538 downstream)																																			---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	61818742	61818743	+	Intron	DEL	TG	-	-	rs10525238		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61818742_61818743delTG	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	62050751	62050752	+	Intron	INS	-	A	A	rs142964477	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62050751_62050752insA	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
FAM19A4	151647	broad.mit.edu	37	3	68952453	68952454	+	Intron	INS	-	A	A	rs77912318		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68952453_68952454insA	uc003dnh.1	-						FAM19A4_uc003dni.1_Intron	NM_182522	NP_872328			family with sequence similarity 19 (chemokine							extracellular region				skin(2)	2		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)														---	---	---	---
FRMD4B	23150	broad.mit.edu	37	3	69374015	69374015	+	Intron	DEL	G	-	-	rs77202778		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69374015delG	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dny.2_Intron	NM_015123	NP_055938			FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	69676047	69676048	+	IGR	INS	-	A	A	rs139294623	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69676047_69676048insA								FRMD4B (84314 upstream) : MITF (112585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75275064	75275065	+	IGR	INS	-	A	A	rs148662216	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75275064_75275065insA								CNTN3 (704721 upstream) : FAM86D (195640 downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77376656	77376656	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77376656delT	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	78177324	78177324	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78177324delA								ROBO2 (480663 upstream) : ROBO1 (469064 downstream)																																			---	---	---	---
GBE1	2632	broad.mit.edu	37	3	81700769	81700770	+	Intron	INS	-	AT	AT			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81700769_81700770insAT	uc003dqg.2	-						GBE1_uc011bgm.1_Intron	NM_000158	NP_000149			glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)										Glycogen_Storage_Disease_type_IV				---	---	---	---
Unknown	0	broad.mit.edu	37	3	84074794	84074794	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84074794delT								None (None upstream) : CADM2 (933339 downstream)																																			---	---	---	---
CGGBP1	8545	broad.mit.edu	37	3	88124903	88124904	+	Intron	INS	-	T	T	rs35978382		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88124903_88124904insT	uc003dqu.2	-							NM_003663	NP_003654			CGG triplet repeat binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding				0		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	90459544	90459544	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90459544delG								EPHA3 (928262 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90473693	90473693	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90473693delA								EPHA3 (942411 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	98177768	98177768	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98177768delT								OR5K3 (67294 upstream) : OR5K1 (10653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	99313687	99313688	+	IGR	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99313687_99313688delAG								DCBLD2 (693154 upstream) : COL8A1 (43766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104569851	104569854	+	IGR	DEL	TGTG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104569851_104569854delTGTG								None (None upstream) : ALCAM (515859 downstream)																																			---	---	---	---
BBX	56987	broad.mit.edu	37	3	107449341	107449341	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107449341delT	uc010hpr.2	+						BBX_uc003dwk.3_Intron|BBX_uc003dwl.3_Intron|BBX_uc010hps.1_Intron|BBX_uc003dwm.3_Intron	NM_001142568	NP_001136040			HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)															---	---	---	---
CD96	10225	broad.mit.edu	37	3	111350478	111350478	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111350478delA	uc003dxw.2	+						CD96_uc003dxx.2_Intron|CD96_uc010hpy.1_Intron	NM_198196	NP_937839			CD96 antigen isoform 1 precursor						cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3														Opitz_Trigonocephaly_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	3	116195922	116195923	+	IGR	DEL	AG	-	-	rs72149131		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116195922_116195923delAG								LSAMP (671904 upstream) : LOC285194 (232712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117087005	117087006	+	IGR	DEL	CA	-	-	rs57266851		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117087005_117087006delCA								LOC285194 (651120 upstream) : None (None downstream)																																			---	---	---	---
STXBP5L	9515	broad.mit.edu	37	3	121113252	121113252	+	Intron	DEL	T	-	-	rs75500404		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121113252delT	uc003eec.3	+						STXBP5L_uc011bji.1_Intron	NM_014980	NP_055795			syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	123193700	123193700	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123193700delT								ADCY5 (26308 upstream) : PTPLB (19663 downstream)																																			---	---	---	---
KALRN	8997	broad.mit.edu	37	3	123938717	123938718	+	Intron	DEL	CT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123938717_123938718delCT	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831			kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
KALRN	8997	broad.mit.edu	37	3	124347244	124347245	+	Intron	INS	-	TCCC	TCCC			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124347244_124347245insTCCC	uc003ehg.2	+						KALRN_uc003ehi.2_Intron|KALRN_uc003ehk.2_Intron|KALRN_uc003ehj.2_Intron	NM_001024660	NP_001019831			kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
ITGB5	3693	broad.mit.edu	37	3	124572289	124572289	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124572289delA	uc003eho.2	-							NM_002213	NP_002204			integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)														---	---	---	---
CHCHD6	84303	broad.mit.edu	37	3	126640354	126640354	+	Intron	DEL	T	-	-	rs11318628		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126640354delT	uc003ejf.1	+						CHCHD6_uc010hsj.1_Intron	NM_032343	NP_115719			coiled-coil-helix-coiled-coil-helix domain												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	127190003	127190003	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127190003delC								PLXNA1 (433775 upstream) : TPRA1 (101905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	128233757	128233759	+	IGR	DEL	TGA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128233757_128233759delTGA								LOC90246 (4330 upstream) : C3orf27 (57085 downstream)																																			---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129462779	129462779	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129462779delA	uc003emz.3	-						TMCC1_uc011blc.1_Intron|TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395			transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1																		---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131648435	131648436	+	Intron	DEL	AA	-	-	rs112620204		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131648435_131648436delAA	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	132629639	132629640	+	IGR	INS	-	CA	CA	rs138883336	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132629639_132629640insCA								NCRNA00119 (36589 upstream) : TMEM108 (127531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	133855409	133855420	+	IGR	DEL	GAAGGAAGGGAG	-	-	rs112418669		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133855409_133855420delGAAGGAAGGGAG								SLCO2A1 (106489 upstream) : RYK (20558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	134039248	134039248	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134039248delA								RYK (69662 upstream) : AMOTL2 (31446 downstream)																																			---	---	---	---
CEP63	80254	broad.mit.edu	37	3	134282562	134282562	+	3'UTR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134282562delC	uc003eqo.1	+	16					CEP63_uc003eql.1_3'UTR|CEP63_uc003eqm.2_Intron|CEP63_uc003eqn.1_3'UTR	NM_025180	NP_079456			centrosomal protein 63 isoform a						cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	137003378	137003378	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137003378delC								IL20RB (273458 upstream) : SOX14 (480201 downstream)																																			---	---	---	---
DZIP1L	199221	broad.mit.edu	37	3	137830845	137830845	+	Intron	DEL	A	-	-	rs72015543		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137830845delA	uc003erq.2	-						DZIP1L_uc003err.1_Intron	NM_173543	NP_775814			DAZ interacting protein 1-like							intracellular	zinc ion binding			ovary(1)|pancreas(1)	2																		---	---	---	---
PIK3CB	5291	broad.mit.edu	37	3	138412249	138412250	+	Intron	DEL	TT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138412249_138412250delTT	uc011bmq.1	-						PIK3CB_uc011bmn.1_Intron|PIK3CB_uc011bmo.1_Intron|PIK3CB_uc011bmp.1_Intron	NM_006219	NP_006210			catalytic phosphatidylinositol 3-kinase beta						activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	140546401	140546401	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140546401delA								TRIM42 (126410 upstream) : SLC25A36 (114261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144868877	144868879	+	IGR	DEL	TTA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144868877_144868879delTTA								None (None upstream) : PLOD2 (918349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	146854894	146854894	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146854894delT								PLSCR5 (530891 upstream) : ZIC4 (248943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	150514636	150514638	+	IGR	DEL	CTC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150514636_150514638delCTC								SIAH2 (33373 upstream) : CLRN1OS (55633 downstream)																																			---	---	---	---
MED12L	116931	broad.mit.edu	37	3	150948359	150948359	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150948359delT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|P2RY14_uc003eys.1_Intron|P2RY14_uc003eyr.1_Intron	NM_053002	NP_443728			mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	155096679	155096680	+	IGR	INS	-	CTCT	CTCT	rs139847957	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155096679_155096680insCTCT								MME (195161 upstream) : PLCH1 (100991 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	156302715	156302716	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156302715_156302716delAC								SSR3 (29780 upstream) : LOC100287227 (88248 downstream)																																			---	---	---	---
LEKR1	389170	broad.mit.edu	37	3	156693090	156693091	+	Intron	DEL	AA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156693090_156693091delAA	uc003fba.1	+							NM_001004316	NP_001004316			leucine, glutamate and lysine rich 1												0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	157468179	157468179	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157468179delT								C3orf55 (149160 upstream) : SHOX2 (345622 downstream)																																			---	---	---	---
MLF1	4291	broad.mit.edu	37	3	158291600	158291600	+	Intron	DEL	G	-	-	rs113664416		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158291600delG	uc003fcb.2	+						uc003fbw.1_5'Flank|MLF1_uc003fbz.2_Intron|MLF1_uc003fca.2_Intron|MLF1_uc003fbx.2_Intron|MLF1_uc003fcc.2_Intron|MLF1_uc003fby.2_Intron|MLF1_uc010hvx.2_Intron	NM_022443	NP_071888			myeloid leukemia factor 1 isoform 1						cell cycle arrest|myeloid progenitor cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein domain specific binding				0		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)					T	NPM1	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	3	158596865	158596866	+	IGR	INS	-	TGTG	TGTG	rs140932291	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158596865_158596866insTGTG								MFSD1 (49361 upstream) : SCHIP1 (190251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	159738027	159738027	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159738027delA	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	160400228	160400229	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160400228_160400229delAC								ARL14 (3995 upstream) : PPM1L (73767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161619761	161619761	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161619761delT								OTOL1 (398033 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161624965	161624965	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161624965delT								OTOL1 (403237 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	163435795	163435796	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163435795_163435796insA								None (None upstream) : MIR1263 (453463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	163759626	163759627	+	IGR	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163759626_163759627delCA								None (None upstream) : MIR1263 (129632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166739149	166739150	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166739149_166739150insT								None (None upstream) : ZBBX (218931 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	168235680	168235680	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168235680delG								GOLIM4 (422263 upstream) : MIR551B (33962 downstream)																																			---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173964534	173964534	+	Intron	DEL	T	-	-	rs147561892		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173964534delT	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	175540889	175540892	+	IGR	DEL	CAGC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175540889_175540892delCAGC								NAALADL2 (17463 upstream) : None (None downstream)																																			---	---	---	---
PEX5L	51555	broad.mit.edu	37	3	179597536	179597536	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179597536delT	uc003fki.1	-						PEX5L_uc011bqd.1_Intron|PEX5L_uc011bqe.1_Intron|PEX5L_uc011bqf.1_Intron|PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Intron|PEX5L_uc011bqg.1_Intron|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643			peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	181036401	181036402	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181036401_181036402delAC								DNAJC19 (328871 upstream) : SOX2OT (245107 downstream)																																			---	---	---	---
SOX2OT	347689	broad.mit.edu	37	3	181330024	181330025	+	Intron	DEL	GT	-	-	rs149492226		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181330024_181330025delGT	uc003fkv.2	+						SOX2OT_uc003fkw.3_Intron					Homo sapiens cDNA FLJ12764 fis, clone NT2RP2001506.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	181703616	181703617	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181703616_181703617insT	uc003fky.2	+											Homo sapiens cDNA clone IMAGE:5296886.																														---	---	---	---
MCF2L2	23101	broad.mit.edu	37	3	182913201	182913201	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182913201delA	uc003fli.1	-							NM_015078	NP_055893			Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)															---	---	---	---
DGKG	1608	broad.mit.edu	37	3	185968878	185968879	+	Intron	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185968878_185968879delGT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337			diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
ADIPOQ	9370	broad.mit.edu	37	3	186565976	186565977	+	Intron	INS	-	AAG	AAG	rs150789289	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186565976_186565977insAAG	uc003fra.2	+						ADIPOQ_uc010hyy.2_Intron	NM_004797	NP_004788			adiponectin precursor						brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity			ovary(1)	1	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	187724293	187724293	+	IGR	DEL	A	-	-	rs113322568		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187724293delA								BCL6 (260818 upstream) : LPP (147426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	187866292	187866293	+	IGR	INS	-	GT	GT	rs34071326		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187866292_187866293insGT								BCL6 (402817 upstream) : LPP (5426 downstream)																																			---	---	---	---
LPP	4026	broad.mit.edu	37	3	188377624	188377629	+	Intron	DEL	ACACAT	-	-	rs138958932	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188377624_188377629delACACAT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
LPP	4026	broad.mit.edu	37	3	188377628	188377629	+	Intron	DEL	AT	-	-	rs58197493		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188377628_188377629delAT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
TPRG1	285386	broad.mit.edu	37	3	188947949	188947949	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188947949delG	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887			tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	190924611	190924611	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190924611delT								SNAR-I (328772 upstream) : OSTN (5711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193533311	193533312	+	IGR	INS	-	T	T	rs142857675	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193533311_193533312insT								OPA1 (117712 upstream) : LOC100128023 (177572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193566780	193566780	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193566780delA								OPA1 (151181 upstream) : LOC100128023 (144104 downstream)																																			---	---	---	---
SDHAP1	255812	broad.mit.edu	37	3	195711343	195711344	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195711343_195711344insT	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0																		---	---	---	---
SDHAP1	255812	broad.mit.edu	37	3	195714613	195714614	+	Intron	INS	-	A	A	rs139057401		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195714613_195714614insA	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0																		---	---	---	---
PAK2	5062	broad.mit.edu	37	3	196550435	196550435	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196550435delC	uc003fwy.3	+							NM_002577	NP_002568			p21-activated kinase 2						axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity			ovary(1)|lung(1)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	197851028	197851029	+	IGR	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197851028_197851029delCA								LOC348840 (43486 upstream) : FAM157A (28208 downstream)																																			---	---	---	---
ZNF595	152687	broad.mit.edu	37	4	54942	54943	+	Intron	INS	-	T	T	rs139883952		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54942_54943insT	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330			zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3573306	3573307	+	IGR	DEL	CT	-	-	rs138081375		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3573306_3573307delCT								LRPAP1 (39082 upstream) : ADRA2C (194768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3604323	3604325	+	IGR	DEL	CTG	-	-	rs10571400		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3604323_3604325delCTG								LRPAP1 (70099 upstream) : ADRA2C (163750 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3609205	3609205	+	IGR	DEL	C	-	-	rs33919702		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3609205delC								LRPAP1 (74981 upstream) : ADRA2C (158870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3612637	3612637	+	IGR	DEL	T	-	-	rs62274304		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3612637delT								LRPAP1 (78413 upstream) : ADRA2C (155438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3808814	3808815	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3808814_3808815insT								ADRA2C (38563 upstream) : LOC348926 (134855 downstream)																																			---	---	---	---
SLC2A9	56606	broad.mit.edu	37	4	10015778	10015778	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10015778delC	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425			solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	18071723	18071724	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18071723_18071724delAC								LCORL (48338 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	22175552	22175552	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22175552delT								KCNIP4 (225178 upstream) : GPR125 (213447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	22690883	22690883	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22690883delA								GPR125 (173211 upstream) : GBA3 (3665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49644024	49644025	+	IGR	INS	-	ATGGA	ATGGA	rs138643557		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49644024_49644025insATGGA								CWH43 (579931 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67011878	67011879	+	IGR	INS	-	TG	TG	rs140270643	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67011878_67011879insTG								EPHA5 (476225 upstream) : MIR1269 (130663 downstream)																																			---	---	---	---
SCARB2	950	broad.mit.edu	37	4	77134212	77134212	+	Intron	DEL	C	-	-	rs5859503		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77134212delC	uc003hju.1	-						FAM47E_uc003hjv.2_5'Flank|SCARB2_uc011cbu.1_Intron	NM_005506	NP_005497			scavenger receptor class B, member 2						cell adhesion|protein targeting to lysosome	integral to plasma membrane|lysosomal lumen|lysosomal membrane|membrane fraction	enzyme binding|receptor activity				0			Lung(101;0.196)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	78366567	78366567	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78366567delA								CCNG2 (275357 upstream) : CXCL13 (66340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	132324782	132324782	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132324782delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	148342614	148342617	+	IGR	DEL	AGGA	-	-	rs72491777		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148342614_148342617delAGGA								MIR548G (76745 upstream) : EDNRA (59290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	176416486	176416486	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176416486delT								ADAM29 (517156 upstream) : GPM6A (137603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190588715	190588716	+	IGR	DEL	AG	-	-	rs67332528		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190588715_190588716delAG								None (None upstream) : FRG1 (273258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190630206	190630206	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190630206delG								None (None upstream) : FRG1 (231768 downstream)																																			---	---	---	---
ZDHHC11	79844	broad.mit.edu	37	5	796054	796055	+	3'UTR	DEL	CT	-	-	rs67870018		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:796054_796055delCT	uc011cma.1	-	13					ZDHHC11_uc010itc.2_RNA|ZDHHC11_uc003jbj.2_RNA	NM_024786	NP_079062			zinc finger, DHHC-type containing 11							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)															---	---	---	---
NKD2	85409	broad.mit.edu	37	5	1026064	1026065	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1026064_1026065insA	uc003jbt.1	+						NKD2_uc010itf.1_Intron	NM_033120	NP_149111			naked cuticle homolog 2						exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	1048204	1048205	+	IGR	INS	-	GTTA	GTTA	rs149059976	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1048204_1048205insGTTA								NKD2 (9279 upstream) : SLC12A7 (2286 downstream)																																			---	---	---	---
NDUFS6	4726	broad.mit.edu	37	5	1810191	1810192	+	Intron	INS	-	T	T	rs148525812	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1810191_1810192insT	uc003jcy.2	+							NM_004553	NP_004544			NADH dehydrogenase (ubiquinone) Fe-S protein 6,						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	2888807	2888808	+	IGR	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2888807_2888808delGT								C5orf38 (133295 upstream) : IRX1 (707360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3701223	3701225	+	IGR	DEL	CTC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3701223_3701225delCTC								IRX1 (99707 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3770136	3770147	+	IGR	DEL	TTCTTTCTTTCT	-	-	rs34353371		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3770136_3770147delTTCTTTCTTTCT								IRX1 (168620 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7004483	7004484	+	IGR	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7004483_7004484delGT								PAPD7 (247322 upstream) : ADCY2 (391859 downstream)																																			---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7489927	7489928	+	Intron	INS	-	GT	GT	rs35228737		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7489927_7489928insGT	uc003jdz.1	+							NM_020546	NP_065433			adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	8306347	8306348	+	IGR	INS	-	T	T	rs9986137	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8306347_8306348insT								MTRR (405114 upstream) : SEMA5A (728790 downstream)																																			---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15775493	15775494	+	Intron	INS	-	AC	AC	rs149401468	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15775493_15775494insAC	uc003jfn.1	+							NM_012304	NP_036436			F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	20846478	20846479	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20846478_20846479insT	uc003jge.1	+											Homo sapiens cDNA FLJ36043 fis, clone TESTI2017582.																														---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21536533	21536538	+	Intron	DEL	ATAAGC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21536533_21536538delATAAGC	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	29663775	29663776	+	IGR	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29663775_29663776delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30909855	30909856	+	IGR	INS	-	T	T	rs143679384	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30909855_30909856insT								None (None upstream) : CDH6 (283940 downstream)																																			---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31886809	31886809	+	Intron	DEL	T	-	-	rs67322355		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31886809delT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	34065772	34065773	+	IGR	INS	-	A	A	rs148945624	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34065772_34065773insA								C1QTNF3 (22455 upstream) : RAI14 (590660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	34401894	34401894	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34401894delT								C1QTNF3 (358577 upstream) : RAI14 (254539 downstream)																																			---	---	---	---
RAI14	26064	broad.mit.edu	37	5	34719262	34719263	+	Intron	INS	-	GG	GG	rs147690703	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34719262_34719263insGG	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron|RAI14_uc010ius.1_Intron|RAI14_uc003jis.2_Intron|RAI14_uc003jit.2_Intron|RAI14_uc011cok.1_Intron	NM_015577	NP_056392			retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)																	---	---	---	---
TTC23L	153657	broad.mit.edu	37	5	34844425	34844429	+	Intron	DEL	TAAGT	-	-	rs2307656		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34844425_34844429delTAAGT	uc003jiu.2	+							NM_144725	NP_653326			tetratricopeptide repeat domain 23-like								binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	35322390	35322390	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35322390delC								PRLR (91596 upstream) : SPEF2 (295599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	38665206	38665207	+	Intron	DEL	CA	-	-	rs79965106		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38665206_38665207delCA	uc003jlj.2	+											Homo sapiens cDNA clone IMAGE:4829282.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	44081565	44081565	+	IGR	DEL	A	-	-	rs11362852		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44081565delA								NNT (375898 upstream) : FGF10 (223532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44845929	44845930	+	IGR	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44845929_44845930delCA								MRPS30 (30315 upstream) : HCN1 (413423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	45165962	45165964	+	IGR	DEL	TTT	-	-	rs77846793		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45165962_45165964delTTT								MRPS30 (350348 upstream) : HCN1 (93389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	45954061	45954061	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45954061delG								HCN1 (257841 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46324705	46324705	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46324705delG								HCN1 (628485 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	54887126	54887141	+	IGR	DEL	GTGTGTGTGTGTGTGT	-	-	rs34006176		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54887126_54887141delGTGTGTGTGTGTGTGT								PPAP2A (56253 upstream) : SLC38A9 (34535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55985089	55985090	+	IGR	DEL	TA	-	-	rs34194373		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55985089_55985090delTA								ANKRD55 (455903 upstream) : MAP3K1 (125810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	56069087	56069087	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56069087delA								ANKRD55 (539901 upstream) : MAP3K1 (41813 downstream)																																			---	---	---	---
GPBP1	65056	broad.mit.edu	37	5	56531132	56531133	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56531132_56531133insA	uc003jrh.3	+						GPBP1_uc010iwg.2_Intron|GPBP1_uc003jri.3_Intron|GPBP1_uc003jrj.3_Intron|GPBP1_uc003jrk.3_Intron|GPBP1_uc003jrl.3_Intron	NM_022913	NP_075064			GC-rich promoter binding protein 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)														---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58980008	58980008	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58980008delC	uc003jsa.2	-						PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	61482481	61482482	+	IGR	INS	-	A	A	rs143086183	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61482481_61482482insA								FLJ37543 (480119 upstream) : KIF2A (119507 downstream)																																			---	---	---	---
RGS7BP	401190	broad.mit.edu	37	5	63840503	63840505	+	Intron	DEL	AAG	-	-	rs35661639		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63840503_63840505delAAG	uc003jtj.2	+							NM_001029875	NP_001025046			regulator of G-protein signaling 7 binding						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane					0		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	66680129	66680129	+	IGR	DEL	T	-	-	rs11313573		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66680129delT								CD180 (187512 upstream) : PIK3R1 (831475 downstream)																																			---	---	---	---
PIK3R1	5295	broad.mit.edu	37	5	67531700	67531701	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67531700_67531701insT	uc003jva.2	+						PIK3R1_uc003jvb.2_Intron	NM_181523	NP_852664			phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	71213103	71213103	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71213103delA								CARTPT (196231 upstream) : MAP1B (190015 downstream)																																			---	---	---	---
SV2C	22987	broad.mit.edu	37	5	75396911	75396911	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75396911delA	uc003kei.1	+							NM_014979	NP_055794			synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	77130485	77130485	+	IGR	DEL	A	-	-	rs67289668		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77130485delA								TBCA (58300 upstream) : AP3B1 (167666 downstream)																																			---	---	---	---
LHFPL2	10184	broad.mit.edu	37	5	77818934	77818935	+	Intron	DEL	GG	-	-	rs142786367	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77818934_77818935delGG	uc003kfo.2	-							NM_005779	NP_005770			lipoma HMGIC fusion partner-like 2							integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	77965253	77965256	+	IGR	DEL	AAGG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77965253_77965256delAAGG								LHFPL2 (20605 upstream) : ARSB (107783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	77969000	77969001	+	IGR	DEL	GT	-	-	rs34527894		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77969000_77969001delGT								LHFPL2 (24352 upstream) : ARSB (104038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	78513820	78513821	+	IGR	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78513820_78513821delAG								BHMT (85708 upstream) : JMY (18133 downstream)																																			---	---	---	---
HOMER1	9456	broad.mit.edu	37	5	78812250	78812254	+	5'Flank	DEL	CGTTG	-	-	rs6896999	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78812250_78812254delCGTTG	uc003kfy.2	-						HOMER1_uc010jab.2_5'Flank|HOMER1_uc010jac.2_5'Flank|HOMER1_uc010jad.2_5'Flank	NM_004272	NP_004263			homer 1						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	79263156	79263157	+	IGR	INS	-	A	A	rs141009666	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79263156_79263157insA								CMYA5 (167108 upstream) : MTX3 (9384 downstream)																																			---	---	---	---
SERINC5	256987	broad.mit.edu	37	5	79468861	79468861	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79468861delT	uc003kgj.2	-						SERINC5_uc003kgk.2_Intron|SERINC5_uc003kgl.2_Intron|SERINC5_uc003kgm.2_Intron|SERINC5_uc011ctj.1_Intron	NM_178276	NP_840060			developmentally regulated protein TPO1						phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)														---	---	---	---
MSH3	4437	broad.mit.edu	37	5	80014315	80014315	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80014315delT	uc003kgz.2	+							NM_002439	NP_002430			mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)									MMR					---	---	---	---
MSH3	4437	broad.mit.edu	37	5	80129603	80129604	+	Intron	INS	-	T	T	rs145538501	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80129603_80129604insT	uc003kgz.2	+							NM_002439	NP_002430			mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)									MMR					---	---	---	---
Unknown	0	broad.mit.edu	37	5	84386849	84386849	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84386849delT								EDIL3 (706238 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	84532856	84532859	+	IGR	DEL	TGTG	-	-	rs145447108		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84532856_84532859delTGTG								EDIL3 (852245 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	86414959	86414959	+	5'Flank	DEL	T	-	-	rs61449832		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86414959delT	uc003kit.2	+											Homo sapiens cDNA clone IMAGE:5444809, **** WARNING: chimeric clone ****.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	90943014	90943014	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90943014delC								LOC100129716 (226483 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	91716298	91716299	+	Intron	DEL	GT	-	-	rs34074351		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91716298_91716299delGT	uc003kkb.1	+											Homo sapiens cDNA FLJ31923 fis, clone NT2RP7005323.																														---	---	---	---
FAM172A	83989	broad.mit.edu	37	5	93348377	93348379	+	Intron	DEL	CTG	-	-	rs145603817		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93348377_93348379delCTG	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Intron	NM_032042	NP_114431			hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0																		---	---	---	---
C5orf36	285600	broad.mit.edu	37	5	93924379	93924379	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93924379delA	uc011cuk.1	-						C5orf36_uc003kkp.2_Intron	NM_001145678	NP_001139150			hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	98024995	98024995	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98024995delA								None (None upstream) : RGMB (80004 downstream)																																			---	---	---	---
PAM	5066	broad.mit.edu	37	5	102341611	102341612	+	Intron	INS	-	TTG	TTG	rs149291923	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102341611_102341612insTTG	uc003knw.2	+						PAM_uc003kns.2_Intron|PAM_uc003knt.2_Intron|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Intron|PAM_uc003knz.2_5'Flank	NM_000919	NP_000910			peptidylglycine alpha-amidating monooxygenase						peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	102543135	102543135	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102543135delG								PPIP5K2 (4228 upstream) : C5orf30 (51307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	104650163	104650164	+	IGR	INS	-	GT	GT	rs142087413	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104650163_104650164insGT								RAB9BP1 (214365 upstream) : None (None downstream)																																			---	---	---	---
DCP2	167227	broad.mit.edu	37	5	112316726	112316727	+	Intron	INS	-	T	T	rs148246563	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112316726_112316727insT	uc003kqh.2	+						DCP2_uc011cwa.1_Intron|DCP2_uc003kqg.2_Intron	NM_152624	NP_689837			DCP2 decapping enzyme						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus|RNA-induced silencing complex	exoribonuclease activity, producing 5'-phosphomonoesters|manganese ion binding|protein binding|protein binding|RNA binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	113669308	113669308	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113669308delA								YTHDC2 (738329 upstream) : KCNN2 (28708 downstream)																																			---	---	---	---
KCNN2	3781	broad.mit.edu	37	5	113698631	113698632	+	In_Frame_Ins	INS	-	GCC	GCC	rs151038013	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113698631_113698632insGCC	uc003kqo.2	+	1	616_617	c.159_160insGCC	c.(157-162)insGCC	p.58_59insA		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	58_59						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	114440915	114440915	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114440915delG								KCNN2 (608719 upstream) : TRIM36 (19552 downstream)																																			---	---	---	---
ZNF474	133923	broad.mit.edu	37	5	121487401	121487402	+	Intron	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121487401_121487402delTG	uc003ksv.2	+							NM_207317	NP_997200			zinc finger protein 474							intracellular	zinc ion binding				0		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	121553861	121553861	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121553861delT								ZNF474 (64604 upstream) : SNCAIP (93525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	121643065	121643066	+	IGR	INS	-	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121643065_121643066insG								ZNF474 (153808 upstream) : SNCAIP (4320 downstream)																																			---	---	---	---
PRDM6	93166	broad.mit.edu	37	5	122430128	122430129	+	Intron	DEL	TC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122430128_122430129delTC	uc003kti.2	+						PRDM6_uc003ktj.2_Intron	NM_001136239	NP_001129711			PR domain containing 6						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	126937884	126937885	+	IGR	INS	-	A	A	rs144970647	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126937884_126937885insA								PRRC1 (47106 upstream) : CTXN3 (46828 downstream)																																			---	---	---	---
FLJ33630	644873	broad.mit.edu	37	5	127308164	127308164	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127308164delC	uc003kun.2	-						FLJ33630_uc003kuo.2_Intron|FLJ33630_uc003kup.1_Intron|FLJ33630_uc003kuq.1_Intron					Homo sapiens full length insert cDNA clone ZD74E10.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	128508882	128508882	+	IGR	DEL	T	-	-	rs77607223		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128508882delT								ISOC1 (59165 upstream) : ADAMTS19 (287221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	134884331	134884359	+	IGR	DEL	GTGCTGGGGCCGTGGGGATGGAAGCCGTA	-	-	rs72229889		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134884331_134884359delGTGCTGGGGCCGTGGGGATGGAAGCCGTA								NEUROG1 (12692 upstream) : CXCL14 (22014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	134998391	134998392	+	IGR	INS	-	CCT	CCT	rs149172086	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134998391_134998392insCCT								LOC340074 (8767 upstream) : LOC153328 (171973 downstream)																																			---	---	---	---
TRPC7	57113	broad.mit.edu	37	5	135577251	135577251	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135577251delT	uc003lbn.1	-						TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_Intron|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122			transient receptor potential cation channel,						axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	137620089	137620089	+	IGR	DEL	T	-	-	rs71585115		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137620089delT								GFRA3 (9836 upstream) : CDC25C (870 downstream)																																			---	---	---	---
HSPA9	3313	broad.mit.edu	37	5	137908589	137908590	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137908589_137908590insT	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron	NM_004134	NP_004125			heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	138275912	138275913	+	IGR	INS	-	A	A	rs35601533		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138275912_138275913insA								CTNNA1 (5190 upstream) : SIL1 (6499 downstream)																																			---	---	---	---
MATR3	9782	broad.mit.edu	37	5	138662112	138662112	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138662112delT	uc003ldu.2	+						MATR3_uc003ldt.2_Intron|MATR3_uc003ldw.2_Intron|MATR3_uc003ldx.2_Intron|MATR3_uc010jfc.2_Intron|MATR3_uc011czb.1_Intron|MATR3_uc003ldz.2_Intron|MATR3_uc003lea.2_Intron|MATR3_uc003leb.2_Intron|MATR3_uc003lec.2_Intron	NM_199189	NP_954659			matrin 3							nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	145085503	145085504	+	IGR	DEL	AC	-	-	rs72277085		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145085503_145085504delAC								None (None upstream) : PRELID2 (53078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	145104722	145104726	+	IGR	DEL	AAGAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145104722_145104726delAAGAA								None (None upstream) : PRELID2 (33856 downstream)																																			---	---	---	---
SH3RF2	153769	broad.mit.edu	37	5	145349299	145349299	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145349299delA	uc003lnt.2	+						SH3RF2_uc011dbl.1_Intron	NM_152550	NP_689763			SH3 domain containing ring finger 2								ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
DPYSL3	1809	broad.mit.edu	37	5	146890298	146890299	+	5'Flank	INS	-	CACACA	CACACA	rs148067256	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146890298_146890299insCACACA	uc003loo.2	-							NM_001387	NP_001378			dihydropyrimidinase-like 3						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
MIR145	406937	broad.mit.edu	37	5	148808777	148808778	+	5'Flank	INS	-	A	A	rs147953922	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148808777_148808778insA	hsa-mir-145|MI0000461	+						LOC728264_uc003lqs.2_RNA|LOC728264_uc003lqp.2_RNA																	0																		---	---	---	---
TCOF1	6949	broad.mit.edu	37	5	149752288	149752288	+	Intron	DEL	G	-	-	rs67830955		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149752288delG	uc003lry.2	+						TCOF1_uc003lrw.2_Intron|TCOF1_uc011dch.1_Intron|TCOF1_uc003lrz.2_Intron|TCOF1_uc003lrx.2_Intron|TCOF1_uc003lsa.2_Intron|TCOF1_uc011dci.1_5'Flank	NM_001135243	NP_001128715			Treacher Collins-Franceschetti syndrome 1						skeletal system development	nucleolus	protein binding|transporter activity			ovary(2)|large_intestine(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	150613116	150613116	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150613116delG								CCDC69 (9462 upstream) : GM2A (19497 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	152469555	152469555	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152469555delG								NMUR2 (684715 upstream) : GRIA1 (399620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	153990422	153990422	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153990422delC								HAND1 (132598 upstream) : MIR1303 (74914 downstream)																																	OREG0016970	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
C5orf4	10826	broad.mit.edu	37	5	154218167	154218167	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154218167delT	uc003lvs.3	-						C5orf4_uc011dde.1_Intron	NM_032385	NP_115761			hypothetical protein LOC10826						fatty acid biosynthetic process	integral to membrane	iron ion binding|oxidoreductase activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	157940143	157940144	+	IGR	INS	-	AA	AA	rs150235265	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157940143_157940144insAA								CLINT1 (653975 upstream) : EBF1 (182780 downstream)																																			---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158315264	158315265	+	Intron	DEL	GT	-	-	rs151106797		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158315264_158315265delGT	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870			early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	5	158539317	158539317	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158539317delT	uc003lxm.1	+											Homo sapiens cDNA FLJ41549 fis, clone COLON1000084.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	163351339	163351340	+	IGR	INS	-	A	A	rs138282366	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163351339_163351340insA								MAT2B (405006 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165355493	165355493	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165355493delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	166019471	166019474	+	IGR	DEL	TGTG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166019471_166019474delTGTG								None (None upstream) : ODZ2 (692369 downstream)																																			---	---	---	---
SH3PXD2B	285590	broad.mit.edu	37	5	171829190	171829190	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171829190delG	uc003mbr.2	-						SH3PXD2B_uc003mbs.1_Intron	NM_001017995	NP_001017995			SH3 and PX domains 2B						adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
ATP6V0E1	8992	broad.mit.edu	37	5	172408367	172408370	+	5'Flank	DEL	AAAG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172408367_172408370delAAAG	uc003mcd.1	+							NM_003945	NP_003936			ATPase, H+ transporting, lysosomal 9kDa, V0						ATP hydrolysis coupled proton transport|cell growth|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport|vacuolar acidification	endosome membrane|integral to membrane|membrane fraction|proton-transporting V-type ATPase, V0 domain|vacuole	proton-transporting ATPase activity, rotational mechanism				0	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	172912080	172912081	+	IGR	INS	-	T	T	rs147209003	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172912080_172912081insT								STC2 (155574 upstream) : LOC285593 (94565 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	175354501	175354501	+	IGR	DEL	T	-	-	rs77936160		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175354501delT								CPLX2 (43478 upstream) : THOC3 (32035 downstream)																																			---	---	---	---
C5orf25	375484	broad.mit.edu	37	5	175743674	175743675	+	Intron	DEL	AA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175743674_175743675delAA	uc003mds.3	+						C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc003mdv.2_Intron					RecName: Full=Uncharacterized protein C5orf25;												0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	176230743	176230744	+	IGR	DEL	GT	-	-	rs77564373		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176230743_176230744delGT								TSPAN17 (144685 upstream) : UNC5A (6816 downstream)																																			---	---	---	---
C5orf45	51149	broad.mit.edu	37	5	179270082	179270089	+	Intron	DEL	GCAGGCAA	-	-	rs10608390		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179270082_179270089delGCAGGCAA	uc003mla.2	-						C5orf45_uc003mky.2_Intron|C5orf45_uc011dgt.1_Intron|C5orf45_uc011dgu.1_Intron|C5orf45_uc003mlc.2_Intron|C5orf45_uc003mlb.2_Intron	NM_016175	NP_057259			hypothetical protein LOC51149 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	180591954	180591954	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180591954delA								OR2V2 (9065 upstream) : TRIM7 (28970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23936901	23936901	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23936901delT								None (None upstream) : NRSN1 (189513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40578840	40578840	+	IGR	DEL	T	-	-	rs66598969		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40578840delT								LRFN2 (23714 upstream) : UNC5CL (415932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	48618787	48618787	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48618787delA								C6orf138 (539844 upstream) : MUT (780207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	50948615	50948620	+	IGR	DEL	TGCGTG	-	-	rs71681963		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50948615_50948620delTGCGTG								TFAP2B (133290 upstream) : PKHD1 (531525 downstream)																																			---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51846287	51846287	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51846287delT	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639			fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	53288592	53288593	+	IGR	INS	-	TCTT	TCTT	rs137877090	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53288592_53288593insTCTT								ELOVL5 (74650 upstream) : GCLC (73547 downstream)																																			---	---	---	---
LRRC1	55227	broad.mit.edu	37	6	53787794	53787794	+	3'UTR	DEL	T	-	-	rs67155925		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53787794delT	uc003pcd.1	+	14						NM_018214	NP_060684			leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57503574	57503575	+	Intron	INS	-	A	A	rs150588289		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57503574_57503575insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57554978	57554979	+	IGR	INS	-	AC	AC	rs146629400		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57554978_57554979insAC								PRIM2 (41603 upstream) : GUSBL2 (691180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57595232	57595232	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57595232delG								PRIM2 (81857 upstream) : GUSBL2 (650927 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57604394	57604395	+	IGR	INS	-	C	C	rs141266160	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57604394_57604395insC								PRIM2 (91019 upstream) : GUSBL2 (641764 downstream)																																			---	---	---	---
RNGTT	8732	broad.mit.edu	37	6	89435668	89435669	+	Intron	DEL	GA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89435668_89435669delGA	uc003pmr.2	-						RNGTT_uc003pms.2_Intron|RNGTT_uc011dzu.1_Intron|RNGTT_uc003pmt.2_Intron	NM_003800	NP_003791			RNA guanylyltransferase and 5'-phosphatase						interspecies interaction between organisms|mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	GTP binding|mRNA guanylyltransferase activity|polynucleotide 5'-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)														---	---	---	---
GABRR1	2569	broad.mit.edu	37	6	89928537	89928537	+	5'Flank	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89928537delT	uc003pna.2	-						GABRR1_uc011dzv.1_5'Flank|GABRR1_uc011dzw.1_5'Flank	NM_002042	NP_002033			gamma-aminobutyric acid (GABA) receptor, rho 1						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)													---	---	---	---
SOBP	55084	broad.mit.edu	37	6	107863971	107863971	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107863971delT	uc003prx.2	+						SOBP_uc003prw.1_Intron	NM_018013	NP_060483			sine oculis binding protein homolog								metal ion binding			ovary(1)	1		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)														---	---	---	---
HS3ST5	222537	broad.mit.edu	37	6	114405998	114405998	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114405998delT	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840			heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124633797	124633797	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124633797delT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	131449174	131449174	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131449174delG								EPB41L2 (64712 upstream) : AKAP7 (7697 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	132922084	132922091	+	IGR	DEL	GAAAGAAA	-	-	rs140286386		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132922084_132922091delGAAAGAAA								TAAR5 (11207 upstream) : TAAR2 (16198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	135203173	135203174	+	IGR	DEL	AC	-	-	rs66657528		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135203173_135203174delAC								SGK1 (563977 upstream) : ALDH8A1 (35355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	147806350	147806350	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147806350delA								STXBP5 (97643 upstream) : SAMD5 (23713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	166176310	166176310	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166176310delC								PDE10A (100726 upstream) : C6orf176 (161226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	169399325	169399325	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169399325delT								SMOC2 (330654 upstream) : THBS2 (216551 downstream)																																			---	---	---	---
FAM20C	56975	broad.mit.edu	37	7	291486	291486	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:291486delA	uc003sip.2	+						FAM20C_uc011jvn.1_Intron	NM_020223	NP_064608			family with sequence similarity 20, member C							extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)														---	---	---	---
PRKAR1B	5575	broad.mit.edu	37	7	590284	590285	+	Intron	INS	-	GGC	GGC	rs72152929		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:590284_590285insGGC	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726			protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	1358698	1358699	+	IGR	DEL	AT	-	-	rs111662921		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1358698_1358699delAT								UNCX (82086 upstream) : MICALL2 (115297 downstream)																																			---	---	---	---
CARD11	84433	broad.mit.edu	37	7	2996974	2996974	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2996974delC	uc003smv.2	-							NM_032415	NP_115791			caspase recruitment domain family, member 11						positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)				Mis		DLBCL								---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3921979	3921979	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3921979delA	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4492888	4492889	+	IGR	DEL	GA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4492888_4492889delGA								SDK1 (184259 upstream) : FOXK1 (190499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	5113670	5113670	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5113670delT								LOC389458 (817 upstream) : WIPI2 (116165 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	5213484	5213484	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5213484delA								LOC389458 (100631 upstream) : WIPI2 (16351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	6444501	6444502	+	IGR	DEL	TT	-	-	rs139644356		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6444501_6444502delTT								RAC1 (904 upstream) : DAGLB (4246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	9060078	9060078	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9060078delC								NXPH1 (267486 upstream) : PER4 (613822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	20997812	20997813	+	IGR	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20997812_20997813delAG								RPL23P8 (130373 upstream) : SP4 (469876 downstream)																																			---	---	---	---
STK31	56164	broad.mit.edu	37	7	23844701	23844701	+	Intron	DEL	T	-	-	rs66605281		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23844701delT	uc003sws.3	+						STK31_uc003swt.3_Intron|STK31_uc011jze.1_Intron|STK31_uc010kuq.2_Intron|STK31_uc003swv.1_Intron	NM_031414	NP_113602			serine/threonine kinase 31 isoform a								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9																		---	---	---	---
FAM188B	84182	broad.mit.edu	37	7	30862427	30862427	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30862427delT	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron	NM_032222	NP_115598			hypothetical protein LOC84182												0																		---	---	---	---
PDE1C	5137	broad.mit.edu	37	7	32140607	32140608	+	Intron	INS	-	TGA	TGA	rs150760807	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32140607_32140608insTGA	uc003tco.1	-							NM_005020	NP_005011			phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	36345529	36345530	+	IGR	DEL	GA	-	-	rs34809446		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36345529_36345530delGA								EEPD1 (4378 upstream) : KIAA0895 (18229 downstream)																																			---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40347414	40347415	+	Intron	INS	-	T	T	rs77731915		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40347414_40347415insT	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	46904638	46904638	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46904638delA								IGFBP3 (943767 upstream) : TNS3 (410115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	47000456	47000457	+	IGR	INS	-	A	A	rs111568976		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47000456_47000457insA								None (None upstream) : TNS3 (314296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	47678567	47678567	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47678567delT								TNS3 (56825 upstream) : C7orf65 (16275 downstream)																																			---	---	---	---
PKD1L1	168507	broad.mit.edu	37	7	47921880	47921881	+	Intron	INS	-	TCCC	TCCC	rs142686062	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47921880_47921881insTCCC	uc003tny.1	-							NM_138295	NP_612152			polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11																		---	---	---	---
SUN3	256979	broad.mit.edu	37	7	48071430	48071433	+	5'Flank	DEL	CACA	-	-	rs111523679		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48071430_48071433delCACA	uc003tof.2	-						SUN3_uc003tog.2_5'Flank|SUN3_uc011kcf.1_5'Flank	NM_152782	NP_689995			Sad1 and UNC84 domain containing 1							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	48813713	48813713	+	IGR	DEL	G	-	-	rs5884061		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48813713delG								ABCA13 (126622 upstream) : CDC14C (150444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53032172	53032175	+	IGR	DEL	AAAC	-	-	rs111442434		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53032172_53032175delAAAC								None (None upstream) : POM121L12 (71174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53192852	53192853	+	IGR	INS	-	A	A	rs148263373	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53192852_53192853insA								POM121L12 (88235 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53514538	53514539	+	IGR	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53514538_53514539delAG								POM121L12 (409921 upstream) : HPVC1 (754378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54356644	54356646	+	IGR	DEL	CAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54356644_54356646delCAA								HPVC1 (86530 upstream) : VSTM2A (253373 downstream)																																			---	---	---	---
PSPH	5723	broad.mit.edu	37	7	56168171	56168172	+	Intron	INS	-	A	A	rs144873946	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56168171_56168172insA	uc003trj.2	-							NM_004577	NP_004568			phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	57613728	57613728	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57613728delT								ZNF716 (80463 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57651750	57651751	+	IGR	INS	-	T	T	rs148924254		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57651750_57651751insT								ZNF716 (118485 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57651752	57651753	+	IGR	INS	-	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57651752_57651753insG								ZNF716 (118487 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57712123	57712123	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57712123delA								ZNF716 (178858 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57774941	57774942	+	IGR	DEL	CA	-	-	rs4103218	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57774941_57774942delCA								ZNF716 (241676 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57922739	57922740	+	IGR	DEL	AT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57922739_57922740delAT								ZNF716 (389474 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61800253	61800254	+	IGR	INS	-	AAT	AAT	rs62455156	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61800253_61800254insAAT								None (None upstream) : LOC643955 (951418 downstream)																																	OREG0007430	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	---	---	---	---
Unknown	0	broad.mit.edu	37	7	61816451	61816452	+	IGR	INS	-	A	A	rs56129720		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61816451_61816452insA								None (None upstream) : LOC643955 (935220 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65264574	65264574	+	IGR	DEL	T	-	-	rs111238827		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65264574delT								CCT6P1 (35913 upstream) : VKORC1L1 (73683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	69051524	69051525	+	IGR	INS	-	TG	TG			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69051524_69051525insTG								None (None upstream) : AUTS2 (12380 downstream)																																			---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	70738862	70738865	+	Intron	DEL	AGAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70738862_70738865delAGAA	uc003tvy.2	+							NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	70936042	70936042	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70936042delT	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	72842631	72842632	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72842631_72842632delAC								FKBP6 (69990 upstream) : FZD9 (5477 downstream)																																			---	---	---	---
WBSCR22	114049	broad.mit.edu	37	7	73103390	73103390	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73103390delT	uc003tyt.2	+						WBSCR22_uc010lbi.1_Intron|WBSCR22_uc003tyu.2_Intron|WBSCR22_uc003tyv.2_Intron|WBSCR22_uc003tyw.1_Intron	NM_017528	NP_059998			Williams Beuren syndrome chromosome region 22							nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)																---	---	---	---
MDH2	4191	broad.mit.edu	37	7	75681886	75681887	+	Intron	INS	-	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75681886_75681887insC	uc003ueo.2	+						MDH2_uc003uep.2_Intron|MDH2_uc011kgh.1_Intron	NM_005918	NP_005909			mitochondrial malate dehydrogenase precursor						gluconeogenesis|malate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus|plasma membrane	binding|L-malate dehydrogenase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					NADH(DB00157)													---	---	---	---
PHTF2	57157	broad.mit.edu	37	7	77576276	77576276	+	Intron	DEL	A	-	-	rs113457897		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77576276delA	uc003ugs.3	+						PHTF2_uc003ugq.3_Intron|PHTF2_uc010ldv.2_Intron|PHTF2_uc003ugt.3_Intron|PHTF2_uc003ugu.3_Intron	NM_001127357	NP_001120829			putative homeodomain transcription factor 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleus	DNA binding			ovary(1)	1																		---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	77673996	77673997	+	Intron	DEL	GT	-	-	rs113067527		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77673996_77673997delGT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	82167786	82167787	+	IGR	DEL	GA	-	-	rs34975897		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82167786_82167787delGA								CACNA2D1 (94755 upstream) : PCLO (215534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85148269	85148272	+	IGR	DEL	TTTG	-	-	rs71954317		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85148269_85148272delTTTG								SEMA3D (332098 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89218494	89218494	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89218494delT								ZNF804B (252150 upstream) : DPY19L2P4 (530220 downstream)																																			---	---	---	---
GNGT1	2792	broad.mit.edu	37	7	93388342	93388343	+	Intron	INS	-	AC	AC	rs138257011	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93388342_93388343insAC	uc003umx.1	+											Homo sapiens guanine nucleotide binding protein gamma 1 (GNG1) mRNA, complete cds.						G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	94498124	94498124	+	IGR	DEL	G	-	-	rs35957095		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94498124delG								PEG10 (199120 upstream) : PPP1R9A (38825 downstream)																																			---	---	---	---
PPP1R9A	55607	broad.mit.edu	37	7	94734290	94734291	+	Intron	INS	-	C	C	rs147344017	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94734290_94734291insC	uc003unp.2	+						PPP1R9A_uc010lfj.2_Intron|PPP1R9A_uc011kif.1_Intron|PPP1R9A_uc003unq.2_Intron|PPP1R9A_uc011kig.1_Intron	NM_017650	NP_060120			protein phosphatase 1, regulatory (inhibitor)							cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)												HNSCC(28;0.073)			---	---	---	---
DYNC1I1	1780	broad.mit.edu	37	7	95661809	95661809	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95661809delT	uc003uoc.3	+						DYNC1I1_uc003uod.3_Intron|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Intron	NM_004411	NP_004402			dynein, cytoplasmic 1, intermediate chain 1						vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	96187835	96187835	+	IGR	DEL	G	-	-	rs66910207		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96187835delG								SLC25A13 (236376 upstream) : SHFM1 (114402 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	96665225	96665228	+	IGR	DEL	GTGT	-	-	rs35074400		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96665225_96665228delGTGT								DLX5 (11082 upstream) : ACN9 (80677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97263475	97263478	+	IGR	DEL	CAAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97263475_97263478delCAAA								ACN9 (452402 upstream) : TAC1 (97793 downstream)																																			---	---	---	---
LMTK2	22853	broad.mit.edu	37	7	97752029	97752044	+	Intron	DEL	TGTGTGTGTGTATATA	-	-	rs58400468	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97752029_97752044delTGTGTGTGTGTATATA	uc003upd.1	+							NM_014916	NP_055731			lemur tyrosine kinase 2 precursor						early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)																	---	---	---	---
LMTK2	22853	broad.mit.edu	37	7	97772380	97772381	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97772380_97772381insA	uc003upd.1	+							NM_014916	NP_055731			lemur tyrosine kinase 2 precursor						early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)																	---	---	---	---
TRIM4	89122	broad.mit.edu	37	7	99519933	99519934	+	5'Flank	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99519933_99519934delAC	uc003usd.2	-						TRIM4_uc003use.2_5'Flank|TRIM4_uc011kjc.1_5'Flank|TRIM4_uc003usf.2_5'Flank	NM_033017	NP_148977			tripartite motif protein TRIM4 isoform alpha						protein trimerization	cytoplasm|plasma membrane	zinc ion binding			ovary(1)|kidney(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)																---	---	---	---
RELN	5649	broad.mit.edu	37	7	103157625	103157625	+	Intron	DEL	T	-	-	rs35531504		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103157625delT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	103730429	103730429	+	IGR	DEL	A	-	-	rs35542904		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103730429delA								RELN (100466 upstream) : ORC5L (36361 downstream)																																			---	---	---	---
CDHR3	222256	broad.mit.edu	37	7	105534989	105534989	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105534989delT	uc003vdk.2	+											RecName: Full=Cadherin-like protein 28; Flags: Precursor;						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1																		---	---	---	---
CDHR3	222256	broad.mit.edu	37	7	105544909	105544909	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105544909delT	uc003vdk.2	+											RecName: Full=Cadherin-like protein 28; Flags: Precursor;						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	106140414	106140414	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106140414delT	uc003vds.2	-											Homo sapiens full length insert cDNA clone ZC44D09.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	108479819	108479819	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108479819delA								DNAJB9 (264527 upstream) : C7orf66 (44221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	108683670	108683671	+	IGR	INS	-	A	A	rs76212055		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108683670_108683671insA								C7orf66 (159033 upstream) : EIF3IP1 (915613 downstream)																																			---	---	---	---
IMMP2L	83943	broad.mit.edu	37	7	110661940	110661943	+	Intron	DEL	AAAC	-	-	rs151201472		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110661940_110661943delAAAC	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938			IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)														---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111566573	111566576	+	Intron	DEL	AAAG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111566573_111566576delAAAG	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	112216517	112216518	+	IGR	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112216517_112216518delAG								C7orf53 (85582 upstream) : TMEM168 (189271 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	112824137	112824137	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112824137delA								LOC401397 (65500 upstream) : PPP1R3A (692745 downstream)																																			---	---	---	---
TFEC	22797	broad.mit.edu	37	7	115735803	115735804	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115735803_115735804insT	uc011kmw.1	-											SubName: Full=cDNA FLJ55256, highly similar to Homo sapiens transcription factor EC (TFEC), transcript variant 1, mRNA;							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	119907416	119907416	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119907416delG								None (None upstream) : KCND2 (6306 downstream)																																			---	---	---	---
RBM28	55131	broad.mit.edu	37	7	127969461	127969461	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127969461delT	uc003vmp.2	-						RBM28_uc003vmo.2_Intron|RBM28_uc011koj.1_Intron|RBM28_uc011kok.1_Intron	NM_018077	NP_060547			RNA binding motif protein 28						mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	129206952	129206952	+	IGR	DEL	A	-	-	rs35316126		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129206952delA								FAM40B (78715 upstream) : NRF1 (44603 downstream)																																			---	---	---	---
CPA5	93979	broad.mit.edu	37	7	129983110	129983113	+	5'Flank	DEL	TCCT	-	-	rs10534130		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129983110_129983113delTCCT	uc010lmd.1	+						CPA5_uc003vps.2_5'Flank|CPA5_uc003vpt.2_5'Flank|CPA5_uc010lme.1_5'Flank|CPA5_uc003vpu.1_5'Flank	NM_001127441	NP_001120913			carboxypeptidase A5 isoform 1						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	131271576	131271577	+	IGR	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131271576_131271577delTG								PODXL (30200 upstream) : PLXNA4 (536515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	131339016	131339017	+	IGR	DEL	TG	-	-	rs137971941		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131339016_131339017delTG								PODXL (97640 upstream) : PLXNA4 (469075 downstream)																																			---	---	---	---
CHRM2	1129	broad.mit.edu	37	7	136564793	136564794	+	Intron	INS	-	T	T	rs11373690		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136564793_136564794insT	uc003vtf.1	+						CHRM2_uc003vtg.1_Intron|CHRM2_uc003vtj.1_Intron|CHRM2_uc003vtk.1_Intron|CHRM2_uc003vtl.1_Intron|CHRM2_uc003vtm.1_Intron|CHRM2_uc003vti.1_Intron|CHRM2_uc003vto.1_Intron|CHRM2_uc003vtn.1_Intron	NM_001006630	NP_001006631			cholinergic receptor, muscarinic 2						activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)													---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137478045	137478045	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137478045delT	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708			diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
CREB3L2	64764	broad.mit.edu	37	7	137629814	137629814	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137629814delT	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vty.3_Intron	NM_194071	NP_919047			cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160								T	FUS	fibromyxoid sarcoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	139907148	139907148	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139907148delT								LOC100134229 (27709 upstream) : SLC37A3 (126406 downstream)																																			---	---	---	---
BRAF	673	broad.mit.edu	37	7	140516776	140516776	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140516776delA	uc003vwc.3	-							NM_004333	NP_004324			B-Raf						activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				---	---	---	---
BRAF	673	broad.mit.edu	37	7	140533838	140533838	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140533838delG	uc003vwc.3	-							NM_004333	NP_004324			B-Raf						activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	140739670	140739675	+	IGR	DEL	GTGAGT	-	-	rs67484622		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140739670_140739675delGTGAGT								MRPS33 (24889 upstream) : AGK (511403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	143733106	143733106	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143733106delA								OR6B1 (31081 upstream) : OR2A5 (14389 downstream)																																			---	---	---	---
TPK1	27010	broad.mit.edu	37	7	144356825	144356826	+	Intron	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144356825_144356826delGT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890			thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)													---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	148064332	148064332	+	Intron	DEL	T	-	-	rs1637865	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148064332delT	uc003weu.1	+						CNTNAP2_uc003wev.1_Intron	NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
XRCC2	7516	broad.mit.edu	37	7	152345514	152345514	+	3'UTR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152345514delG	uc003wld.2	-	3						NM_005431	NP_005422			X-ray repair cross complementing protein 2						meiosis	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity			breast(1)|liver(1)	2		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)									Homologous_recombination					---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157432387	157432387	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157432387delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158041453	158041454	+	Intron	DEL	AT	-	-	rs34204199		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158041453_158041454delAT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158184819	158184819	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158184819delG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	158791139	158791139	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158791139delC								WDR60 (52257 upstream) : LOC154822 (9906 downstream)																																			---	---	---	---
SLC7A2	6542	broad.mit.edu	37	8	17419690	17419708	+	Intron	DEL	TTTTTTTTTTTTTTTTTTT	-	-	rs71894772		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17419690_17419708delTTTTTTTTTTTTTTTTTTT	uc011kyc.1	+						SLC7A2_uc011kyd.1_Intron|SLC7A2_uc011kye.1_Intron|SLC7A2_uc011kyf.1_Intron	NM_001008539	NP_001008539			solute carrier family 7, member 2 isoform 2						cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	61050849	61050850	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61050849_61050850insA								None (None upstream) : CA8 (50573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	111814877	111814878	+	IGR	DEL	CT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111814877_111814878delCT								KCNV1 (826801 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	112879138	112879138	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112879138delA								None (None upstream) : CSMD3 (356023 downstream)																																			---	---	---	---
MRPL13	28998	broad.mit.edu	37	8	121411176	121411177	+	Intron	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121411176_121411177delAC	uc003ypa.2	-						MRPL13_uc010mdf.2_Intron	NM_014078	NP_054797			mitochondrial ribosomal protein L13						translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome			central_nervous_system(1)	1	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
KANK1	23189	broad.mit.edu	37	9	481295	481296	+	Intron	INS	-	A	A	rs145031920	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:481295_481296insA	uc003zgl.1	+							NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
VLDLR	7436	broad.mit.edu	37	9	2634461	2634461	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2634461delT	uc003zhk.1	+						VLDLR_uc003zhl.1_Intron|VLDLR_uc003zhm.1_Intron|VLDLR_uc003zhn.1_Intron	NM_003383	NP_003374			very low density lipoprotein receptor isoform a						cholesterol metabolic process|endocytosis|lipid transport|memory|very-low-density lipoprotein particle clearance	coated pit|integral to membrane|membrane fraction|plasma membrane|very-low-density lipoprotein particle	apolipoprotein binding|calcium ion binding|low-density lipoprotein receptor activity|very-low-density lipoprotein particle receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	3759793	3759794	+	IGR	INS	-	T	T	rs150204624	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3759793_3759794insT								RFX3 (233810 upstream) : GLIS3 (64334 downstream)																																			---	---	---	---
CD274	29126	broad.mit.edu	37	9	5454413	5454414	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5454413_5454414insT	uc003zje.2	+						C9orf46_uc003zjd.2_Intron|CD274_uc011lmb.1_Intron|CD274_uc010mhn.2_5'Flank|CD274_uc003zjf.2_5'Flank	NM_014143	NP_054862			CD274 molecule precursor						cell proliferation|cell surface receptor linked signaling pathway|immune response|T cell costimulation	endomembrane system|integral to membrane	receptor activity			lung(1)|central_nervous_system(1)	2	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)				T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
Unknown	0	broad.mit.edu	37	9	7205371	7205375	+	IGR	DEL	GGGGG	-	-	rs112239541		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7205371_7205375delGGGGG								KDM4C (29724 upstream) : C9orf123 (591118 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8771820	8771820	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8771820delA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13717561	13717562	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13717561_13717562insA								MPDZ (437998 upstream) : NFIB (364286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13861162	13861162	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13861162delT								MPDZ (581599 upstream) : NFIB (220686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	16010668	16010668	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16010668delC								C9orf93 (38773 upstream) : BNC2 (398834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	18281100	18281100	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18281100delA								SH3GL2 (483980 upstream) : ADAMTSL1 (193004 downstream)																																			---	---	---	---
ELAVL2	1993	broad.mit.edu	37	9	23783791	23783791	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23783791delA	uc003zpu.2	-						ELAVL2_uc003zps.2_Intron|ELAVL2_uc003zpt.2_Intron|ELAVL2_uc003zpv.2_Intron|ELAVL2_uc003zpw.2_Intron	NM_004432	NP_004423			ELAV (embryonic lethal, abnormal vision,						regulation of transcription, DNA-dependent		mRNA 3'-UTR binding|nucleotide binding|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	25501904	25501905	+	IGR	INS	-	G	G	rs140437425	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25501904_25501905insG								None (None upstream) : TUSC1 (174489 downstream)																																			---	---	---	---
TEK	7010	broad.mit.edu	37	9	27203554	27203555	+	Intron	INS	-	TAGGTC	TAGGTC	rs144615069	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27203554_27203555insTAGGTC	uc003zqi.3	+						TEK_uc011lno.1_Intron|TEK_uc011lnp.1_Intron|TEK_uc003zqj.1_Intron	NM_000459	NP_000450			TEK tyrosine kinase, endothelial precursor						angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)														---	---	---	---
C9orf11	54586	broad.mit.edu	37	9	27291192	27291193	+	Intron	INS	-	T	T	rs138227130	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27291192_27291193insT	uc003zql.2	-						C9orf11_uc011lnq.1_Intron	NM_020641	NP_065692			Acr formation associated factor isoform 1							acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)														---	---	---	---
MOBKL2B	79817	broad.mit.edu	37	9	27513918	27513924	+	Intron	DEL	GATGGAT	-	-	rs11279544		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27513918_27513924delGATGGAT	uc003zqn.2	-							NM_024761	NP_079037			MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	29534445	29534446	+	IGR	INS	-	A	A	rs114378113	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29534445_29534446insA								MIR873 (645492 upstream) : None (None downstream)																																			---	---	---	---
UBAP1	51271	broad.mit.edu	37	9	34210579	34210581	+	Intron	DEL	TGG	-	-	rs10580858		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34210579_34210581delTGG	uc003ztx.2	+						UBAP1_uc010mka.1_Intron|UBAP1_uc003zty.2_Intron|UBAP1_uc011loi.1_Intron|UBAP1_uc011loj.1_Intron	NM_016525	NP_057609			ubiquitin associated protein 1							cytoplasm					0			LUSC - Lung squamous cell carcinoma(29;0.00272)															---	---	---	---
KIAA1539	80256	broad.mit.edu	37	9	35114499	35114499	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35114499delC	uc003zwo.2	-						KIAA1539_uc003zwm.2_5'Flank|KIAA1539_uc003zwn.2_Intron|KIAA1539_uc003zwp.1_Intron|KIAA1539_uc010mkk.1_Intron	NM_025182	NP_079458			hypothetical protein LOC80256							nucleus				ovary(2)	2	all_epithelial(49;0.217)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)															---	---	---	---
RUSC2	9853	broad.mit.edu	37	9	35539569	35539576	+	Intron	DEL	CATGCATG	-	-	rs113956351		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35539569_35539576delCATGCATG	uc003zww.2	+						RUSC2_uc010mkq.2_Intron|RUSC2_uc003zwx.3_Intron	NM_014806	NP_055621			RUN and SH3 domain containing 2							cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	36772535	36772535	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36772535delA								MELK (94857 upstream) : PAX5 (65996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	38569472	38569473	+	Intron	DEL	AG	-	-	rs112902043		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38569472_38569473delAG	uc004abb.1	-						uc010mmc.1_Intron|uc010mmd.1_Intron|uc004abd.1_5'Flank|uc004abe.1_5'Flank					Homo sapiens mRNA for KIAA2015 protein.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	44058365	44058373	+	IGR	DEL	CCTATGAGT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44058365_44058373delCCTATGAGT								FAM75A6 (427635 upstream) : FAM27C (931863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	44890451	44890452	+	IGR	DEL	AC	-	-	rs111482954		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44890451_44890452delAC								None (None upstream) : FAM27C (99784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66711482	66711483	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66711482_66711483insT								LOC442421 (208455 upstream) : AQP7P1 (542784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66736654	66736655	+	IGR	INS	-	T	T	rs150571010	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66736654_66736655insT								LOC442421 (233627 upstream) : AQP7P1 (517612 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68430746	68430746	+	IGR	DEL	T	-	-	rs113456947		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430746delT								FAM27B (636557 upstream) : MIR1299 (571493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68504920	68504921	+	IGR	INS	-	TT	TT	rs139625679		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68504920_68504921insTT								FAM27B (710731 upstream) : MIR1299 (497318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69823054	69823057	+	IGR	DEL	CCTG	-	-	rs142790503	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69823054_69823057delCCTG								LOC100133920 (158105 upstream) : FOXD4L5 (352652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	74236222	74236222	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74236222delC								TRPM3 (174402 upstream) : TMEM2 (62060 downstream)																																			---	---	---	---
GDA	9615	broad.mit.edu	37	9	74831595	74831596	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74831595_74831596insT	uc004aiq.2	+						GDA_uc011lse.1_Intron|GDA_uc011lsf.1_Intron|GDA_uc004air.2_Intron|GDA_uc010mow.1_Intron|GDA_uc004ais.2_Intron|GDA_uc004ait.1_Intron	NM_004293	NP_004284			guanine deaminase						nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	76586915	76586916	+	IGR	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76586915_76586916delGT								ANXA1 (801608 upstream) : RORB (525336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	77871069	77871070	+	IGR	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77871069_77871070delTG								OSTF1 (108956 upstream) : PCSK5 (634490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	81374994	81374994	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81374994delA								PSAT1 (429987 upstream) : TLE4 (811884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83143507	83143508	+	IGR	INS	-	G	G	rs150806834	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83143507_83143508insG								TLE4 (801850 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84016034	84016035	+	IGR	INS	-	T	T	rs138699461	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84016034_84016035insT								None (None upstream) : TLE1 (182565 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84096030	84096031	+	IGR	INS	-	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84096030_84096031insC								None (None upstream) : TLE1 (102569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84784063	84784063	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84784063delC								FLJ46321 (173893 upstream) : RASEF (813254 downstream)																																			---	---	---	---
GKAP1	80318	broad.mit.edu	37	9	86385477	86385478	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86385477_86385478insT	uc004amy.2	-						GKAP1_uc004amz.2_Intron|GKAP1_uc011lsu.1_Intron	NM_025211	NP_079487			G kinase anchoring protein 1 isoform a						signal transduction	Golgi apparatus					0																		---	---	---	---
NTRK2	4915	broad.mit.edu	37	9	87457077	87457077	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87457077delA	uc004aoa.1	+						NTRK2_uc004any.1_Intron|NTRK2_uc004anz.1_Intron|NTRK2_uc011lsz.1_Intron|NTRK2_uc011lta.1_Intron|NTRK2_uc004aoc.2_Intron	NM_001018064	NP_001018074			neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16															TSP Lung(25;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	87974605	87974605	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87974605delC								NTRK2 (336100 upstream) : AGTPBP1 (186850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89986066	89986067	+	IGR	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89986066_89986067delCA								C9orf170 (211425 upstream) : DAPK1 (126591 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	90942104	90942104	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90942104delA								CDK20 (352437 upstream) : SPIN1 (60736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91860846	91860847	+	IGR	INS	-	A	A	rs34023255		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91860846_91860847insA								SHC3 (67164 upstream) : CKS2 (65266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	92927776	92927777	+	IGR	DEL	GT	-	-	rs394411		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92927776_92927777delGT								LOC100129066 (593102 upstream) : DIRAS2 (444337 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	93901026	93901026	+	IGR	DEL	T	-	-	rs34569098		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93901026delT								SYK (240193 upstream) : AUH (75073 downstream)																																			---	---	---	---
GRIN3A	116443	broad.mit.edu	37	9	104446400	104446401	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104446400_104446401insT	uc004bbp.1	-						GRIN3A_uc004bbq.1_Intron	NM_133445	NP_597702			glutamate receptor, ionotropic,						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	107397148	107397148	+	IGR	DEL	A	-	-	rs34833723		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107397148delA								OR13C9 (16663 upstream) : OR13D1 (59555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	110200134	110200134	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110200134delA								RAD23B (105665 upstream) : KLF4 (47001 downstream)																																			---	---	---	---
C9orf5	23731	broad.mit.edu	37	9	111860834	111860835	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111860834_111860835insA	uc004bdt.3	-						C9orf5_uc004bds.3_Intron|C9orf5_uc004bdr.3_Intron	NM_032012	NP_114401			hypothetical protein LOC23731							integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	115851573	115851574	+	IGR	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115851573_115851574delTG								ZFP37 (32577 upstream) : C9orf110 (15432 downstream)																																			---	---	---	---
BSPRY	54836	broad.mit.edu	37	9	116114761	116114762	+	Intron	DEL	AC	-	-	rs72349955		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116114761_116114762delAC	uc004bhg.3	+						BSPRY_uc010muw.2_Intron	NM_017688	NP_060158			B-box and SPRY domain containing						calcium ion transport	cytoplasm|membrane	zinc ion binding			breast(1)	1																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119264420	119264421	+	Intron	INS	-	TGTG	TGTG	rs142464736	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119264420_119264421insTGTG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_Intron|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_Intron|uc004bju.1_5'Flank	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119310385	119310386	+	Intron	INS	-	TGTT	TGTT	rs142574000	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119310385_119310386insTGTT	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_Intron|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_Intron|uc004bju.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119870717	119870718	+	Intron	INS	-	ACAC	ACAC	rs138848508	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119870717_119870718insACAC	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	122259677	122259678	+	IGR	DEL	AA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122259677_122259678delAA								DBC1 (127938 upstream) : MIR147 (747579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	122754515	122754516	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122754515_122754516delAC								DBC1 (622776 upstream) : MIR147 (252741 downstream)																																			---	---	---	---
DAB2IP	153090	broad.mit.edu	37	9	124438915	124438916	+	Intron	DEL	CA	-	-	rs35324441		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124438915_124438916delCA	uc004bln.2	+							NM_032552	NP_115941			disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128747566	128747567	+	IGR	INS	-	ACT	ACT			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128747566_128747567insACT								PBX3 (17913 upstream) : FAM125B (341561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	128853019	128853020	+	IGR	INS	-	G	G	rs150890282	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128853019_128853020insG								PBX3 (123366 upstream) : FAM125B (236108 downstream)																																			---	---	---	---
RAPGEF1	2889	broad.mit.edu	37	9	134591251	134591261	+	Intron	DEL	AAAAAAAAAAA	-	-	rs145340457		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134591251_134591261delAAAAAAAAAAA	uc004cbc.2	-						RAPGEF1_uc010mzn.2_Intron|RAPGEF1_uc004cbd.2_Intron	NM_005312	NP_005303			guanine nucleotide-releasing factor 2 isoform a						activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	134711486	134711486	+	IGR	DEL	T	-	-	rs68021002		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134711486delT								RAPGEF1 (96269 upstream) : MED27 (24013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	135565828	135565830	+	IGR	DEL	AAA	-	-	rs35810017		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135565828_135565830delAAA								GTF3C4 (360 upstream) : C9orf98 (35135 downstream)																																			---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137577464	137577466	+	Intron	DEL	CCA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137577464_137577466delCCA	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138225446	138225448	+	IGR	DEL	TGG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138225446_138225448delTGG								OLFM1 (212415 upstream) : KIAA0649 (146200 downstream)																																			---	---	---	---
PAEP	5047	broad.mit.edu	37	9	138457901	138457901	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138457901delT	uc004cge.1	+						PAEP_uc004cgd.1_Intron|PAEP_uc011mdp.1_Intron|PAEP_uc004cgg.1_Intron|PAEP_uc010nbc.1_Intron|PAEP_uc004cgf.1_Intron	NM_001018049	NP_001018059			glycodelin precursor						multicellular organismal development	extracellular region	binding|transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138502082	138502087	+	IGR	DEL	AGAGAC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138502082_138502087delAGAGAC								PAEP (43460 upstream) : GLT6D1 (13415 downstream)																																			---	---	---	---
LOC26102	26102	broad.mit.edu	37	9	139217921	139217922	+	3'UTR	INS	-	TG	TG	rs142187889	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139217921_139217922insTG	uc011mdt.1	-	1						NR_026964				Homo sapiens cDNA FLJ45830 fis, clone NT2RP8006521.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	139628989	139628989	+	IGR	DEL	C	-	-	rs1832148	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139628989delC								SNHG7 (6353 upstream) : LCN10 (3639 downstream)																																			---	---	---	---
C9orf139	401563	broad.mit.edu	37	9	139924507	139924507	+	Intron	DEL	C	-	-	rs75467572		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139924507delC	uc004ckp.1	+						ABCA2_uc011mel.1_5'Flank|ABCA2_uc011mem.1_5'Flank|ABCA2_uc004ckl.1_5'Flank|ABCA2_uc004ckm.1_5'Flank	NM_207511	NP_997394			hypothetical protein LOC401563												0	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)												OREG0019625	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EHMT1	79813	broad.mit.edu	37	9	140563888	140563888	+	Intron	DEL	G	-	-	rs60732108		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140563888delG	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033			euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)														---	---	---	---
CACNA1B	774	broad.mit.edu	37	9	140968697	140968697	+	Intron	DEL	T	-	-	rs78547363		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140968697delT	uc004cog.2	+						CACNA1B_uc004coi.2_Intron|CACNA1B_uc004cok.1_5'Flank|CACNA1B_uc010ncp.1_5'Flank	NM_000718	NP_000709			calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)													---	---	---	---
LARP4B	23185	broad.mit.edu	37	10	901065	901065	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:901065delG	uc001ifs.1	-							NM_015155	NP_055970			La ribonucleoprotein domain family, member 4B								nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	2243821	2243821	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2243821delA								ADARB2 (464103 upstream) : PFKP (865931 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	2712022	2712023	+	IGR	INS	-	GGAA	GGAA	rs147762210	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2712022_2712023insGGAA								ADARB2 (932304 upstream) : PFKP (397729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	2943033	2943033	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2943033delT								None (None upstream) : PFKP (166719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3892353	3892353	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3892353delC								KLF6 (64880 upstream) : LOC100216001 (729091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	5423270	5423270	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5423270delC								UCN3 (7101 upstream) : TUBAL3 (11792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6868240	6868240	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6868240delA	uc001ijm.2	+											Homo sapiens cDNA FLJ36835 fis, clone ASTRO2010996.																														---	---	---	---
SFMBT2	57713	broad.mit.edu	37	10	7420620	7420621	+	Intron	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7420620_7420621delGT	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051			Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7689553	7689554	+	Intron	INS	-	T	T	rs140346933	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7689553_7689554insT	uc001ijq.2	-						ITIH5_uc001ijr.1_Intron	NM_030569	NP_085046			inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	8721444	8721445	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8721444_8721445delAC								GATA3 (604282 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	10846513	10846513	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10846513delT								SFTA1P (9636 upstream) : LOC254312 (130391 downstream)																																			---	---	---	---
DHTKD1	55526	broad.mit.edu	37	10	12132428	12132447	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCC	-	-	rs11409083		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12132428_12132447delTTCCTTCCTTCCTTCCTTCC	uc001ild.3	+							NM_018706	NP_061176			dehydrogenase E1 and transketolase domain						glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)															---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13938682	13938682	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13938682delA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
HSPA14	51182	broad.mit.edu	37	10	14910501	14910502	+	Intron	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14910501_14910502delCA	uc001inf.2	+							NM_016299	NP_057383			heat shock 70kDa protein 14 isoform 1						'de novo' cotranslational protein folding	cytosol	ATP binding|protein binding			ovary(2)|breast(2)|lung(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	15449679	15449680	+	IGR	INS	-	A	A	rs145807491	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15449679_15449680insA								FAM171A1 (36621 upstream) : ITGA8 (109408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	19318724	19318724	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19318724delT								ARL5B (351784 upstream) : PLXDC2 (786648 downstream)																																			---	---	---	---
PLXDC2	84898	broad.mit.edu	37	10	20155362	20155362	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20155362delA	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron	NM_032812	NP_116201			plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	23899300	23899300	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23899300delT								OTUD1 (167992 upstream) : KIAA1217 (84375 downstream)																																			---	---	---	---
ENKUR	219670	broad.mit.edu	37	10	25287288	25287289	+	Intron	DEL	CT	-	-	rs111884959		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25287288_25287289delCT	uc001isg.1	-						ENKUR_uc001ish.1_Intron	NM_145010	NP_659447			enkurin							cilium|flagellum	calmodulin binding|SH3 domain binding				0																		---	---	---	---
CREM	1390	broad.mit.edu	37	10	35446204	35446205	+	Intron	INS	-	AACT	AACT	rs143553325	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35446204_35446205insAACT	uc001iyb.2	+						CREM_uc001ixx.2_Intron|CREM_uc001ixy.2_Intron|CREM_uc001ixz.2_Intron|CREM_uc001iya.2_Intron|CREM_uc001iyc.2_Intron|CREM_uc001iyd.2_Intron|CREM_uc001iye.2_Intron	NM_181571	NP_853549			cAMP responsive element modulator isoform a						cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	36647022	36647023	+	IGR	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs147050495	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36647022_36647023insGTGTGTGTGT								FZD8 (716660 upstream) : ANKRD30A (767762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36773898	36773899	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36773898_36773899insT								FZD8 (843536 upstream) : ANKRD30A (640886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38896118	38896119	+	IGR	DEL	AC	-	-	rs111387844		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38896118_38896119delAC								LOC399744 (155038 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43347250	43347255	+	IGR	DEL	TGTTGT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43347250_43347255delTGTTGT								BMS1 (16867 upstream) : RET (225262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43548479	43548479	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43548479delT								BMS1 (218096 upstream) : RET (24038 downstream)																																			---	---	---	---
RASGEF1A	221002	broad.mit.edu	37	10	43732902	43732903	+	Intron	INS	-	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43732902_43732903insC	uc001jap.1	-							NM_145313	NP_660356			RasGEF domain family, member 1A						cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47019229	47019230	+	Intron	DEL	CT	-	-	rs140104666		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47019229_47019230delCT	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ARHGAP22	58504	broad.mit.edu	37	10	49862894	49862895	+	Intron	INS	-	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49862894_49862895insC	uc001jgv.2	-						ARHGAP22_uc010qgm.1_5'Flank					SubName: Full=Putative uncharacterized protein ARHGAP22;						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	58530199	58530200	+	IGR	DEL	AC	-	-	rs58220448		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58530199_58530200delAC								ZWINT (409165 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	61492736	61492739	+	IGR	DEL	CACA	-	-	rs35066910		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61492736_61492739delCACA								SLC16A9 (23087 upstream) : CCDC6 (55783 downstream)																																			---	---	---	---
CDH23	64072	broad.mit.edu	37	10	73384011	73384011	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73384011delC	uc001jrx.3	+						CDH23_uc001jrw.3_Intron	NM_022124	NP_071407			cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	77193175	77193175	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77193175delT								C10orf41 (24436 upstream) : MIR606 (119041 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	79839874	79839874	+	IGR	DEL	T	-	-	rs111370391		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79839874delT								RPS24 (23304 upstream) : LOC283050 (863210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	81393194	81393195	+	IGR	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81393194_81393195delGT								SFTPA1 (17993 upstream) : LOC650623 (49536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	82015925	82015926	+	IGR	INS	-	GAT	GAT	rs142011303	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82015925_82015926insGAT								ANXA11 (50492 upstream) : MAT1A (15651 downstream)																																			---	---	---	---
MAT1A	4143	broad.mit.edu	37	10	82039520	82039521	+	Intron	INS	-	AG	AG	rs71482772		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82039520_82039521insAG	uc001kbw.2	-							NM_000429	NP_000420			methionine adenosyltransferase I, alpha						methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	85330218	85330219	+	IGR	DEL	TG	-	-	rs146032698		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85330218_85330219delTG								NRG3 (583283 upstream) : GHITM (568966 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85850782	85850783	+	IGR	DEL	CA	-	-	rs72128374		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85850782_85850783delCA								None (None upstream) : GHITM (48402 downstream)																																			---	---	---	---
FAM190B	54462	broad.mit.edu	37	10	86196905	86196908	+	Intron	DEL	ACAG	-	-	rs66630178		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86196905_86196908delACAG	uc001kdh.1	+						FAM190B_uc010qmd.1_Intron|FAM190B_uc001kdi.1_Intron|FAM190B_uc010qme.1_Intron	NM_018999	NP_061872			granule cell antiserum positive 14											ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	87095144	87095144	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87095144delA								FAM190B (816868 upstream) : GRID1 (264168 downstream)																																			---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88283947	88283950	+	5'Flank	DEL	GTGT	-	-	rs149502524		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88283947_88283950delGTGT	uc001kdo.2	-						WAPAL_uc001kdn.2_5'Flank|WAPAL_uc009xsw.2_5'Flank|WAPAL_uc010qmh.1_5'Flank|WAPAL_uc010qmi.1_5'Flank|WAPAL_uc010qmj.1_5'Flank	NM_015045	NP_055860			wings apart-like homolog						cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	89846931	89846932	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89846931_89846932insA								PTEN (118400 upstream) : RNLS (45125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	94845615	94845615	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94845615delT								CYP26A1 (7974 upstream) : MYOF (220572 downstream)																																			---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95100518	95100518	+	Intron	DEL	T	-	-	rs67116993		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95100518delT	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc009xue.2_Intron	NM_013451	NP_038479			myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	101015304	101015313	+	IGR	DEL	TGCACGCATG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101015304_101015313delTGCACGCATG								HPSE2 (19685 upstream) : CNNM1 (73543 downstream)																																			---	---	---	---
ERLIN1	10613	broad.mit.edu	37	10	101926992	101926992	+	Intron	DEL	A	-	-	rs75860150		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101926992delA	uc001kqn.3	-						ERLIN1_uc001kqo.3_Intron|ERLIN1_uc010qpm.1_Intron	NM_006459	NP_006450			ER lipid raft associated 1						ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane	protein binding				0		Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)														---	---	---	---
ARL3	403	broad.mit.edu	37	10	104471522	104471522	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104471522delA	uc001kwa.2	-						SFXN2_uc001kwb.2_5'Flank|SFXN2_uc001kwc.2_5'Flank	NM_004311	NP_004302			ADP-ribosylation factor-like 3						cell cycle|cytokinesis|small GTPase mediated signal transduction	centrosome|cytoplasmic microtubule|Golgi membrane|midbody|nucleus|photoreceptor connecting cilium|spindle microtubule	GDP binding|GTP binding|metal ion binding|microtubule binding				0		Colorectal(252;0.122)		Epithelial(162;4.88e-09)|all cancers(201;1.29e-07)|BRCA - Breast invasive adenocarcinoma(275;0.22)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	111152943	111152943	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111152943delG								None (None upstream) : XPNPEP1 (471581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	111603276	111603277	+	IGR	INS	-	CA	CA	rs141183347	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111603276_111603277insCA								None (None upstream) : XPNPEP1 (21247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	116184759	116184760	+	IGR	INS	-	T	T	rs145810481		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116184759_116184760insT								AFAP1L2 (20244 upstream) : ABLIM1 (6110 downstream)																																			---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116262054	116262054	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116262054delG	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc010qsf.1_Intron|ABLIM1_uc009xyn.2_Intron|ABLIM1_uc010qsj.1_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304			actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	118333812	118333812	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118333812delC								PNLIP (6446 upstream) : PNLIPRP1 (16678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	119192954	119192955	+	IGR	DEL	CA	-	-	rs35450212	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119192954_119192955delCA								PDZD8 (58017 upstream) : EMX2OS (50850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	119663993	119663994	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119663993_119663994delAC								EMX2 (354937 upstream) : RAB11FIP2 (100435 downstream)																																			---	---	---	---
FGFR2	2263	broad.mit.edu	37	10	123344371	123344372	+	Intron	DEL	CC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123344371_123344372delCC	uc010qtk.1	-						FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Intron|FGFR2_uc010qti.1_Intron|FGFR2_uc010qtj.1_Intron|FGFR2_uc010qtl.1_Intron|FGFR2_uc010qtm.1_Intron|FGFR2_uc001lfl.3_Intron|FGFR2_uc001lfm.2_Intron|FGFR2_uc001lfn.3_Intron|FGFR2_uc010qtn.1_Intron|FGFR2_uc010qto.1_Intron|FGFR2_uc001lfo.1_Intron|FGFR2_uc010qtp.1_Intron|FGFR2_uc010qtq.1_Intron	NM_000141	NP_000132			fibroblast growth factor receptor 2 isoform 1						angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	10	125413058	125413059	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125413058_125413059insA								BUB3 (488172 upstream) : GPR26 (12812 downstream)																																			---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126771159	126771160	+	Intron	DEL	TT	-	-	rs138193956		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126771159_126771160delTT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	128402175	128402176	+	IGR	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128402175_128402176delTG								C10orf90 (43096 upstream) : DOCK1 (191847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130718113	130718114	+	IGR	INS	-	AC	AC	rs139614651	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130718113_130718114insAC								MKI67 (793645 upstream) : MGMT (547340 downstream)																																			---	---	---	---
MGMT	4255	broad.mit.edu	37	10	131398237	131398238	+	Intron	INS	-	GTAG	GTAG	rs146570640	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131398237_131398238insGTAG	uc001lkh.2	+							NM_002412	NP_002403			O-6-methylguanine-DNA methyltransferase											ovary(1)|breast(1)	2		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)									Direct_reversal_of_damage					---	---	---	---
Unknown	0	broad.mit.edu	37	10	132109170	132109171	+	IGR	DEL	CA	-	-	rs142720776		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132109170_132109171delCA								GLRX3 (126386 upstream) : TCERG1L (781485 downstream)																																			---	---	---	---
SCGB1C1	147199	broad.mit.edu	37	11	191824	191824	+	5'Flank	DEL	C	-	-	rs4890206		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:191824delC	uc001loa.1	+							NM_145651	NP_663626			secretoglobin, family 1C, member 1 precursor							extracellular region	binding			skin(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	6040446	6040447	+	IGR	INS	-	A	A	rs146956087	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6040446_6040447insA								OR56A4 (16068 upstream) : OR56A1 (7532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	27256168	27256170	+	IGR	DEL	AGC	-	-	rs147629085		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27256168_27256170delAGC								BBOX1 (106814 upstream) : CCDC34 (103891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	34427131	34427134	+	IGR	DEL	TCTC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34427131_34427134delTCTC								ABTB2 (48329 upstream) : CAT (33344 downstream)																																			---	---	---	---
CD6	923	broad.mit.edu	37	11	60782053	60782053	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60782053delA	uc001nqq.2	+						CD6_uc001nqp.2_Intron|CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716			CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	66127918	66127918	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66127918delG								B3GNT1 (12757 upstream) : SLC29A2 (2075 downstream)																																			---	---	---	---
C2CD3	26005	broad.mit.edu	37	11	73730728	73730729	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73730728_73730729insT	uc001out.2	-											Homo sapiens mRNA for hypothetical protein, complete cds, clone:Hsa11-digit29-22-02-04-C.							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	89357932	89357932	+	IGR	DEL	A	-	-	rs74381208		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89357932delA								NOX4 (35153 upstream) : FOLH1B (34533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	90004388	90004388	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90004388delA								CHORDC1 (47856 upstream) : MIR1261 (597901 downstream)																																			---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92355447	92355448	+	Intron	INS	-	A	A	rs112598135		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92355447_92355448insA	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
BACE1	23621	broad.mit.edu	37	11	117161995	117161995	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117161995delT	uc001pqz.2	-						BACE1_uc001pqw.2_Intron|BACE1_uc001pqx.2_Intron|BACE1_uc001pqy.2_Intron|BACE1_uc010rxg.1_Intron|BACE1_uc010rxh.1_Intron|BACE1_uc009yzo.1_Intron|uc010rxi.1_5'Flank	NM_012104	NP_036236			beta-site APP-cleaving enzyme 1 isoform A						beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding			ovary(1)	1	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	120863287	120863288	+	IGR	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120863287_120863288delGT								GRIK4 (6318 upstream) : TBCEL (31515 downstream)																																			---	---	---	---
LOC100288778	100288778	broad.mit.edu	37	12	81587	81587	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81587delA	uc010scy.1	+						uc010scx.1_Intron|LOC100288778_uc010scz.1_Intron|LOC100288778_uc010sdb.1_Intron					SubName: Full=Actin nucleation promoting factor; Flags: Fragment;												0																		---	---	---	---
IQSEC3	440073	broad.mit.edu	37	12	189997	189997	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:189997delG	uc001qhu.1	+						IQSEC3_uc001qht.1_Intron	NM_015232	NP_056047			IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)														---	---	---	---
B4GALNT3	283358	broad.mit.edu	37	12	656321	656322	+	Intron	INS	-	GGGCGTTGCT	GGGCGTTGCT	rs138189612	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:656321_656322insGGGCGTTGCT	uc001qii.1	+						B4GALNT3_uc001qij.1_Intron	NM_173593	NP_775864			beta							Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)													OREG0021561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1572864	1572867	+	Intron	DEL	TGTG	-	-	rs57210462		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1572864_1572867delTGTG	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc001qje.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
MLF2	8079	broad.mit.edu	37	12	6871056	6871057	+	Intron	INS	-	AA	AA	rs147294591		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6871056_6871057insAA	uc009zey.1	-							NM_005439	NP_005430			myeloid leukemia factor 2						defense response	cytoplasm|nucleus	protein binding			large_intestine(1)	1																		---	---	---	---
C1S	716	broad.mit.edu	37	12	7116056	7116057	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7116056_7116057insA	uc001qsj.2	+						LPCAT3_uc010sfw.1_Intron|LPCAT3_uc001qsi.2_Intron|LPCAT3_uc009zfp.2_Intron|LPCAT3_uc010sfx.1_Intron|LPCAT3_uc009zfq.1_Intron	NM_201442	NP_958850			complement component 1, s subcomponent						complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	7333389	7333390	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7333389_7333390insA								CLSTN3 (21861 upstream) : PEX5 (8369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	8164024	8164025	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8164024_8164025insT								SLC2A3 (75132 upstream) : FOXJ2 (21334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	8508185	8508186	+	IGR	DEL	AG	-	-	rs146846168		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8508185_8508186delAG								LOC653113 (112643 upstream) : LOC389634 (1376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	9296762	9296763	+	IGR	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9296762_9296763delAG								A2M (28204 upstream) : PZP (4674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	9481042	9481043	+	IGR	DEL	GT	-	-	rs141670536		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9481042_9481043delGT								LOC642846 (14358 upstream) : DDX12 (89245 downstream)																																			---	---	---	---
PRB4	5545	broad.mit.edu	37	12	11354617	11354620	+	Intron	DEL	AAGG	-	-	rs36124492		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11354617_11354620delAAGG	uc001qzf.1	-							NM_002723	NP_002714			proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1															HNSCC(22;0.051)			---	---	---	---
GPRC5A	9052	broad.mit.edu	37	12	13050544	13050545	+	Intron	DEL	TT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13050544_13050545delTT	uc001rba.2	+						GPRC5A_uc001raz.2_Intron	NM_003979	NP_003970			G protein-coupled receptor, family C, group 5,							cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	14889640	14889640	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14889640delA								GUCY2C (40121 upstream) : HIST4H4 (31294 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	19569812	19569812	+	IGR	DEL	T	-	-	rs111650338		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19569812delT								PLEKHA5 (40481 upstream) : AEBP2 (22796 downstream)																																			---	---	---	---
PDE3A	5139	broad.mit.edu	37	12	20706079	20706080	+	Intron	INS	-	T	T	rs145227642		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20706079_20706080insT	uc001reh.1	+							NM_000921	NP_000912			phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	25111886	25111888	+	IGR	DEL	TTT	-	-	rs35748363		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25111886_25111888delTTT								BCAT1 (9578 upstream) : C12orf77 (34482 downstream)																																			---	---	---	---
ARNTL2	56938	broad.mit.edu	37	12	27549980	27549983	+	Intron	DEL	TTTG	-	-	rs113966358		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27549980_27549983delTTTG	uc001rht.1	+						ARNTL2_uc001rhw.2_Intron|ARNTL2_uc010sjp.1_Intron|ARNTL2_uc001rhu.1_Intron|ARNTL2_uc009zji.1_Intron|ARNTL2_uc001rhv.1_Intron|uc001rhx.2_Intron	NM_020183	NP_064568			aryl hydrocarbon receptor nuclear						circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	30774867	30774868	+	IGR	DEL	AA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30774867_30774868delAA								TMTC1 (837175 upstream) : IPO8 (7055 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31221648	31221649	+	Intron	INS	-	C	C	rs138250464		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31221648_31221649insC	uc001rjq.1	-											Homo sapiens cDNA FLJ39041 fis, clone NT2RP7010109.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	33399232	33399232	+	IGR	DEL	T	-	-	rs67931288		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33399232delT								PKP2 (349452 upstream) : SYT10 (129116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38470460	38470460	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38470460delT								None (None upstream) : ALG10B (240097 downstream)																																			---	---	---	---
ALG10B	144245	broad.mit.edu	37	12	38721438	38721439	+	3'UTR	DEL	AA	-	-	rs34572827		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38721438_38721439delAA	uc001rln.3	+	3					ALG10B_uc001rlo.3_3'UTR|ALG10B_uc010skk.1_3'UTR	NM_001013620	NP_001013642			asparagine-linked glycosylation 10 homolog B						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|skin(1)	3	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	42426149	42426150	+	IGR	DEL	CT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42426149_42426150delCT								PDZRN4 (457765 upstream) : GXYLT1 (49500 downstream)																																			---	---	---	---
PPHLN1	51535	broad.mit.edu	37	12	42640824	42640825	+	Intron	INS	-	A	A	rs72284985		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42640824_42640825insA	uc001rmy.2	+							NM_201439	NP_958847			periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	43047414	43047415	+	IGR	INS	-	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43047414_43047415insG								PRICKLE1 (63842 upstream) : ADAMTS20 (700598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47998312	47998312	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47998312delG								FAM113B (367871 upstream) : RPAP3 (57404 downstream)																																			---	---	---	---
DIP2B	57609	broad.mit.edu	37	12	50962733	50962733	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50962733delT	uc001rwv.2	+						DIP2B_uc001rwu.2_Intron	NM_173602	NP_775873			DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6																		---	---	---	---
SCN8A	6334	broad.mit.edu	37	12	52196190	52196190	+	Intron	DEL	A	-	-	rs35303376		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52196190delA	uc001ryw.2	+							NM_014191	NP_055006			sodium channel, voltage gated, type VIII, alpha						axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	52317465	52317466	+	IGR	INS	-	G	G	rs145295564	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52317465_52317466insG								ACVRL1 (321 upstream) : ACVR1B (28020 downstream)																																	OREG0021826	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
CD63	967	broad.mit.edu	37	12	56124340	56124341	+	5'Flank	INS	-	A	A	rs141928598	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56124340_56124341insA	uc001shm.2	-						CD63_uc009znz.2_5'Flank|CD63_uc001shn.2_5'Flank|CD63_uc001sho.2_5'Flank|CD63_uc001shp.2_5'Flank	NM_001780	NP_001771			CD63 antigen isoform A						platelet activation|platelet degranulation	integral to plasma membrane|late endosome membrane|lysosomal membrane|platelet dense granule membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	59640350	59640350	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59640350delA								LRIG3 (326088 upstream) : SLC16A7 (349498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	60563770	60563771	+	IGR	DEL	AA	-	-	rs145344897		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60563770_60563771delAA								SLC16A7 (388363 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	61787110	61787110	+	IGR	DEL	G	-	-	rs35836039		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61787110delG								None (None upstream) : FAM19A2 (314933 downstream)																																			---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62297061	62297061	+	Intron	DEL	T	-	-	rs59924344		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62297061delT	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62369388	62369389	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62369388_62369389insT	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	69470620	69470620	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69470620delA								CPM (113600 upstream) : CPSF6 (162697 downstream)																																			---	---	---	---
PTPRB	5787	broad.mit.edu	37	12	70971626	70971626	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70971626delT	uc001swb.3	-						PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron|PTPRB_uc001swd.3_Intron|PTPRB_uc009zrr.1_Intron	NM_002837	NP_002828			protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---
TSPAN8	7103	broad.mit.edu	37	12	71576600	71576601	+	Intron	DEL	AA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71576600_71576601delAA	uc001swk.1	-							NM_004616	NP_004607			transmembrane 4 superfamily member 3						protein glycosylation	integral to membrane|lysosome	signal transducer activity			skin(2)|lung(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	73089668	73089669	+	IGR	DEL	AC	-	-	rs34682865	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73089668_73089669delAC								TRHDE (30247 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	74743488	74743495	+	IGR	DEL	TTTGCGTG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74743488_74743495delTTTGCGTG								None (None upstream) : ATXN7L3B (188056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77585395	77585395	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77585395delA								E2F7 (126035 upstream) : NAV3 (639674 downstream)																																			---	---	---	---
TMTC2	160335	broad.mit.edu	37	12	83262708	83262708	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83262708delC	uc001szt.2	+						TMTC2_uc001szr.1_Intron|TMTC2_uc001szs.1_Intron|TMTC2_uc010suk.1_Intron	NM_152588	NP_689801			transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2																		---	---	---	---
TMTC2	160335	broad.mit.edu	37	12	83393402	83393403	+	Intron	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83393402_83393403delAG	uc001szt.2	+						TMTC2_uc010suk.1_Intron	NM_152588	NP_689801			transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	85927136	85927136	+	IGR	DEL	T	-	-	rs113191365		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85927136delT								ALX1 (231577 upstream) : RASSF9 (271195 downstream)																																			---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86935963	86935963	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86935963delT	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	87351071	87351072	+	IGR	INS	-	T	T	rs145499824	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87351071_87351072insT								MGAT4C (118390 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	89633528	89633529	+	IGR	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89633528_89633529delGT								KITLG (659290 upstream) : DUSP6 (108310 downstream)																																			---	---	---	---
PLEKHG7	440107	broad.mit.edu	37	12	93145804	93145804	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93145804delA	uc001tcj.2	+							NM_001004330	NP_001004330			pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	93656029	93656032	+	IGR	DEL	TTTG	-	-	rs113938635		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93656029_93656032delTTTG								EEA1 (332922 upstream) : NUDT4 (115669 downstream)																																			---	---	---	---
NTN4	59277	broad.mit.edu	37	12	96056011	96056012	+	Intron	INS	-	T	T	rs111826418		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96056011_96056012insT	uc001tei.2	-						NTN4_uc009ztf.2_Intron|NTN4_uc009ztg.2_Intron	NM_021229	NP_067052			netrin 4 precursor						axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	97659528	97659529	+	IGR	DEL	GT	-	-	rs112719568		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97659528_97659529delGT								NEDD1 (312067 upstream) : RMST (199270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98133734	98133736	+	Intron	DEL	AGG	-	-	rs36122792		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98133734_98133736delAGG	uc001tfc.1	-						uc001tfd.2_Intron					Homo sapiens cDNA FLJ25775 fis, clone TST06543.																														---	---	---	---
SPIC	121599	broad.mit.edu	37	12	101874972	101874973	+	Intron	INS	-	T	T	rs143905883	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101874972_101874973insT	uc001tid.2	+						SPIC_uc009zua.2_Intron|SPIC_uc010svp.1_Intron	NM_152323	NP_689536			Spi-C transcription factor (Spi-1/PU.1 related)							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1																		---	---	---	---
TXNRD1	7296	broad.mit.edu	37	12	104628416	104628417	+	Intron	INS	-	A	A	rs33956129		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104628416_104628417insA	uc010swk.1	+						TXNRD1_uc001tkm.1_Intron	NM_001093771	NP_001087240			thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	104842861	104842861	+	IGR	DEL	T	-	-	rs35939000		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104842861delT								TXNRD1 (98803 upstream) : CHST11 (7888 downstream)																																			---	---	---	---
CHST11	50515	broad.mit.edu	37	12	105043552	105043552	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105043552delA	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	107531927	107531927	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107531927delG								CRY1 (44329 upstream) : BTBD11 (180270 downstream)																																			---	---	---	---
PRDM4	11108	broad.mit.edu	37	12	108127165	108127167	+	3'UTR	DEL	ATT	-	-	rs35721831		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108127165_108127167delATT	uc001tmp.2	-	12					PRDM4_uc010sww.1_3'UTR|PRDM4_uc001tmq.2_RNA	NM_012406	NP_036538			PR domain containing 4						cell proliferation|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	108869054	108869055	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108869054_108869055insA								CMKLR1 (135960 upstream) : FICD (39996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	110108591	110108591	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110108591delT								MVK (73521 upstream) : C12orf34 (43599 downstream)																																			---	---	---	---
PTPN11	5781	broad.mit.edu	37	12	112876291	112876291	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112876291delT	uc001ttx.2	+						PTPN11_uc001ttw.1_Intron	NM_002834	NP_002825			protein tyrosine phosphatase, non-receptor type						axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding			haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392								Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				---	---	---	---
RPH3A	22895	broad.mit.edu	37	12	113012294	113012295	+	5'Flank	DEL	GA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113012294_113012295delGA	uc010syl.1	+							NM_001143854	NP_001137326			rabphilin 3A homolog isoform 1						intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)														---	---	---	---
RPH3A	22895	broad.mit.edu	37	12	113120161	113120161	+	Intron	DEL	T	-	-	rs35365778		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113120161delT	uc010syl.1	+							NM_001143854	NP_001137326			rabphilin 3A homolog isoform 1						intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)														---	---	---	---
IQCD	115811	broad.mit.edu	37	12	113637528	113637528	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113637528delT	uc001tuu.2	-							NM_138451	NP_612460			IQ motif containing D											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	114900672	114900673	+	IGR	INS	-	A	A	rs146451693	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114900672_114900673insA								TBX5 (54425 upstream) : TBX3 (207386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115832283	115832286	+	IGR	DEL	ATGG	-	-	rs71896244		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115832283_115832286delATGG								TBX3 (710314 upstream) : MED13L (564097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	117073313	117073313	+	IGR	DEL	T	-	-	rs11358032		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117073313delT								MAP1LC3B2 (58888 upstream) : C12orf49 (80283 downstream)																																			---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118400255	118400255	+	Intron	DEL	T	-	-	rs71450238		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118400255delT	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	118911923	118911923	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118911923delA								SUDS3 (56084 upstream) : SRRM4 (507473 downstream)																																			---	---	---	---
CCDC64	92558	broad.mit.edu	37	12	120522695	120522695	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120522695delA	uc001txl.1	+						CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_Intron	NM_207311	NP_997194			coiled-coil domain containing 64						Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120602669	120602670	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120602669_120602670insT	uc001txo.2	-							NM_006836	NP_006827			GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	121795212	121795213	+	IGR	DEL	AG	-	-	rs1647252		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121795212_121795213delAG								ANAPC5 (3200 upstream) : RNF34 (42689 downstream)																																			---	---	---	---
WDR66	144406	broad.mit.edu	37	12	122378143	122378143	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122378143delT	uc009zxk.2	+							NM_144668	NP_653269			WD repeat domain 66								calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)														---	---	---	---
CDK2AP1	8099	broad.mit.edu	37	12	123750055	123750055	+	Intron	DEL	A	-	-	rs146967934		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123750055delA	uc001ueq.2	-						CDK2AP1_uc001uep.2_Intron	NM_004642	NP_004633			CDK2-associated protein  1						DNA-dependent DNA replication|protein phosphorylation|S phase of mitotic cell cycle	cytoplasm|nucleus	DNA binding|protein binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000554)|Epithelial(86;0.00178)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125233050	125233050	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125233050delT								NCOR2 (181040 upstream) : SCARB1 (29125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128461764	128461765	+	IGR	DEL	TC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128461764_128461765delTC								None (None upstream) : TMEM132C (437526 downstream)																																			---	---	---	---
RIMBP2	23504	broad.mit.edu	37	12	130905620	130905620	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130905620delT	uc001uil.2	-							NM_015347	NP_056162			RIM-binding protein 2							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)														---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131533526	131533527	+	Intron	DEL	GA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131533526_131533527delGA	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19646950	19646950	+	Intron	DEL	T	-	-	rs36089073		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19646950delT	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	23565418	23565421	+	IGR	DEL	TTTG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23565418_23565421delTTTG								None (None upstream) : SGCG (189639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	24961336	24961336	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24961336delT								C1QTNF9 (64671 upstream) : PARP4 (33739 downstream)																																			---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29790506	29790506	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29790506delC	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
FRY	10129	broad.mit.edu	37	13	32848437	32848437	+	Intron	DEL	A	-	-	rs34343129		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32848437delA	uc001utx.2	+						FRY_uc010tdw.1_Intron|FRY_uc001uty.2_Intron|FRY_uc001utz.2_Intron|FRY_uc010tdx.1_Intron	NM_023037	NP_075463			furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	36949480	36949480	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36949480delT								SPG20 (5163 upstream) : CCNA1 (56177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	38541501	38541502	+	IGR	INS	-	C	C	rs2786635		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38541501_38541502insC								TRPC4 (97562 upstream) : UFM1 (382440 downstream)																																			---	---	---	---
LHFP	10186	broad.mit.edu	37	13	40169844	40169844	+	Intron	DEL	A	-	-	rs33999589		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40169844delA	uc001uxf.2	-							NM_005780	NP_005771			lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)				T	HMGA2	lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	13	47015672	47015673	+	IGR	INS	-	A	A	rs147471061	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47015672_47015673insA								C13orf18 (3347 upstream) : LRCH1 (111623 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	51740728	51740728	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51740728delA								GUCY1B2 (85730 upstream) : FAM124A (55779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	53175926	53175933	+	IGR	DEL	ACACACAC	-	-	rs71780369		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53175926_53175933delACACACAC								TPTE2P3 (14702 upstream) : HNRNPA1L2 (15672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63646570	63646571	+	IGR	DEL	AC	-	-	rs111782150		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63646570_63646571delAC								None (None upstream) : OR7E156P (664997 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64381170	64381170	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64381170delA								OR7E156P (64469 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	77351060	77351060	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77351060delG								LMO7 (917056 upstream) : KCTD12 (103244 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81595835	81595835	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81595835delC								SPRY2 (680749 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83926005	83926011	+	IGR	DEL	AGGAAGG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83926005_83926011delAGGAAGG								None (None upstream) : SLITRK1 (525333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	89431018	89431018	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89431018delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90342536	90342547	+	IGR	DEL	ACACAGAGAGAG	-	-	rs71107369	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90342536_90342547delACACAGAGAGAG								None (None upstream) : MIR622 (540889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	95652682	95652683	+	IGR	INS	-	A	A	rs146089655	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95652682_95652683insA								SOX21 (288293 upstream) : ABCC4 (19401 downstream)																																			---	---	---	---
UBAC2	337867	broad.mit.edu	37	13	99933085	99933086	+	Intron	DEL	CT	-	-	rs36041704		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99933085_99933086delCT	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_001144072	NP_001137544			UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102623725	102623728	+	Intron	DEL	TTTT	-	-	rs34042855		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102623725_102623728delTTTT	uc001vpf.2	-							NM_175929	NP_787125			fibroblast growth factor 14 isoform 1B						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
LOC643677	643677	broad.mit.edu	37	13	103394340	103394340	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103394340delC	uc001vpm.2	-	4	8847	c.8707delG	c.(8707-8709)GATfs	p.D2903fs		NM_001146197	NP_001139669			hypothetical protein LOC643677												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	104339066	104339067	+	IGR	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104339066_104339067delTG								SLC10A2 (619870 upstream) : None (None downstream)																																			---	---	---	---
ARHGEF7	8874	broad.mit.edu	37	13	111770965	111770965	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111770965delC	uc001vrs.2	+						ARHGEF7_uc001vrr.2_Intron|ARHGEF7_uc001vrt.2_Intron	NM_001113511	NP_001106983			PAK-interacting exchange factor beta isoform c						apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	112629402	112629403	+	IGR	INS	-	TG	TG	rs146058932	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112629402_112629403insTG								C13orf16 (632809 upstream) : SOX1 (92510 downstream)																																			---	---	---	---
RASA3	22821	broad.mit.edu	37	13	114757504	114757505	+	Intron	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114757504_114757505delCA	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394			RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)															---	---	---	---
RASA3	22821	broad.mit.edu	37	13	114778874	114778881	+	Intron	DEL	TTTCCCTC	-	-	rs59312132	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114778874_114778881delTTTCCCTC	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394			RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)															---	---	---	---
Unknown	0	broad.mit.edu	37	14	20149342	20149342	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20149342delA								P704P (129070 upstream) : OR4Q3 (66245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20670975	20670976	+	IGR	DEL	GG	-	-	rs78780979		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20670975_20670976delGG								OR11G2 (4445 upstream) : OR11H6 (20893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	21610898	21610898	+	IGR	DEL	G	-	-	rs71112552		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21610898delG								ZNF219 (38035 upstream) : OR5AU1 (12199 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	22946227	22946227	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22946227delA	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wed.1_5'Flank|uc001wee.3_5'Flank|uc010tmt.1_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
TGM1	7051	broad.mit.edu	37	14	24732473	24732474	+	5'Flank	INS	-	G	G	rs2273301	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24732473_24732474insG	uc001wod.2	-						TGM1_uc010tog.1_5'Flank	NM_000359	NP_000350			transglutaminase 1						cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)													---	---	---	---
Unknown	0	broad.mit.edu	37	14	24860009	24860010	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24860009_24860010insA								NFATC4 (11201 upstream) : NYNRIN (7982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28792665	28792665	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28792665delT								None (None upstream) : FOXG1 (443622 downstream)																																			---	---	---	---
PRKD1	5587	broad.mit.edu	37	14	30187609	30187610	+	Intron	INS	-	C	C	rs137927946	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30187609_30187610insC	uc001wqh.2	-							NM_002742	NP_002733			protein kinase D1						cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	30788465	30788465	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30788465delT								PRKD1 (391566 upstream) : G2E3 (239864 downstream)																																			---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33001272	33001272	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33001272delT	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	38320539	38320540	+	Intron	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38320539_38320540delTG	uc001wug.2	+											Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	40749534	40749534	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40749534delA								FBXO33 (847830 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	41470360	41470360	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:41470360delT								None (None upstream) : LRFN5 (606404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44337064	44337065	+	IGR	DEL	TA	-	-	rs71412930	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44337064_44337065delTA								None (None upstream) : FSCB (636290 downstream)																																			---	---	---	---
FERMT2	10979	broad.mit.edu	37	14	53411961	53411962	+	Intron	INS	-	T	T	rs141923666	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53411961_53411962insT	uc001xad.2	-						FERMT2_uc001xac.2_Intron|FERMT2_uc001xae.2_Intron|FERMT2_uc001xaf.2_Intron	NM_006832	NP_006823			fermitin family homolog 2 isoform 1						actin cytoskeleton organization|cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytosol|focal adhesion|stress fiber	binding				0	Breast(41;0.0342)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	54751255	54751255	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54751255delA								BMP4 (327701 upstream) : CDKN3 (112418 downstream)																																			---	---	---	---
C14orf34	645687	broad.mit.edu	37	14	56257238	56257238	+	Intron	DEL	T	-	-	rs144723334	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56257238delT	uc010trd.1	-						C14orf34_uc010tre.1_Intron	NR_026796				Homo sapiens chromosome 14 open reading frame 34 (C14orf34), transcript variant 1, non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	57152855	57152856	+	IGR	INS	-	C	C	rs147660726	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57152855_57152856insC								C14orf101 (36625 upstream) : OTX2 (114571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57211463	57211463	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57211463delT								C14orf101 (95233 upstream) : OTX2 (55964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	62603798	62603798	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62603798delA								FLJ43390 (6566 upstream) : KCNH5 (570149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	63618211	63618212	+	IGR	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63618211_63618212delAG								KCNH5 (49627 upstream) : RHOJ (52933 downstream)																																			---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64685826	64685827	+	Intron	INS	-	TG	TG	rs33992127		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64685826_64685827insTG	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron|SYNE2_uc010aqa.2_Intron|SYNE2_uc001xgq.2_Intron|SYNE2_uc001xgr.2_Intron|SYNE2_uc010tsi.1_Intron|SYNE2_uc001xgs.2_Intron|SYNE2_uc001xgt.2_Intron	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	69319507	69319508	+	IGR	INS	-	T	T	rs138428238	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69319507_69319508insT								C14orf181 (56317 upstream) : ACTN1 (21333 downstream)																																			---	---	---	---
PCNX	22990	broad.mit.edu	37	14	71481408	71481409	+	Intron	INS	-	G	G	rs138375408	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71481408_71481409insG	uc001xmo.2	+						PCNX_uc010are.1_Intron|PCNX_uc010arf.1_Intron	NM_014982	NP_055797			pecanex-like 1							integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72704668	72704669	+	Intron	INS	-	T	T	rs148096396	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72704668_72704669insT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	75102225	75102225	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75102225delG								LTBP2 (23191 upstream) : KIAA0317 (25732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	75712529	75712529	+	IGR	DEL	A	-	-	rs5809698		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75712529delA								TMED10 (69180 upstream) : FOS (32952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	75753071	75753072	+	IGR	INS	-	AA	AA			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75753071_75753072insAA								FOS (4136 upstream) : JDP2 (141437 downstream)																																			---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79519977	79519980	+	Intron	DEL	GTTG	-	-	rs142787002	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79519977_79519980delGTTG	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79679211	79679211	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79679211delT	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
C14orf145	145508	broad.mit.edu	37	14	81236720	81236720	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81236720delC	uc001xux.2	-						C14orf145_uc010asz.1_Intron	NM_152446	NP_689659			hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	83158776	83158776	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83158776delA								None (None upstream) : None (None downstream)																																			---	---	---	---
SPATA7	55812	broad.mit.edu	37	14	88859027	88859027	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88859027delT	uc001xwq.2	+						SPATA7_uc001xwr.2_Intron	NM_018418	NP_060888			spermatogenesis-associated protein 7 isoform a						response to stimulus|visual perception					ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	89616834	89616834	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89616834delT								TTC8 (272500 upstream) : FOXN3 (5683 downstream)																																			---	---	---	---
C14orf159	80017	broad.mit.edu	37	14	91607444	91607446	+	Intron	DEL	ATC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91607444_91607446delATC	uc001xzb.2	+						C14orf159_uc010atu.1_Intron|C14orf159_uc010atv.1_Intron|C14orf159_uc001xyy.2_Intron|C14orf159_uc001xyx.2_Intron|C14orf159_uc001xyw.2_Intron|C14orf159_uc001xzc.2_Intron|C14orf159_uc001xza.2_Intron|C14orf159_uc001xyv.2_Intron|C14orf159_uc001xyz.2_Intron|C14orf159_uc010twj.1_Intron|C14orf159_uc001xze.2_Intron	NM_001102366	NP_001095836			hypothetical protein LOC80017 isoform a							mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)														---	---	---	---
ATXN3	4287	broad.mit.edu	37	14	92537088	92537089	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92537088_92537089insT	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron	NM_004993	NP_004984			ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	95171156	95171156	+	IGR	DEL	A	-	-	rs34810148		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95171156delA								SERPINA13 (57826 upstream) : GSC (63405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	96643397	96643398	+	IGR	DEL	CA	-	-	rs10562506		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96643397_96643398delCA								C14orf132 (83264 upstream) : BDKRB2 (27737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97082762	97082763	+	IGR	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97082762_97082763delCA								PAPOLA (49316 upstream) : VRK1 (180921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97466320	97466320	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97466320delC								VRK1 (118370 upstream) : C14orf64 (925627 downstream)																																			---	---	---	---
C14orf68	283600	broad.mit.edu	37	14	100793290	100793290	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100793290delA	uc001yhc.2	+						C14orf68_uc001yhd.2_Intron	NM_207117	NP_997000			chromosome 14 open reading frame 68						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0		Melanoma(154;0.152)																---	---	---	---
DYNC1H1	1778	broad.mit.edu	37	14	102475843	102475843	+	Intron	DEL	T	-	-	rs34292577		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102475843delT	uc001yks.2	+							NM_001376	NP_001367			cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10																		---	---	---	---
HSP90AA1	3320	broad.mit.edu	37	14	102574044	102574044	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102574044delG	uc001ykv.3	-							NM_001017963	NP_001017963			heat shock 90kDa protein 1, alpha isoform 1						axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	20088944	20088944	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20088944delA								None (None upstream) : GOLGA6L6 (648150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20283123	20283123	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20283123delT								None (None upstream) : GOLGA6L6 (453971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20441424	20441424	+	IGR	DEL	T	-	-	rs71399652		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20441424delT								None (None upstream) : GOLGA6L6 (295670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20552536	20552537	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20552536_20552537insT								None (None upstream) : GOLGA6L6 (184557 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20591823	20591824	+	Intron	INS	-	AA	AA			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20591823_20591824insAA	uc001ytg.2	-						uc010tyx.1_Intron					RecName: Full=Putative HERC2-like protein 3;																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	20602750	20602751	+	Intron	INS	-	A	A	rs141852156		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20602750_20602751insA	uc001ytg.2	-						uc010tyx.1_Intron					RecName: Full=Putative HERC2-like protein 3;																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22489207	22489207	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22489207delT								OR4N3P (74822 upstream) : MIR1268 (24022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22490731	22490731	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22490731delT								OR4N3P (76346 upstream) : MIR1268 (22498 downstream)																																			---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	26022234	26022235	+	Intron	DEL	GC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26022234_26022235delGC	uc010ayu.2	-							NM_024490	NP_077816			ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	34807125	34807126	+	IGR	INS	-	G	G	rs143188748	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34807125_34807126insG								GOLGA8A (125124 upstream) : GOLGA8B (10359 downstream)																																			---	---	---	---
GPR176	11245	broad.mit.edu	37	15	40112505	40112506	+	Intron	DEL	AT	-	-	rs76658253		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40112505_40112506delAT	uc001zkj.1	-						GPR176_uc010uck.1_Intron|GPR176_uc001zkk.1_Intron	NM_007223	NP_009154			G protein-coupled receptor 176						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)														---	---	---	---
IGDCC3	9543	broad.mit.edu	37	15	65623124	65623125	+	Intron	INS	-	TCTA	TCTA	rs150339477	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65623124_65623125insTCTA	uc002aos.2	-						IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875			putative neuronal cell adhesion molecule											ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	70668837	70668880	+	IGR	DEL	AGAGAGGGAGGGGAGGAGGAAGAGAGAGAAGGCGGGAGGAAGGA	-	-	rs11633452		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70668837_70668880delAGAGAGGGAGGGGAGGAGGAAGAGAGAGAAGGCGGGAGGAAGGA								TLE3 (278581 upstream) : UACA (278015 downstream)																																			---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71444762	71444762	+	Intron	DEL	A	-	-	rs11325093		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71444762delA	uc002atb.1	+							NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
ADPGK	83440	broad.mit.edu	37	15	73050249	73050249	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73050249delA	uc002avg.3	-						ADPGK_uc002ave.3_5'Flank|ADPGK_uc010ukw.1_Intron|ADPGK_uc002avf.3_Intron|ADPGK_uc002avi.3_Intron|ADPGK_uc002avh.3_Intron	NM_031284	NP_112574			ADP-dependent glucokinase						glycolysis	extracellular region	ADP-specific glucokinase activity|metal ion binding				0																		---	---	---	---
SGK269	79834	broad.mit.edu	37	15	77577234	77577235	+	Intron	DEL	AC	-	-	rs111316383		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77577234_77577235delAC	uc002bcm.2	-							NM_024776	NP_079052			NKF3 kinase family member						cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)														---	---	---	---
RASGRF1	5923	broad.mit.edu	37	15	79285812	79285812	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79285812delC	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron|RASGRF1_uc010unh.1_Intron|RASGRF1_uc002beo.2_Intron	NM_002891	NP_002882			Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87401695	87401696	+	Intron	DEL	GT	-	-	rs72402482		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87401695_87401696delGT	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
CRTC3	64784	broad.mit.edu	37	15	91094573	91094574	+	Intron	INS	-	CT	CT	rs142508643	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91094573_91094574insCT	uc002bpp.2	+						CRTC3_uc002bpn.2_Intron|CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606			transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)					T	MAML2	salivary gland mucoepidermoid								---	---	---	---
Unknown	0	broad.mit.edu	37	15	95123313	95123314	+	IGR	DEL	GT	-	-	rs35567862		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95123313_95123314delGT								MCTP2 (96133 upstream) : LOC145820 (853008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96716608	96716608	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96716608delT								LOC145820 (665534 upstream) : NR2F2 (152549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96996372	96996373	+	IGR	DEL	GT	-	-	rs66504124		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96996372_96996373delGT								NR2F2 (112882 upstream) : SPATA8 (330306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98539145	98539145	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98539145delA								ARRDC4 (22078 upstream) : FAM169B (441246 downstream)																																			---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100543039	100543039	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100543039delT	uc002bvv.1	-							NM_139057	NP_620688			ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
RAB11FIP3	9727	broad.mit.edu	37	16	554087	554087	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:554087delC	uc002chf.2	+						RAB11FIP3_uc010uuf.1_Intron|RAB11FIP3_uc010uug.1_Intron	NM_014700	NP_055515			rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	4235269	4235269	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4235269delG								ADCY9 (69083 upstream) : SRL (4108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	9413531	9413531	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9413531delA								C16orf72 (199986 upstream) : GRIN2A (433736 downstream)																																			---	---	---	---
CLEC16A	23274	broad.mit.edu	37	16	11118908	11118908	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11118908delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041			C-type lectin domain family 16, member A									p.0?(1)		ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	18686115	18686115	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18686115delT								ABCC6P1 (76510 upstream) : RPS15A (108162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	22698295	22698296	+	IGR	INS	-	C	C	rs150038558	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22698295_22698296insC								LOC653786 (110109 upstream) : HS3ST2 (127564 downstream)																																			---	---	---	---
SCNN1G	6340	broad.mit.edu	37	16	23193134	23193137	+	5'Flank	DEL	AGGC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23193134_23193137delAGGC	uc002dlm.1	+							NM_001039	NP_001030			sodium channel, nonvoltage-gated 1, gamma						excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
IL4R	3566	broad.mit.edu	37	16	27323852	27323852	+	5'Flank	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27323852delA	uc002don.2	+						IL4R_uc002dom.2_5'Flank|IL4R_uc002dop.3_5'Flank|IL4R_uc010bxy.2_5'Flank|IL4R_uc002doo.2_5'Flank	NM_000418	NP_000409			interleukin 4 receptor alpha chain isoform a						immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32559704	32559704	+	IGR	DEL	T	-	-	rs79174964		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32559704delT								HERC2P4 (395830 upstream) : TP53TG3B (125137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33065327	33065327	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33065327delT								SLC6A10P (168864 upstream) : MIR1826 (900181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33481145	33481146	+	IGR	INS	-	C	C	rs146417227	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33481145_33481146insC								SLC6A10P (584682 upstream) : MIR1826 (484362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33947228	33947229	+	IGR	DEL	AA	-	-	rs111797998		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33947228_33947229delAA								None (None upstream) : MIR1826 (18279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33965831	33965832	+	IGR	DEL	AG	-	-	rs10580819		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33965831_33965832delAG								MIR1826 (239 upstream) : UBE2MP1 (437970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34179236	34179236	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34179236delC								MIR1826 (213644 upstream) : UBE2MP1 (224566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34181148	34181148	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34181148delT								MIR1826 (215556 upstream) : UBE2MP1 (222654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46454744	46454745	+	IGR	INS	-	TTG	TTG	rs113435740		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46454744_46454745insTTG								None (None upstream) : ANKRD26P1 (48504 downstream)																																			---	---	---	---
VPS35	55737	broad.mit.edu	37	16	46708575	46708575	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46708575delA	uc002eef.3	-						VPS35_uc002eed.2_Intron|VPS35_uc002eee.2_Intron	NM_018206	NP_060676			vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)																---	---	---	---
NOB1	28987	broad.mit.edu	37	16	69785968	69785968	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69785968delA	uc002exs.2	-							NM_014062	NP_054781			nin one binding protein							nucleus	metal ion binding|protein binding				0																		---	---	---	---
WWP2	11060	broad.mit.edu	37	16	69902565	69902572	+	Intron	DEL	CACACACA	-	-	rs111960041		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69902565_69902572delCACACACA	uc002exu.1	+						WWP2_uc002ext.2_Intron|WWP2_uc002exv.1_Intron|WWP2_uc010vlm.1_Intron	NM_007014	NP_008945			WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6																		---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	70959219	70959220	+	Intron	INS	-	A	A	rs139697010	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70959219_70959220insA	uc002ezr.2	-							NM_032821	NP_116210			hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	75944766	75944767	+	IGR	INS	-	TATC	TATC	rs141761316	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75944766_75944767insTATC								TERF2IP (253438 upstream) : CNTNAP4 (366409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79534152	79534153	+	IGR	DEL	AG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79534152_79534153delAG								WWOX (287589 upstream) : MAF (93593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85184269	85184270	+	IGR	DEL	TG	-	-	rs148479780		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85184269_85184270delTG								FAM92B (38155 upstream) : KIAA0182 (460759 downstream)																																			---	---	---	---
KIAA0182	23199	broad.mit.edu	37	16	85643878	85643878	+	5'Flank	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85643878delG	uc002fiw.2	+							NM_001134473	NP_001127945			genetic suppressor element 1 isoform 2								protein binding			large_intestine(3)|ovary(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	88467876	88467879	+	IGR	DEL	CAGA	-	-	rs66800435		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88467876_88467879delCAGA								BANP (356953 upstream) : ZNF469 (26000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88467878	88467881	+	IGR	DEL	GATG	-	-	rs66800435		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88467878_88467881delGATG								BANP (356955 upstream) : ZNF469 (25998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	211032	211033	+	IGR	INS	-	G	G	rs143222815	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:211032_211033insG								RPH3AL (8456 upstream) : C17orf97 (49085 downstream)																																			---	---	---	---
NXN	64359	broad.mit.edu	37	17	715904	715905	+	Intron	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:715904_715905delGT	uc002fsa.2	-						NXN_uc010vqd.1_Intron|NXN_uc002frz.2_Intron|NXN_uc010vqe.1_Intron	NM_022463	NP_071908			nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	896700	896700	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:896700delC								NXN (13690 upstream) : TIMM22 (3657 downstream)																																			---	---	---	---
ABR	29	broad.mit.edu	37	17	969771	969772	+	Intron	INS	-	T	T	rs112876947		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:969771_969772insT	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010vqg.1_Intron|ABR_uc002fsg.2_Intron|ABR_uc002fsh.1_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	4573661	4573662	+	IGR	DEL	TC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4573661_4573662delTC								ALOX15 (28072 upstream) : PELP1 (1018 downstream)																																			---	---	---	---
MINK1	50488	broad.mit.edu	37	17	4790231	4790232	+	Intron	INS	-	C	C	rs148942862	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4790231_4790232insC	uc010vsl.1	+						MINK1_uc010vsk.1_Intron|MINK1_uc010vsm.1_Intron|MINK1_uc010vsn.1_Intron|MINK1_uc010vso.1_Intron|MINK1_uc010vsp.1_Intron	NM_153827	NP_722549			misshapen-like kinase 1 isoform 3						JNK cascade	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)|skin(1)	6																		---	---	---	---
NLRP1	22861	broad.mit.edu	37	17	5439470	5439471	+	Intron	INS	-	TT	TT			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5439470_5439471insTT	uc002gci.2	-						NLRP1_uc002gcg.1_Intron|NLRP1_uc002gck.2_Intron|NLRP1_uc002gcj.2_Intron|NLRP1_uc002gcl.2_Intron|NLRP1_uc002gch.3_Intron|NLRP1_uc010clh.2_Intron	NM_033004	NP_127497			NLR family, pyrin domain containing 1 isoform 1						defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)																---	---	---	---
WDR16	146845	broad.mit.edu	37	17	9503870	9503871	+	Intron	INS	-	TTTG	TTTG			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9503870_9503871insTTTG	uc002gly.2	+						WDR16_uc002glz.2_Intron|WDR16_uc010coc.2_Intron	NM_145054	NP_659491			WD40-repeat protein upregulated in HCC isoform							cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
CENPV	201161	broad.mit.edu	37	17	16252165	16252170	+	Intron	DEL	TGCAGG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16252165_16252170delTGCAGG	uc002gpw.2	-							NM_181716	NP_859067			proline rich 6						cell division|centromeric heterochromatin formation|mitosis|positive regulation of cytokinesis|regulation of chromosome organization	condensed chromosome kinetochore|cytoplasm|nucleus|spindle midzone	carbon-sulfur lyase activity				0																		---	---	---	---
LRRC48	83450	broad.mit.edu	37	17	17903391	17903392	+	Intron	INS	-	GT	GT	rs144650443	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17903391_17903392insGT	uc010vxd.1	+						LRRC48_uc002gsa.2_Intron|LRRC48_uc010vxc.1_Intron|LRRC48_uc002gsb.2_Intron|LRRC48_uc010vxe.1_Intron	NM_001130090	NP_001123562			leucine rich repeat containing 48 isoform a							cytoplasm				pancreas(1)	1	all_neural(463;0.228)																	---	---	---	---
PRPSAP2	5636	broad.mit.edu	37	17	18795553	18795553	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18795553delT	uc002gup.1	+						PRPSAP2_uc002guo.1_Intron|PRPSAP2_uc010vyi.1_Intron|PRPSAP2_uc010vyj.1_Intron|PRPSAP2_uc010vyk.1_Intron	NM_002767	NP_002758			phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|magnesium ion binding|ribose phosphate diphosphokinase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	20660074	20660074	+	IGR	DEL	A	-	-	rs34485964		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20660074delA								LGALS9B (289226 upstream) : CCDC144NL (106636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25305394	25305394	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25305394delA								None (None upstream) : WSB1 (315712 downstream)																																			---	---	---	---
SEZ6	124925	broad.mit.edu	37	17	27321291	27321291	+	Intron	DEL	T	-	-	rs72284783		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27321291delT	uc002hdp.2	-						SEZ6_uc010cry.1_Intron|SEZ6_uc002hdq.1_Intron|SEZ6_uc010crz.1_Intron	NM_178860	NP_849191			seizure related 6 homolog isoform 1							integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)															---	---	---	---
SEZ6	124925	broad.mit.edu	37	17	27325403	27325403	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27325403delC	uc002hdp.2	-						SEZ6_uc010cry.1_Intron|SEZ6_uc002hdq.1_Intron|SEZ6_uc010crz.1_Intron	NM_178860	NP_849191			seizure related 6 homolog isoform 1							integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	27361723	27361724	+	IGR	DEL	AA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27361723_27361724delAA								SEZ6 (28265 upstream) : PIPOX (8194 downstream)																																			---	---	---	---
TAOK1	57551	broad.mit.edu	37	17	27738577	27738577	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27738577delT	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron	NM_020791	NP_065842			TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)															---	---	---	---
LRRC37B2	147172	broad.mit.edu	37	17	28985771	28985772	+	Intron	INS	-	AGGA	AGGA	rs28881798		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28985771_28985772insAGGA	uc010csj.1	+											Homo sapiens cDNA FLJ90801 fis, clone Y79AA1000207.												0																		---	---	---	---
RHOT1	55288	broad.mit.edu	37	17	30495261	30495262	+	Intron	DEL	CA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30495261_30495262delCA	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron|RHOT1_uc002hgv.2_Intron	NM_018307	NP_060777			ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)																---	---	---	---
ACACA	31	broad.mit.edu	37	17	35547372	35547372	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35547372delA	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuy.2_Intron	NM_198836	NP_942133			acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---
ACACA	31	broad.mit.edu	37	17	35747590	35747591	+	Intron	INS	-	A	A	rs75573982		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35747590_35747591insA	uc002hno.2	-						ACACA_uc002hnn.2_Intron|ACACA_uc002hnq.2_Intron|C17orf78_uc002hns.2_Intron	NM_198834	NP_942131			acetyl-Coenzyme A carboxylase alpha isoform 1						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	43454235	43454235	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43454235delA								MAP3K14 (59821 upstream) : ARHGAP27 (17034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	43665602	43665602	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43665602delA								LRRC37A4 (70086 upstream) : LOC644172 (11889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	47909029	47909030	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47909029_47909030insT								MYST2 (2573 upstream) : TAC4 (6641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	49515612	49515613	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49515612_49515613insA								UTP18 (140322 upstream) : CA10 (192062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52215740	52215741	+	IGR	INS	-	TG	TG	rs149672456	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52215740_52215741insTG								KIF2B (313167 upstream) : TOM1L1 (762311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52267287	52267288	+	IGR	DEL	AC	-	-	rs150700062		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52267287_52267288delAC								KIF2B (364714 upstream) : TOM1L1 (710764 downstream)																																			---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	58951998	58951999	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58951998_58951999insT	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
AXIN2	8313	broad.mit.edu	37	17	63611581	63611582	+	Intron	INS	-	CA	CA	rs148176927	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63611581_63611582insCA	uc010den.1	-							NM_004655	NP_004646			axin 2						cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2														Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64495266	64495267	+	Intron	INS	-	T	T	rs151141384	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64495266_64495267insT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
BIRC5	332	broad.mit.edu	37	17	76212962	76212962	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76212962delT	uc002jvg.2	+						BIRC5_uc002jve.1_Intron|BIRC5_uc002jvd.1_Intron|BIRC5_uc010dhk.1_Intron|BIRC5_uc010dhl.1_Intron|BIRC5_uc002jvf.2_Intron|BIRC5_uc002jvh.2_Intron|BIRC5_uc002jvi.2_Intron|EPR1_uc002jvj.1_Intron	NM_001168	NP_001159			baculoviral IAP repeat-containing protein 5						anti-apoptosis|apoptosis|cell division|chromosome segregation|cytokinesis|establishment of chromosome localization|G2/M transition of mitotic cell cycle|mitosis|mitotic prometaphase|positive regulation of exit from mitosis|positive regulation of mitotic cell cycle|protein complex localization|spindle checkpoint	centriole|chromosome passenger complex|chromosome, centromeric region|cytoplasm|cytoplasmic microtubule|cytosol|interphase microtubule organizing center|midbody|midbody|nuclear chromosome|spindle|spindle microtubule	caspase inhibitor activity|chaperone binding|cobalt ion binding|cofactor binding|cysteine-type endopeptidase inhibitor activity|metal ion binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|Ran GTPase binding|zinc ion binding			kidney(1)	1			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.153)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	77910714	77910715	+	RNA	INS	-	GC	GC	rs141061869	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77910714_77910715insGC	uc002jxg.1	-	1		c.1563_1564insGC								Homo sapiens cDNA FLJ20748 fis, clone HEP05772.																														---	---	---	---
C17orf56	146705	broad.mit.edu	37	17	79204128	79204134	+	Intron	DEL	TGAGTGC	-	-	rs150422103		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79204128_79204134delTGAGTGC	uc002jzu.1	-						C17orf56_uc002jzr.1_Intron|C17orf56_uc002jzs.1_Intron|C17orf56_uc002jzt.1_Intron|C17orf56_uc002jzv.1_Intron|uc002jzw.1_RNA	NM_144679	NP_653280			hypothetical protein LOC146705							integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)													OREG0024811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
BAHCC1	57597	broad.mit.edu	37	17	79399235	79399235	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79399235delG	uc002kaf.2	+							NM_001080519	NP_001073988			BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)															---	---	---	---
C17orf70	80233	broad.mit.edu	37	17	79513882	79513882	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79513882delA	uc002kaq.2	-						C17orf70_uc002kao.1_Intron|C17orf70_uc010wuq.1_Intron|C17orf70_uc002kap.2_Intron	NM_001109760	NP_001103230			Fanconi anemia core complex 100 kDa subunit						DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)															---	---	---	---
STRA13	201254	broad.mit.edu	37	17	79978682	79978682	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79978682delT	uc002kdc.2	-						STRA13_uc002kdd.2_Intron|LRRC45_uc002kde.2_5'Flank	NM_144998	NP_659435			stimulated by retinoic acid 13						DNA repair	chromosome, centromeric region|Fanconi anaemia nuclear complex	DNA binding|protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)													OREG0024818	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	18	15391617	15391624	+	IGR	DEL	GCTCATGG	-	-	rs9973166	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15391617_15391624delGCTCATGG								LOC644669 (65699 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15407548	15407551	+	IGR	DEL	ACTT	-	-	rs7235713	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15407548_15407551delACTT								LOC644669 (81630 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	19217783	19217784	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19217783_19217784insT								SNRPD1 (7575 upstream) : ABHD3 (13074 downstream)																																			---	---	---	---
C18orf45	85019	broad.mit.edu	37	18	20848768	20848769	+	Intron	DEL	GT	-	-	rs72363310		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20848768_20848769delGT	uc010xaq.1	-											Homo sapiens cDNA FLJ41629 fis, clone DFNES2010502.							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)																	---	---	---	---
DCC	1630	broad.mit.edu	37	18	49868650	49868651	+	Intron	INS	-	GT	GT	rs150869606	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49868650_49868651insGT	uc002lfe.1	+							NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
DCC	1630	broad.mit.edu	37	18	50226667	50226668	+	Intron	DEL	CA	-	-	rs34806717		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50226667_50226668delCA	uc002lfe.1	+							NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	54707123	54707124	+	IGR	DEL	AC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54707123_54707124delAC								WDR7 (10087 upstream) : ST8SIA3 (312597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	63052541	63052542	+	IGR	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63052541_63052542delTG								None (None upstream) : CDH7 (364946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	63921502	63921502	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63921502delT								CDH7 (373328 upstream) : CDH19 (249819 downstream)																																			---	---	---	---
RTTN	25914	broad.mit.edu	37	18	67724385	67724385	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67724385delA	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron|RTTN_uc010dqp.2_Intron	NM_173630	NP_775901			rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	70299158	70299158	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70299158delA								CBLN2 (87435 upstream) : NETO1 (110393 downstream)																																			---	---	---	---
NFATC1	4772	broad.mit.edu	37	18	77167993	77167993	+	Intron	DEL	T	-	-	rs11304592		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77167993delT	uc010xfg.1	+						NFATC1_uc002lnc.1_Intron|NFATC1_uc010xff.1_Intron|NFATC1_uc002lnd.2_Intron|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfi.1_Intron|NFATC1_uc010xfj.1_Intron|NFATC1_uc002lnf.2_Intron|NFATC1_uc002lng.2_Intron|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153			nuclear factor of activated T-cells, cytosolic						intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)														---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2513914	2513915	+	3'UTR	INS	-	C	C	rs138879974	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2513914_2513915insC	uc002lwd.2	-	5					GNG7_uc010dte.1_RNA	NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	3125533	3125533	+	IGR	DEL	T	-	-	rs11351782		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3125533delT								GNA11 (4081 upstream) : GNA15 (10658 downstream)																																			---	---	---	---
CHAF1A	10036	broad.mit.edu	37	19	4412544	4412545	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4412544_4412545insA	uc002mal.2	+							NM_005483	NP_005474			chromatin assembly factor 1, subunit A (p150)						cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)									Chromatin_Structure					---	---	---	---
Unknown	0	broad.mit.edu	37	19	4444654	4444655	+	IGR	INS	-	CCG	CCG	rs139000330	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4444654_4444655insCCG								CHAF1A (1261 upstream) : UBXN6 (606 downstream)																																			---	---	---	---
PLIN5	440503	broad.mit.edu	37	19	4528426	4528426	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4528426delT	uc002mas.2	-							NM_001013706	NP_001013728			lipid storage droplet protein 5							lipid particle					0																		---	---	---	---
ACSBG2	81616	broad.mit.edu	37	19	6133501	6133502	+	5'Flank	DEL	TG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6133501_6133502delTG	uc002mef.1	+						ACSBG2_uc002mee.1_5'Flank|ACSBG2_uc002meg.1_5'Flank|ACSBG2_uc002meh.1_5'Flank|ACSBG2_uc002mei.1_5'Flank|ACSBG2_uc010xiz.1_5'Flank	NM_030924	NP_112186			bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1																		---	---	---	---
INSR	3643	broad.mit.edu	37	19	7191940	7191943	+	Intron	DEL	GGAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7191940_7191943delGGAA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	10187316	10187318	+	IGR	DEL	AGA	-	-	rs34886019		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10187316_10187318delAGA								C3P1 (2505 upstream) : C19orf66 (9488 downstream)																																			---	---	---	---
DNMT1	1786	broad.mit.edu	37	19	10306290	10306290	+	5'Flank	DEL	C	-	-	rs79563357		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10306290delC	uc002mng.2	-						DNMT1_uc010xlc.1_5'Flank|DNMT1_uc002mnh.2_5'Flank|DNMT1_uc010xld.1_5'Flank	NM_001379	NP_001370			DNA (cytosine-5-)-methyltransferase 1 isoform b						chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	11381083	11381084	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11381083_11381084insA								DOCK6 (7926 upstream) : TSPAN16 (25740 downstream)																																			---	---	---	---
ZNF709	163051	broad.mit.edu	37	19	12635268	12635268	+	Intron	DEL	A	-	-	rs74708199		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12635268delA	uc002mtx.3	-							NM_001145647	NP_001139119			zinc finger protein 709 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	13282255	13282256	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13282255_13282256insT								IER2 (16539 upstream) : CACNA1A (35000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	13744730	13744731	+	IGR	INS	-	TG	TG	rs143234949	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13744730_13744731insTG								CACNA1A (127456 upstream) : CCDC130 (97843 downstream)																																			---	---	---	---
ASF1B	55723	broad.mit.edu	37	19	14249732	14249732	+	5'Flank	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14249732delT	uc002mye.2	-						uc002myf.2_Intron	NM_018154	NP_060624			anti-silencing function 1B						cell differentiation|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus					0																		---	---	---	---
LPHN1	22859	broad.mit.edu	37	19	14297376	14297376	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14297376delC	uc010xnn.1	-						LPHN1_uc010xno.1_Intron	NM_001008701	NP_001008701			latrophilin 1 isoform 1 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5																		---	---	---	---
ZNF333	84449	broad.mit.edu	37	19	14810278	14810278	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14810278delT	uc002mzn.2	+						ZNF333_uc010dzq.2_Intron|ZNF333_uc002mzk.3_Intron|ZNF333_uc002mzl.3_Intron|ZNF333_uc002mzm.2_Intron|ZNF333_uc010dzr.1_Intron	NM_032433	NP_115809			zinc finger protein 333						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	15172349	15172350	+	IGR	DEL	GT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15172349_15172350delGT								CASP14 (5449 upstream) : OR1I1 (25527 downstream)																																			---	---	---	---
FKBP8	23770	broad.mit.edu	37	19	18655307	18655308	+	5'Flank	INS	-	TGGA	TGGA	rs146266680		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18655307_18655308insTGGA	uc002njk.1	-						FKBP8_uc010xqi.1_5'Flank|FKBP8_uc002njj.1_5'Flank|FKBP8_uc002njl.1_5'Flank|FKBP8_uc002njm.1_5'Flank|FKBP8_uc010ebr.1_5'Flank|FKBP8_uc002njn.2_5'Flank	NM_012181	NP_036313			FK506-binding protein 8						apoptosis|interspecies interaction between organisms|intracellular signal transduction|protein folding	integral to endoplasmic reticulum membrane|mitochondrial membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|protein binding			ovary(1)	1																		---	---	---	---
ZNF681	148213	broad.mit.edu	37	19	23936063	23936064	+	Intron	INS	-	G	G	rs140838429	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23936063_23936064insG	uc002nrk.3	-						ZNF681_uc002nrl.3_Intron|ZNF681_uc002nrj.3_Intron|ZNF681_uc002nrm.1_Intron	NM_138286	NP_612143			zinc finger protein 681						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	27856979	27856979	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27856979delC								None (None upstream) : LOC148189 (424423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29359845	29359846	+	IGR	INS	-	AC	AC	rs145225852	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29359845_29359846insAC								None (None upstream) : LOC148145 (96194 downstream)																																			---	---	---	---
CHST8	64377	broad.mit.edu	37	19	34172777	34172777	+	Intron	DEL	T	-	-	rs67250338		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34172777delT	uc002nus.3	+						CHST8_uc002nut.3_Intron|CHST8_uc002nuu.2_5'Flank	NM_001127895	NP_001121367			carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)																	---	---	---	---
CHST8	64377	broad.mit.edu	37	19	34195306	34195314	+	Intron	DEL	GGGTCACTG	-	-	rs67549038		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34195306_34195314delGGGTCACTG	uc002nus.3	+						CHST8_uc002nut.3_Intron|CHST8_uc002nuu.2_Intron	NM_001127895	NP_001121367			carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	34524735	34524736	+	IGR	DEL	AC	-	-	rs71798653		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34524735_34524736delAC								KCTD15 (218070 upstream) : LSM14A (138616 downstream)																																			---	---	---	---
KIAA0355	9710	broad.mit.edu	37	19	34802355	34802355	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34802355delT	uc002nvd.3	+							NM_014686	NP_055501			hypothetical protein LOC9710											ovary(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---
PDCD2L	84306	broad.mit.edu	37	19	34910405	34910405	+	Intron	DEL	T	-	-	rs10706238		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34910405delT	uc002nvj.2	+							NM_032346	NP_115722			programmed cell death 2-like							cytoplasm				ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)															---	---	---	---
FAM187B	148109	broad.mit.edu	37	19	35716283	35716295	+	Intron	DEL	GGGCTCCACCCGT	-	-	rs74267587		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35716283_35716295delGGGCTCCACCCGT	uc002nyk.1	-							NM_152481	NP_689694			family with sequence similarity 187, member B							integral to membrane				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	37285235	37285235	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37285235delG								ZNF567 (70987 upstream) : ZNF790 (23098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	37794821	37794822	+	IGR	DEL	AC	-	-	rs71177438		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37794821_37794822delAC								ZNF383 (60247 upstream) : HKR1 (8917 downstream)																																			---	---	---	---
RINL	126432	broad.mit.edu	37	19	39359607	39359607	+	3'UTR	DEL	T	-	-	rs111788981		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39359607delT	uc002ojq.2	-	12					RINL_uc002ojr.1_3'UTR|RINL_uc010xuo.1_3'UTR	NM_198445	NP_940847			Ras and Rab interactor-like								GTPase activator activity			pancreas(1)	1																		---	---	---	---
SELV	348303	broad.mit.edu	37	19	40008129	40008129	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40008129delA	uc010xvc.1	+							NM_182704	NP_874363			selenoprotein V						cell redox homeostasis		selenium binding				0	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;8.61e-26)|all cancers(26;2.76e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)															---	---	---	---
PSG6	5675	broad.mit.edu	37	19	43495725	43495725	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43495725delG	uc002ovh.1	-						PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron					SubName: Full=Putative uncharacterized protein PSG6;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	43809000	43809005	+	IGR	DEL	ACACAC	-	-	rs67675047		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43809000_43809005delACACAC								PSG9 (35318 upstream) : PRG1 (44203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	43873033	43873033	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43873033delG								CD177 (5554 upstream) : TEX101 (19730 downstream)																																			---	---	---	---
XRCC1	7515	broad.mit.edu	37	19	44066595	44066595	+	Intron	DEL	T	-	-	rs3213318		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44066595delT	uc002owt.2	-						XRCC1_uc010xwp.1_Intron	NM_006297	NP_006288			X-ray repair cross complementing protein 1						base-excision repair|single strand break repair	nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(2)|large_intestine(1)|prostate(1)|breast(1)	7		Prostate(69;0.0153)											Other_BER_factors					---	---	---	---
CEACAM19	56971	broad.mit.edu	37	19	45179213	45179213	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45179213delT	uc002ozo.3	+						CEACAM19_uc002ozp.3_Intron	NM_020219	NP_064604			carcinoembryonic antigen-related cell adhesion							integral to membrane					0	Lung NSC(12;0.00308)|all_lung(12;0.00806)	Prostate(69;0.0376)																---	---	---	---
FOXA3	3171	broad.mit.edu	37	19	46371358	46371358	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46371358delA	uc002pdr.2	+							NM_004497	NP_004488			forkhead box A3						brain development|cellular glucose homeostasis|cellular response to starvation|chromatin modification|embryo development|endocrine pancreas development|negative regulation of cell proliferation|neural plate anterior/posterior regionalization|neuron fate specification|positive regulation of hepatocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|spermatogenesis	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(1)	1		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)														---	---	---	---
ZNF114	163071	broad.mit.edu	37	19	48771768	48771769	+	5'Flank	DEL	AA	-	-	rs10536244		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48771768_48771769delAA	uc002pil.1	+						ZNF114_uc010elv.1_5'Flank|ZNF114_uc002pim.1_5'Flank	NM_153608	NP_705836			zinc finger protein 114						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)														---	---	---	---
CGB7	94027	broad.mit.edu	37	19	49566269	49566270	+	Intron	INS	-	T	T	rs34534089		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49566269_49566270insT	uc010yah.1	-						NTF4_uc002pmf.3_Intron					SubName: Full=cDNA FLJ60732;						apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)													---	---	---	---
TRPM4	54795	broad.mit.edu	37	19	49685348	49685351	+	Intron	DEL	TCTG	-	-	rs72249769	by1000genomes;by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49685348_49685351delTCTG	uc002pmw.2	+						TRPM4_uc010emu.2_Intron|TRPM4_uc010yak.1_Intron|TRPM4_uc002pmx.2_Intron|TRPM4_uc010emv.2_Intron|TRPM4_uc010yal.1_Intron|TRPM4_uc002pmy.2_5'Flank	NM_017636	NP_060106			transient receptor potential cation channel,						dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)														---	---	---	---
BCL2L12	83596	broad.mit.edu	37	19	50171349	50171350	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50171349_50171350insT	uc002ppa.2	+						IRF3_uc010end.1_5'Flank|IRF3_uc002pox.1_5'Flank|IRF3_uc002poy.1_5'Flank|IRF3_uc002pou.2_5'Flank|IRF3_uc002pov.2_5'Flank|IRF3_uc002pow.2_5'Flank|IRF3_uc002poz.1_5'Flank|BCL2L12_uc002ppb.2_Intron	NM_138639	NP_619580			BCL2-like 12 isoform 1						apoptosis					central_nervous_system(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.000681)|GBM - Glioblastoma multiforme(134;0.0214)														---	---	---	---
MYBPC2	4606	broad.mit.edu	37	19	50933999	50934000	+	5'Flank	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50933999_50934000insA	uc002psf.2	+							NM_004533	NP_004524			myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)														---	---	---	---
MYBPC2	4606	broad.mit.edu	37	19	50959635	50959638	+	Intron	DEL	ATCC	-	-	rs140639802		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50959635_50959638delATCC	uc002psf.2	+							NM_004533	NP_004524			myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	55636111	55636124	+	IGR	DEL	ACAAGAACTTCAAA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55636111_55636124delACAAGAACTTCAAA								PPP1R12C (7184 upstream) : TNNT1 (8038 downstream)																																			---	---	---	---
BRSK1	84446	broad.mit.edu	37	19	55795213	55795214	+	5'Flank	DEL	CT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55795213_55795214delCT	uc002qkg.2	+						BRSK1_uc002qkf.2_Intron	NM_032430	NP_115806			BR serine/threonine kinase 1						establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)														---	---	---	---
ISOC2	79763	broad.mit.edu	37	19	55964546	55964547	+	3'UTR	INS	-	C	C	rs139098245	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55964546_55964547insC	uc002qlb.2	-	6					ISOC2_uc002qla.2_3'UTR|ISOC2_uc002qlc.2_3'UTR	NM_001136201	NP_001129673			isochorismatase domain containing 2 isoform 1						protein destabilization	mitochondrion|nucleus	catalytic activity|protein binding			ovary(1)	1	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)														---	---	---	---
ZFP28	140612	broad.mit.edu	37	19	57052943	57052943	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57052943delC	uc002qnj.2	+						ZFP28_uc002qni.2_Intron	NM_020828	NP_065879			zinc finger protein 28						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)														---	---	---	---
ZNF543	125919	broad.mit.edu	37	19	57838235	57838235	+	Intron	DEL	G	-	-	rs10549195		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57838235delG	uc002qoi.1	+							NM_213598	NP_998763			zinc finger protein 543						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	59118934	59118934	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59118934delT								MGC2752 (8084 upstream) : None (None downstream)																																			---	---	---	---
TRIB3	57761	broad.mit.edu	37	20	362386	362387	+	Intron	INS	-	G	G	rs146335136	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:362386_362387insG	uc002wdm.2	+						TRIB3_uc002wdn.2_Intron	NM_021158	NP_066981			tribbles 3						apoptosis|cellular lipid metabolic process|insulin receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fatty acid biosynthetic process|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein binding|positive regulation of ubiquitin-protein ligase activity|regulation of glucose transport|regulation of MAP kinase activity|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	ATP binding|protein kinase activity|protein kinase binding|protein kinase inhibitor activity|transcription corepressor activity|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			central_nervous_system(2)	2		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)														---	---	---	---
FAM110A	83541	broad.mit.edu	37	20	835501	835502	+	Intron	DEL	TG	-	-	rs71728684		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:835501_835502delTG	uc010fzz.2	+											Homo sapiens F10 mRNA for hypothetical protein, complete cds.							microtubule organizing center|spindle pole	protein binding				0																		---	---	---	---
FAM110A	83541	broad.mit.edu	37	20	835764	835765	+	Intron	DEL	AA	-	-	rs34195094		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:835764_835765delAA	uc010fzz.2	+											Homo sapiens F10 mRNA for hypothetical protein, complete cds.							microtubule organizing center|spindle pole	protein binding				0																		---	---	---	---
FKBP1A	2280	broad.mit.edu	37	20	1332892	1332893	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332892_1332893insT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron					Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)													---	---	---	---
EBF4	57593	broad.mit.edu	37	20	2672638	2672638	+	5'Flank	DEL	A	-	-	rs11288953		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2672638delA	uc002wgt.3	+						EBF4_uc002wgs.3_5'Flank	NM_001110514	NP_001103984			early B-cell factor 4						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding				0																		---	---	---	---
C20orf141	128653	broad.mit.edu	37	20	2795560	2795562	+	5'Flank	DEL	AGC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2795560_2795562delAGC	uc010gat.2	+						C20orf141_uc002wgv.1_5'Flank|C20orf141_uc002wgw.2_5'Flank|uc002wgx.1_5'Flank|uc002wgy.1_5'Flank	NM_080739	NP_542777			hypothetical protein LOC128653							integral to membrane					0																		---	---	---	---
PTPRA	5786	broad.mit.edu	37	20	2861958	2861958	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2861958delA	uc010zqb.1	+						VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|PTPRA_uc010zqc.1_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc010zqd.1_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_Intron					SubName: Full=cDNA FLJ60525, highly similar to Receptor-type tyrosine-protein phosphatase alpha (EC 3.1.3.48);						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	3166507	3166507	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3166507delG								ProSAPiP1 (12315 upstream) : DDRGK1 (4511 downstream)																																			---	---	---	---
C20orf194	25943	broad.mit.edu	37	20	3351101	3351102	+	Intron	INS	-	G	G	rs140437596	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3351101_3351102insG	uc002wii.2	-						C20orf194_uc002wik.2_Intron|C20orf194_uc010gay.1_Intron	NM_001009984	NP_001009984			hypothetical protein LOC25943												0																		---	---	---	---
ATRN	8455	broad.mit.edu	37	20	3482245	3482245	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3482245delG	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537			attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---
SPEF1	25876	broad.mit.edu	37	20	3761598	3761599	+	Intron	INS	-	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3761598_3761599insC	uc002wjj.2	-							NM_015417	NP_056232			calponin-homology and microtubule-associated							cilium axoneme|cytoplasm|cytoskeleton					0																		---	---	---	---
CRLS1	54675	broad.mit.edu	37	20	5984182	5984182	+	5'Flank	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5984182delA	uc002wmn.3	+						CRLS1_uc010gbq.2_5'Flank	NM_019095	NP_061968			cardiolipin synthase 1 isoform 1						phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphotransferase activity, for other substituted phosphate groups				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	6783522	6783523	+	IGR	DEL	TC	-	-	rs4053193		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6783522_6783523delTC								BMP2 (22612 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6791395	6791395	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6791395delA								BMP2 (30485 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6897117	6897117	+	IGR	DEL	T	-	-	rs11326349		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6897117delT								BMP2 (136207 upstream) : HAO1 (966514 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7123262	7123263	+	IGR	INS	-	ACAC	ACAC	rs145079903	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7123262_7123263insACAC								BMP2 (362352 upstream) : HAO1 (740368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7277484	7277484	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7277484delG								BMP2 (516574 upstream) : HAO1 (586147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7448915	7448915	+	IGR	DEL	A	-	-	rs36124278		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7448915delA								BMP2 (688005 upstream) : HAO1 (414716 downstream)																																			---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8112028	8112028	+	5'Flank	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8112028delA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_5'Flank|PLCB1_uc002wmz.1_5'Flank|PLCB1_uc002wna.2_5'Flank	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PAK7	57144	broad.mit.edu	37	20	9714036	9714043	+	Intron	DEL	TCTTTCTT	-	-	rs138872634		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9714036_9714043delTCTTTCTT	uc002wnl.2	-						PAK7_uc002wnk.2_Intron|PAK7_uc002wnj.2_Intron|PAK7_uc010gby.1_Intron	NM_020341	NP_065074			p21-activated kinase 7								ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	10156379	10156382	+	Intron	DEL	TTTT	-	-	rs113205709		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10156379_10156382delTTTT	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																														---	---	---	---
MKKS	8195	broad.mit.edu	37	20	10412596	10412597	+	5'Flank	INS	-	AT	AT	rs139704720	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10412596_10412597insAT	uc002wnt.1	-						MKKS_uc002wnu.1_Intron|MKKS_uc010zrd.1_Intron	NM_018848	NP_061336			McKusick-Kaufman syndrome protein						brain morphogenesis|cerebral cortex development|convergent extension involved in gastrulation|detection of mechanical stimulus involved in sensory perception of sound|fat cell differentiation|flagellum assembly|gonad development|heart looping|hippocampus development|intracellular transport|melanosome transport|photoreceptor cell maintenance|pigment granule aggregation in cell center|protein folding|regulation of cilium beat frequency involved in ciliary motility|sensory perception of smell|social behavior|spermatid development|striatum development	cytosol|microtubule organizing center|motile cilium	ATP binding|unfolded protein binding				0														Bardet-Biedl_syndrome				---	---	---	---
C20orf94	128710	broad.mit.edu	37	20	10483420	10483420	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10483420delT	uc010zre.1	+							NM_001009608	NP_001009608			hypothetical protein LOC128710								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	11516851	11516852	+	IGR	INS	-	AG	AG	rs142168728	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11516851_11516852insAG								JAG1 (862157 upstream) : BTBD3 (354625 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11824857	11824858	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11824857_11824858insA								None (None upstream) : BTBD3 (46619 downstream)																																			---	---	---	---
SPTLC3	55304	broad.mit.edu	37	20	13075041	13075042	+	Intron	DEL	CA	-	-	rs146862604		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13075041_13075042delCA	uc002wod.1	+							NM_018327	NP_060797			serine palmitoyltransferase, long chain base						sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15060709	15060710	+	Intron	INS	-	T	T	rs143194889	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15060709_15060710insT	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15093597	15093598	+	Intron	DEL	TG	-	-	rs148299168		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15093597_15093598delTG	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15718504	15718505	+	Intron	INS	-	ATGG	ATGG	rs140170435	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15718504_15718505insATGG	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	16239110	16239111	+	IGR	INS	-	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16239110_16239111insC								MACROD2 (205271 upstream) : KIF16B (13638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	16562674	16562685	+	IGR	DEL	CTCTCTCTCTCT	-	-	rs35603915		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16562674_16562685delCTCTCTCTCTCT								KIF16B (8596 upstream) : SNRPB2 (147944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	16809242	16809243	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16809242_16809243insT								OTOR (76434 upstream) : PCSK2 (397509 downstream)																																			---	---	---	---
RRBP1	6238	broad.mit.edu	37	20	17653656	17653656	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17653656delG	uc010zrq.1	-						RRBP1_uc002wpv.1_Intron|RRBP1_uc002wpw.1_Intron|RRBP1_uc010gcl.1_Intron|RRBP1_uc010zrr.1_Intron					SubName: Full=RRBP1 protein; Flags: Fragment;						protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	17888327	17888328	+	IGR	INS	-	TTGAGAC	TTGAGAC	rs140685337	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17888327_17888328insTTGAGAC								BANF2 (171810 upstream) : SNX5 (33918 downstream)																																			---	---	---	---
OVOL2	58495	broad.mit.edu	37	20	18040038	18040039	+	5'Flank	INS	-	GGA	GGA	rs142796428	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18040038_18040039insGGA	uc002wqi.1	-							NM_021220	NP_067043			zinc finger protein 339						negative regulation of keratinocyte differentiation|negative regulation of Notch signaling pathway|negative regulation of transcription by competitive promoter binding|regulation of cell cycle|regulation of keratinocyte proliferation|transcription, DNA-dependent	nucleus	DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
HSPC072	29075	broad.mit.edu	37	20	18775373	18775374	+	5'Flank	INS	-	G	G	rs144598150	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18775373_18775374insG	uc002wrg.2	-						HSPC072_uc002wri.3_5'Flank|HSPC072_uc002wrh.3_5'Flank|LOC100270804_uc010zsc.1_RNA	NR_026884				Homo sapiens HSPC072 mRNA, complete cds.												0																		---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19535029	19535029	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19535029delT	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20156163	20156164	+	Intron	INS	-	T	T	rs144677336	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20156163_20156164insT	uc002wru.2	+						C20orf26_uc010zse.1_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	21233421	21233422	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21233421_21233422insA								PLK1S1 (6165 upstream) : XRN2 (50520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21592784	21592785	+	IGR	INS	-	AC	AC	rs143635288	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21592784_21592785insAC								NKX2-2 (98120 upstream) : PAX1 (93512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22104960	22104963	+	IGR	DEL	AAAT	-	-	rs72262034		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22104960_22104963delAAAT								PAX1 (408340 upstream) : LOC284788 (276008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23529061	23529062	+	IGR	INS	-	T	T	rs149576925	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23529061_23529062insT								CSTT (6408 upstream) : CST9L (16310 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23834146	23834147	+	IGR	INS	-	C	C	rs142924005	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23834146_23834147insC								CST2 (26834 upstream) : CST5 (22425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24725110	24725110	+	IGR	DEL	G	-	-	rs66711900		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24725110delG								TMEM90B (77943 upstream) : CST7 (204756 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24726939	24726939	+	IGR	DEL	C	-	-	rs11300871		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24726939delC								TMEM90B (79772 upstream) : CST7 (202927 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24771039	24771040	+	IGR	DEL	AT	-	-	rs144865037		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24771039_24771040delAT								TMEM90B (123872 upstream) : CST7 (158826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25069978	25069978	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25069978delC								VSX1 (7211 upstream) : LOC284798 (51456 downstream)																																			---	---	---	---
ABHD12	26090	broad.mit.edu	37	20	25351485	25351486	+	Intron	INS	-	T	T	rs72105239		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25351485_25351486insT	uc002wus.1	-						ABHD12_uc002wuq.2_Intron|ABHD12_uc002wur.2_Intron|ABHD12_uc002wut.1_Intron|ABHD12_uc002wuu.1_Intron	NM_001042472	NP_001035937			abhydrolase domain containing 12 isoform a							integral to membrane	acylglycerol lipase activity			skin(1)	1																		---	---	---	---
NINL	22981	broad.mit.edu	37	20	25540402	25540403	+	Intron	INS	-	T	T	rs78523201		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25540402_25540403insT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron	NM_025176	NP_079452			ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25858804	25858805	+	IGR	INS	-	A	A	rs140974923	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25858804_25858805insA								FAM182B (10018 upstream) : LOC100134868 (131630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25893268	25893268	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25893268delC								FAM182B (44482 upstream) : LOC100134868 (97167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25906988	25906988	+	IGR	DEL	T	-	-	rs138412925	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25906988delT								FAM182B (58202 upstream) : LOC100134868 (83447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26117513	26117514	+	IGR	INS	-	GGTGGT	GGTGGT			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26117513_26117514insGGTGGT								C20orf191 (22836 upstream) : MIR663 (71308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26209829	26209829	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26209829delT								MIR663 (20915 upstream) : None (None downstream)																																			---	---	---	---
HM13	81502	broad.mit.edu	37	20	30110664	30110665	+	Intron	INS	-	A	A	rs148539717	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30110664_30110665insA	uc002wwe.2	+						HM13_uc002wwc.2_Intron|HM13_uc002wwd.2_Intron|HM13_uc002wwb.1_Intron	NM_030789	NP_110416			minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)															---	---	---	---
HM13	81502	broad.mit.edu	37	20	30115629	30115629	+	Intron	DEL	T	-	-	rs11475928		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30115629delT	uc002wwe.2	+						HM13_uc002wwc.2_Intron|HM13_uc002wwd.2_Intron|HM13_uc002wwb.1_Intron	NM_030789	NP_110416			minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	30217236	30217236	+	IGR	DEL	A	-	-	rs113006911		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30217236delA								ID1 (22923 upstream) : COX4I2 (8455 downstream)																																			---	---	---	---
TPX2	22974	broad.mit.edu	37	20	30329289	30329290	+	Intron	INS	-	T	T	rs139357834		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30329289_30329290insT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244			TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)															---	---	---	---
TM9SF4	9777	broad.mit.edu	37	20	30735309	30735310	+	Intron	INS	-	A	A	rs138949307	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30735309_30735310insA	uc002wxj.2	+						TM9SF4_uc010zts.1_Intron|TM9SF4_uc002wxk.2_Intron|TM9SF4_uc010gdz.2_Intron	NM_014742	NP_055557			transmembrane 9 superfamily protein member 4							integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	30836519	30836519	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30836519delA								POFUT1 (10053 upstream) : KIF3B (28948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	31288810	31288811	+	IGR	INS	-	T	T	rs71886654		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31288810_31288811insT								C20orf203 (27067 upstream) : COMMD7 (1683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	32073501	32073501	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32073501delT								SNTA1 (41803 upstream) : CBFA2T2 (4427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	32469222	32469223	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32469222_32469223insT								CHMP4B (27053 upstream) : RALY (112509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	32537183	32537184	+	IGR	INS	-	CT	CT	rs141614782	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32537183_32537184insCT								CHMP4B (95014 upstream) : RALY (44548 downstream)																																			---	---	---	---
RALY	22913	broad.mit.edu	37	20	32660736	32660739	+	Intron	DEL	GTGT	-	-	rs3835232		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32660736_32660739delGTGT	uc002xab.2	+						RALY_uc010zui.1_Intron|RALY_uc002xac.2_Intron|RALY_uc002xad.2_Intron|RALY_uc002xae.1_Intron	NM_016732	NP_057951			RNA binding protein (autoantigenic,							catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	33418455	33418455	+	IGR	DEL	A	-	-	rs76379438		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33418455delA								NCOA6 (5022 upstream) : HMGB3L1 (2925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	34656832	34656832	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34656832delA								LOC647979 (17950 upstream) : EPB41L1 (22594 downstream)																																			---	---	---	---
DLGAP4	22839	broad.mit.edu	37	20	35048420	35048420	+	Intron	DEL	A	-	-	rs11476708		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35048420delA	uc002xff.2	+						DLGAP4_uc010zvp.1_Intron	NM_014902	NP_055717			disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
C20orf117	140710	broad.mit.edu	37	20	35436759	35436759	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35436759delA	uc002xgd.1	-						C20orf117_uc002xge.1_Intron	NM_199181	NP_954650			hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36308111	36308111	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36308111delT								BLCAP (151808 upstream) : CTNNBL1 (14323 downstream)																																			---	---	---	---
RPRD1B	58490	broad.mit.edu	37	20	36680267	36680267	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36680267delC	uc002xho.3	+							NM_021215	NP_067038			Regulation of nuclear pre-mRNA domain containing											pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	37959432	37959432	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37959432delT								LOC339568 (106041 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39999332	39999333	+	IGR	INS	-	T	T	rs72378067		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39999332_39999333insT								EMILIN3 (3834 upstream) : CHD6 (31837 downstream)																																			---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41079270	41079271	+	Intron	INS	-	T	T	rs149007287	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41079270_41079271insT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	42038293	42038293	+	IGR	DEL	T	-	-	rs148204885		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42038293delT								PTPRT (219736 upstream) : SFRS6 (48211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	43805252	43805254	+	IGR	DEL	CTT	-	-	rs71339829		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43805252_43805254delCTT								PI3 (68 upstream) : SEMG1 (30384 downstream)																																			---	---	---	---
SDC4	6385	broad.mit.edu	37	20	43958412	43958413	+	Intron	INS	-	AT	AT	rs146669456	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43958412_43958413insAT	uc002xnu.2	-						SDC4_uc010zws.1_Intron	NM_002999	NP_002990			syndecan 4 precursor							extracellular region|integral to plasma membrane	cytoskeletal protein binding|thrombospondin receptor activity				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
WFDC9	259240	broad.mit.edu	37	20	44258875	44258877	+	Intron	DEL	TTG	-	-	rs75601807		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44258875_44258877delTTG	uc002xoy.2	-						WFDC10A_uc002xoz.2_Intron	NM_147198	NP_671731			protease inhibitor WAP9 precursor							extracellular region					0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SLC12A5	57468	broad.mit.edu	37	20	44658529	44658532	+	Intron	DEL	GCGC	-	-	rs33990605	by1000genomes;by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44658529_44658532delGCGC	uc010zxl.1	+						SLC12A5_uc002xra.2_Intron|SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Intron	NM_001134771	NP_001128243			solute carrier family 12 (potassium-chloride						potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)													---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45572080	45572081	+	Intron	DEL	TC	-	-	rs11469779		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45572080_45572081delTC	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	46123110	46123111	+	IGR	DEL	AT	-	-	rs72186538		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46123110_46123111delAT								ZMYND8 (137636 upstream) : NCOA3 (7546 downstream)																																			---	---	---	---
NCOA3	8202	broad.mit.edu	37	20	46283608	46283609	+	3'UTR	INS	-	TG	TG	rs144164627	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46283608_46283609insTG	uc002xtk.2	+	23					NCOA3_uc002xtl.2_3'UTR|NCOA3_uc002xtm.2_3'UTR|NCOA3_uc002xtn.2_3'UTR|NCOA3_uc010zyc.1_3'UTR	NM_181659	NP_858045			nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5																		---	---	---	---
SULF2	55959	broad.mit.edu	37	20	46413142	46413144	+	Intron	DEL	GGA	-	-	rs11470952		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46413142_46413144delGGA	uc002xto.2	-						SULF2_uc002xtr.2_Intron|SULF2_uc002xtq.2_Intron|SULF2_uc010ghv.1_Intron	NM_018837	NP_061325			sulfatase 2 isoform a precursor						bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	46526858	46526860	+	IGR	DEL	TAT	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46526858_46526860delTAT								SULF2 (111498 upstream) : LOC284749 (461794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	46627291	46627292	+	IGR	INS	-	TGTG	TGTG	rs141198278	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46627291_46627292insTGTG								SULF2 (211931 upstream) : LOC284749 (361362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	47501046	47501046	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47501046delA								PREX1 (56626 upstream) : ARFGEF2 (37229 downstream)																																			---	---	---	---
B4GALT5	9334	broad.mit.edu	37	20	48314113	48314113	+	Intron	DEL	T	-	-	rs11476870		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48314113delT	uc002xuu.3	-							NM_004776	NP_004767			UDP-Gal:betaGlcNAc beta 1,4-						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48356146	48356147	+	IGR	INS	-	C	C	rs146658074	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48356146_48356147insC								B4GALT5 (25725 upstream) : SLC9A8 (73103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48639084	48639086	+	IGR	DEL	AAC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48639084_48639086delAAC								SNAI1 (33666 upstream) : TMEM189-UBE2V1 (58577 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48644815	48644830	+	IGR	DEL	ACACACACACACACAC	-	-	rs36232176	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48644815_48644830delACACACACACACACAC								SNAI1 (39397 upstream) : TMEM189-UBE2V1 (52833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	50452698	50452698	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50452698delT								SALL4 (33650 upstream) : ZFP64 (247853 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	50824044	50824044	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50824044delG								ZFP64 (15520 upstream) : TSHZ2 (764833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	50888013	50888018	+	IGR	DEL	GTGTGT	-	-	rs74177430		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50888013_50888018delGTGTGT								ZFP64 (79489 upstream) : TSHZ2 (700859 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51716006	51716007	+	Intron	INS	-	TAA	TAA	rs139022522	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51716006_51716007insTAA	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51746372	51746372	+	Intron	DEL	T	-	-	rs73625472		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51746372delT	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52412181	52412181	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52412181delT								ZNF217 (201380 upstream) : SUMO1P1 (78861 downstream)																																			---	---	---	---
BCAS1	8537	broad.mit.edu	37	20	52633939	52633939	+	Intron	DEL	T	-	-	rs112011911		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52633939delT	uc002xws.2	-						BCAS1_uc010zzb.1_Intron|BCAS1_uc010gim.2_Intron|BCAS1_uc002xwt.2_Intron|BCAS1_uc010gil.1_Intron	NM_003657	NP_003648			breast carcinoma amplified sequence 1							cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	53411786	53411787	+	IGR	INS	-	C	C	rs146457262	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53411786_53411787insC								DOK5 (144077 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53574827	53574828	+	IGR	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53574827_53574828insT								DOK5 (307118 upstream) : CBLN4 (997669 downstream)																																			---	---	---	---
C20orf108	116151	broad.mit.edu	37	20	54931365	54931365	+	5'Flank	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54931365delG	uc002xxc.2	+							NM_080821	NP_543011			hypothetical protein LOC116151							integral to membrane					0			Colorectal(105;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	56127342	56127342	+	IGR	DEL	T	-	-	rs11332246		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56127342delT								CTCFL (26634 upstream) : PCK1 (8795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56148822	56148822	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56148822delT								PCK1 (7315 upstream) : ZBP1 (30082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56516510	56516511	+	IGR	INS	-	G	G	rs144363474	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56516510_56516511insG								PMEPA1 (229969 upstream) : C20orf85 (209472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56590378	56590378	+	IGR	DEL	T	-	-	rs11474778		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56590378delT								PMEPA1 (303837 upstream) : C20orf85 (135605 downstream)																																			---	---	---	---
PPP4R1L	55370	broad.mit.edu	37	20	56835701	56835701	+	Intron	DEL	T	-	-	rs10710910		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56835701delT	uc002xyy.1	-						PPP4R1L_uc010gjn.1_Intron					SubName: Full=cDNA FLJ50842, moderately similar to Serine/threonine-protein phosphatase 4regulatory subunit 1;												0																		---	---	---	---
PPP4R1L	55370	broad.mit.edu	37	20	56851167	56851168	+	Intron	INS	-	TCACAAG	TCACAAG	rs145758727	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56851167_56851168insTCACAAG	uc002xyy.1	-						PPP4R1L_uc010gjn.1_Intron					SubName: Full=cDNA FLJ50842, moderately similar to Serine/threonine-protein phosphatase 4regulatory subunit 1;												0																		---	---	---	---
NPEPL1	79716	broad.mit.edu	37	20	57279344	57279344	+	Intron	DEL	A	-	-	rs3833302		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57279344delA	uc010zzs.1	+						NPEPL1_uc010zzr.1_Intron|NPEPL1_uc002xzn.2_Intron|NPEPL1_uc010gjo.1_Intron|NPEPL1_uc002xzp.2_Intron	NM_024663	NP_078939			aminopeptidase-like 1						proteolysis	cytoplasm	aminopeptidase activity|manganese ion binding|metalloexopeptidase activity				0	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	59606620	59606620	+	IGR	DEL	C	-	-	rs66698191		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59606620delC								MIR646 (722995 upstream) : CDH4 (220939 downstream)																																			---	---	---	---
RPS21	6227	broad.mit.edu	37	20	60959446	60959447	+	5'Flank	INS	-	T	T	rs77335310		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60959446_60959447insT	uc002ycr.2	+						RPS21_uc002ycs.2_5'Flank|RPS21_uc002yct.2_5'Flank|RPS21_uc002ycu.2_5'Flank	NM_001024	NP_001015			ribosomal protein S21						endocrine pancreas development|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein N-terminus binding|structural constituent of ribosome				0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)															---	---	---	---
SLCO4A1	28231	broad.mit.edu	37	20	61292373	61292374	+	Intron	INS	-	AGCCCCC	AGCCCCC	rs144381587	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61292373_61292374insAGCCCCC	uc002ydb.1	+						SLCO4A1_uc002ydc.1_Intron	NM_016354	NP_057438			solute carrier organic anion transporter family						sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)															---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62082491	62082491	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62082491delA	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
EEF1A2	1917	broad.mit.edu	37	20	62123888	62123889	+	Intron	INS	-	GGAT	GGAT			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62123888_62123889insGGAT	uc002yfd.1	-						EEF1A2_uc002yfe.1_Intron|EEF1A2_uc010gkg.1_Intron	NM_001958	NP_001949			eukaryotic translation elongation factor 1 alpha							nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)															---	---	---	---
PRIC285	85441	broad.mit.edu	37	20	62191130	62191133	+	Intron	DEL	AGTC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62191130_62191133delAGTC	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412			PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	62742922	62742923	+	IGR	INS	-	A	A	rs139884290	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62742922_62742923insA								NPBWR2 (4738 upstream) : MYT1 (40221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10421787	10421788	+	IGR	INS	-	CT	CT			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10421787_10421788insCT								None (None upstream) : TPTE (484955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10621228	10621228	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10621228delG								None (None upstream) : TPTE (285515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10799447	10799451	+	IGR	DEL	GACTC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10799447_10799451delGACTC								None (None upstream) : TPTE (107292 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10825358	10825367	+	IGR	DEL	CTCGAATGGA	-	-	rs75725437		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10825358_10825367delCTCGAATGGA								None (None upstream) : TPTE (81376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10840041	10840042	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10840041_10840042insA								None (None upstream) : TPTE (66701 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10857140	10857144	+	IGR	DEL	GTCTC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10857140_10857144delGTCTC								None (None upstream) : TPTE (49599 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11089103	11089103	+	Intron	DEL	G	-	-	rs4913748		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11089103delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11099478	11099479	+	5'Flank	INS	-	A	A	rs3048558		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11099478_11099479insA	uc002yit.1	-						BAGE_uc002yix.2_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11099703	11099704	+	5'Flank	INS	-	A	A	rs139261899		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11099703_11099704insA	uc002yit.1	-						BAGE_uc002yix.2_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
LIPI	149998	broad.mit.edu	37	21	15503135	15503135	+	Intron	DEL	A	-	-	rs58866310		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15503135delA	uc002yjm.2	-						uc002yjk.2_Intron|uc002yjl.2_Intron	NM_198996	NP_945347			lipase, member I						lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)														---	---	---	---
C21orf34	388815	broad.mit.edu	37	21	17464973	17464974	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17464973_17464974insT	uc002ykb.2	+						C21orf34_uc010glc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)														---	---	---	---
C21orf34	388815	broad.mit.edu	37	21	17828674	17828675	+	Intron	INS	-	T	T	rs140482166	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17828674_17828675insT	uc002ykb.2	+						C21orf34_uc010glc.2_Intron|C21orf34_uc002ykc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)														---	---	---	---
CXADR	1525	broad.mit.edu	37	21	18930071	18930072	+	Intron	DEL	AA	-	-	rs142225425		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18930071_18930072delAA	uc002yki.2	+						CXADR_uc002ykh.1_Intron|CXADR_uc010gld.1_Intron|CXADR_uc010gle.1_Intron|CXADR_uc002ykj.1_Intron	NM_001338	NP_001329			coxsackie virus and adenovirus receptor						blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)														---	---	---	---
C21orf91	54149	broad.mit.edu	37	21	19152635	19152637	+	Intron	DEL	TGA	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19152635_19152637delTGA	uc002ykm.2	-						C21orf91_uc002ykn.2_Intron					Homo sapiens partial mRNA; ID YG81-6.											ovary(1)	1				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	20897096	20897096	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20897096delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	23667965	23667968	+	IGR	DEL	TGTG	-	-	rs142390705		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23667965_23667968delTGTG								NCAM2 (756751 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	25823491	25823492	+	Intron	INS	-	T	T	rs147905020	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25823491_25823492insT	uc002yli.1	+											Homo sapiens cDNA FLJ42200 fis, clone THYMU2034647.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	30146910	30146911	+	IGR	INS	-	A	A	rs141573730	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30146910_30146911insA								NCRNA00161 (234234 upstream) : N6AMT1 (97602 downstream)																																			---	---	---	---
BACH1	571	broad.mit.edu	37	21	30696878	30696895	+	Intron	DEL	TGTGTGTGTGTGTGTGTG	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30696878_30696895delTGTGTGTGTGTGTGTGTG	uc002ynj.2	+						BACH1_uc002ynk.2_Intron|BACH1_uc002ynl.2_Intron	NM_001186	NP_001177			BTB and CNC homology 1 transcription factor							nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|liver(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	31398844	31398845	+	IGR	INS	-	A	A	rs148724718	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31398844_31398845insA								GRIK1 (86562 upstream) : CLDN17 (139418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	32942782	32942782	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32942782delA								TIAM1 (10492 upstream) : SOD1 (89153 downstream)																																			---	---	---	---
MRAP	56246	broad.mit.edu	37	21	33667607	33667607	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33667607delT	uc002ypj.2	+						MRAP_uc002ypk.2_Intron|MRAP_uc011ado.1_Intron	NM_178817	NP_848932			melanocortin 2 receptor accessory protein						positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|integral to membrane|perinuclear region of cytoplasm|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding				0																		---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36594583	36594584	+	Intron	DEL	CA	-	-	rs78150171		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36594583_36594584delCA	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
CHAF1B	8208	broad.mit.edu	37	21	37768302	37768302	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37768302delT	uc002yvj.2	+							NM_005441	NP_005432			chromatin assembly factor 1 subunit B						cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|cytoplasm	chromatin binding|histone binding|unfolded protein binding			ovary(1)|skin(1)	2																		---	---	---	---
IGSF5	150084	broad.mit.edu	37	21	41119867	41119868	+	Intron	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41119867_41119868insA	uc002yyo.2	+							NM_001080444	NP_001073913			immunoglobulin superfamily 5 like							integral to membrane|tight junction					0		Prostate(19;5.35e-06)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	42357873	42357873	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42357873delG								DSCAM (138834 upstream) : C21orf130 (155554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	43076150	43076152	+	IGR	DEL	AAC	-	-	rs35914745		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43076150_43076152delAAC								TMPRSS2 (173107 upstream) : NCRNA00111 (23310 downstream)																																			---	---	---	---
PDE9A	5152	broad.mit.edu	37	21	44138178	44138179	+	Intron	INS	-	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44138178_44138179insT	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron	NM_002606	NP_002597			phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	44512267	44512267	+	IGR	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44512267delC								CBS (15795 upstream) : U2AF1 (799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	44861825	44861826	+	IGR	DEL	GT	-	-	rs143671391		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44861825_44861826delGT								SIK1 (14823 upstream) : C21orf125 (8078 downstream)																																			---	---	---	---
TRAPPC10	7109	broad.mit.edu	37	21	45466404	45466404	+	Intron	DEL	G	-	-	rs66490209		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45466404delG	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc002zdz.2_Intron	NM_003274	NP_003265			trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
PFKL	5211	broad.mit.edu	37	21	45720610	45720626	+	Intron	DEL	GCTGCCCGGGGCATTGA	-	-	rs112275031		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45720610_45720626delGCTGCCCGGGGCATTGA	uc002zel.2	+						PFKL_uc002zek.2_Intron|PFKL_uc011afd.1_Intron	NM_002626	NP_002617			liver phosphofructokinase						fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)														---	---	---	---
ADARB1	104	broad.mit.edu	37	21	46575986	46575986	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46575986delT	uc002zgy.2	+						ADARB1_uc002zgr.2_Intron|ADARB1_uc002zgs.2_Intron|ADARB1_uc002zgw.2_Intron|ADARB1_uc002zgv.2_Intron|ADARB1_uc002zgt.2_Intron|ADARB1_uc010gpx.2_Intron|ADARB1_uc002zgq.2_Intron|ADARB1_uc002zgu.2_Intron|ADARB1_uc011afo.1_Intron	NM_015833	NP_056648			RNA-specific adenosine deaminase B1 isoform 2						adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding			skin(1)	1				Colorectal(79;0.115)														---	---	---	---
DIP2A	23181	broad.mit.edu	37	21	47982564	47982564	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47982564delT	uc002zjo.2	+						DIP2A_uc011afz.1_Intron|DIP2A_uc002zjs.2_Intron|DIP2A_uc002zjt.2_5'Flank	NM_015151	NP_055966			disco-interacting protein 2A isoform a						multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	19648389	19648390	+	IGR	INS	-	AC	AC	rs144694600	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19648389_19648390insAC								LOC150185 (94027 upstream) : SEPT5 (53597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	21431216	21431217	+	IGR	INS	-	ACA	ACA	rs151295650	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21431216_21431217insACA								LOC400891 (12761 upstream) : POM121L8P (205497 downstream)																																			---	---	---	---
CABIN1	23523	broad.mit.edu	37	22	24483879	24483879	+	Intron	DEL	T	-	-	rs5844585		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24483879delT	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron	NM_012295	NP_036427			calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
KREMEN1	83999	broad.mit.edu	37	22	29474471	29474471	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29474471delA	uc011akm.1	+						KREMEN1_uc003ael.2_Intron	NM_032045	NP_114434			kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	32709809	32709809	+	IGR	DEL	G	-	-	rs139754480		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32709809delG								SLC5A4 (58491 upstream) : RFPL3 (41063 downstream)																																			---	---	---	---
BPIL2	254240	broad.mit.edu	37	22	32862912	32862913	+	5'Flank	INS	-	A	A	rs113967888		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32862912_32862913insA	uc011amb.1	-						BPIL2_uc003amo.3_5'Flank					SubName: Full=cDNA FLJ61439, highly similar to Bactericidal/permeability-increasingprotein-like 2;							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2																		---	---	---	---
CACNG2	10369	broad.mit.edu	37	22	37051859	37051859	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37051859delT	uc003aps.1	-							NM_006078	NP_006069			voltage-dependent calcium channel gamma-2						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0																		---	---	---	---
TMPRSS6	164656	broad.mit.edu	37	22	37468369	37468370	+	Intron	INS	-	ATGG	ATGG	rs148651823	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37468369_37468370insATGG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837			transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6																		---	---	---	---
GCAT	23464	broad.mit.edu	37	22	38204694	38204695	+	Intron	INS	-	T	T	rs113518864		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38204694_38204695insT	uc003atz.2	+						GCAT_uc003aua.1_Intron	NM_014291	NP_055106			glycine C-acetyltransferase precursor						biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
ADSL	158	broad.mit.edu	37	22	40746374	40746374	+	Intron	DEL	C	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40746374delC	uc003ayp.3	+						ADSL_uc003ays.3_Intron|ADSL_uc003ayq.3_Intron|ADSL_uc003ayr.3_Intron|ADSL_uc003ayt.3_Intron	NM_000026	NP_000017			adenylosuccinate lyase isoform a						AMP biosynthetic process|protein tetramerization|purine base metabolic process	cytosol	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	41590017	41590018	+	Intron	INS	-	TGA	TGA	rs140034156	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41590017_41590018insTGA	uc003azm.2	-											Homo sapiens, clone IMAGE:5580334, mRNA.																														---	---	---	---
CYB5R3	1727	broad.mit.edu	37	22	43044614	43044614	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43044614delG	uc003bcz.2	-						CYB5R3_uc003bcy.2_5'Flank|CYB5R3_uc003bcx.2_5'Flank	NM_000398	NP_000389			cytochrome b5 reductase 3 isoform m						blood circulation|cholesterol biosynthetic process|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|hemoglobin complex|mitochondrial outer membrane	cytochrome-b5 reductase activity			skin(1)	1					NADH(DB00157)													---	---	---	---
EFCAB6	64800	broad.mit.edu	37	22	44134261	44134262	+	Intron	DEL	CA	-	-	rs144479768		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44134261_44134262delCA	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Intron|EFCAB6_uc003beb.3_Intron	NM_022785	NP_073622			CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	44920314	44920315	+	IGR	INS	-	CTCA	CTCA	rs139826600	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44920314_44920315insCTCA								LDOC1L (26309 upstream) : NCRNA00207 (44904 downstream)																																			---	---	---	---
PHF21B	112885	broad.mit.edu	37	22	45279857	45279859	+	Intron	DEL	ATT	-	-	rs111731961		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45279857_45279859delATT	uc003bfn.2	-						PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron	NM_138415	NP_612424			PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	49153114	49153123	+	IGR	DEL	GAAGAGGAAA	-	-	rs62225054	by1000genomes;by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49153114_49153123delGAAGAGGAAA								FAM19A5 (5372 upstream) : C22orf34 (655053 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49246159	49246161	+	IGR	DEL	GAG	-	-	rs143723249	by1000genomes	TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49246159_49246161delGAG								FAM19A5 (98417 upstream) : C22orf34 (562015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49724443	49724443	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49724443delT								FAM19A5 (576701 upstream) : C22orf34 (83733 downstream)																																			---	---	---	---
PLXNB2	23654	broad.mit.edu	37	22	50714838	50714838	+	Intron	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50714838delG	uc003bkv.3	-						PLXNB2_uc003bkt.1_Intron|PLXNB2_uc003bku.1_Intron	NM_012401	NP_036533			plexin B2 precursor						regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)												OREG0026679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	X	442778	442779	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:442778_442779insA								PPP2R3B (95151 upstream) : SHOX (142300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1226810	1226811	+	IGR	INS	-	CA	CA			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1226810_1226811insCA								SHOX (606665 upstream) : CRLF2 (88076 downstream)																																			---	---	---	---
P2RY8	286530	broad.mit.edu	37	X	1592026	1592027	+	Intron	INS	-	TGGA	TGGA			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1592026_1592027insTGGA	uc004cpz.2	-							NM_178129	NP_835230			G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)						T	CRLF2	B-ALL|Downs associated ALL								---	---	---	---
POLA1	5422	broad.mit.edu	37	X	24987325	24987325	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24987325delA	uc004dbl.2	+							NM_016937	NP_058633			DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)													---	---	---	---
DMD	1756	broad.mit.edu	37	X	33038374	33038374	+	Intron	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:33038374delT	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron|DMD_uc010ngr.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
HDAC6	10013	broad.mit.edu	37	X	48675659	48675659	+	Intron	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48675659delA	uc011mmi.1	+						HDAC6_uc004dks.1_Intron|HDAC6_uc010nig.1_Intron|HDAC6_uc004dkt.1_Intron|HDAC6_uc011mmk.1_Intron|HDAC6_uc004dkv.1_Intron|HDAC6_uc004dkw.1_Intron|HDAC6_uc004dkx.1_5'Flank	NM_006044	NP_006035			histone deacetylase 6						aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	58534574	58534574	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:58534574delT								ZXDA (597507 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	67696587	67696588	+	IGR	INS	-	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67696587_67696588insA								OPHN1 (43288 upstream) : YIPF6 (22298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	81392087	81392087	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:81392087delA								SH3BGRL (838045 upstream) : None (None downstream)																																			---	---	---	---
RPA4	29935	broad.mit.edu	37	X	96140184	96140184	+	3'UTR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96140184delA	uc004efv.3	+	1					DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	NM_013347	NP_037479			replication protein A4, 34kDa						DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding				0													Other_identified_genes_with_known_or_suspected_DNA_repair_function					---	---	---	---
Unknown	0	broad.mit.edu	37	X	103566456	103566456	+	IGR	DEL	G	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103566456delG								ESX1 (66868 upstream) : IL1RAPL2 (244540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	105635732	105635734	+	IGR	DEL	TCC	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105635732_105635734delTCC								MUM1L1 (182784 upstream) : CXorf57 (219426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	118646829	118646829	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118646829delT								SLC25A5 (41537 upstream) : CXorf56 (26672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	128127590	128127590	+	IGR	DEL	T	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128127590delT								ACTRT1 (941208 upstream) : SMARCA1 (452890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	135938954	135938954	+	IGR	DEL	T	-	-	rs35970888		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135938954delT								ARHGEF6 (75451 upstream) : RBMX (12399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	153022509	153022509	+	IGR	DEL	A	-	-			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153022509delA								ABCD1 (12293 upstream) : PLXNB3 (7142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	155214689	155214690	+	IGR	INS	-	TCACTAC	TCACTAC			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155214689_155214690insTCACTAC								VAMP7 (41257 upstream) : IL9R (12556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9924245	9924246	+	IGR	INS	-	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9924245_9924246insG								TTTY22 (273391 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59030837	59030837	+	IGR	DEL	T	-	-	rs147048784		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59030837delT								None (None upstream) : None (None downstream)																																			---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7725006	7725006	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7725006G>A	uc001aoi.2	+	9	2606	c.2399G>A	c.(2398-2400)AGC>AAC	p.S800N		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	800					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152082565	152082565	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152082565A>C	uc001ezp.2	-	2	3128	c.3128T>G	c.(3127-3129)CTC>CGC	p.L1043R	TCHH_uc009wne.1_Missense_Mutation_p.L1043R	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1043	10 X 30 AA tandem repeats.|4-5.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FCRLB	127943	broad.mit.edu	37	1	161697183	161697183	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161697183G>T	uc001gbh.2	+	8	1246	c.1012G>T	c.(1012-1014)GGG>TGG	p.G338W	FCRLB_uc009wus.2_Missense_Mutation_p.G338W|FCRLB_uc001gbj.2_Silent_p.P289P|FCRLB_uc001gbk.2_3'UTR|FCRLB_uc001gbl.2_Silent_p.P282P|FCRLB_uc001gbm.2_3'UTR|FCRLB_uc001gbi.2_Missense_Mutation_p.G338W|FCRLB_uc001gbn.3_3'UTR	NM_001002901	NP_001002901	Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	338						endoplasmic reticulum					0	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)															---	---	---	---
PLXNA2	5362	broad.mit.edu	37	1	208216499	208216499	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208216499G>C	uc001hgz.2	-	21	4682	c.3924C>G	c.(3922-3924)GAC>GAG	p.D1308E		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	1308	Potential.|Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)														---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1687887	1687887	+	Silent	SNP	T	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1687887T>G	uc002qxa.2	-	5	517	c.453A>C	c.(451-453)CCA>CCC	p.P151P	PXDN_uc002qxb.1_Silent_p.P151P|PXDN_uc002qxc.1_5'UTR	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	151	LRR 3.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
ST3GAL5	8869	broad.mit.edu	37	2	86075089	86075089	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86075089T>C	uc002sqq.1	-	4	686	c.557A>G	c.(556-558)CAC>CGC	p.H186R	ST3GAL5_uc010fgq.1_Missense_Mutation_p.H58R|ST3GAL5_uc002sqp.1_Missense_Mutation_p.H163R	NM_003896	NP_003887	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	186	Lumenal (Potential).				ganglioside biosynthetic process|protein glycosylation	integral to Golgi membrane|integral to plasma membrane	lactosylceramide alpha-2,3-sialyltransferase activity|neolactotetraosylceramide alpha-2,3-sialyltransferase activity				0																		---	---	---	---
BUB1	699	broad.mit.edu	37	2	111419292	111419292	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111419292C>A	uc002tgc.2	-	10	1196	c.1084G>T	c.(1084-1086)GTT>TTT	p.V362F	BUB1_uc010yxh.1_Missense_Mutation_p.V342F|BUB1_uc010fkb.2_Missense_Mutation_p.V362F|BUB1_uc002tgd.2_Missense_Mutation_p.V362F	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	362					apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)														---	---	---	---
LMOD3	56203	broad.mit.edu	37	3	69168779	69168779	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69168779C>A	uc003dns.2	-	2	936	c.727G>T	c.(727-729)GGG>TGG	p.G243W	LMOD3_uc003dnt.2_Missense_Mutation_p.G243W	NM_198271	NP_938012	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	243						cytoplasm|cytoskeleton	tropomyosin binding			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)														---	---	---	---
LMOD3	56203	broad.mit.edu	37	3	69168781	69168781	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69168781T>A	uc003dns.2	-	2	934	c.725A>T	c.(724-726)GAT>GTT	p.D242V	LMOD3_uc003dnt.2_Missense_Mutation_p.D242V	NM_198271	NP_938012	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	242						cytoplasm|cytoskeleton	tropomyosin binding			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)														---	---	---	---
LMOD3	56203	broad.mit.edu	37	3	69168783	69168783	+	Silent	SNP	C	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69168783C>A	uc003dns.2	-	2	932	c.723G>T	c.(721-723)CTG>CTT	p.L241L	LMOD3_uc003dnt.2_Silent_p.L241L	NM_198271	NP_938012	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	241						cytoplasm|cytoskeleton	tropomyosin binding			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)														---	---	---	---
PJA2	9867	broad.mit.edu	37	5	108680401	108680401	+	Intron	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108680401C>T	uc003kos.3	-							NM_014819	NP_055634			praja 2, RING-H2 motif containing						long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)														---	---	---	---
BAI3	577	broad.mit.edu	37	6	70064152	70064152	+	Silent	SNP	A	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70064152A>C	uc003pev.3	+	27	3935	c.3487A>C	c.(3487-3489)AGA>CGA	p.R1163R	BAI3_uc010kak.2_Silent_p.R1163R|BAI3_uc011dxx.1_Silent_p.R369R	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1163	Cytoplasmic (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
RBM16	22828	broad.mit.edu	37	6	155116139	155116139	+	Intron	SNP	A	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155116139A>G	uc003qqa.2	+						RBM16_uc011efj.1_Intron|RBM16_uc011efk.1_Intron|RBM16_uc003qpz.2_Intron|RBM16_uc010kji.2_Intron	NM_014892	NP_055707			RNA-binding motif protein 16						mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding				0		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)														---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82784471	82784471	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82784471A>G	uc003uhx.2	-	2	1775	c.1486T>C	c.(1486-1488)TCA>CCA	p.S496P	PCLO_uc003uhv.2_Missense_Mutation_p.S496P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	142161977	142161977	+	Intron	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142161977C>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_RNA|uc011krw.1_Missense_Mutation_p.A100T					SubName: Full=V_segment translation product; Flags: Fragment;																														---	---	---	---
NCOA2	10499	broad.mit.edu	37	8	71071839	71071839	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71071839G>A	uc003xyn.1	-	10	1187	c.1025C>T	c.(1024-1026)TCT>TTT	p.S342F		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	342					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)					T	RUNXBP2	AML								---	---	---	---
KIAA2026	158358	broad.mit.edu	37	9	5922218	5922218	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5922218C>T	uc003zjq.3	-	8	3994	c.3778G>A	c.(3778-3780)GCT>ACT	p.A1260T	KIAA2026_uc010mht.2_Missense_Mutation_p.A435T	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	1260										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)														---	---	---	---
TAF1L	138474	broad.mit.edu	37	9	32631710	32631710	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32631710C>T	uc003zrg.1	-	1	3958	c.3868G>A	c.(3868-3870)GGA>AGA	p.G1290R	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1290					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)														---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7608308	7608308	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7608308G>A	uc001ijq.2	-	13	2291	c.2212C>T	c.(2212-2214)CGC>TGC	p.R738C	ITIH5_uc001ijp.2_Missense_Mutation_p.R524C	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	738					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
C10orf54	64115	broad.mit.edu	37	10	73521610	73521610	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73521610G>A	uc001jsd.2	-	2	397	c.256C>T	c.(256-258)CGC>TGC	p.R86C	CDH23_uc001jrx.3_Intron|C10orf54_uc001jse.2_5'UTR|C10orf54_uc009xqm.2_Intron|C10orf54_uc001jsf.1_Missense_Mutation_p.R86C	NM_022153	NP_071436	Q9H7M9	GI24_HUMAN	platelet receptor Gi24 precursor	86	Ig-like.|Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90341418	90341418	+	Silent	SNP	C	T	T	rs148977593		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90341418C>T	uc001kfe.2	-	3	408	c.273G>A	c.(271-273)TCG>TCA	p.S91S	RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Silent_p.S91S	NM_001031709	NP_001026879	Q5VYX0	RNLS_HUMAN	renalase isoform 1	91						extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
CWF19L1	55280	broad.mit.edu	37	10	102006563	102006563	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102006563G>A	uc001kqq.1	-	8	925	c.838C>T	c.(838-840)CTT>TTT	p.L280F	CWF19L1_uc001kqs.1_Missense_Mutation_p.L32F|CWF19L1_uc001kqr.1_Missense_Mutation_p.L280F|CWF19L1_uc001kqt.1_5'UTR|CWF19L1_uc010qpn.1_Missense_Mutation_p.L143F	NM_018294	NP_060764	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control	280							catalytic activity				0		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)														---	---	---	---
PHLDA2	7262	broad.mit.edu	37	11	2950367	2950367	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2950367G>T	uc001lxa.1	-	1	284	c.228C>A	c.(226-228)GAC>GAA	p.D76E		NM_003311	NP_003302	Q53GA4	PHLA2_HUMAN	pleckstrin homology-like domain family A member	76	PH.				apoptosis	cytoplasm|membrane					0		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
PAMR1	25891	broad.mit.edu	37	11	35513643	35513643	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35513643C>G	uc001mwg.2	-	3	372	c.329G>C	c.(328-330)GGG>GCG	p.G110A	PAMR1_uc001mwf.2_Missense_Mutation_p.G110A|PAMR1_uc010rew.1_Missense_Mutation_p.G110A|PAMR1_uc010rex.1_Missense_Mutation_p.G70A	NM_001001991	NP_001001991	Q6UXH9	PAMR1_HUMAN	regeneration associated muscle protease isoform	110					proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
TMEM126B	55863	broad.mit.edu	37	11	85347202	85347202	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85347202G>A	uc001pao.2	+	6	784	c.532G>A	c.(532-534)GGA>AGA	p.G178R	TMEM126B_uc001pap.2_Missense_Mutation_p.G178R|TMEM126B_uc001paq.1_3'UTR	NM_018480	NP_060950	Q8IUX1	T126B_HUMAN	transmembrane protein 126B	208	Helical; (Potential).					integral to membrane					0		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)																---	---	---	---
ZBTB39	9880	broad.mit.edu	37	12	57397688	57397688	+	Silent	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57397688C>T	uc001sml.1	-	2	1100	c.1014G>A	c.(1012-1014)CGG>CGA	p.R338R	RDH16_uc010sqx.1_5'Flank	NM_014830	NP_055645	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	338					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1																		---	---	---	---
RFX4	5992	broad.mit.edu	37	12	107126877	107126877	+	Intron	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107126877C>T	uc001tlr.2	+						RFX4_uc001tls.2_Silent_p.S558S|RFX4_uc001tlt.2_Intron|RFX4_uc001tlv.2_Intron	NM_213594	NP_998759			regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	108004034	108004034	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108004034G>A	uc001tmk.1	+	5	2232	c.1711G>A	c.(1711-1713)GAC>AAC	p.D571N	BTBD11_uc009zut.1_Missense_Mutation_p.D571N|BTBD11_uc001tmj.2_Missense_Mutation_p.D571N|BTBD11_uc001tml.1_Missense_Mutation_p.D108N	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	571						integral to membrane	DNA binding			skin(2)|ovary(1)	3																OREG0022090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SPRED1	161742	broad.mit.edu	37	15	38643405	38643405	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38643405A>T	uc001zka.3	+	7	1210	c.875A>T	c.(874-876)TAT>TTT	p.Y292F		NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain	292					inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)										Legius_syndrome				---	---	---	---
FSIP1	161835	broad.mit.edu	37	15	40018838	40018838	+	Silent	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40018838G>A	uc001zki.2	-	9	1220	c.1002C>T	c.(1000-1002)TCC>TCT	p.S334S		NM_152597	NP_689810	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	334										ovary(2)|skin(1)	3		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)														---	---	---	---
USP7	7874	broad.mit.edu	37	16	9009114	9009114	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9009114T>A	uc002czl.2	-	10	1274	c.1075A>T	c.(1075-1077)AAT>TAT	p.N359Y	USP7_uc010uyk.1_Missense_Mutation_p.N260Y|USP7_uc010uyj.1_Missense_Mutation_p.N260Y|USP7_uc002czk.2_Missense_Mutation_p.N343Y|USP7_uc010uyl.1_RNA	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	359					interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3																		---	---	---	---
STX4	6810	broad.mit.edu	37	16	31051116	31051116	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31051116G>T	uc002eal.2	+	10	1110	c.886G>T	c.(886-888)GTT>TTT	p.V296F	STX4_uc002eak.2_Missense_Mutation_p.V294F|STX4_uc002eam.2_Missense_Mutation_p.V218F|uc002ean.1_5'Flank	NM_004604	NP_004595	Q12846	STX4_HUMAN	syntaxin 4	296	Helical; Anchor for type IV membrane protein; (Potential).|Interaction with CENPF (By similarity).				intracellular protein transport|platelet activation|post-Golgi vesicle-mediated transport	basolateral plasma membrane|cell surface|cytosol|integral to membrane|plasma membrane enriched fraction|specific granule|vacuole	SNAP receptor activity				0																		---	---	---	---
FTO	79068	broad.mit.edu	37	16	53913791	53913791	+	Silent	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53913791C>T	uc002ehr.2	+	6	1233	c.1011C>T	c.(1009-1011)CGC>CGT	p.R337R	FTO_uc010vha.1_Silent_p.R41R	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	337					DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
LRRC46	90506	broad.mit.edu	37	17	45913414	45913414	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45913414G>C	uc002ima.2	+	6	654	c.398G>C	c.(397-399)AGC>ACC	p.S133T	LRRC46_uc002imb.2_Missense_Mutation_p.S86T	NM_033413	NP_219481	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	133										ovary(1)	1																		---	---	---	---
MED13	9969	broad.mit.edu	37	17	60140634	60140634	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60140634T>A	uc002izo.2	-	2	172	c.95A>T	c.(94-96)AAA>ATA	p.K32I		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	32					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	78282871	78282871	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78282871A>C	uc002jyf.2	+	14	2698	c.2555A>C	c.(2554-2556)CAT>CCT	p.H852P	uc002jyg.1_Missense_Mutation_p.H583P	NM_020954	NP_066005			hypothetical protein LOC57714																														---	---	---	---
DSG1	1828	broad.mit.edu	37	18	28934728	28934728	+	Silent	SNP	C	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28934728C>A	uc002kwp.2	+	15	2781	c.2569C>A	c.(2569-2571)CGA>AGA	p.R857R	DSG1_uc010xbp.1_Silent_p.R216R	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	857	Desmoglein repeat 2.|Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)															---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9085666	9085666	+	Missense_Mutation	SNP	G	T	T	rs34029599		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9085666G>T	uc002mkp.2	-	1	6353	c.6149C>A	c.(6148-6150)TCC>TAC	p.S2050Y		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2050	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
NCAN	1463	broad.mit.edu	37	19	19338422	19338422	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19338422G>A	uc002nlz.2	+	8	2092	c.1993G>A	c.(1993-1995)GCC>ACC	p.A665T	NCAN_uc010ecc.1_Missense_Mutation_p.A229T	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	665					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)															---	---	---	---
RBM42	79171	broad.mit.edu	37	19	36128233	36128233	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36128233C>T	uc002oan.2	+	9	1385	c.1309C>T	c.(1309-1311)CGC>TGC	p.R437C	RBM42_uc010eef.2_Missense_Mutation_p.R383C|RBM42_uc002oao.2_Missense_Mutation_p.R415C|RBM42_uc002oap.2_Missense_Mutation_p.R407C|RBM42_uc002oaq.2_Missense_Mutation_p.R408C|RBM42_uc010eeg.2_Intron	NM_024321	NP_077297	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	437	Necessary for interaction with HNRNPK (By similarity).|RRM.					cytoplasm|nucleus	nucleotide binding|RNA binding				0	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)															---	---	---	---
PEG3	5178	broad.mit.edu	37	19	57327738	57327738	+	Missense_Mutation	SNP	C	A	A	rs56332142		TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57327738C>A	uc002qnu.2	-	7	2423	c.2072G>T	c.(2071-2073)CGG>CTG	p.R691L	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.R662L|PEG3_uc002qnv.2_Missense_Mutation_p.R691L|PEG3_uc002qnw.2_Missense_Mutation_p.R567L|PEG3_uc002qnx.2_Missense_Mutation_p.R565L|PEG3_uc010etr.2_Missense_Mutation_p.R691L	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	691					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)														---	---	---	---
NINL	22981	broad.mit.edu	37	20	25470531	25470531	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25470531C>G	uc002wux.1	-	12	1650	c.1576G>C	c.(1576-1578)GAG>CAG	p.E526Q	NINL_uc010gdn.1_Missense_Mutation_p.E526Q|NINL_uc010gdo.1_Missense_Mutation_p.E309Q	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	526	Potential.				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	10862639	10862639	+	IGR	SNP	G	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10862639G>T								None (None upstream) : TPTE (44104 downstream)																																			---	---	---	---
DSCR10	259234	broad.mit.edu	37	21	39580370	39580370	+	RNA	SNP	C	A	A			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39580370C>A	uc010gnt.1	+	3		c.492C>A				NR_027695				Homo sapiens DSCR10 mRNA, complete cds.												0																		---	---	---	---
MED12	9968	broad.mit.edu	37	X	70349258	70349258	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4294-01A-01D-1126-08	TCGA-BR-4294-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70349258C>T	uc004dyy.2	+	26	3869	c.3670C>T	c.(3670-3672)CTC>TTC	p.L1224F	MED12_uc011mpq.1_Missense_Mutation_p.L1224F|MED12_uc004dyz.2_Missense_Mutation_p.L1224F|MED12_uc004dza.2_Missense_Mutation_p.L1071F|MED12_uc010nla.2_5'Flank	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1224					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)															OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
