Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RAVER2	55225	broad.mit.edu	37	1	65278445	65278445	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65278445C>T	uc001dbs.1	+	10	1744	c.1666C>T	c.(1666-1668)CTC>TTC	p.L556F	RAVER2_uc001dbt.1_Missense_Mutation_p.L448F|RAVER2_uc010opb.1_Missense_Mutation_p.L281F	NM_018211	NP_060681	Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	569						cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)	1						TCAAACTTCACTCTTGGGAGA	0.373													6	417	---	---	---	---	PASS
USP33	23032	broad.mit.edu	37	1	78189104	78189104	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78189104T>C	uc001dht.2	-	13	1741	c.1394A>G	c.(1393-1395)AAA>AGA	p.K465R	USP33_uc001dhs.2_Missense_Mutation_p.K186R|USP33_uc001dhu.2_Missense_Mutation_p.K434R|USP33_uc001dhv.2_Missense_Mutation_p.K270R|USP33_uc001dhw.2_Missense_Mutation_p.K465R	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1	465					axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						GTGCTGTTTTTTTCTCTTTGG	0.348													7	493	---	---	---	---	PASS
CCBL2	56267	broad.mit.edu	37	1	89454019	89454019	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89454019C>A	uc001dmp.2	-	2	392	c.15G>T	c.(13-15)CAG>CAT	p.Q5H	CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_5'UTR|RBMXL1_uc009wcx.2_5'UTR|RBMXL1_uc001dms.2_Intron	NM_001008661	NP_001008661	Q6YP21	KAT3_HUMAN	kynurenine aminotransferase III isoform 1	5					biosynthetic process|kynurenine metabolic process|tryptophan catabolic process		cysteine-S-conjugate beta-lyase activity|kynurenine-glyoxylate transaminase activity|kynurenine-oxoglutarate transaminase activity|pyridoxal phosphate binding			ovary(1)	1		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	AGAGGCTCCTCTGGGCCAAAA	0.383													24	99	---	---	---	---	PASS
KIAA1107	23285	broad.mit.edu	37	1	92642527	92642527	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92642527A>G	uc010otd.1	+	5	561	c.463A>G	c.(463-465)ACC>GCC	p.T155A	KIAA1107_uc001dop.2_Missense_Mutation_p.T80A	NM_015237	NP_056052	Q9UPP5	K1107_HUMAN	hypothetical protein LOC23285	210											0						TTCGTCAAGTACCAATAGAAA	0.323													4	156	---	---	---	---	PASS
SORT1	6272	broad.mit.edu	37	1	109884661	109884661	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109884661T>C	uc001dxm.1	-	9	1132	c.1083A>G	c.(1081-1083)GTA>GTG	p.V361V	SORT1_uc010ovi.1_Silent_p.V224V	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein	361	Extracellular (Potential).				endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		CATGCATGAATACCATGTCAT	0.443													14	73	---	---	---	---	PASS
HAO2	51179	broad.mit.edu	37	1	119923771	119923771	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119923771T>C	uc001ehq.1	+	3	415	c.63T>C	c.(61-63)ACT>ACC	p.T21T	HAO2_uc001ehr.1_Silent_p.T21T	NM_001005783	NP_001005783	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2	21	FMN hydroxy acid dehydrogenase.				fatty acid alpha-oxidation	peroxisome	(S)-2-hydroxy-acid oxidase activity			ovary(2)|skin(2)	4	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		CTAAGTCAACTCGGGATTTTA	0.463													56	229	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144813815	144813815	+	Silent	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144813815A>G	uc009wig.1	+	10	1138	c.1062A>G	c.(1060-1062)GCA>GCG	p.A354A	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Silent_p.A354A|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Silent_p.A285A|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Silent_p.A285A|NBPF9_uc010oyg.1_Silent_p.A319A|NBPF9_uc009wii.1_Silent_p.A83A|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Silent_p.A14A	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	354	Potential.					cytoplasm					0						AGAAGCTTGCAGAGCAGCTGA	0.532													5	36	---	---	---	---	PASS
NOS1AP	9722	broad.mit.edu	37	1	162040040	162040040	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162040040G>A	uc001gbv.2	+	1	460	c.73G>A	c.(73-75)GCC>ACC	p.A25T	NOS1AP_uc010pkr.1_Missense_Mutation_p.A25T|NOS1AP_uc010pks.1_RNA|NOS1AP_uc001gbw.2_Missense_Mutation_p.A25T	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor	25					regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			CAACGAGGACGCCTTCCAGCA	0.632													5	17	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179609084	179609084	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179609084G>A	uc001gnf.1	+	10	1881	c.1631G>A	c.(1630-1632)CGG>CAG	p.R544Q	TDRD5_uc010pnp.1_Missense_Mutation_p.R544Q|TDRD5_uc001gnh.1_Missense_Mutation_p.R99Q	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	544	Tudor.				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						TGGTGGTATCGGGTCATTATC	0.433													5	401	---	---	---	---	PASS
NUP133	55746	broad.mit.edu	37	1	229619824	229619824	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229619824T>C	uc001htn.2	-	12	1661	c.1569A>G	c.(1567-1569)AAA>AAG	p.K523K		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	523					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GAAAGGCAGCTTTCAGCAACT	0.323													7	460	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947723	237947723	+	Silent	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947723C>T	uc001hyl.1	+	90	12831	c.12711C>T	c.(12709-12711)TCC>TCT	p.S4237S	RYR2_uc010pya.1_Silent_p.S652S	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4237	Helical; Name=M3; (Potential).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTTCTTCTCCATTCTGACGG	0.522													11	69	---	---	---	---	PASS
CEP68	23177	broad.mit.edu	37	2	65298597	65298597	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65298597A>T	uc002sdl.3	+	3	581	c.367A>T	c.(367-369)ACC>TCC	p.T123S	CEP68_uc002sdj.2_Missense_Mutation_p.T123S|CEP68_uc010yqb.1_Missense_Mutation_p.T123S|CEP68_uc002sdk.3_Missense_Mutation_p.T123S|CEP68_uc010yqc.1_Missense_Mutation_p.T123S|CEP68_uc010yqd.1_Missense_Mutation_p.T123S	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	123					centrosome organization	centrosome				skin(1)	1						GGTGGAGAAGACCAAGCTTTC	0.453													9	54	---	---	---	---	PASS
EXOC6B	23233	broad.mit.edu	37	2	72411218	72411218	+	Silent	SNP	C	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72411218C>G	uc010fep.2	-	21	2433	c.2295G>C	c.(2293-2295)CTG>CTC	p.L765L		NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2	765					protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						CAAGCAGGGTCAGAGCAGTCA	0.512													20	60	---	---	---	---	PASS
LOC654342	654342	broad.mit.edu	37	2	91843471	91843471	+	RNA	SNP	C	T	T	rs113954000	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91843471C>T	uc002sts.3	-	2		c.99G>A			LOC654342_uc002stt.2_RNA|LOC654342_uc010yub.1_RNA					Homo sapiens cDNA clone IMAGE:4801360.												0						CTGGACGCAGCCATGCTGGGC	0.602													9	16	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289													8	223	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97869979	97869979	+	Missense_Mutation	SNP	G	T	T	rs111515821		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97869979G>T	uc010yva.1	+	50	3284	c.3040G>T	c.(3040-3042)GAT>TAT	p.D1014Y	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1014											0						AGGAAAAAAGGATGGAGAAAA	0.289													8	188	---	---	---	---	PASS
TBC1D8	11138	broad.mit.edu	37	2	101624288	101624288	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101624288A>T	uc010fiv.2	-	20	3549	c.3418T>A	c.(3418-3420)TTG>ATG	p.L1140M	RPL31_uc010yvu.1_Intron|RPL31_uc010yvv.1_Intron|RPL31_uc010fiu.1_Intron|TBC1D8_uc002tau.3_Missense_Mutation_p.L897M	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	1140					blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						TCTTGCTACAAGTTACTCAGC	0.428													51	146	---	---	---	---	PASS
BUB1	699	broad.mit.edu	37	2	111395447	111395447	+	3'UTR	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111395447C>T	uc002tgc.2	-	25					BUB1_uc010yxh.1_3'UTR|BUB1_uc010fkb.2_3'UTR	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1						apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		TTTTAACAAACATTTACATAA	0.264													7	39	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135722316	135722316	+	3'UTR	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135722316G>A	uc002tue.1	-	10					YSK4_uc002tuf.1_3'UTR|YSK4_uc010fnc.1_3'UTR|YSK4_uc010fnd.1_3'UTR|YSK4_uc010zbg.1_3'UTR	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1								ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		AACTGGGTTAGACTGAATTTT	0.403													11	28	---	---	---	---	PASS
R3HDM1	23518	broad.mit.edu	37	2	136418887	136418887	+	Silent	SNP	T	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136418887T>A	uc002tuo.2	+	18	2341	c.1971T>A	c.(1969-1971)CCT>CCA	p.P657P	R3HDM1_uc010fni.2_Silent_p.P656P|R3HDM1_uc002tup.2_Silent_p.P602P|R3HDM1_uc010zbh.1_Silent_p.P405P	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1	657							nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		CCAGCCAACCTCAGTATCGCC	0.438													18	94	---	---	---	---	PASS
R3HDM1	23518	broad.mit.edu	37	2	136418888	136418888	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136418888C>A	uc002tuo.2	+	18	2342	c.1972C>A	c.(1972-1974)CAG>AAG	p.Q658K	R3HDM1_uc010fni.2_Missense_Mutation_p.Q657K|R3HDM1_uc002tup.2_Missense_Mutation_p.Q603K|R3HDM1_uc010zbh.1_Missense_Mutation_p.Q406K	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1	658							nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		CAGCCAACCTCAGTATCGCCC	0.438													18	94	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173354378	173354378	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173354378A>G	uc002uhp.1	+	20	2874	c.2671A>G	c.(2671-2673)AAC>GAC	p.N891D	ITGA6_uc010zdy.1_Missense_Mutation_p.N772D|ITGA6_uc002uho.1_Missense_Mutation_p.N891D|ITGA6_uc010fqm.1_Intron	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	930	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AAACTCCCTGAACCTAACGGT	0.363													41	108	---	---	---	---	PASS
ABCB6	10058	broad.mit.edu	37	2	220075789	220075789	+	Silent	SNP	G	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220075789G>C	uc002vkc.1	-	15	2287	c.2010C>G	c.(2008-2010)CCC>CCG	p.P670P	ABCB6_uc010fwe.1_Silent_p.P624P	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	670	ABC transporter.				cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGTGTCTTGGGGCACAACTC	0.552													11	40	---	---	---	---	PASS
WDFY1	57590	broad.mit.edu	37	2	224763768	224763768	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224763768A>G	uc002vnq.2	-	6	556	c.505T>C	c.(505-507)TAT>CAT	p.Y169H		NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	169	WD 4.					cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		ACGAAAGCATACTGAGTGTCA	0.438													5	185	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52637738	52637738	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52637738C>T	uc003des.2	-	17	2590	c.2578G>A	c.(2578-2580)GAA>AAA	p.E860K	PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Missense_Mutation_p.E860K|PBRM1_uc003der.2_Missense_Mutation_p.E828K|PBRM1_uc003det.2_Missense_Mutation_p.E875K|PBRM1_uc003deu.2_Missense_Mutation_p.E875K|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.E860K|PBRM1_uc010hmk.1_Missense_Mutation_p.E860K|PBRM1_uc003dey.2_Missense_Mutation_p.E860K|PBRM1_uc003dez.1_Missense_Mutation_p.E860K|PBRM1_uc003dfb.1_Missense_Mutation_p.E773K|PBRM1_uc003dfa.1_Missense_Mutation_p.E206K	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	860	Bromo 6.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCATATATTTCTGAATCTGTC	0.323			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								33	94	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52637740	52637740	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52637740G>T	uc003des.2	-	17	2588	c.2576C>A	c.(2575-2577)TCA>TAA	p.S859*	PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Nonsense_Mutation_p.S859*|PBRM1_uc003der.2_Nonsense_Mutation_p.S827*|PBRM1_uc003det.2_Nonsense_Mutation_p.S874*|PBRM1_uc003deu.2_Nonsense_Mutation_p.S874*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.S859*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.S859*|PBRM1_uc003dey.2_Nonsense_Mutation_p.S859*|PBRM1_uc003dez.1_Nonsense_Mutation_p.S859*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.S772*|PBRM1_uc003dfa.1_Nonsense_Mutation_p.S205*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	859	Bromo 6.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATATATTTCTGAATCTGTCCT	0.323			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								34	89	---	---	---	---	PASS
GPR128	84873	broad.mit.edu	37	3	100356181	100356181	+	Silent	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100356181C>T	uc003duc.2	+	6	901	c.633C>T	c.(631-633)CTC>CTT	p.L211L	GPR128_uc011bhc.1_5'UTR	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	211	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						TGAGTCAACTCCTAGATGCCA	0.343													52	142	---	---	---	---	PASS
PTPLB	201562	broad.mit.edu	37	3	123301066	123301066	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123301066A>G	uc003egj.2	-	2	316	c.266T>C	c.(265-267)TTA>TCA	p.L89S		NM_198402	NP_940684	Q6Y1H2	HACD2_HUMAN	protein tyrosine phosphatase-like (proline	89	Helical; (Potential).				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein binding			kidney(1)	1				GBM - Glioblastoma multiforme(114;0.1)		TACCTCCAATAAGGCTCCAGT	0.383													38	184	---	---	---	---	PASS
BFSP2	8419	broad.mit.edu	37	3	133119014	133119014	+	Silent	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133119014G>A	uc003epn.1	+	1	225	c.87G>A	c.(85-87)GGG>GGA	p.G29G		NM_003571	NP_003562	Q13515	BFSP2_HUMAN	phakinin	29	Head.				response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0						CCTTCAGGGGGCCACGGTCAT	0.642													6	8	---	---	---	---	PASS
EIF2B5	8893	broad.mit.edu	37	3	183862873	183862873	+	3'UTR	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183862873T>C	uc003fmp.2	+	16					EIF2B5_uc003fmq.2_3'UTR|EIF2B5_uc003fmr.2_3'UTR	NM_003907	NP_003898	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B,						astrocyte development|myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|positive regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus|RNA metabolic process	cytosol|eukaryotic translation initiation factor 2B complex|nucleus	guanyl-nucleotide exchange factor activity|transferase activity|translation initiation factor activity|translation initiation factor binding			ovary(5)	5	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			ACTACAGTATTCTTTCCCCTG	0.557													3	9	---	---	---	---	PASS
EHHADH	1962	broad.mit.edu	37	3	184947235	184947235	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184947235C>T	uc003fpf.2	-	4	475	c.448G>A	c.(448-450)GAC>AAC	p.D150N	EHHADH_uc011brs.1_Missense_Mutation_p.D54N	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl	150	Enoyl-CoA hydratase / isomerase.					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)	GTAATTAAGTCAAGTGCAGCA	0.363													22	91	---	---	---	---	PASS
LPP	4026	broad.mit.edu	37	3	188426055	188426055	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188426055G>T	uc003frs.1	+	7	1360	c.1114G>T	c.(1114-1116)GGT>TGT	p.G372C	LPP_uc011bsg.1_Missense_Mutation_p.G225C|LPP_uc011bsi.1_Missense_Mutation_p.G372C|LPP_uc003frt.2_Missense_Mutation_p.G372C|LPP_uc011bsj.1_Missense_Mutation_p.G209C	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation	372		Breakpoint for translocation to form HMGA2-LPP.			cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TGCCTTTCAGGGTGGCCATTC	0.488			T	HMGA2|MLL|C12orf9	lipoma|leukemia								11	42	---	---	---	---	PASS
SENP5	205564	broad.mit.edu	37	3	196613371	196613371	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196613371A>G	uc003fwz.3	+	2	1568	c.1319A>G	c.(1318-1320)TAC>TGC	p.Y440C	SENP5_uc011bty.1_Missense_Mutation_p.Y440C	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	440					cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		GAGAACTCATACCAGATGGAG	0.483													5	89	---	---	---	---	PASS
PIGG	54872	broad.mit.edu	37	4	520921	520921	+	Silent	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:520921G>A	uc003gak.3	+	10	2299	c.2163G>A	c.(2161-2163)AAG>AAA	p.K721K	PIGG_uc003gaj.3_Silent_p.K713K|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_Silent_p.K588K|PIGG_uc003gal.3_Silent_p.K632K	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	721	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			central_nervous_system(2)|ovary(1)|skin(1)	4						CTGTGTCCAAGGCTGCCCTGG	0.637													5	16	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47685603	47685603	+	Intron	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47685603C>A	uc003gxm.2	-						CORIN_uc011bzf.1_Intron|CORIN_uc011bzg.1_Intron|CORIN_uc011bzh.1_Intron|CORIN_uc011bzi.1_Intron|CORIN_uc003gxn.3_3'UTR	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						AGTGACTGAACAAACTTCCTC	0.289													9	29	---	---	---	---	PASS
SEPT11	55752	broad.mit.edu	37	4	77949832	77949832	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77949832A>G	uc003hkj.2	+	8	1166	c.1004A>G	c.(1003-1005)CAG>CGG	p.Q335R	SEPT11_uc010ijh.1_Missense_Mutation_p.Q327R|SEPT11_uc011cca.1_Missense_Mutation_p.Q345R	NM_018243	NP_060713	Q9NVA2	SEP11_HUMAN	septin 11	335	Potential.				cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0						GGAGAACTGCAGAAGAAAGAA	0.393													63	206	---	---	---	---	PASS
C5orf23	79614	broad.mit.edu	37	5	32789575	32789575	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32789575G>T	uc003jhw.1	+	1	631	c.68G>T	c.(67-69)AGG>ATG	p.R23M		NM_024563	NP_078839			hypothetical protein LOC79614												0						TTGAACCACAGGAATGGTTCT	0.418													23	54	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37224836	37224836	+	Silent	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37224836A>G	uc011cpa.1	-	13	2529	c.2298T>C	c.(2296-2298)CTT>CTC	p.L766L		NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	766										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TCCAGAGAATAAGCAATCTGC	0.328													5	339	---	---	---	---	PASS
C5orf51	285636	broad.mit.edu	37	5	41917432	41917432	+	3'UTR	SNP	A	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41917432A>T	uc003jmo.2	+	6						NM_175921	NP_787117	A6NDU8	CE051_HUMAN	hypothetical protein LOC285636												0						CAAATAGAAAAACAACAAAAC	0.328													22	80	---	---	---	---	PASS
TMEM232	642987	broad.mit.edu	37	5	109940964	109940964	+	Silent	SNP	A	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109940964A>T	uc011cvh.1	-	10	1188	c.1116T>A	c.(1114-1116)ACT>ACA	p.T372T	TMEM232_uc003kow.1_Silent_p.T180T|TMEM232_uc003kox.2_RNA|TMEM232_uc010jbs.2_Silent_p.T374T|TMEM232_uc003koy.3_Silent_p.T108T			C9JQI7	TM232_HUMAN	SubName: Full=cDNA FLJ54480;	374						integral to membrane					0						GCAAATCAGAAGTGGCTGCAT	0.353													47	146	---	---	---	---	PASS
SNCAIP	9627	broad.mit.edu	37	5	121759046	121759046	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121759046C>T	uc003ksw.1	+	4	820	c.614C>T	c.(613-615)GCA>GTA	p.A205V	SNCAIP_uc011cwl.1_Intron|SNCAIP_uc010jct.2_Missense_Mutation_p.A205V|SNCAIP_uc003ksx.1_Missense_Mutation_p.A252V|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|SNCAIP_uc011cwm.1_Intron|SNCAIP_uc003kta.1_Intron|SNCAIP_uc010jcv.1_RNA|SNCAIP_uc010jcw.1_Intron|SNCAIP_uc010jcx.1_Missense_Mutation_p.A205V	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein	205					cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TCCAACATGGCACCATTTTGT	0.463													13	35	---	---	---	---	PASS
ZNF608	57507	broad.mit.edu	37	5	124080616	124080616	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124080616C>A	uc003ktq.1	-	1	190	c.67G>T	c.(67-69)GGC>TGC	p.G23C	ZNF608_uc003ktr.1_RNA|ZNF608_uc003kts.1_Missense_Mutation_p.G23C|ZNF608_uc003ktt.1_Missense_Mutation_p.G23C	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	23						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CAATCATCGCCACTGTCATAA	0.393													4	154	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127503597	127503597	+	Intron	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127503597G>T	uc003kus.2	+						SLC12A2_uc010jdf.2_Intron|SLC12A2_uc010jdg.2_Intron|SLC12A2_uc003kut.1_3'UTR	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12						potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	AGTTCATTTAGAAAATGTTAA	0.274													39	176	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127503598	127503598	+	Intron	SNP	A	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127503598A>T	uc003kus.2	+						SLC12A2_uc010jdf.2_Intron|SLC12A2_uc010jdg.2_Intron|SLC12A2_uc003kut.1_3'UTR	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12						potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GTTCATTTAGAAAATGTTAAT	0.279													39	170	---	---	---	---	PASS
SOX30	11063	broad.mit.edu	37	5	157078237	157078237	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157078237T>C	uc003lxb.1	-	1	1192	c.850A>G	c.(850-852)ATA>GTA	p.I284V	SOX30_uc003lxc.1_Missense_Mutation_p.I284V|SOX30_uc011dds.1_Intron	NM_178424	NP_848511	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30 isoform a	284					regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)|central_nervous_system(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTCAATCTTATCAGCTCTGAA	0.557													16	67	---	---	---	---	PASS
HIST1H1C	3006	broad.mit.edu	37	6	26056217	26056217	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26056217G>A	uc003nfw.2	-	1	483	c.440C>T	c.(439-441)CCG>CTG	p.P147L		NM_005319	NP_005310	P16403	H12_HUMAN	histone cluster 1, H1c	147					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)|skin(2)	5						GCTCTTCTTCGGAGTTGCGCC	0.577													6	27	---	---	---	---	PASS
VEGFA	7422	broad.mit.edu	37	6	43742101	43742101	+	Silent	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43742101A>G	uc003owc.2	+	2	1121	c.90A>G	c.(88-90)GCA>GCG	p.A30A	VEGFA_uc003owb.2_Silent_p.A30A|VEGFA_uc003owd.2_Silent_p.A210A|VEGFA_uc003owf.2_Silent_p.A210A|VEGFA_uc003owe.2_Silent_p.A210A|VEGFA_uc003owg.2_Silent_p.A210A|VEGFA_uc003owh.2_Silent_p.A210A|VEGFA_uc003owi.2_Silent_p.A210A|VEGFA_uc003owj.2_Silent_p.A210A|VEGFA_uc010jyx.2_Silent_p.A30A	NM_001025370	NP_001020541	P15692	VEGFA_HUMAN	vascular endothelial growth factor A isoform f	30					basophil chemotaxis|cellular response to hypoxia|induction of positive chemotaxis|induction of positive chemotaxis|platelet activation|platelet degranulation|platelet-derived growth factor receptor signaling pathway|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of cell adhesion|positive regulation of cell division|positive regulation of endothelial cell proliferation|positive regulation of leukocyte migration|positive regulation of mast cell chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|positive regulation of vascular permeability|regulation of cell shape|vascular endothelial growth factor receptor signaling pathway|vasculogenesis	cell surface|extracellular space|membrane|platelet alpha granule lumen	cell surface binding|chemoattractant activity|cytokine activity|fibronectin binding|growth factor activity|heparin binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity|vascular endothelial growth factor receptor 1 binding|vascular endothelial growth factor receptor 2 binding|vascular endothelial growth factor receptor binding			ovary(1)|breast(1)	2	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Atorvastatin(DB01076)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Simvastatin(DB00641)	CACCCATGGCAGAAGGAGGAG	0.617											OREG0017458	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	46	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	145119063	145119063	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145119063C>T	uc003qkt.2	+	63	9274	c.9182C>T	c.(9181-9183)GCG>GTG	p.A3061V		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	3061	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GTGGCAGCAGCGGAGACTGCA	0.448													4	146	---	---	---	---	PASS
BZW2	28969	broad.mit.edu	37	7	16720980	16720980	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16720980G>A	uc003stl.2	+	4	468	c.290G>A	c.(289-291)TGT>TAT	p.C97Y	BZW2_uc011jxx.1_Translation_Start_Site|BZW2_uc003stm.2_Translation_Start_Site|BZW2_uc003stj.2_Missense_Mutation_p.C97Y|BZW2_uc003stk.2_Missense_Mutation_p.C21Y|BZW2_uc003stn.1_Missense_Mutation_p.C97Y|BZW2_uc003sto.1_Translation_Start_Site|BZW2_uc003stp.2_Translation_Start_Site|BZW2_uc010kua.2_Missense_Mutation_p.C97Y	NM_001159767	NP_001153239	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	97					cell differentiation|nervous system development|RNA metabolic process		protein binding			ovary(2)	2	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		ACCAACCACTGTGTGTTTTCA	0.418													72	227	---	---	---	---	PASS
C7orf63	79846	broad.mit.edu	37	7	89939424	89939424	+	Silent	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89939424C>A	uc010lep.2	+	23	2949	c.2698C>A	c.(2698-2700)CGA>AGA	p.R900R	C7orf63_uc011khj.1_Silent_p.R882R|C7orf63_uc011khk.1_Silent_p.R416R	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1	900							binding			ovary(1)	1						CACTCCTGCCCGATTAGTAGG	0.428													6	291	---	---	---	---	PASS
TSPAN12	23554	broad.mit.edu	37	7	120446726	120446726	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120446726T>C	uc003vjk.2	-	7	863	c.489A>G	c.(487-489)GTA>GTG	p.V163V	TSPAN12_uc010lkj.2_Silent_p.V36V	NM_012338	NP_036470	O95859	TSN12_HUMAN	transmembrane 4 superfamily member 12	163	Extracellular (Potential).				angiogenesis|cell surface receptor linked signaling pathway|regulation of angiogenesis|retina layer formation	integral to plasma membrane|membrane fraction					0	all_neural(327;0.117)					CAGTGAAATATACTACTCCAC	0.403													6	174	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140508708	140508708	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140508708A>G	uc003vwc.3	-	4	653	c.592T>C	c.(592-594)TAC>CAC	p.Y198H		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	198	RBD.				activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TGAATTCTGTAAACAGCACAG	0.378		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				6	207	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97316399	97316399	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97316399T>A	uc003yht.1	+	7	986	c.884T>A	c.(883-885)ATC>AAC	p.I295N	PTDSS1_uc003yhu.1_Missense_Mutation_p.I149N	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	295	Helical; (Potential).				phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CTTTTCATGATCATCTGGCAG	0.383													73	281	---	---	---	---	PASS
SLA	6503	broad.mit.edu	37	8	134072581	134072581	+	Intron	SNP	G	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134072581G>C	uc003ytz.2	-						TG_uc003ytw.2_Intron|TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mdy.1_Intron|SLA_uc010mdz.1_Intron|SLA_uc010mea.2_Intron|SLA_uc011ljd.1_Translation_Start_Site	NM_001045556	NP_001039021	Q13239	SLAP1_HUMAN	Src-like-adaptor isoform a							endosome	SH3/SH2 adaptor activity			lung(1)|liver(1)	2	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			TATATGTGAAGATGAGATTGG	0.448													10	47	---	---	---	---	PASS
MPDZ	8777	broad.mit.edu	37	9	13224388	13224388	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13224388G>C	uc010mia.1	-	3	435	c.378C>G	c.(376-378)ATC>ATG	p.I126M	MPDZ_uc010mhy.2_Missense_Mutation_p.I126M|MPDZ_uc010mhz.2_Missense_Mutation_p.I126M|MPDZ_uc011lmn.1_Missense_Mutation_p.I126M|MPDZ_uc003zlb.3_Missense_Mutation_p.I126M	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	126					interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		CCATATTTTTGATAAGCTGAT	0.333													54	201	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32543675	32543675	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32543675G>A	uc003zrb.2	-	3	1015	c.848C>T	c.(847-849)GCT>GTT	p.A283V	TOPORS_uc003zrc.2_Missense_Mutation_p.A216V	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	283	Required for DNA-binding.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		GAAAAATTCAGCTGAAATATC	0.383													7	35	---	---	---	---	PASS
CBWD3	445571	broad.mit.edu	37	9	70490099	70490099	+	5'UTR	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70490099G>T	uc004aga.3	-	1					CBWD3_uc004agc.3_RNA|CBWD3_uc004afy.3_RNA|CBWD3_uc011lrm.1_5'UTR|CBWD3_uc011lrn.1_RNA|CBWD3_uc004agb.3_5'UTR|CBWD3_uc010moe.1_RNA|CBWD3_uc004agd.1_Intron|CBWD3_uc004age.2_5'UTR	NM_201453	NP_958861	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding				0				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TACCTCAGCTGAACCGCTGGG	0.637													8	23	---	---	---	---	PASS
C9orf64	84267	broad.mit.edu	37	9	86571091	86571091	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86571091C>G	uc004anb.2	-	1	573	c.325G>C	c.(325-327)GCC>CCC	p.A109P	C9orf64_uc004anc.2_5'UTR	NM_032307	NP_115683	Q5T6V5	CI064_HUMAN	hypothetical protein LOC84267	109											0						TCGTCGAGGGCTCTGTTGACG	0.557													15	33	---	---	---	---	PASS
TDRD7	23424	broad.mit.edu	37	9	100234634	100234634	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100234634G>C	uc004axj.2	+	10	2026	c.1801G>C	c.(1801-1803)GGA>CGA	p.G601R	TDRD7_uc011lux.1_Missense_Mutation_p.G527R|TDRD7_uc010msp.1_5'UTR|TDRD7_uc011luy.1_5'UTR	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	601					lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				TTTAACTTGTGGAAAGATCTT	0.368													59	210	---	---	---	---	PASS
TDRD7	23424	broad.mit.edu	37	9	100234635	100234635	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100234635G>T	uc004axj.2	+	10	2027	c.1802G>T	c.(1801-1803)GGA>GTA	p.G601V	TDRD7_uc011lux.1_Missense_Mutation_p.G527V|TDRD7_uc010msp.1_5'UTR|TDRD7_uc011luy.1_5'UTR	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	601					lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				TTAACTTGTGGAAAGATCTTT	0.373													61	205	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117840320	117840320	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117840320G>T	uc004bjj.3	-	7	2938	c.2576C>A	c.(2575-2577)TCC>TAC	p.S859Y	TNC_uc010mvf.2_Missense_Mutation_p.S859Y	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	859	Fibronectin type-III 3.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GTTCCCGATGGAGTACTGGTT	0.557													27	102	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071484	141071484	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071484T>C	uc004com.2	+	4	1148	c.887T>C	c.(886-888)ATT>ACT	p.I296T	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						GCCAGCTTCATTGGGAATAAT	0.527													4	33	---	---	---	---	PASS
LOC387646	387646	broad.mit.edu	37	10	27538399	27538399	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27538399C>A	uc001its.2	-	1	2837	c.994G>T	c.(994-996)GAT>TAT	p.D332Y		NR_003525				SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;												0						AGCCCCAAATCCAAAGGTTGA	0.507													26	100	---	---	---	---	PASS
AGAP7	653268	broad.mit.edu	37	10	51464817	51464817	+	Nonsense_Mutation	SNP	T	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51464817T>A	uc001jio.2	-	7	1765	c.1639A>T	c.(1639-1641)AAA>TAA	p.K547*	PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	NM_001077685	NP_001071153	Q5VUJ5	AGAP7_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	547	Arf-GAP.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						TCCTCATATTTGGAACGGATC	0.592													28	187	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3700799	3700799	+	Silent	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3700799G>A	uc001lyh.2	-	31	5349	c.5058C>T	c.(5056-5058)CTC>CTT	p.L1686L	NUP98_uc001lyi.2_Silent_p.L1612L|NUP98_uc001lyg.2_Silent_p.L651L	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	1703					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		GTATATGGCGGAGCATTTCAA	0.463			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								24	107	---	---	---	---	PASS
NDUFS3	4722	broad.mit.edu	37	11	47602207	47602207	+	Intron	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602207C>T	uc001nga.2	+						NDUFS3_uc001nft.3_5'UTR|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_Intron	NM_004551	NP_004542	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3						induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	GGGTCTGGGTCAAGAAAGAAC	0.443													13	59	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003804	50003804	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003804C>A	uc010ria.1	-	1	234	c.234G>T	c.(232-234)AAG>AAT	p.K78N		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	78	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						CCACAATCAACTTAGGAGCTG	0.433													28	71	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71728699	71728699	+	Intron	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71728699C>A	uc001orl.1	-						NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Intron|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Intron|NUMA1_uc001oro.1_Intron|NUMA1_uc009ysy.1_Missense_Mutation_p.D385Y|NUMA1_uc001orp.2_Missense_Mutation_p.D385Y|NUMA1_uc001orq.2_Missense_Mutation_p.D385Y	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1						G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CACATGTGGTCAAGACTGTGG	0.527			T	RARA	APL								5	19	---	---	---	---	PASS
TAS2R9	50835	broad.mit.edu	37	12	10962269	10962269	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10962269C>T	uc001qyx.2	-	1	499	c.406G>A	c.(406-408)GGG>AGG	p.G136R	TAS2R8_uc010shh.1_5'Flank	NM_023917	NP_076406	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	136	Helical; Name=4; (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			skin(1)	1						AGAAAGGACCCCAGAAGAATC	0.358													4	125	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19514587	19514587	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19514587A>T	uc001reb.2	+	23	3143	c.3057A>T	c.(3055-3057)GAA>GAT	p.E1019D	PLEKHA5_uc010sie.1_Missense_Mutation_p.E1180D|PLEKHA5_uc001rea.2_Missense_Mutation_p.E1077D|PLEKHA5_uc009zin.2_Missense_Mutation_p.E777D|PLEKHA5_uc010sif.1_Missense_Mutation_p.E1008D|PLEKHA5_uc010sig.1_Missense_Mutation_p.E1001D|PLEKHA5_uc010sih.1_Missense_Mutation_p.E974D|PLEKHA5_uc001rec.1_Missense_Mutation_p.E828D|PLEKHA5_uc009zio.2_Missense_Mutation_p.E285D	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	1019							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ATTCTGTGGAAATGATGGATA	0.284													74	238	---	---	---	---	PASS
PIP4K2C	79837	broad.mit.edu	37	12	57995606	57995606	+	Intron	SNP	T	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57995606T>A	uc001sou.2	+						PIP4K2C_uc001sot.2_3'UTR|PIP4K2C_uc010srs.1_3'UTR|PIP4K2C_uc010srt.1_3'UTR|DTX3_uc001sov.1_5'Flank|DTX3_uc001sow.1_5'Flank|DTX3_uc001sox.1_5'Flank	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type							cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					CTTCCCTCTCTTCCTCCCCAT	0.418													4	11	---	---	---	---	PASS
GLIPR1	11010	broad.mit.edu	37	12	75893785	75893785	+	3'UTR	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75893785A>G	uc001sxs.2	+	6					KRR1_uc001sxt.2_Intron|KRR1_uc009zsc.2_Intron	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor						cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3						ACCAAGTAAAACAAAGAATAT	0.274													6	180	---	---	---	---	PASS
NEDD1	121441	broad.mit.edu	37	12	97306490	97306490	+	Intron	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97306490T>C	uc001teu.3	+						NEDD1_uc001tev.3_Intron|NEDD1_uc010svc.1_Intron|NEDD1_uc001tew.2_Intron|NEDD1_uc001tex.2_5'UTR	NM_152905	NP_690869	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally						cell division|G2/M transition of mitotic cell cycle|mitosis	cytosol					0						GCTCCATAACTCCTCATTTAG	0.353													7	365	---	---	---	---	PASS
SYCP3	50511	broad.mit.edu	37	12	102122920	102122920	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102122920C>T	uc001tiq.2	-	8	756	c.624G>A	c.(622-624)ATG>ATA	p.M208I	CHPT1_uc001tip.1_3'UTR|SYCP3_uc001tir.2_Missense_Mutation_p.M208I|SYCP3_uc001tis.2_Missense_Mutation_p.M208I	NM_153694	NP_710161	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	208	Potential.|Gln-rich.				cell division|male meiosis I|spermatogenesis, exchange of chromosomal proteins	nucleus	DNA binding				0						GCAACATAGCCATTTCTTTTT	0.264													6	461	---	---	---	---	PASS
HSP90B1	7184	broad.mit.edu	37	12	104333382	104333382	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104333382T>C	uc001tkb.1	+	8	1176	c.1071T>C	c.(1069-1071)GCT>GCC	p.A357A	HSP90B1_uc010swg.1_Silent_p.A22A|HSP90B1_uc009zui.1_Intron	NM_003299	NP_003290	P14625	ENPL_HUMAN	heat shock protein 90kDa beta, member 1	357					actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding			ovary(2)|skin(1)	3					Rifabutin(DB00615)	AATACAAAGCTTTCTACAAAT	0.308													7	297	---	---	---	---	PASS
CRYL1	51084	broad.mit.edu	37	13	20978192	20978192	+	3'UTR	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20978192G>T	uc001une.2	-	8					CRYL1_uc001unf.2_3'UTR|CRYL1_uc001ung.2_3'UTR	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin						fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		CTATGTCACAGAGGGCTGATT	0.547													7	28	---	---	---	---	PASS
CRYL1	51084	broad.mit.edu	37	13	21063530	21063530	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21063530T>C	uc001une.2	-	3	334	c.255A>G	c.(253-255)GTA>GTG	p.V85V	CRYL1_uc001unf.2_Silent_p.V63V|CRYL1_uc001ung.2_Silent_p.V63V	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin	85					fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		TGGCACCCTCTACTGCTTCTT	0.557											OREG0022283	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	41	---	---	---	---	PASS
C13orf18	80183	broad.mit.edu	37	13	46919715	46919715	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46919715T>C	uc010acl.2	-	13	2257	c.1652A>G	c.(1651-1653)CAG>CGG	p.Q551R	C13orf18_uc010tfy.1_Missense_Mutation_p.Q74R|C13orf18_uc001vbf.3_Missense_Mutation_p.Q484R|C13orf18_uc001vbg.3_Missense_Mutation_p.Q279R|C13orf18_uc010tfz.1_Missense_Mutation_p.Q394R|C13orf18_uc010acm.2_Missense_Mutation_p.Q416R|C13orf18_uc010acn.2_Missense_Mutation_p.Q336R|C13orf18_uc001vbe.3_Intron|C13orf18_uc001vbh.3_Missense_Mutation_p.Q551R|C13orf18_uc001vbi.3_Missense_Mutation_p.Q394R	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183	551											0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		TCCCGGCACCTGCTCGAACTC	0.522													6	33	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36008785	36008785	+	3'UTR	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36008785T>C	uc001wti.2	-	41					RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Missense_Mutation_p.K2072R|RALGAPA1_uc010tpv.1_3'UTR	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1						activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						ACGACGCAGCTTCATGGACAT	0.532													6	31	---	---	---	---	PASS
FAM179B	23116	broad.mit.edu	37	14	45433557	45433557	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45433557T>A	uc001wvv.2	+	1	2142	c.1933T>A	c.(1933-1935)TGT>AGT	p.C645S	FAM179B_uc001wvw.2_Missense_Mutation_p.C645S|FAM179B_uc010anc.2_RNA|KLHL28_uc001wvr.2_5'Flank|FAM179B_uc010anb.1_Missense_Mutation_p.C645S|FAM179B_uc001wvu.2_Missense_Mutation_p.C645S	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN	hypothetical protein LOC23116	645							binding			skin(2)|upper_aerodigestive_tract(1)	3						CCCAACTATCTGTACCCGAAG	0.453													22	65	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	55005035	55005035	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55005035T>A	uc001xay.2	+	6	1024	c.933T>A	c.(931-933)TTT>TTA	p.F311L	CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	311					cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						GCAGGCAGTTTGTTCAGGAAT	0.428													5	130	---	---	---	---	PASS
SFRS5	6430	broad.mit.edu	37	14	70237800	70237800	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70237800A>T	uc001xll.2	+	8	1980	c.529A>T	c.(529-531)ATT>TTT	p.I177F	SFRS5_uc001xlm.2_RNA|SFRS5_uc001xlo.2_Missense_Mutation_p.I177F|SFRS5_uc001xlp.2_Missense_Mutation_p.I177F|SFRS5_uc001xlq.2_Missense_Mutation_p.I174F	NM_006925	NP_008856	Q13243	SRSF5_HUMAN	splicing factor, arginine/serine-rich 5	177	RRM 2.				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)		AATAAAATTAATTGAAGGCAG	0.318													8	505	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28436294	28436294	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28436294C>A	uc001zbj.2	-	54	8654	c.8548G>T	c.(8548-8550)GTA>TTA	p.V2850L	HERC2_uc001zbk.1_Missense_Mutation_p.V385L	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2850	DOC.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCTGACACTACAACCAGGGAC	0.373													65	230	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43360146	43360146	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43360146C>T	uc001zqq.2	-	6	814	c.748G>A	c.(748-750)GAC>AAC	p.D250N	UBR1_uc010udk.1_Missense_Mutation_p.D250N	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	250					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AGCTCACAGTCAAGAGCTCTT	0.423													38	117	---	---	---	---	PASS
SNX22	79856	broad.mit.edu	37	15	64448384	64448384	+	3'UTR	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64448384A>G	uc002anc.1	+	7					PPIB_uc002and.2_Intron	NM_024798	NP_079074	Q96L94	SNX22_HUMAN	sorting nexin 22						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0						ATGGTGGATCAGGAGGTCCAC	0.557													10	27	---	---	---	---	PASS
CELF6	60677	broad.mit.edu	37	15	72579669	72579669	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72579669T>A	uc002auh.2	-	12	1693	c.1383A>T	c.(1381-1383)CAA>CAT	p.Q461H	uc002aug.2_Intron|CELF6_uc002auk.3_RNA|CELF6_uc010biv.1_RNA|CELF6_uc010biw.2_Missense_Mutation_p.Q348H|CELF6_uc010ukl.1_Missense_Mutation_p.Q324H|CELF6_uc010ukm.1_Missense_Mutation_p.Q434H|CELF6_uc002aui.2_Missense_Mutation_p.Q567H|CELF6_uc002auj.2_Missense_Mutation_p.Q348H	NM_052840	NP_443072	Q96J87	CELF6_HUMAN	bruno-like 6, RNA binding protein	461	RRM 3.				mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3						TCATGCCAATTTGAAAGCCAT	0.522													39	133	---	---	---	---	PASS
HDGFRP3	50810	broad.mit.edu	37	15	83832817	83832817	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83832817A>G	uc002bjs.1	-	2	250	c.95T>C	c.(94-96)CTC>CCC	p.L32P		NM_016073	NP_057157	Q9Y3E1	HDGR3_HUMAN	hepatoma-derived growth factor, related protein	32	PWWP.				cell proliferation	nucleus	growth factor activity				0						GCCCTCTGGGAGTTCATCAAT	0.363													6	263	---	---	---	---	PASS
KLHL25	64410	broad.mit.edu	37	15	86312584	86312584	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86312584A>G	uc002bly.2	-	2	661	c.458T>C	c.(457-459)ATG>ACG	p.M153T		NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN	BTB/POZ KELCH domain protein	153						cytoplasm				ovary(2)	2						CGAGAGCAGCATCATGCCCAG	0.617													5	20	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30747584	30747584	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30747584G>T	uc002dze.1	+	32	7178	c.6793G>T	c.(6793-6795)GTG>TTG	p.V2265L	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.V2060L	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2265	Glu-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			GGCTGAACAGGTGGCTGAGCT	0.542													9	48	---	---	---	---	PASS
GPT2	84706	broad.mit.edu	37	16	46950590	46950590	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46950590G>T	uc002eel.2	+	7	965	c.871G>T	c.(871-873)GAA>TAA	p.E291*	GPT2_uc002eem.2_Nonsense_Mutation_p.E191*	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	291					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	CTTTGCCTGGGAAGAGAAGCT	0.473													49	186	---	---	---	---	PASS
RANGRF	29098	broad.mit.edu	37	17	8193317	8193317	+	3'UTR	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8193317A>G	uc002gkv.2	+	5					SLC25A35_uc002gku.1_Intron|SLC25A35_uc002gkt.2_Intron|RANGRF_uc002gkw.2_3'UTR|RANGRF_uc002gky.2_3'UTR|RANGRF_uc002gkx.2_3'UTR|SLC25A35_uc002gkz.1_Intron	NM_016492	NP_057576	Q9HD47	MOG1_HUMAN	RAN guanine nucleotide release factor						protein transport	cytoplasm|nucleus	guanyl-nucleotide exchange factor activity				0						GAGGGGGAAAAGAGGTTGAAA	0.433													5	117	---	---	---	---	PASS
LOC90586	90586	broad.mit.edu	37	17	41020052	41020052	+	3'UTR	SNP	C	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41020052C>T	uc002ibw.1	+	1					LOC90586_uc002ibx.2_5'UTR	NR_002773				Homo sapiens amine oxidase pseudogene mRNA, splice variant HLAO1.												0						CCACAAGGCCCTTGACCCTGC	0.607													3	4	---	---	---	---	PASS
CEP76	79959	broad.mit.edu	37	18	12697299	12697299	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12697299G>A	uc002kri.2	-	5	785	c.629C>T	c.(628-630)TCA>TTA	p.S210L	PSMG2_uc002krg.2_Intron|CEP76_uc002krh.3_Missense_Mutation_p.S32L|CEP76_uc010wzz.1_Missense_Mutation_p.S135L|CEP76_uc010xaa.1_Missense_Mutation_p.S32L	NM_024899	NP_079175	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	210					G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0						CAGAAAATATGATGCTACTAA	0.378													36	177	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55027490	55027490	+	Silent	SNP	T	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55027490T>A	uc002lgn.2	+	4	1482	c.1125T>A	c.(1123-1125)ACT>ACA	p.T375T		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	375	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		CCAAGCTGACTCTGTCACACT	0.488													12	41	---	---	---	---	PASS
C19orf46	163183	broad.mit.edu	37	19	36494533	36494533	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36494533C>G	uc002ocq.1	-	7	1102	c.1013G>C	c.(1012-1014)AGG>ACG	p.R338T	C19orf46_uc002ocr.1_Missense_Mutation_p.E278D|C19orf46_uc002ocs.1_Missense_Mutation_p.R225T|C19orf46_uc010een.1_Missense_Mutation_p.R253T	NM_001039876	NP_001034965	Q8N205	SYNE4_HUMAN	hypothetical protein LOC163183	338	Cytoplasmic (Potential).				establishment of epithelial cell apical/basal polarity	integral to nuclear outer membrane	actin binding			ovary(1)	1	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCCCTCCAGCCTCACATCCTG	0.502													8	80	---	---	---	---	PASS
TMEM145	284339	broad.mit.edu	37	19	42821063	42821063	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42821063A>C	uc002otk.1	+	11	900	c.848A>C	c.(847-849)TAC>TCC	p.Y283S		NM_173633	NP_775904	Q8NBT3	TM145_HUMAN	transmembrane protein 145	283	Helical; (Potential).					integral to membrane					0		Prostate(69;0.00682)				TTGTCTGTCTACATGACCCTG	0.657													3	9	---	---	---	---	PASS
PROKR2	128674	broad.mit.edu	37	20	5294646	5294646	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5294646C>A	uc010zqw.1	-	1	370	c.370G>T	c.(370-372)GGC>TGC	p.G124C	PROKR2_uc010zqx.1_Missense_Mutation_p.G124C|PROKR2_uc010zqy.1_Missense_Mutation_p.G124C|uc002wly.1_5'Flank	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	124	Extracellular (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						AGCACGTGGCCATGCTCCCAG	0.597										HNSCC(71;0.22)			8	22	---	---	---	---	PASS
RPN2	6185	broad.mit.edu	37	20	35862464	35862464	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35862464T>C	uc002xgp.2	+	15	2023	c.1719T>C	c.(1717-1719)GCT>GCC	p.A573A	RPN2_uc002xgq.2_Silent_p.A541A	NM_002951	NP_002942	P04844	RPN2_HUMAN	ribophorin II isoform 1 precursor	573	Helical; (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TCACTTTTGCTCCTAGCACGA	0.453													7	360	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58422430	58422430	+	3'UTR	SNP	A	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58422430A>G	uc002yau.2	+	13					PHACTR3_uc002yat.2_3'UTR|PHACTR3_uc010zzw.1_3'UTR|PHACTR3_uc002yav.2_3'UTR|PHACTR3_uc002yaw.2_3'UTR|PHACTR3_uc002yax.2_3'UTR|PHACTR3_uc002yay.2_3'UTR	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1							nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AAGACCCAACATAACTCTATC	0.468													5	14	---	---	---	---	PASS
FANCB	2187	broad.mit.edu	37	X	14861710	14861710	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14861710T>C	uc004cwg.1	-	10	2827	c.2559A>G	c.(2557-2559)GCA>GCG	p.A853A	FANCB_uc004cwh.1_Silent_p.A853A	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN	Fanconi anemia complementation group B	853					DNA repair	nucleoplasm				lung(1)	1	Hepatocellular(33;0.183)					TCAGTTTCTGTGCAGCAAAGT	0.303								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	168	---	---	---	---	PASS
EFHC2	80258	broad.mit.edu	37	X	44108155	44108155	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44108155G>T	uc004dgb.3	-	7	956	c.866C>A	c.(865-867)CCA>CAA	p.P289Q		NM_025184	NP_079460	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	289	DM10 2.						calcium ion binding			breast(3)|ovary(2)|central_nervous_system(1)	6						GACTCTAGGTGGGCAATTCTG	0.279													48	149	---	---	---	---	PASS
SMC1A	8243	broad.mit.edu	37	X	53439943	53439943	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53439943T>C	uc004dsg.2	-	5	830	c.761A>G	c.(760-762)AAG>AGG	p.K254R	SMC1A_uc011moe.1_Missense_Mutation_p.K232R|SMC1A_uc011mof.1_Intron|SMC1A_uc004dsi.1_Missense_Mutation_p.K120R	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	254	Potential.				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						gtccatacgcttcttgtcctt	0.174													7	485	---	---	---	---	PASS
FAM104B	90736	broad.mit.edu	37	X	55172431	55172431	+	Intron	SNP	A	T	T	rs5018686	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55172431A>T	uc004duh.1	-						FAM104B_uc004dug.1_Intron|FAM104B_uc004dui.3_3'UTR	NM_138362	NP_612371	Q5XKR9	F104B_HUMAN	hypothetical protein LOC90736												0						TAAAATGTAGACTTAAAAACC	0.313													4	24	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65486502	65486502	+	Silent	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65486502T>C	uc011moz.1	+	21	3534	c.3474T>C	c.(3472-3474)TCT>TCC	p.S1158S	HEPH_uc004dwn.2_Silent_p.S1157S|HEPH_uc004dwo.2_Silent_p.S888S|HEPH_uc010nkr.2_Silent_p.S966S|HEPH_uc011mpa.1_Silent_p.S1158S	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	1155	Cytoplasmic (Potential).				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						AGCTTCTGTCTTTCAAACAGT	0.498													5	150	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70608627	70608627	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70608627G>A	uc004dzu.3	+	17	2657	c.2606G>A	c.(2605-2607)CGT>CAT	p.R869H	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.R890H|TAF1_uc004dzv.3_Missense_Mutation_p.R43H	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	869					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				TCTGATTTTCGTTTACCAACG	0.438													19	350	---	---	---	---	PASS
DIAPH2	1730	broad.mit.edu	37	X	96638943	96638943	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96638943G>A	uc004efu.3	+	25	3441	c.3045G>A	c.(3043-3045)ATG>ATA	p.M1015I	DIAPH2_uc004eft.3_Missense_Mutation_p.M1015I	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	1015	Potential.|FH2.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						GAAGAGAAATGGAAGAGAAGA	0.338													8	475	---	---	---	---	PASS
UTP14A	10813	broad.mit.edu	37	X	129045756	129045756	+	Silent	SNP	A	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129045756A>T	uc004euz.2	+	6	424	c.396A>T	c.(394-396)GTA>GTT	p.V132V	UTP14A_uc011mup.1_Intron|UTP14A_uc011muq.1_Silent_p.V78V	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	132					rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						ACAGAGAAGTAGCATTCAATA	0.478													21	100	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130417044	130417044	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130417044T>C	uc004ewd.2	-	6	1100	c.862A>G	c.(862-864)ATC>GTC	p.I288V	IGSF1_uc004ewe.3_Missense_Mutation_p.I277V|IGSF1_uc004ewf.2_Missense_Mutation_p.I268V	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	288	Ig-like C2-type 3.|Extracellular (Potential).				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						GTATCTTGGATCTTCAAAGAC	0.393													9	281	---	---	---	---	PASS
FGF13	2258	broad.mit.edu	37	X	137793084	137793084	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:137793084C>A	uc004fam.2	-	1	744	c.82G>T	c.(82-84)GTC>TTC	p.V28F	FGF13_uc004fan.2_Intron|FGF13_uc011mwi.1_Intron|FGF13_uc004faq.2_Intron|FGF13_uc004far.2_Intron|FGF13_uc011mwj.1_Intron|FGF13_uc011mwk.1_Intron|uc004fao.2_5'Flank	NM_004114	NP_004105	Q92913	FGF13_HUMAN	fibroblast growth factor 13 isoform 1	28					cell-cell signaling|MAPKKK cascade|nervous system development	cytoplasm|nucleus	growth factor activity|protein kinase activator activity			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GGGCTGCTGACACACTTGCAG	0.587													32	87	---	---	---	---	PASS
PIK3CD	5293	broad.mit.edu	37	1	9720834	9720834	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9720834delT	uc001aqb.3	+						PIK3CD_uc001aqa.2_Intron	NM_005026	NP_005017	O00329	PK3CD_HUMAN	catalytic phosphatidylinositol 3-kinase delta						phosphatidylinositol-mediated signaling|protein phosphorylation	phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(4)|skin(2)|central_nervous_system(1)	7	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)		cttttttGGGTTTTTTTTTCC	0.144													4	2	---	---	---	---	
CASZ1	54897	broad.mit.edu	37	1	10699617	10699618	+	Frame_Shift_Ins	INS	-	AA	AA			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10699617_10699618insAA	uc001aro.2	-	21	4981_4982	c.4661_4662insTT	c.(4660-4662)AGCfs	p.S1554fs		NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	1554					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CGCAGTCGGCGCTGGAGCTGAA	0.658													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	29045783	29045783	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29045783delT								GMEB1 (4398 upstream) : YTHDF2 (17353 downstream)																							CCTTTCTCAATTTCCAAGCTC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31093253	31093254	+	IGR	DEL	GA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31093253_31093254delGA								None (None upstream) : MATN1 (90872 downstream)																							cgcccAACATGAGAAAGAATTT	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33697289	33697289	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33697289delT								TRIM62 (49618 upstream) : ZNF362 (24885 downstream)																							ccatgctgggttttgattatc	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	55216146	55216146	+	IGR	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55216146delC								C1orf175 (8166 upstream) : PARS2 (6427 downstream)																							CTGCGGTAGACCCAGCTGCCC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	55384052	55384053	+	IGR	INS	-	A	A	rs143259472	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55384052_55384053insA								DHCR24 (31131 upstream) : TMEM61 (62412 downstream)																							atactttcaagaagtcgtggtc	0.000													5	6	---	---	---	---	
WDR78	79819	broad.mit.edu	37	1	67280061	67280061	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67280061delT	uc001dcx.2	-						WDR78_uc009waw.2_Intron|WDR78_uc009wax.2_Intron	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						TGAAAGGCTCttttttttttg	0.164													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	71672983	71672983	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71672983delA	uc001dfu.1	+											Homo sapiens cDNA clone IMAGE:6592429, partial cds.																		tacaaaactcaactctaccac	0.055													4	2	---	---	---	---	
MSH4	4438	broad.mit.edu	37	1	76338116	76338116	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76338116delC	uc001dhd.1	+							NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4						chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						cacagaaagtcaagctattgg	0.000								MMR					4	2	---	---	---	---	
CLCA2	9635	broad.mit.edu	37	1	86906168	86906168	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86906168delT	uc001dlr.3	+							NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor						cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		ATTTTGCTGATTTTTTTTTTA	0.279													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	119175400	119175400	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119175400delT								SPAG17 (447552 upstream) : TBX15 (250266 downstream)																							ttgttatttctttttttcttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142803276	142803278	+	Intron	DEL	AAC	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803276_142803278delAAC	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		ACCAAACCAAaacaacaacaaca	0.241													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149194050	149194050	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149194050delA								LOC645166 (240996 upstream) : LOC388692 (85426 downstream)																							ATTATACAGCAAAAAAAAGCG	0.343													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159990630	159990631	+	IGR	INS	-	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159990630_159990631insC								SLAMF9 (66586 upstream) : PIGM (6831 downstream)																							aaTaaaactaacccccaaggta	0.114													4	2	---	---	---	---	
C1orf9	51430	broad.mit.edu	37	1	172555306	172555306	+	Intron	DEL	G	-	-	rs34300126		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172555306delG	uc001giq.3	+						C1orf9_uc010pmm.1_Intron|C1orf9_uc009wwd.2_Intron|C1orf9_uc010pmn.1_Intron|C1orf9_uc010pmo.1_Intron	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein						multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		AACTTTTTTTGGGGGGGGTAT	0.358													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178629129	178629129	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178629129delA								C1orf220 (111105 upstream) : RALGPS2 (65171 downstream)																							GGCAAAAAGGAACTGAGATTG	0.413													4	2	---	---	---	---	
DUSP10	11221	broad.mit.edu	37	1	221911267	221911267	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221911267delC	uc001hmy.1	-						DUSP10_uc001hmx.1_5'Flank|DUSP10_uc001hmz.1_Intron	NM_007207	NP_009138	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10 isoform a						inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0103)		GGAGATGTGACCCAGAAACTG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	226519867	226519867	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226519867delA								LIN9 (22297 upstream) : PARP1 (28526 downstream)																							TTTCATTGTCAAAAAAAAATT	0.413													3	3	---	---	---	---	
GALNT2	2590	broad.mit.edu	37	1	230333497	230333498	+	Intron	DEL	TG	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230333497_230333498delTG	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				TTTTGTGCTCtgtgtgtgtgtg	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11076492	11076492	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11076492delA								KCNF1 (22142 upstream) : C2orf50 (196687 downstream)																							CCAGCATCTCAAAGGGCAGGA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13817349	13817349	+	IGR	DEL	A	-	-	rs112859467		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13817349delA								TRIB2 (934493 upstream) : FAM84A (955507 downstream)																							ggttattggtagaataaaaat	0.000													1	5	---	---	---	---	
ABCG5	64240	broad.mit.edu	37	2	44041946	44041947	+	Intron	INS	-	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44041946_44041947insA	uc002rtn.2	-						ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Intron|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				tttggtaaTATATATAACAtgt	0.005													3	3	---	---	---	---	
ABCG5	64240	broad.mit.edu	37	2	44041954	44041954	+	Intron	DEL	A	-	-	rs78944447		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44041954delA	uc002rtn.2	-						ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Intron|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TATATATAACAtgtgtgttta	0.005													3	3	---	---	---	---	
ABCG5	64240	broad.mit.edu	37	2	44041956	44041957	+	Intron	INS	-	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44041956_44041957insA	uc002rtn.2	-						ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Intron|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TATATAACAtgtgtgtttaaaa	0.005													3	3	---	---	---	---	
APLF	200558	broad.mit.edu	37	2	68764847	68764848	+	Intron	INS	-	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68764847_68764848insT	uc002sep.2	+						APLF_uc002seq.1_Intron|APLF_uc010fdf.2_Intron|APLF_uc002ser.1_Intron	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor						double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						TATTAAACTAAGCGCATAGAAA	0.188													4	3	---	---	---	---	
GCC2	9648	broad.mit.edu	37	2	109089064	109089064	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109089064delT	uc002tec.2	+						GCC2_uc002ted.2_Intron	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2						Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						TGGTTACTACTTTTTTTTTTT	0.284													6	3	---	---	---	---	
AMMECR1L	83607	broad.mit.edu	37	2	128633536	128633536	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128633536delT	uc002tpl.2	-						AMMECR1L_uc002tpm.2_Intron	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN	AMME chromosomal region gene 1-like											central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		cccagctatcttttttttttt	0.010													7	4	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	137872510	137872510	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137872510delT	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTGCTGGATGTTTTTTTTTTC	0.393													5	4	---	---	---	---	
NR4A2	4929	broad.mit.edu	37	2	157183073	157183073	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157183073delT	uc002tyz.3	-						NR4A2_uc002tyx.3_Intron|NR4A2_uc010zcf.1_Intron|NR4A2_uc010zcg.1_Intron	NM_006186	NP_006177	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2						cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						tcttctcgtctttttttgttt	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	157208018	157208019	+	IGR	DEL	TG	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157208018_157208019delTG								NR4A2 (18731 upstream) : GPD2 (83946 downstream)																							GGATTTGTCCTGACACATTAGT	0.401													4	2	---	---	---	---	
MYO3B	140469	broad.mit.edu	37	2	171259144	171259144	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171259144delA	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						ctactgcttgaaaaaaaaaag	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174879811	174879811	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174879811delT								SP3 (49748 upstream) : OLA1 (57365 downstream)																							tgattcaaacttttaggagag	0.095													4	2	---	---	---	---	
SESTD1	91404	broad.mit.edu	37	2	180129791	180129791	+	5'Flank	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180129791delC	uc002uni.3	-							NM_178123	NP_835224	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1						regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			tttcctctggcctcaTGCTGG	0.254													4	2	---	---	---	---	
SSFA2	6744	broad.mit.edu	37	2	182783039	182783039	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182783039delT	uc002uoi.2	+						SSFA2_uc002uoh.2_Intron|SSFA2_uc002uoj.2_Intron|SSFA2_uc002uok.2_Intron|SSFA2_uc010zfo.1_Intron|SSFA2_uc002uol.2_Intron|SSFA2_uc002uom.2_Intron	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1							cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TTTGATTTTGTTTTTTTTTAG	0.373													4	2	---	---	---	---	
RESP18	389075	broad.mit.edu	37	2	220192985	220192985	+	Intron	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220192985delG	uc002vlc.3	-						RESP18_uc002vlb.2_Intron|RESP18_uc010zle.1_Intron	NM_001007089	NP_001007090	Q5W5W9	RES18_HUMAN	regulated endocrine-specific protein 18							endoplasmic reticulum|extracellular region|Golgi apparatus					0						gcccctgtgtggtcagtcctg	0.000													4	2	---	---	---	---	
OBSL1	23363	broad.mit.edu	37	2	220435111	220435111	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220435111delC	uc010fwk.2	-	1	901	c.844delG	c.(844-846)GAGfs	p.E282fs	OBSL1_uc010fwl.1_5'Flank|OBSL1_uc002vmi.2_Frame_Shift_Del_p.E282fs|OBSL1_uc002vmj.2_Intron|INHA_uc002vmk.1_5'Flank	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1	282	Ig-like 3.				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GGGCGGCCCTCCCAGTGCCAT	0.667													4	2	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230753168	230753168	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230753168delA	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AGGAAAACATAAAAAAAAAGA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237710383	237710383	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237710383delA								CXCR7 (219391 upstream) : COPS8 (283701 downstream)																							CCACATTCAGAAAAAAAGCTC	0.383													4	2	---	---	---	---	
ZNF589	51385	broad.mit.edu	37	3	48288850	48288850	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48288850delT	uc003csl.3	+						ZNF589_uc010hjt.1_Intron|ZNF589_uc003csn.2_Intron|ZNF589_uc011bbg.1_Intron|ZNF589_uc003csm.2_Intron	NM_016089	NP_057173	Q86UQ0	ZN589_HUMAN	zinc finger protein 589						regulation of transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTTTTGCTAATTTTTAGGGTA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	102373675	102373675	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102373675delT								ZPLD1 (174990 upstream) : None (None downstream)																							gggccagagattttaggtgag	0.020													4	2	---	---	---	---	
UPK1B	7348	broad.mit.edu	37	3	118905362	118905362	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118905362delC	uc003ecc.2	+						UPK1B_uc011bix.1_Intron|UPK1B_uc003ecd.2_5'Flank	NM_006952	NP_008883	O75841	UPK1B_HUMAN	uroplakin 1B						epithelial cell differentiation	integral to membrane	structural molecule activity				0				GBM - Glioblastoma multiforme(114;0.222)		AAGGCACTGACCAGGCTCTGG	0.438													4	2	---	---	---	---	
SLC12A8	84561	broad.mit.edu	37	3	124911609	124911610	+	Intron	INS	-	G	G			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124911609_124911610insG	uc003ehv.3	-						SLC12A8_uc003ehw.3_Intron|SLC12A8_uc010hrz.1_Intron	NM_024628	NP_078904	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8						potassium ion transport	integral to membrane	symporter activity				0						CAGGATATTGAGGGGTGTGTAC	0.327													4	2	---	---	---	---	
ATR	545	broad.mit.edu	37	3	142277365	142277366	+	Intron	INS	-	AAAT	AAAT	rs72319579		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142277365_142277366insAAAT	uc003eux.3	-							NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein						cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						ctccgtctcaaaaataaataaa	0.069								Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
SR140	23350	broad.mit.edu	37	3	142775514	142775514	+	3'UTR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142775514delT	uc003evh.1	+	28					SR140_uc003evi.1_3'UTR|SR140_uc003evj.1_RNA|SR140_uc003evk.1_3'UTR	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein						RNA processing	nucleus	nucleotide binding|RNA binding				0						CAAGATGAAATTTTTATTGTT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149865368	149865368	+	IGR	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149865368delC								PFN2 (176627 upstream) : TSC22D2 (261420 downstream)																							TGACTCACGACCCCAGGCAGC	0.363													4	2	---	---	---	---	
KCNAB1	7881	broad.mit.edu	37	3	155858849	155858850	+	Intron	INS	-	T	T	rs78801423		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155858849_155858850insT	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_5'Flank	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AGTTTCTTTGCTTTtttttttt	0.228													4	2	---	---	---	---	
LEKR1	389170	broad.mit.edu	37	3	156577251	156577251	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156577251delT	uc003fbb.2	+						LEKR1_uc003fba.1_Intron			Q6ZMV7	LEKR1_HUMAN	Homo sapiens cDNA FLJ16641 fis, clone TESTI4028958.												0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			tttagagcagttttaagttca	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	157402327	157402328	+	IGR	DEL	GG	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157402327_157402328delGG								C3orf55 (83308 upstream) : SHOX2 (411473 downstream)																							TAATATTGGTGGGGGAGGTAGT	0.376													4	2	---	---	---	---	
RARRES1	5918	broad.mit.edu	37	3	158416006	158416008	+	Intron	DEL	GTG	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158416006_158416008delGTG	uc003fci.2	-							NM_206963	NP_996846	P49788	TIG1_HUMAN	retinoic acid receptor responder (tazarotene						negative regulation of cell proliferation	integral to membrane					0			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)	ACCAAAGTCTGTGGGAATAGGGA	0.379													4	2	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	159601640	159601640	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159601640delT	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron|SCHIP1_uc010hvz.1_Intron|SCHIP1_uc003fcu.1_Intron|SCHIP1_uc003fcv.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			CTCCCCCAACTTTTTTTTTTC	0.393													4	3	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171902032	171902032	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171902032delC	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		ttcttttactcagctcatatt	0.249													4	2	---	---	---	---	
MFN1	55669	broad.mit.edu	37	3	179066998	179066999	+	Intron	DEL	TA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179066998_179066999delTA	uc003fjs.2	+						MFN1_uc010hxb.2_Intron|MFN1_uc003fjt.2_Intron	NM_033540	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1						mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity			ovary(2)|large_intestine(1)	3	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GAGAAATAGCTATGTTAATAGT	0.203													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193622859	193622859	+	IGR	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193622859delG								OPA1 (207260 upstream) : LOC100128023 (88025 downstream)																							TGCTACAATAGCAAGAGAAGC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14780216	14780216	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14780216delA	uc003gne.2	-						uc003gnf.2_Intron					Homo sapiens cDNA clone IMAGE:3604199, **** WARNING: chimeric clone ****.																		gcaaggaactaaaaagtggaa	0.080													4	2	---	---	---	---	
LGI2	55203	broad.mit.edu	37	4	25004856	25004856	+	3'UTR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25004856delT	uc003grf.2	-	8						NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2							extracellular region					0		Breast(46;0.173)				GGCTTTAAGATTTTTTTTTAA	0.333													4	2	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48513250	48513251	+	Intron	DEL	GA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48513250_48513251delGA	uc003gyh.1	-						FRYL_uc003gyf.1_Intron|FRYL_uc003gyg.1_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						CCCTATTCCTGAGATTTTTTCA	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	66132958	66132958	+	IGR	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66132958delG								TECRL (857780 upstream) : EPHA5 (52324 downstream)																							tagaagttgagactgccacca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111583410	111583411	+	IGR	DEL	GC	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111583410_111583411delGC								PITX2 (20293 upstream) : MIR297 (198327 downstream)																							CATGTTTGTTGCATGGGTATTA	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	131205451	131205452	+	IGR	INS	-	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131205451_131205452insA								None (None upstream) : None (None downstream)																							tgagctgagtgaaaaaacaaat	0.000													4	2	---	---	---	---	
SLC10A7	84068	broad.mit.edu	37	4	147431414	147431415	+	Intron	DEL	AT	-	-	rs139723022		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147431414_147431415delAT	uc010ioz.2	-						SLC10A7_uc003ikr.2_Intron|SLC10A7_uc010ipa.2_Intron|SLC10A7_uc003iks.2_Intron|SLC10A7_uc003ikt.2_Intron	NM_001029998	NP_001025169	Q0GE19	NTCP7_HUMAN	solute carrier family 10 (sodium/bile acid							integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)					AATTTCTTAAAttttttttttt	0.114													5	3	---	---	---	---	
ARHGAP10	79658	broad.mit.edu	37	4	148831168	148831168	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148831168delT	uc003ilf.2	+						ARHGAP10_uc003ilg.2_Intron	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10						apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		ttttcttttctttttttttga	0.209													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	177512903	177512904	+	IGR	INS	-	AAC	AAC	rs138544983	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177512903_177512904insAAC								SPCS3 (259509 upstream) : VEGFC (91787 downstream)																							GACATGAACTGAACAACAACAA	0.416													5	6	---	---	---	---	
UFSP2	55325	broad.mit.edu	37	4	186327487	186327488	+	Intron	DEL	TG	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186327487_186327488delTG	uc003ixo.2	-						UFSP2_uc003ixn.2_Intron|UFSP2_uc003ixq.2_Intron|UFSP2_uc003ixp.2_Intron	NM_018359	NP_060829	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2							endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		aatacatgtctgtgaaatcaat	0.094													4	2	---	---	---	---	
FAM149A	25854	broad.mit.edu	37	4	187072453	187072453	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187072453delT	uc003iyt.3	+						FAM149A_uc011cla.1_Intron|FAM149A_uc010isj.2_Intron|FAM149A_uc010isk.2_Intron|FAM149A_uc003iyu.3_Intron|FAM149A_uc010isl.2_Intron|FAM149A_uc011clb.1_5'Flank	NM_015398	NP_056213	A5PLN7	F149A_HUMAN	hypothetical protein LOC25854											breast(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		TCTAGGATTCTTTTAGTACAA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190574002	190574002	+	IGR	DEL	G	-	-	rs68116009		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190574002delG								None (None upstream) : FRG1 (287972 downstream)																							gagttcacttgtgcacaaatc	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	11636	11637	+	IGR	INS	-	C	C			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11636_11637insC								None (None upstream) : PLEKHG4B (128736 downstream)																							cctaaccctaaccctaacccta	0.000													4	2	---	---	---	---	
CMBL	134147	broad.mit.edu	37	5	10280300	10280300	+	3'UTR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10280300delT	uc003jes.2	-	6						NM_138809	NP_620164	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase							cytosol	hydrolase activity|protein binding			skin(1)	1						atccacccactttggcctccc	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10914279	10914279	+	IGR	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10914279delC								DAP (152892 upstream) : CTNND2 (57673 downstream)																							CCTCCAGGCTCCCCAGTCAGC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51867038	51867038	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51867038delA								None (None upstream) : ITGA1 (216736 downstream)																							ggaggatgggaaaaaaATGCA	0.279													6	3	---	---	---	---	
ANKRD55	79722	broad.mit.edu	37	5	55409181	55409182	+	Intron	INS	-	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55409181_55409182insA	uc003jqu.2	-						ANKRD55_uc003jqt.2_Intron	NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				tgtacttgcagaaaaaaaaagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	65570105	65570105	+	IGR	DEL	T	-	-	rs67280939		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65570105delT								SFRS12 (93393 upstream) : MAST4 (322071 downstream)																							AAATGTTTTCTTTTTTTTCCA	0.428													3	3	---	---	---	---	
CAST	831	broad.mit.edu	37	5	96072163	96072166	+	Intron	DEL	AAAC	-	-	rs71916107		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96072163_96072166delAAAC	uc003klz.1	+						CAST_uc003klt.2_Intron|CAST_uc003klu.2_Intron|CAST_uc003klv.2_Intron|CAST_uc003klw.2_Intron|CAST_uc003klx.2_Intron|CAST_uc003kly.2_Intron|CAST_uc011cuo.1_Intron|CAST_uc011cup.1_Intron|CAST_uc011cuq.1_Intron|CAST_uc011cur.1_Intron|CAST_uc011cus.1_Intron|CAST_uc003kma.1_Intron|CAST_uc011cut.1_Intron|CAST_uc003kmb.2_Intron|CAST_uc003kmc.2_Intron|CAST_uc003kmd.2_Intron|CAST_uc003kme.2_Intron|CAST_uc003kmf.2_Intron	NM_001042443	NP_001035908	P20810	ICAL_HUMAN	calpastatin isoform i								calcium-dependent cysteine-type endopeptidase inhibitor activity|protein binding			central_nervous_system(3)|ovary(1)|kidney(1)	5		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		TTTTAAAAAAAAACAAACAAACTC	0.324													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	147167921	147167921	+	IGR	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147167921delG								JAKMIP2 (5669 upstream) : SPINK1 (36222 downstream)																							tatgaagcaaggaaagaaagg	0.000													4	2	---	---	---	---	
SPINK5	11005	broad.mit.edu	37	5	147481730	147481730	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147481730delA	uc003lox.2	+						SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tgtgggatctaaaaaaagcta	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173244486	173244486	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173244486delA								BOD1 (200820 upstream) : CPEB4 (70845 downstream)																							CGTAACAGGGAAAAAAAATTG	0.383													4	2	---	---	---	---	
FAF2	23197	broad.mit.edu	37	5	175881832	175881833	+	Intron	DEL	TG	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175881832_175881833delTG	uc003mej.3	+							NM_014613	NP_055428	Q96CS3	FAF2_HUMAN	UBX domain containing 8						response to unfolded protein	endoplasmic reticulum|lipid particle	protein binding			ovary(1)	1						aactctattctgtaatatgttc	0.045													4	2	---	---	---	---	
NSD1	64324	broad.mit.edu	37	5	176694924	176694924	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176694924delT	uc003mfr.3	+						NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_Intron	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCTGTCGAAATTTTTTTTTCT	0.294			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			5	3	---	---	---	---	
CD2AP	23607	broad.mit.edu	37	6	47549466	47549466	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47549466delC	uc003oyw.2	+							NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein						cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			AGAATGTTTTCATCACCACAG	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	52677938	52677939	+	IGR	DEL	GT	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52677938_52677939delGT								GSTA1 (9274 upstream) : GSTA5 (18602 downstream)																							CTCACTCATGGTGCCAAAAGCA	0.465													4	2	---	---	---	---	
SYNCRIP	10492	broad.mit.edu	37	6	86346559	86346559	+	Intron	DEL	A	-	-	rs116240890	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86346559delA	uc003pla.2	-						SYNCRIP_uc003pku.2_Intron|SYNCRIP_uc003pkw.2_Intron|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Intron|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Intron	NM_006372	NP_006363	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA						CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		GTGATGTGGGAAAAAAAAAAC	0.353													4	3	---	---	---	---	
FBXL4	26235	broad.mit.edu	37	6	99340968	99340968	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99340968delT	uc003ppf.1	-						FBXL4_uc003ppg.1_Intron|FBXL4_uc003pph.1_Intron|FBXL4_uc010kcp.2_Intron	NM_012160	NP_036292	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4						ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex				skin(2)	2		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TGACTCCAGATTTTTTTTTTC	0.388													4	2	---	---	---	---	
FYN	2534	broad.mit.edu	37	6	112188267	112188267	+	Intron	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112188267delG	uc003pvk.2	-							NM_002037	NP_002028	P06241	FYN_HUMAN	protein-tyrosine kinase fyn isoform a						axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	CTCtgttcctgggcttgctct	0.234													4	2	---	---	---	---	
VTA1	51534	broad.mit.edu	37	6	142510897	142510897	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142510897delT	uc003qiw.2	+						VTA1_uc011edt.1_Intron|VTA1_uc011edu.1_Intron	NM_016485	NP_057569	Q9NP79	VTA1_HUMAN	Vps20-associated 1 homolog						cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		TGTCTCCTGCttttttttttt	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	142785933	142785934	+	IGR	INS	-	CT	CT			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142785933_142785934insCT								GPR126 (18532 upstream) : LOC153910 (61658 downstream)																							GGTTGCACTTCCTCTCTCTCAC	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	156240015	156240015	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156240015delA								NOX3 (462978 upstream) : MIR1202 (27916 downstream)																							GCTGGTACGTAACCAAATGCC	0.463													4	2	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157345403	157345403	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157345403delT	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron|ARID1B_uc003qqq.1_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TTATAAACTCTTAGAAAAACA	0.333													4	2	---	---	---	---	
PACRG	135138	broad.mit.edu	37	6	163578382	163578384	+	Intron	DEL	GCA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163578382_163578384delGCA	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		CACCACCTCTGCAAAGCCTCCCA	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164317330	164317330	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164317330delA								QKI (322438 upstream) : None (None downstream)																							ATTTTGACCCAAACTGTGATT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24057650	24057650	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24057650delT								STK31 (113285 upstream) : NPY (266159 downstream)																							ttctttgctattttttaacac	0.000													4	2	---	---	---	---	
LOC349114	349114	broad.mit.edu	37	7	39773695	39773695	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39773695delA	uc003thf.2	+							NR_026999				Homo sapiens cDNA FLJ40085 fis, clone TESTI2002993.												0						tcttccttggaatgtagcaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96918442	96918442	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96918442delA								ACN9 (107369 upstream) : TAC1 (442829 downstream)																							AGAGCTAGTGAAAAAATCAGA	0.323													4	2	---	---	---	---	
PLOD3	8985	broad.mit.edu	37	7	100854824	100854824	+	Intron	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100854824delG	uc003uyd.2	-						PLOD3_uc010lhs.2_Intron	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase						protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	GGGTCTACCTGGGCCCCGGGT	0.542													4	2	---	---	---	---	
RBM28	55131	broad.mit.edu	37	7	127953006	127953006	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127953006delA	uc003vmp.2	-						RBM28_uc003vmo.2_Intron|RBM28_uc011koj.1_Intron	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28						mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						GGGAATATGTAAAACAAGGAG	0.353													4	2	---	---	---	---	
FAM71F1	84691	broad.mit.edu	37	7	128362506	128362506	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128362506delT	uc003vno.1	+						FAM71F1_uc010llo.1_Intron|FAM71F1_uc011koq.1_Intron|FAM71F1_uc003vnm.1_Intron|FAM71F1_uc003vnn.1_Intron|FAM71F1_uc010llp.1_Intron|FAM71F1_uc003vnp.1_Intron	NM_032599	NP_115988	Q96KD3	F71F1_HUMAN	testes development-related NYD-SP18											skin(1)	1						AAGAAATTAATTTTGCCCCGA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143227664	143227665	+	IGR	DEL	GA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143227664_143227665delGA								TAS2R41 (51775 upstream) : LOC441294 (41225 downstream)																							atgttattctgaggtgttgagt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148347109	148347109	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148347109delA								C7orf33 (34158 upstream) : CUL1 (47897 downstream)																							accctgtctcaaaaaaaaaaa	0.204													4	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152059472	152059473	+	Intron	INS	-	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152059472_152059473insT	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aggtctaagaatttttttttaa	0.114			N		medulloblastoma								4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3837081	3837081	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3837081delA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		aggcctttggaaaacacctac	0.025													4	2	---	---	---	---	
MFHAS1	9258	broad.mit.edu	37	8	8749266	8749266	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8749266delC	uc003wsj.1	-	1	1866	c.1303delG	c.(1303-1305)GAGfs	p.E435fs		NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified	435	Roc.										0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GGGCATCCCTCCACTCTCTCC	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8897935	8897935	+	IGR	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8897935delG								ERI1 (7086 upstream) : PPP1R3B (95839 downstream)																							ctaacgccttggggcagcagt	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	10305812	10305812	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10305812delA								MSRA (19413 upstream) : PRSS55 (77269 downstream)																							tcagaacttcaaaaaaaactg	0.000													4	2	---	---	---	---	
EFHA2	286097	broad.mit.edu	37	8	16973350	16973350	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16973350delC	uc003wxd.2	+							NM_181723	NP_859074	Q86XE3	EFHA2_HUMAN	EF-hand domain family, member A2							integral to membrane	calcium ion binding			skin(1)	1				Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)		AAACCAGACTCCCTGTTTTCT	0.478													4	2	---	---	---	---	
BMP1	649	broad.mit.edu	37	8	22026825	22026826	+	Intron	DEL	TC	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22026825_22026826delTC	uc003xbg.2	+						BMP1_uc011kzb.1_Intron|BMP1_uc003xba.2_Intron|BMP1_uc003xbb.2_Intron|BMP1_uc003xbe.2_Intron|BMP1_uc003xbc.2_Intron|BMP1_uc003xbd.2_Intron|BMP1_uc003xbf.2_Intron|BMP1_uc011kzc.1_Intron|BMP1_uc003xbh.2_Intron|BMP1_uc003xbi.2_Intron	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3						cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		AGTCAGCTAAtctctctctctc	0.436													4	2	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	31598865	31598866	+	Intron	INS	-	C	C	rs7009880	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31598865_31598866insC	uc003xip.2	+							NM_013962	NP_039256	Q02297	NRG1_HUMAN	neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		ctgcacatgtaccccctgaatc	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	75110049	75110050	+	IGR	INS	-	A	A	rs147121562	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75110049_75110050insA								LY96 (168744 upstream) : JPH1 (36891 downstream)																							CACACAGTTACAAGGGCTTCTG	0.495													4	3	---	---	---	---	
LOC100192378	100192378	broad.mit.edu	37	8	77527399	77527399	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77527399delT	uc003yas.3	-							NR_024360				Homo sapiens cDNA clone IMAGE:4811567.												0						ATTTTCTTAATTTTCCATCAG	0.398													4	2	---	---	---	---	
SPAG1	6674	broad.mit.edu	37	8	101206174	101206174	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101206174delT	uc003yjh.1	+						SPAG1_uc003yjg.1_Intron|SPAG1_uc003yji.1_Intron	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1						single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		TGTGTGTGTGTTTTTTTTTTA	0.204													4	2	---	---	---	---	
BAALC	79870	broad.mit.edu	37	8	104190518	104190519	+	Intron	DEL	GT	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104190518_104190519delGT	uc003yld.2	+						BAALC_uc003yle.2_Intron|uc003ylf.2_Intron	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			aatccttgtggtgatggagctg	0.000													4	2	---	---	---	---	
MTSS1	9788	broad.mit.edu	37	8	125603774	125603775	+	Intron	DEL	AA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125603774_125603775delAA	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			attgtaatctaaaaattgactt	0.099													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141207076	141207077	+	Intron	INS	-	TA	TA	rs145504349	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141207076_141207077insTA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						AAATGTCATTTTATCTTTTATA	0.391													5	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	2214269	2214269	+	IGR	DEL	G	-	-	rs141832819		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2214269delG								SMARCA2 (20648 upstream) : FLJ35024 (208433 downstream)																							TAGCGGGCCAGGGAGGTTACT	0.458													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	13866461	13866461	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13866461delA								MPDZ (586898 upstream) : NFIB (215387 downstream)																							ttccttaattatcgacccaca	0.005													4	2	---	---	---	---	
LINGO2	158038	broad.mit.edu	37	9	28402548	28402548	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28402548delC	uc010mjf.1	-						LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		ATCTTCTCTGCCCCACTTCTc	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	29963429	29963429	+	IGR	DEL	A	-	-	rs34689006		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29963429delA								None (None upstream) : None (None downstream)																							GAAGCACAGTAACACTCAAGG	0.373													2	5	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66495777	66495777	+	5'Flank	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66495777delG	uc004aed.1	+											Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						ttttagaattgtttttgtaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68393548	68393548	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68393548delA								FAM27B (599359 upstream) : MIR1299 (608691 downstream)																							atatccctttagcatttcttg	0.000													11	5	---	---	---	---	
CBWD3	445571	broad.mit.edu	37	9	70484761	70484761	+	Intron	DEL	T	-	-	rs112840153		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70484761delT	uc004aga.3	-						CBWD5_uc011lrl.1_5'Flank|CBWD3_uc004agc.3_Intron|CBWD3_uc004afy.3_Intron|CBWD3_uc011lrm.1_Intron|CBWD3_uc011lrn.1_Intron|CBWD3_uc004agb.3_Intron|CBWD3_uc010moe.1_Intron|CBWD3_uc004agd.1_Intron|CBWD3_uc004age.2_Intron	NM_201453	NP_958861	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding				0				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		AATGAAGGCATTTTTTTCTTG	0.383													8	5	---	---	---	---	
C9orf135	138255	broad.mit.edu	37	9	72460633	72460634	+	Intron	DEL	AC	-	-	rs34208910		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72460633_72460634delAC	uc004ahl.2	+						C9orf135_uc011lrw.1_Intron|C9orf135_uc010moq.2_Intron|C9orf135_uc011lrx.1_Intron|C9orf135_uc010mop.2_Intron	NM_001010940	NP_001010940	Q5VTT2	CI135_HUMAN	hypothetical protein LOC138255							integral to membrane				ovary(1)	1						GCAGGAACTAACACAGCTCTAA	0.475													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	88464729	88464729	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88464729delA								AGTPBP1 (107785 upstream) : NAA35 (91328 downstream)																							TGAAGCTGCCAAAAACATGCA	0.224													4	2	---	---	---	---	
NAA35	60560	broad.mit.edu	37	9	88592546	88592547	+	Intron	INS	-	TA	TA			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88592546_88592547insTA	uc004aoi.3	+						NAA35_uc004aoj.3_Intron|NAA35_uc004aok.1_Intron	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						GAATTTTGTTTTATTTTTTACT	0.292													15	7	---	---	---	---	
SLC27A4	10999	broad.mit.edu	37	9	131100883	131100883	+	5'Flank	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131100883delA	uc004but.2	+						SLC27A4_uc004buu.2_5'Flank	NM_005094	NP_005085	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid						long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding				0						tccgtctcggaaaaaaaaaaa	0.149													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	5431273	5431274	+	IGR	DEL	TT	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5431273_5431274delTT								UCN3 (15104 upstream) : TUBAL3 (3788 downstream)																							TTCAAAATAATTTTAAGGAGGA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10284291	10284292	+	IGR	DEL	TC	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10284291_10284292delTC								None (None upstream) : SFTA1P (542110 downstream)																							gtggacagtatctctctcttca	0.000													4	2	---	---	---	---	
TRDMT1	1787	broad.mit.edu	37	10	17195305	17195305	+	Intron	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17195305delG	uc001iop.2	-						TRDMT1_uc001ioq.2_Intron|TRDMT1_uc001ior.2_Intron|TRDMT1_uc001ios.2_Intron|TRDMT1_uc009xjt.2_Intron|TRDMT1_uc010qcc.1_Intron|TRDMT1_uc010qcd.1_3'UTR	NM_004412	NP_004403	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1 isoform						tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding			ovary(1)	1						GAGTTAGAGAGGGGGAGAATG	0.502													4	2	---	---	---	---	
LOC441666	441666	broad.mit.edu	37	10	42833086	42833087	+	RNA	DEL	TA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42833086_42833087delTA	uc010qey.1	-	3		c.888_889delTA				NR_024380				Homo sapiens noncoding mRNA sequence.												0						CAGTATGAACTATGTTATGTTG	0.361													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	54714998	54714999	+	IGR	DEL	AT	-	-	rs57676258		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54714998_54714999delAT								MBL2 (183538 upstream) : PCDH15 (847536 downstream)																							aggagaagagatagagagagac	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	62525138	62525140	+	IGR	DEL	AAG	-	-	rs72200584		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62525138_62525140delAAG								ANK3 (31983 upstream) : CDK1 (12983 downstream)																							gaagagagaaaagaagaagaaga	0.034													4	2	---	---	---	---	
LOC650623	650623	broad.mit.edu	37	10	81444807	81444807	+	RNA	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81444807delG	uc010qlu.1	+	1		c.2077delG				NR_027512				Homo sapiens BEN domain containing 3 pseudogene (LOC650623), non-coding RNA.												0						GCCCCCGAGAGGAGCAGCAAG	0.597													4	2	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105183203	105183203	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105183203delT	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TCCTCTTTGCTTTTTTGGATC	0.473													20	9	---	---	---	---	
SORCS3	22986	broad.mit.edu	37	10	106903115	106903115	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106903115delT	uc001kyi.1	+							NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		catccttcactttttttcaat	0.000													4	2	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116464795	116464795	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116464795delT	uc001lbz.1	-									O14639	ABLM1_HUMAN	Homo sapiens cDNA FLJ25105 fis, clone CBR01442.						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		GTTCAAGTTCTTTTTTTTTTC	0.448													4	2	---	---	---	---	
C10orf90	118611	broad.mit.edu	37	10	128240099	128240099	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128240099delA	uc010qum.1	-						C10orf90_uc009yao.2_Intron	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611											ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TGAGTGTGGGAAAAAAAAATT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	131041119	131041120	+	IGR	DEL	TA	-	-	rs36020724		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131041119_131041120delTA								None (None upstream) : MGMT (224334 downstream)																							AATGGAGCTTTATAAGATGGGG	0.505													4	2	---	---	---	---	
DCHS1	8642	broad.mit.edu	37	11	6665958	6665958	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6665958delC	uc001mem.1	-							NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCTTCCACACCACCATACTC	0.328													4	2	---	---	---	---	
CTR9	9646	broad.mit.edu	37	11	10796504	10796504	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10796504delC	uc001mja.2	+							NM_014633	NP_055448	Q6PD62	CTR9_HUMAN	SH2 domain binding protein 1						histone H2B ubiquitination|histone monoubiquitination	Cdc73/Paf1 complex|nuclear speck				ovary(2)	2				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GTGCAAGATTCAAATGCAAAT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11203811	11203812	+	IGR	INS	-	T	T	rs146876469	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11203811_11203812insT								ZBED5 (324191 upstream) : GALNTL4 (88609 downstream)																							TTTGTTTAGACTTTTTTTGTCT	0.436													4	2	---	---	---	---	
GALNTL4	374378	broad.mit.edu	37	11	11348276	11348276	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11348276delC	uc001mjo.2	-							NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		GGGAGAACCTCCCACTCTTGC	0.493													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19797267	19797268	+	Intron	INS	-	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19797267_19797268insA	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						cagaagtctccctgaagaggtg	0.000													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20055367	20055368	+	Intron	DEL	TG	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20055367_20055368delTG	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron|NAV2_uc001mpt.2_Intron|NAV2_uc009yhx.2_Intron|NAV2_uc009yhy.1_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TTTGGGGTTATGTGTGTGTGTG	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43142495	43142495	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43142495delA								None (None upstream) : API5 (191010 downstream)																							AAAAAGAGACAAAAAAAAACA	0.184													4	2	---	---	---	---	
EHD1	10938	broad.mit.edu	37	11	64630762	64630763	+	Intron	DEL	GG	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64630762_64630763delGG	uc001obu.1	-						EHD1_uc001obv.1_Intron|EHD1_uc010rnq.1_Intron	NM_006795	NP_006786	Q9H4M9	EHD1_HUMAN	EH-domain containing 1						blood coagulation|cholesterol homeostasis|endocytic recycling|intracellular protein transport|low-density lipoprotein particle clearance|positive regulation of cholesterol storage|protein homooligomerization	early endosome membrane|lipid particle|plasma membrane|platelet dense tubular network membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|protein binding				0						TTGCCAAGCTGGGGATGGAGAT	0.574													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	71827319	71827319	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71827319delT								C11orf51 (3497 upstream) : FOLR3 (19452 downstream)																							ctccagagagttttcccactc	0.219													4	2	---	---	---	---	
TYR	7299	broad.mit.edu	37	11	89025208	89025208	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89025208delT	uc001pcs.2	+							NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor						eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	gaattaagactttttttttca	0.114									Oculocutaneous_Albinism				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90849825	90849825	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90849825delT								MIR1261 (247455 upstream) : None (None downstream)																							aagtacttcattttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	102128372	102128372	+	IGR	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102128372delC								YAP1 (24218 upstream) : BIRC3 (59822 downstream)																							CAAGCTTTGTCCCCACTCCCC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109956821	109956821	+	IGR	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109956821delG								C11orf87 (656983 upstream) : ZC3H12C (7105 downstream)																							GGATATTCTTGGGCTGAAAAT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115641047	115641048	+	IGR	DEL	AC	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115641047_115641048delAC								CADM1 (265806 upstream) : BUD13 (977840 downstream)																							aagtttaaaaacaaaaaacagg	0.000													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	132125076	132125076	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132125076delT	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron|NTM_uc001qgr.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						AGCCTGAACATTTTTTTTATC	0.289													4	2	---	---	---	---	
ACSM4	341392	broad.mit.edu	37	12	7456667	7456667	+	5'Flank	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7456667delT	uc001qsx.1	+							NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						agttaaggggtttttttagac	0.139													3	3	---	---	---	---	
RPL13AP20	387841	broad.mit.edu	37	12	13026035	13026035	+	5'Flank	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13026035delA	uc010sho.1	+							NR_003932				SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;												0						CCCTTTGAAGAACCACAGAGG	0.473													4	2	---	---	---	---	
NAP1L1	4673	broad.mit.edu	37	12	76450179	76450179	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76450179delA	uc001sxw.2	-						NAP1L1_uc001sxv.2_Intron|NAP1L1_uc001sxz.2_Intron|NAP1L1_uc001sxx.2_Intron|NAP1L1_uc001sxy.2_Intron|NAP1L1_uc010sty.1_Intron|NAP1L1_uc010stz.1_Intron|NAP1L1_uc010sua.1_Intron|NAP1L1_uc001syb.2_Intron|NAP1L1_uc001sya.2_Intron|NAP1L1_uc001syc.2_Intron	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1						DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				CCATTTTAGTAAAAAAAAAAT	0.348													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	83063834	83063834	+	IGR	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83063834delC								C12orf26 (190893 upstream) : TMTC2 (17100 downstream)																							TCAGCCTGGGCCCCCAGCAAG	0.229													4	2	---	---	---	---	
ATP2B1	490	broad.mit.edu	37	12	89987581	89987581	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89987581delT	uc001tbh.2	-						ATP2B1_uc001tbg.2_Intron|ATP2B1_uc009zsr.2_Intron|ATP2B1_uc001tbf.2_Intron	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						ATAttagagattttttttttc	0.159													4	2	---	---	---	---	
SVOP	55530	broad.mit.edu	37	12	109331489	109331490	+	Intron	DEL	TC	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109331489_109331490delTC	uc010sxh.1	-							NM_018711	NP_061181	Q8N4V2	SVOP_HUMAN	SV2 related protein							cell junction|integral to membrane|synaptic vesicle membrane	ion transmembrane transporter activity				0						CTTCCCCAGTTCTAGGTCTAGG	0.460													4	2	---	---	---	---	
MIPEP	4285	broad.mit.edu	37	13	24308732	24308732	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24308732delT	uc001uox.3	-							NM_005932	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase precursor						protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		tcttgggacctcaagaggaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31992751	31992752	+	IGR	DEL	CT	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31992751_31992752delCT								B3GALTL (86342 upstream) : RXFP2 (320927 downstream)																							CAATCCAGAACTCAGAGAAATG	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	48240559	48240559	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48240559delA								HTR2A (769509 upstream) : SUCLA2 (276233 downstream)																							ttccagctctactcagtatct	0.000													4	2	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50284029	50284029	+	Intron	DEL	A	-	-	rs34513990		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50284029delA	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		AAACTTTATGAAAAAAAAAAA	0.254													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	52070109	52070109	+	IGR	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52070109delC								INTS6 (42834 upstream) : WDFY2 (88375 downstream)																							GCAAAACAGGCCCTTTGGAGA	0.328													4	2	---	---	---	---	
PCDH9	5101	broad.mit.edu	37	13	67187106	67187106	+	Intron	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67187106delG	uc001vik.2	-						PCDH9_uc010aei.2_Intron|PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		catgcaaagtgggggctcaat	0.000													4	2	---	---	---	---	
MYCBP2	23077	broad.mit.edu	37	13	77695268	77695269	+	Intron	INS	-	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77695268_77695269insA	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron|MYCBP2_uc001vkg.1_Intron	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TTTTTAAATAGAAAAAAAATAA	0.257													4	2	---	---	---	---	
DOCK9	23348	broad.mit.edu	37	13	99655915	99655916	+	Intron	INS	-	C	C	rs139566878	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99655915_99655916insC	uc001vnt.2	-						DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tit.1_Intron	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					cttgactccttgtctcttattt	0.000													4	4	---	---	---	---	
NALCN	259232	broad.mit.edu	37	13	102037593	102037595	+	Intron	DEL	CTC	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102037593_102037595delCTC	uc001vox.1	-						NALCN_uc001voy.2_Intron|NALCN_uc001voz.2_Intron|NALCN_uc001vpa.2_Intron	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ccttttCTTTCTCCGTGAGATCC	0.241													4	2	---	---	---	---	
IL25	64806	broad.mit.edu	37	14	23840743	23840743	+	5'Flank	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23840743delC	uc001wjr.2	+						IL25_uc001wjq.2_5'Flank	NM_022789	NP_073626	Q9H293	IL25_HUMAN	interleukin 25 isoform 1 precursor						inflammatory response	extracellular space|membrane	cytokine activity|interleukin-17E receptor binding			ovary(1)	1	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		GTTCCAGGTGCCCCAAGACTC	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	25708259	25708259	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25708259delA								STXBP6 (189088 upstream) : None (None downstream)																							GCATTTTTGGAAATGGAATTA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	49243873	49243873	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49243873delA								None (None upstream) : SDCCAG1 (789154 downstream)																							agtatctgttaaaaaaaaaag	0.000													4	2	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64625797	64625797	+	Intron	DEL	T	-	-	rs113291922		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64625797delT	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron|SYNE2_uc001xgp.2_Intron|SYNE2_uc010aqa.2_5'Flank	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTGAGTGGCCTTTTTTTTTTC	0.289													3	3	---	---	---	---	
SPTB	6710	broad.mit.edu	37	14	65300458	65300458	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65300458delC	uc001xhs.2	-						SPTB_uc001xhu.2_Intron	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		cagggaccatccatattcatt	0.035													4	2	---	---	---	---	
TTLL5	23093	broad.mit.edu	37	14	76188597	76188597	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76188597delT	uc001xrx.2	+						TTLL5_uc010ask.1_Intron|TTLL5_uc001xry.1_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		CATGCTGttcttttttttttg	0.224													4	2	---	---	---	---	
EML5	161436	broad.mit.edu	37	14	89182646	89182646	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89182646delT	uc001xxg.2	-						EML5_uc001xxh.1_5'Flank	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3						GCTTCTGTACTTTTTTTTAAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20452335	20452335	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20452335delA								None (None upstream) : GOLGA6L6 (284759 downstream)																							cgtggggtttaagtgagtaaa	0.000													2	4	---	---	---	---	
HERC2P2	400322	broad.mit.edu	37	15	23326128	23326128	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23326128delA	uc001yvr.2	-	13	1799	c.1599delT	c.(1597-1599)GTTfs	p.V533fs	HERC2P2_uc010ayf.1_Intron|HERC2P2_uc001yvp.3_RNA					RecName: Full=Putative HERC2-like protein 3;												0						GGATCAAATCAACATCCTTTA	0.413													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	30369053	30369053	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30369053delT								TJP1 (254347 upstream) : FAM7A3 (26882 downstream)																							ACTAGGATGATTTTTTTTTGT	0.234													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38668386	38668386	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38668386delA								SPRED1 (18937 upstream) : FAM98B (77942 downstream)																							aaccaaaaggaaaaaaaaaag	0.000													4	2	---	---	---	---	
SPG11	80208	broad.mit.edu	37	15	44889308	44889309	+	Intron	INS	-	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44889308_44889309insT	uc001ztx.2	-						SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zty.1_Intron	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AAAGTAGAttcttttttttttt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	58580636	58580636	+	IGR	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58580636delG								ALDH1A2 (9174 upstream) : LIPC (122139 downstream)																							GAACTTAGGTGGGAAAAAGAT	0.343													4	2	---	---	---	---	
DENND4A	10260	broad.mit.edu	37	15	66030849	66030849	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66030849delA	uc002aph.2	-						DENND4A_uc002api.2_Intron|DENND4A_uc002apj.3_Intron|DENND4A_uc010ujj.1_Intron	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						CCATAATCACAAAAAAGCATT	0.279													4	2	---	---	---	---	
ITGA11	22801	broad.mit.edu	37	15	68668566	68668567	+	Intron	INS	-	T	T	rs141266701	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68668566_68668567insT	uc002ari.2	-						ITGA11_uc010bib.2_Intron	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	GTTCTCCTCTCTTTTTTTTTTC	0.332													3	3	---	---	---	---	
PAQR5	54852	broad.mit.edu	37	15	69624565	69624566	+	Intron	DEL	GA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69624565_69624566delGA	uc002arz.2	+						PAQR5_uc002asa.2_Intron	NM_017705	NP_060175	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V						cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding			ovary(2)	2						ttctgtaatggagagaggggta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84059113	84059113	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84059113delA								BNC1 (105645 upstream) : SH3GL3 (56978 downstream)																							CTTCTTGAAGAAAAAAAAAAA	0.368													7	4	---	---	---	---	
C15orf51	196968	broad.mit.edu	37	15	100348753	100348753	+	5'Flank	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100348753delT	uc010urx.1	-						C15orf51_uc010ury.1_5'Flank|C15orf51_uc010urz.1_5'Flank|C15orf51_uc010bow.2_5'Flank|uc010box.2_Intron	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						GCCTTTTTAATTTTTTTTTTA	0.333													1	7	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6858391	6858391	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6858391delT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		AAAGTATTGCTTTCTTAAGTG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9532063	9532063	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9532063delT								C16orf72 (318518 upstream) : GRIN2A (315204 downstream)																							tagttctttgttgtgggaggc	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32817417	32817418	+	IGR	INS	-	TC	TC	rs138071874		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32817417_32817418insTC								TP53TG3B (128539 upstream) : SLC6A10P (71379 downstream)																							tcatcatttcatcatttcatct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33551696	33551696	+	IGR	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33551696delC								SLC6A10P (655233 upstream) : MIR1826 (413812 downstream)																							TACTTACTTTCTTCATTTTTA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51274412	51274413	+	IGR	DEL	CA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51274412_51274413delCA								SALL1 (89229 upstream) : None (None downstream)																							tttcctgcttcaaagttgagga	0.168													4	2	---	---	---	---	
CHD9	80205	broad.mit.edu	37	16	53267314	53267314	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53267314delT	uc002ehb.2	+						CHD9_uc002egy.2_Intron|CHD9_uc002eha.1_Intron|CHD9_uc002ehc.2_Intron|CHD9_uc002ehf.2_5'Flank|CHD9_uc002ehd.2_Intron|CHD9_uc002ehe.1_5'Flank	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				agagttggggtttgccattct	0.000													4	2	---	---	---	---	
TSNAXIP1	55815	broad.mit.edu	37	16	67854645	67854645	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67854645delA	uc002euj.2	+						TSNAXIP1_uc010cep.2_Intron|TSNAXIP1_uc010vjz.1_Intron|TSNAXIP1_uc002euf.3_Intron|TSNAXIP1_uc010vka.1_Intron|TSNAXIP1_uc010vkb.1_Intron|TSNAXIP1_uc002eug.3_Intron|TSNAXIP1_uc002euh.3_Intron|TSNAXIP1_uc002eui.3_Intron|TSNAXIP1_uc002euk.2_5'Flank	NM_018430	NP_060900	Q2TAA8	TXIP1_HUMAN	translin-associated factor X interacting protein						cell differentiation|multicellular organismal development|spermatogenesis	perinuclear region of cytoplasm					0		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)		agactgtctcaaaaaaaaaaa	0.254													4	3	---	---	---	---	
NFAT5	10725	broad.mit.edu	37	16	69602249	69602250	+	Intron	INS	-	TG	TG	rs9937747	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69602249_69602250insTG	uc002exm.1	+						NFAT5_uc002exh.1_Intron|NFAT5_uc002exi.2_Intron|NFAT5_uc002exj.1_Intron|NFAT5_uc002exk.1_Intron|NFAT5_uc002exl.1_Intron|NFAT5_uc002exn.1_Intron|MIR1538_hsa-mir-1538|MI0007259_5'Flank	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c						excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						atatatatatatgtgtgtgtgt	0.094													4	2	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78215106	78215107	+	Intron	DEL	GA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78215106_78215107delGA	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron|WWOX_uc002ffj.1_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		gagacagaaggagagagagaga	0.406													4	2	---	---	---	---	
SMYD4	114826	broad.mit.edu	37	17	1732277	1732278	+	Intron	DEL	CT	-	-	rs78702139		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1732277_1732278delCT	uc002ftm.3	-						RPA1_uc002fto.2_5'Flank	NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4								zinc ion binding			skin(3)|kidney(2)	5						AGGTATTTCCCTCTCTTACATA	0.406													1	6	---	---	---	---	
ZZEF1	23140	broad.mit.edu	37	17	3920345	3920346	+	Intron	DEL	GT	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3920345_3920346delGT	uc002fxe.2	-						ZZEF1_uc002fxg.1_5'UTR	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CATGGACTGCGTGTGTGTGTGT	0.530													4	2	---	---	---	---	
UBE2G1	7326	broad.mit.edu	37	17	4174330	4174330	+	3'UTR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4174330delA	uc002fxs.2	-	6						NM_003342	NP_003333	P62253	UB2G1_HUMAN	ubiquitin-conjugating enzyme E2G 1						protein K48-linked ubiquitination|protein K63-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						CTTATAAGCCAAAGACTACTT	0.438													4	2	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44198216	44198216	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44198216delA	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				ATGCAATACCAAAAAATACAG	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	55147354	55147354	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55147354delA								RNF126P1 (23199 upstream) : AKAP1 (15199 downstream)																							taatttaagcaaaaaaggagg	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	56120400	56120401	+	IGR	INS	-	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56120400_56120401insT								SFRS1 (35693 upstream) : DYNLL2 (40379 downstream)																							TTTGCGTCTTCACTTGCCTCTG	0.475													4	2	---	---	---	---	
SUPT4H1	6827	broad.mit.edu	37	17	56424310	56424310	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56424310delA	uc002iwe.1	-						uc010dct.1_Intron|uc010dcu.1_Intron|uc002ivz.2_Intron|uc010dcv.1_Intron|uc002iwa.2_Intron|uc002iwb.2_Intron|uc002iwc.2_Intron|SUPT4H1_uc002iwd.1_Intron	NM_003168	NP_003159	P63272	SPT4H_HUMAN	suppressor of Ty 4 homolog 1						chromatin remodeling|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ccttgtctctaaaaaaaataa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68135661	68135661	+	IGR	DEL	A	-	-	rs11308231		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68135661delA								KCNJ16 (3917 upstream) : KCNJ2 (29153 downstream)																							AAACAAAGGTAAAAAAAAAGA	0.214													4	2	---	---	---	---	
L3MBTL4	91133	broad.mit.edu	37	18	6199809	6199809	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6199809delA	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				ACAAAGAAGTAATGTTGTAGC	0.388													4	2	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	7026190	7026190	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7026190delA	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTCCAAGCGGAAAAAAAAAAG	0.388													4	2	---	---	---	---	
PPP4R1	9989	broad.mit.edu	37	18	9550604	9550605	+	Intron	INS	-	A	A			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9550604_9550605insA	uc002koe.1	-						PPP4R1_uc002kof.2_Intron|PPP4R1_uc010wzo.1_Intron|PPP4R1_uc002kod.1_Intron	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1						protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						TCAAGTTCCTTAGAGTGTAAGG	0.446													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9286400	9286400	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9286400delT								ZNF317 (12311 upstream) : OR7D2 (9870 downstream)																							ATTGTACACATTTTTTTTTTA	0.473													4	2	---	---	---	---	
PDE4A	5141	broad.mit.edu	37	19	10572804	10572804	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10572804delT	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron|PDE4A_uc002mom.2_Intron|PDE4A_uc002mon.2_Intron|PDE4A_uc002moo.2_Intron	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	TCCttctttctttttttttgt	0.274													4	3	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13318896	13318896	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13318896delA	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	AAAGGAAATCAAAAAAAAAGA	0.473													9	4	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14740629	14740629	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14740629delT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						AAAGGCATGATTTTTTTTTGA	0.174													4	2	---	---	---	---	
ZNF536	9745	broad.mit.edu	37	19	30935867	30935867	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935867delG	uc002nsu.1	+	2	1536	c.1398delG	c.(1396-1398)CTGfs	p.L466fs	ZNF536_uc010edd.1_Frame_Shift_Del_p.L466fs	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	466					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AGGAAGCGCTGGGGAAGCTGC	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	38225749	38225749	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38225749delT								ZNF607 (15058 upstream) : ZNF573 (3454 downstream)																							TTAGTACTAATTTTTGAGACT	0.224													4	2	---	---	---	---	
CSNK2A1	1457	broad.mit.edu	37	20	470679	470680	+	Intron	DEL	TT	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:470679_470680delTT	uc002wdw.1	-						CSNK2A1_uc002wdx.1_Intron|CSNK2A1_uc002wdy.1_Intron	NM_177559	NP_808227	P68400	CSK21_HUMAN	casein kinase II alpha 1 subunit isoform a						axon guidance|Wnt receptor signaling pathway	cytosol|NuRD complex|plasma membrane|Sin3 complex	ATP binding|protein N-terminus binding|protein serine/threonine kinase activity			ovary(1)	1		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			ttagtctttctttttttttttt	0.074													4	2	---	---	---	---	
KIF16B	55614	broad.mit.edu	37	20	16507705	16507705	+	Intron	DEL	C	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16507705delC	uc002wpg.1	-						KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Intron|KIF16B_uc010gcj.1_Intron	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						CGGTCTTTTACCAAAGCACTG	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32844818	32844818	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32844818delT								EIF2S2 (144733 upstream) : ASIP (3353 downstream)																							ACTTTCCTTGTTTTTTAAAGT	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10700886	10700886	+	IGR	DEL	T	-	-	rs112403107		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10700886delT								None (None upstream) : TPTE (205857 downstream)																							ggaaacactctttttgtagaa	0.000													5	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11059163	11059163	+	Intron	DEL	G	-	-	rs141258961		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11059163delG	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATCTCTCTGTGGGAAATGACT	0.368													11	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11071214	11071215	+	Intron	INS	-	C	C	rs140937252		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11071214_11071215insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gcagaccaattagggcttcagg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11149030	11149032	+	IGR	DEL	GAA	-	-	rs143833307		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11149030_11149032delGAA								BAGE (50093 upstream) : None (None downstream)																							catctaaagggaagaagacaaat	0.000													9	5	---	---	---	---	
USP16	10600	broad.mit.edu	37	21	30409426	30409426	+	Intron	DEL	T	-	-	rs71723731		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30409426delT	uc002ymy.2	+						USP16_uc002ymx.2_Intron|USP16_uc002ymw.2_Intron|USP16_uc011acm.1_Intron|USP16_uc011acn.1_Intron|USP16_uc011aco.1_5'Flank	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a						cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						GGGTTTTGTGTTTTTTTTCTG	0.333													4	2	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37649597	37649598	+	Intron	INS	-	TC	TC			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37649597_37649598insTC	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						CACttttttttttgagacagat	0.257													4	2	---	---	---	---	
HLCS	3141	broad.mit.edu	37	21	38253255	38253258	+	Intron	DEL	TTTG	-	-	rs72432542		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38253255_38253258delTTTG	uc010gnb.2	-						HLCS_uc002yvs.2_Intron	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase						cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	GCAGAGAGTTtttgtttgtttgtt	0.275													4	2	---	---	---	---	
PTTG1IP	754	broad.mit.edu	37	21	46273644	46273644	+	Intron	DEL	A	-	-	rs71326076		TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46273644delA	uc002zgb.1	-						PTTG1IP_uc011afj.1_Intron|PTTG1IP_uc011afk.1_Intron	NM_004339	NP_004330	P53801	PTTG_HUMAN	pituitary tumor-transforming gene 1						protein import into nucleus	cytoplasm|integral to membrane|nucleus				ovary(1)	1				Colorectal(79;0.0659)		ACCGGGAAACAACAGGCGACA	0.612													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17349817	17349818	+	IGR	INS	-	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17349817_17349818insT								HSFYL1 (39592 upstream) : GAB4 (93011 downstream)																							AAAAAGAAGTCTTTCTGGCATA	0.208													13	9	---	---	---	---	
KREMEN1	83999	broad.mit.edu	37	22	29521778	29521778	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29521778delT	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						CTTTTGACTGTTTTTTTTTTA	0.333													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	31386588	31386588	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31386588delA								TUG1 (11211 upstream) : SMTN (90717 downstream)																							CACCACATGGAAAAAAAGCAC	0.537													4	2	---	---	---	---	
ENTHD1	150350	broad.mit.edu	37	22	40146510	40146510	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40146510delA	uc003ayg.2	-							NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1											ovary(2)|skin(1)	3	Melanoma(58;0.0749)					AGCTGCAATTAAAAAAAAAAT	0.368													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	22344937	22344937	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22344937delA								ZNF645 (52363 upstream) : DDX53 (673150 downstream)																							GTTACACTTCAAGTCACAATT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	34695923	34695924	+	IGR	DEL	TT	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34695923_34695924delTT								TMEM47 (20518 upstream) : FAM47B (265007 downstream)																							agtggtgacatttaagaaaaag	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	45720962	45720962	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45720962delA								MIR222 (114432 upstream) : ZNF673 (585662 downstream)																							ATGACACTTTAAAAATATTCA	0.294													4	2	---	---	---	---	
ZC4H2	55906	broad.mit.edu	37	X	64231404	64231405	+	Intron	INS	-	T	T			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64231404_64231405insT	uc004dvv.2	-							NM_018684	NP_061154	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing								metal ion binding|protein binding			ovary(1)	1						AATTTACAGTCTTTTTTGACAA	0.406													4	2	---	---	---	---	
AR	367	broad.mit.edu	37	X	66943842	66943842	+	3'UTR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66943842delT	uc004dwu.1	+	8					AR_uc004dwv.1_3'UTR	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1						cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	TTTGCTGGGCTTTTTTTTTCT	0.438									Androgen_Insensitivity_Syndrome				6	3	---	---	---	---	
TAF1	6872	broad.mit.edu	37	X	70639873	70639873	+	Intron	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70639873delT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				tttttaattcttttttttttt	0.234													4	2	---	---	---	---	
CXorf26	51260	broad.mit.edu	37	X	75391695	75391695	+	5'Flank	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75391695delT	uc004ecl.1	+						CXorf26_uc004eck.1_5'Flank	NM_016500	NP_057584	Q9BVG4	CX026_HUMAN	hypothetical protein LOC51260												0						aatcgacaacttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	81905095	81905096	+	IGR	DEL	GG	-	-	rs12010276	by1000genomes	TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:81905095_81905096delGG								None (None upstream) : POU3F4 (858173 downstream)																							atttcttgtaggggtaagagta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	91001438	91001438	+	IGR	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91001438delA								PABPC5 (307856 upstream) : PCDH11X (32866 downstream)																							aaactgaggcaaaaaaaaatt	0.000													4	2	---	---	---	---	
DIAPH2	1730	broad.mit.edu	37	X	96180249	96180249	+	Intron	DEL	A	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96180249delA	uc004efu.3	+						DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efs.2_Intron	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						tcttccttttaaaaaaaatcc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	102990753	102990756	+	IGR	DEL	CCAA	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102990753_102990756delCCAA								GLRA4 (7201 upstream) : PLP1 (40683 downstream)																							GAAAATCAAGCCAACCAAAAAGAT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	110518199	110518199	+	IGR	DEL	T	-	-			TCGA-B0-4818-01A-01D-1501-10	TCGA-B0-4818-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110518199delT								CAPN6 (4448 upstream) : DCX (18809 downstream)																							CTAGCTGGCCTTTGTATTCCA	0.468													4	2	---	---	---	---	
