Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RSPO1	284654	broad.mit.edu	37	1	38079542	38079542	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38079542C>T	uc001cbl.1	-	7	1247	c.459G>A	c.(457-459)TGG>TGA	p.W153*	RSPO1_uc001cbm.1_Nonsense_Mutation_p.W153*|RSPO1_uc009vvf.1_Nonsense_Mutation_p.W126*|RSPO1_uc009vvg.1_Intron	NM_001038633	NP_001033722	Q2MKA7	RSPO1_HUMAN	R-spondin1 precursor	153	TSP type-1.				positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCCACGGAGACCACTCGCTCA	0.622													31	106	---	---	---	---	PASS
BMP8B	656	broad.mit.edu	37	1	40226077	40226077	+	3'UTR	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40226077C>T	uc001cdz.1	-	7					PPIE_uc001cdv.2_Intron|PPIE_uc001cdw.2_Intron	NM_001720	NP_001711	P34820	BMP8B_HUMAN	bone morphogenetic protein 8B preproprotein						cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity				0	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGCAGCTGGGCCGGGCGGGTG	0.632													8	15	---	---	---	---	PASS
TXNDC12	51060	broad.mit.edu	37	1	52492991	52492991	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52492991C>A	uc001cti.2	-	4	520	c.241G>T	c.(241-243)GAA>TAA	p.E81*		NM_015913	NP_056997	O95831	AIFM1_HUMAN	thioredoxin domain containing 12 precursor	329	FAD-dependent oxidoreductase (By similarity).				activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(1)	1						TCTGAAATTTCCGTAGATTCT	0.338													39	104	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118598450	118598450	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118598450T>A	uc001ehk.2	-	19	2696	c.2628A>T	c.(2626-2628)AAA>AAT	p.K876N		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	876						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TCCTGATGATTTTCTCATTCA	0.313													43	137	---	---	---	---	PASS
ECM1	1893	broad.mit.edu	37	1	150482475	150482475	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150482475G>A	uc001eus.2	+	4	500	c.301G>A	c.(301-303)GAA>AAA	p.E101K	ECM1_uc010pce.1_Missense_Mutation_p.E30K|ECM1_uc010pcf.1_Missense_Mutation_p.E23K|ECM1_uc001eut.2_Missense_Mutation_p.E101K|ECM1_uc001euu.2_Missense_Mutation_p.E130K|ECM1_uc001euv.2_Missense_Mutation_p.E128K|ECM1_uc009wlu.2_5'UTR	NM_004425	NP_004416	Q16610	ECM1_HUMAN	extracellular matrix protein 1 isoform 1	101					angiogenesis|biomineral tissue development|negative regulation of bone mineralization|negative regulation of peptidase activity|ossification|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade	proteinaceous extracellular matrix	laminin binding|protease binding|protein C-terminus binding|signal transducer activity			ovary(2)|central_nervous_system(1)	3	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TGCTGAAAAGGAAGGTGAGCG	0.587													33	96	---	---	---	---	PASS
FCRLA	84824	broad.mit.edu	37	1	161677075	161677075	+	Silent	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161677075C>A	uc001gbe.2	+	1	314	c.72C>A	c.(70-72)CTC>CTA	p.L24L	FCRLA_uc001gbd.2_Silent_p.L24L|FCRLA_uc001gbf.2_Silent_p.L24L|FCRLA_uc001gbg.2_Silent_p.L24L|FCRLA_uc009wuo.2_Silent_p.L24L|FCRLA_uc009wup.2_Silent_p.L24L|FCRLA_uc009wuq.2_Silent_p.L24L	NM_032738	NP_116127	Q7L513	FCRLA_HUMAN	Fc receptor-like and mucin-like 1	7					cell differentiation	cytoplasm|extracellular region					0	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			GCTGTGTCCTCATGGCCTGGG	0.478													29	68	---	---	---	---	PASS
NVL	4931	broad.mit.edu	37	1	224491542	224491542	+	Silent	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224491542G>A	uc001hok.2	-	9	886	c.843C>T	c.(841-843)CTC>CTT	p.L281L	NVL_uc001hol.2_Silent_p.L175L|NVL_uc010pvd.1_Silent_p.L190L|NVL_uc010pve.1_Silent_p.L65L|NVL_uc010pvf.1_RNA	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1	281						aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity			skin(2)	2				GBM - Glioblastoma multiforme(131;0.00501)		GCATGTGTATGAGCATCTTGC	0.468													16	37	---	---	---	---	PASS
CYP26B1	56603	broad.mit.edu	37	2	72359545	72359545	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72359545G>T	uc002sih.1	-	6	1350	c.1350C>A	c.(1348-1350)TTC>TTA	p.F450L	CYP26B1_uc010yra.1_Missense_Mutation_p.F433L|CYP26B1_uc010yrb.1_Missense_Mutation_p.F375L	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,	450					cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2						GCACCTTCAGGAACAGCTTGG	0.672													9	25	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109384143	109384143	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109384143A>G	uc002tem.3	+	20	7274	c.7148A>G	c.(7147-7149)AAT>AGT	p.N2383S		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2383	RanBD1 3.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						CTTTGTGCCAATCACAGAATA	0.353													227	474	---	---	---	---	PASS
CHCHD5	84269	broad.mit.edu	37	2	113342211	113342211	+	5'UTR	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113342211G>A	uc002thz.1	+	1					CHCHD5_uc002tia.2_5'UTR	NM_032309	NP_115685	Q9BSY4	CHCH5_HUMAN	coiled-coil-helix-coiled-coil-helix domain												0						CCCTACGCCGGCAAAGGTCTC	0.592													3	51	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152352797	152352797	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152352797A>G	uc010fnx.2	-	140	19102	c.18911T>C	c.(18910-18912)ATT>ACT	p.I6304T	NEB_uc002txr.2_Missense_Mutation_p.I2696T|RIF1_uc002txp.2_Intron|NEB_uc010zbz.1_Missense_Mutation_p.I104T|NEB_uc002txq.2_Missense_Mutation_p.I183T|NEB_uc010zca.1_Missense_Mutation_p.I135T|NEB_uc010zcb.1_Missense_Mutation_p.I104T	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	6304	Nebulin 173.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TACCGAGCTAATATTTTCTTG	0.338													9	18	---	---	---	---	PASS
CHL1	10752	broad.mit.edu	37	3	443351	443351	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:443351C>T	uc003bou.2	+	26	3651	c.3380C>T	c.(3379-3381)TCA>TTA	p.S1127L	CHL1_uc003bot.2_Missense_Mutation_p.S1143L|CHL1_uc011asi.1_Missense_Mutation_p.S1090L	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	1127	Cytoplasmic (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GAAATTCAGTCAGTAAAAGAT	0.274													26	50	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183794	10183794	+	Missense_Mutation	SNP	G	T	T	rs119103277		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183794G>T	uc003bvc.2	+	1	476	c.263G>T	c.(262-264)TGG>TTG	p.W88L	VHL_uc003bvd.2_Missense_Mutation_p.W88L	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	88			W -> R (in VHLD; type I).|W -> S (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.W88R(5)|p.W88*(4)|p.V87_W88del(2)|p.W88C(2)|p.W88fs*71(2)|p.W88S(2)|p.W88L(1)|p.V87_W88>G(1)|p.R60fs*35(1)|p.V84_E94>E(1)|p.W88fs*43(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CTGCCCGTATGGCTCAACTTC	0.726		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				8	9	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52442512	52442512	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52442512T>C	uc003ddx.2	-	4	348	c.233A>G	c.(232-234)AAT>AGT	p.N78S	PHF7_uc003ddy.2_5'Flank|PHF7_uc003ddz.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	78					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GAACATGTTATTCACAATATC	0.488			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								6	6	---	---	---	---	PASS
FAM86D	692099	broad.mit.edu	37	3	75475709	75475709	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75475709T>C	uc003dpp.3	-	7	888	c.529A>G	c.(529-531)ATC>GTC	p.I177V	FAM86D_uc003dpo.3_RNA|FAM86D_uc003dps.3_RNA|FAM86D_uc003dpq.3_Missense_Mutation_p.I85V|FAM86D_uc003dpr.3_RNA	NR_024241				RecName: Full=Protein FAM86B1;												0						CTCCGCAGGATCCCGACCAGC	0.562													3	13	---	---	---	---	PASS
FGFBP1	9982	broad.mit.edu	37	4	15938034	15938034	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15938034C>A	uc003gom.2	-	2	340	c.222G>T	c.(220-222)GAG>GAT	p.E74D		NM_005130	NP_005121	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	74					cell-cell signaling|negative regulation of cell proliferation|signal transduction	extracellular space|plasma membrane	heparin binding				0						CCTCCTCCTGCTCAGTAGCAG	0.507													80	164	---	---	---	---	PASS
JMY	133746	broad.mit.edu	37	5	78608277	78608277	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78608277C>A	uc003kfx.3	+	8	2540	c.2020C>A	c.(2020-2022)CAA>AAA	p.Q674K	JMY_uc003kfw.1_Missense_Mutation_p.Q320K	NM_152405	NP_689618	Q8N9B5	JMY_HUMAN	junction-mediating and regulatory protein	674					'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity				0		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		CTGGGTTAGCCAAGAGAGACA	0.294													24	54	---	---	---	---	PASS
BAT2	7916	broad.mit.edu	37	6	31599655	31599655	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31599655G>A	uc003nvb.3	+	16	3454	c.3205G>A	c.(3205-3207)GGG>AGG	p.G1069R	BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Missense_Mutation_p.G1069R	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	1069	4 X 57 AA type A repeats.					cytoplasm|nucleus	protein binding				0						GCGTGGAGGTGGGACAGGGGG	0.657													10	20	---	---	---	---	PASS
HLA-DPA1	3113	broad.mit.edu	37	6	33036318	33036318	+	Intron	SNP	T	C	C	rs79015944		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33036318T>C	uc003ocs.1	-						HLA-DPA1_uc010juk.2_3'UTR	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1						CTGAATGCTTTTAACCCATTA	0.259													4	20	---	---	---	---	PASS
C6orf35	729515	broad.mit.edu	37	6	157744466	157744466	+	Silent	SNP	A	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157744466A>G	uc003sih.3	-	1	329	c.66T>C	c.(64-66)AAT>AAC	p.N22N		NM_018452	NP_060922	Q9NWH2	CF035_HUMAN	hypothetical protein LOC729515	22						integral to membrane					0						AAAGCCGGTCATTCGTGGACC	0.637													98	274	---	---	---	---	PASS
SUN1	23353	broad.mit.edu	37	7	912892	912892	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:912892G>A	uc011jvp.1	+	20	2361	c.2282G>A	c.(2281-2283)CGG>CAG	p.R761Q	GET4_uc003sjj.1_Intron|SUN1_uc003sjf.2_Missense_Mutation_p.R678Q|SUN1_uc011jvq.1_Missense_Mutation_p.R658Q|SUN1_uc003sjg.2_Missense_Mutation_p.R666Q|SUN1_uc011jvr.1_Missense_Mutation_p.R559Q|SUN1_uc003sji.2_Missense_Mutation_p.R599Q|SUN1_uc003sjk.2_Missense_Mutation_p.R400Q	NM_001130965	NP_001124437	O94901	SUN1_HUMAN	unc-84 homolog A isoform a	788	Perinuclear space.|SUN.				cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0						GTGGAACTTCGGATTTTTTCT	0.408											OREG0017816	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	83	222	---	---	---	---	PASS
ADAP1	11033	broad.mit.edu	37	7	939073	939073	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:939073A>C	uc003sjo.3	-	9	1026	c.850T>G	c.(850-852)TAC>GAC	p.Y284D	ADAP1_uc003sjm.3_Missense_Mutation_p.Y110D|ADAP1_uc011jvs.1_Missense_Mutation_p.Y189D|ADAP1_uc003sjn.3_Missense_Mutation_p.Y212D|ADAP1_uc010ksc.2_Missense_Mutation_p.Y212D	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1	284	PH 2.				cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						TCTTTGAAGTACATGAGCCTG	0.662													19	29	---	---	---	---	PASS
ANLN	54443	broad.mit.edu	37	7	36478858	36478858	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36478858A>C	uc003tff.2	+	21	3133	c.2929A>C	c.(2929-2931)AAA>CAA	p.K977Q	ANLN_uc011kaz.1_Missense_Mutation_p.K889Q|ANLN_uc003tfg.2_Missense_Mutation_p.K940Q|ANLN_uc010kxe.2_Missense_Mutation_p.K939Q	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	977	Localization to the cleavage furrow.				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						tttaaaaataaaatGTCAAGT	0.303													37	60	---	---	---	---	PASS
NRF1	4899	broad.mit.edu	37	7	129297261	129297261	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129297261G>A	uc003voz.2	+	2	187	c.70G>A	c.(70-72)GTG>ATG	p.V24M	NRF1_uc003vpa.2_Missense_Mutation_p.V24M|NRF1_uc011kpa.1_Translation_Start_Site|NRF1_uc003vpb.2_Missense_Mutation_p.V24M	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	24	Dimerization.				generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						GGCCCAGCAAGTGCAGCAGGT	0.493													20	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142247177	142247177	+	Intron	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142247177G>A	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011kse.1_Intron|uc003vye.2_Intron|uc003vyd.3_Silent_p.V93V					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		TCAGAGTAGAGACGGATCCCT	0.567													15	81	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154379787	154379787	+	Intron	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154379787C>A	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Missense_Mutation_p.T352N|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CAGAGAGCAACCGAGTGAGCC	0.567													18	42	---	---	---	---	PASS
VIPR2	7434	broad.mit.edu	37	7	158829472	158829472	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158829472C>A	uc003woh.2	-	7	905	c.719G>T	c.(718-720)TGC>TTC	p.C240F	VIPR2_uc010lqx.2_RNA|VIPR2_uc010lqy.2_RNA	NM_003382	NP_003373	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	240	Cytoplasmic (Potential).				cell-cell signaling	integral to plasma membrane				lung(1)|central_nervous_system(1)	2	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		GGCCAGGAAGCACCTTCTAGG	0.577													3	39	---	---	---	---	PASS
ADAM7	8756	broad.mit.edu	37	8	24366159	24366159	+	3'UTR	SNP	T	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24366159T>C	uc003xeb.2	+	22					ADAM7_uc003xec.2_Intron	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		ACTCACATTTTTGGTAGTGTT	0.383													12	33	---	---	---	---	PASS
CHRNA6	8973	broad.mit.edu	37	8	42608259	42608259	+	3'UTR	SNP	G	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42608259G>T	uc003xpj.2	-	6					CHRNA6_uc011lcw.1_3'UTR	NM_004198	NP_004189	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6							cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TCCTTTCCTTGTGGCAGGGAA	0.403													3	30	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48694798	48694798	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48694798C>T	uc003xqi.2	-	81	11471	c.11414G>A	c.(11413-11415)TGG>TAG	p.W3805*	PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	3805	PI3K/PI4K.				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				ATTTTCAAGCCACTCAATTAA	0.473								NHEJ					14	60	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106813890	106813890	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106813890G>A	uc003ymd.2	+	8	1603	c.1580G>A	c.(1579-1581)CGA>CAA	p.R527Q	ZFPM2_uc011lhs.1_Missense_Mutation_p.R258Q	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	527					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GTGCATCGGCGACTGAGGCAT	0.473													52	128	---	---	---	---	PASS
NDRG1	10397	broad.mit.edu	37	8	134256644	134256644	+	Intron	SNP	G	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134256644G>T	uc003yuh.2	-						NDRG1_uc003yue.1_5'UTR|NDRG1_uc003yuf.1_Intron|NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron|NDRG1_uc003yui.1_5'Flank	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CTAGGAGAGAGGGAAGCTCGT	0.522													13	38	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2116050	2116050	+	Splice_Site	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2116050G>A	uc003zhc.2	+	25	3783	c.3684_splice	c.e25+1	p.E1228_splice	SMARCA2_uc003zhd.2_Splice_Site_p.E1228_splice|SMARCA2_uc010mha.2_Splice_Site_p.E1161_splice	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GGAAAATGAGGTATTAGAGAA	0.463											OREG0019074	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	13	---	---	---	---	PASS
NR4A3	8013	broad.mit.edu	37	9	102626233	102626233	+	3'UTR	SNP	T	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102626233T>G	uc004baf.1	+	8					NR4A3_uc004bag.1_3'UTR|NR4A3_uc004bai.2_3'UTR	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				AAACCTATCATTTCCTGTCCT	0.458			T	EWSR1	extraskeletal myxoid chondrosarcoma								23	32	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120475390	120475390	+	Silent	SNP	T	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475390T>C	uc004bjz.2	+	3	1275	c.984T>C	c.(982-984)TAT>TAC	p.Y328Y	TLR4_uc004bka.2_Silent_p.Y288Y|TLR4_uc004bkb.2_Silent_p.Y128Y	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	328	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						ACTTTTCTTATAATTTCGGAT	0.323													68	81	---	---	---	---	PASS
RABGAP1	23637	broad.mit.edu	37	9	125865394	125865394	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125865394G>A	uc011lzh.1	+	26	3246	c.3112G>A	c.(3112-3114)GCC>ACC	p.A1038T	RABGAP1_uc004bnl.3_RNA|RABGAP1_uc011lzj.1_Missense_Mutation_p.A377T	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	1038	Potential.				cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						TTTAGGGCTTGCCCTCAATGA	0.527											OREG0019466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	33	---	---	---	---	PASS
WDR37	22884	broad.mit.edu	37	10	1149775	1149775	+	Silent	SNP	A	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1149775A>C	uc001igf.1	+	10	1133	c.960A>C	c.(958-960)ACA>ACC	p.T320T	WDR37_uc009xhm.1_Silent_p.T321T|WDR37_uc009xhn.1_RNA|WDR37_uc001igg.1_RNA	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	320											0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ACTCTCTGACAGGTGCCTGGG	0.577													17	31	---	---	---	---	PASS
CUZD1	50624	broad.mit.edu	37	10	124593448	124593448	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124593448C>T	uc001lgq.2	-	8	1723	c.1391G>A	c.(1390-1392)CGA>CAA	p.R464Q	CUZD1_uc001lgp.2_Missense_Mutation_p.R183Q|CUZD1_uc009yad.2_Missense_Mutation_p.R183Q|CUZD1_uc009yaf.2_Missense_Mutation_p.R98Q|CUZD1_uc001lgr.2_Missense_Mutation_p.R183Q|CUZD1_uc010qty.1_Missense_Mutation_p.R183Q|CUZD1_uc009yae.2_Missense_Mutation_p.R183Q|CUZD1_uc001lgs.2_Missense_Mutation_p.R464Q|CUZD1_uc010qtz.1_Missense_Mutation_p.R464Q	NM_022034	NP_071317	Q86UP6	CUZD1_HUMAN	CUB and zona pellucida-like domains 1 precursor	464	Extracellular (Potential).|ZP.				cell cycle|cell division|cell proliferation|substrate-dependent cell migration, cell attachment to substrate|trypsinogen activation	integral to membrane|transport vesicle membrane|zymogen granule membrane				ovary(1)|skin(1)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		AGTTTCATCTCGACTACATCT	0.353													42	97	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1268529	1268529	+	Silent	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1268529G>A	uc009ycr.1	+	50	12129	c.12003G>A	c.(12001-12003)TCG>TCA	p.S4001S	MUC5B_uc001ltb.2_Silent_p.S3476S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3473	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTGGACTTCGGCCACCTCGG	0.672													4	26	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14793670	14793670	+	Intron	SNP	A	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14793670A>T	uc001mln.2	+						PDE3B_uc001mlm.2_3'UTR|PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						AACTAAACTAATAAGTTAACT	0.224													7	7	---	---	---	---	PASS
RBM14	10432	broad.mit.edu	37	11	66391778	66391778	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66391778T>G	uc001oit.2	+	2	570	c.431T>G	c.(430-432)GTG>GGG	p.V144G	RBM14_uc009yrh.2_Intron|RBM14_uc009yri.2_Missense_Mutation_p.V144G|RBM4_uc009yrj.2_Intron|RBM4_uc009yrk.2_Intron	NM_006328	NP_006319	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	144	RRM 2.				DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|histone deacetylation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus	mediator complex|ribonucleoprotein complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|protein binding, bridging|RNA binding|RNA polymerase II transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CGCATCAACGTGGAACTCTCC	0.567													30	70	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70332433	70332433	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70332433G>C	uc001oqc.2	-	21	4043	c.3965C>G	c.(3964-3966)ACT>AGT	p.T1322S	SHANK2_uc010rqn.1_Missense_Mutation_p.T734S|SHANK2_uc001opz.2_Missense_Mutation_p.T727S|uc009ysn.1_Intron|SHANK2_uc001opy.2_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	943					intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GTCCAGCTTAGTGGCGTCCAC	0.587													38	105	---	---	---	---	PASS
NLRX1	79671	broad.mit.edu	37	11	119050726	119050726	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119050726G>A	uc001pvu.2	+	7	2211	c.1996G>A	c.(1996-1998)GGC>AGC	p.G666S	NLRX1_uc010rzc.1_Missense_Mutation_p.G488S|NLRX1_uc001pvv.2_Missense_Mutation_p.G666S|NLRX1_uc001pvw.2_Missense_Mutation_p.G666S|NLRX1_uc001pvx.2_Missense_Mutation_p.G666S	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	666	Required for the repression of MAVS- induced interferon signaling.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGGCAAGCTGGGCCGGCAGGT	0.607													7	43	---	---	---	---	PASS
ST14	6768	broad.mit.edu	37	11	130079781	130079781	+	3'UTR	SNP	G	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130079781G>T	uc001qfw.2	+	19						NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CAGTGTGCACGCCTGCAGGCT	0.592													3	22	---	---	---	---	PASS
CCNT1	904	broad.mit.edu	37	12	49110458	49110458	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49110458T>G	uc001rse.1	-	1	324	c.1A>C	c.(1-3)ATG>CTG	p.M1L	CCNT1_uc009zkz.1_5'UTR	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	1					cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6						TCTCCCTCCATAGTGCTTCAA	0.557											OREG0021767	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	190	187	---	---	---	---	PASS
PRKAG1	5571	broad.mit.edu	37	12	49398646	49398646	+	Intron	SNP	C	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49398646C>G	uc001rsy.2	-						uc001rsw.2_Intron|PRKAG1_uc010smd.1_Intron|PRKAG1_uc001rsx.2_Intron|PRKAG1_uc001rsz.2_Intron|PRKAG1_uc009zlb.2_Intron|PRKAG1_uc010sme.1_3'UTR	NM_002733	NP_002724	P54619	AAKG1_HUMAN	AMP-activated protein kinase, noncatalytic						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|positive regulation of protein kinase activity|regulation of fatty acid oxidation|regulation of glycolysis|spermatogenesis	cytosol	cAMP-dependent protein kinase activity|cAMP-dependent protein kinase regulator activity|protein kinase binding			kidney(1)	1						gtgtgtgtgtCTTTTCTCTCT	0.244													6	73	---	---	---	---	PASS
MAB21L1	4081	broad.mit.edu	37	13	36049373	36049373	+	Silent	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36049373G>A	uc001uvc.2	-	1	1460	c.903C>T	c.(901-903)AAC>AAT	p.N301N	NBEA_uc001uvb.2_Intron|NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_5'Flank|NBEA_uc010teg.1_5'Flank	NM_005584	NP_005575	Q13394	MB211_HUMAN	mab-21-like protein 1	301					anatomical structure morphogenesis	nucleus				ovary(2)	2		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GCAAAATCCCGTTCAGCCGAT	0.517													46	96	---	---	---	---	PASS
CIDEB	27141	broad.mit.edu	37	14	24774973	24774973	+	Intron	SNP	T	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24774973T>C	uc001won.2	-						CIDEB_uc001woo.2_Intron|CIDEB_uc001wop.2_Intron	NM_014430	NP_055245	Q9UHD4	CIDEB_HUMAN	cell death-inducing DFFA-like effector b						apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis	cytosol					0				GBM - Glioblastoma multiforme(265;0.0181)		AGGAGCTCCCTGAATGGCAGA	0.532													20	25	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64491137	64491137	+	Silent	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64491137C>A	uc001xgm.2	+	39	6030	c.5800C>A	c.(5800-5802)CGA>AGA	p.R1934R	SYNE2_uc001xgl.2_Silent_p.R1934R	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1934	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATGCCAGGCTCGAGCAAAGGA	0.413													3	87	---	---	---	---	PASS
FLVCR2	55640	broad.mit.edu	37	14	76088434	76088434	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76088434A>G	uc001xrs.2	+	2	1058	c.682A>G	c.(682-684)ATT>GTT	p.I228V	FLVCR2_uc010tvd.1_Missense_Mutation_p.I23V	NM_017791	NP_060261	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular	228	Helical; (Potential).				transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)		TGGAATTGCGATTGGGTTCTT	0.438													113	131	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29346498	29346498	+	Silent	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346498G>A	uc001zck.2	+	3	618	c.411G>A	c.(409-411)GCG>GCA	p.A137A	APBA2_uc010azj.2_Silent_p.A137A|APBA2_uc010uat.1_Silent_p.A137A|APBA2_uc001zcl.2_Silent_p.A137A|APBA2_uc010uas.1_Silent_p.A137A	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	137					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GCCAGGAGGCGGTGGAGGAGT	0.667													3	72	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42702005	42702005	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42702005T>G	uc001zpn.1	+	18	2319	c.2013T>G	c.(2011-2013)GAT>GAG	p.D671E	CAPN3_uc001zpk.1_Missense_Mutation_p.D438E|CAPN3_uc001zpl.1_Missense_Mutation_p.D578E|CAPN3_uc010udf.1_Missense_Mutation_p.D584E|CAPN3_uc010udg.1_Missense_Mutation_p.D536E|CAPN3_uc001zpo.1_Missense_Mutation_p.D665E|CAPN3_uc001zpp.1_Missense_Mutation_p.D579E|CAPN3_uc001zpq.1_Missense_Mutation_p.D159E|CAPN3_uc010bcv.1_Missense_Mutation_p.D6E|CAPN3_uc001zpr.1_Missense_Mutation_p.D6E|CAPN3_uc001zps.1_Missense_Mutation_p.D6E|CAPN3_uc001zpt.1_Missense_Mutation_p.D6E	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	671	EF-hand 1.|Domain IV.				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		TCTGTGCAGATGAGCTCAAGA	0.537													73	199	---	---	---	---	PASS
CPEB1	64506	broad.mit.edu	37	15	83226709	83226709	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83226709C>A	uc002bit.2	-	4	724	c.587G>T	c.(586-588)GGA>GTA	p.G196V	CPEB1_uc002biq.2_Missense_Mutation_p.G61V|CPEB1_uc002bir.2_Missense_Mutation_p.G61V|CPEB1_uc002bis.2_Missense_Mutation_p.G61V|CPEB1_uc010uod.1_Intron|CPEB1_uc010uoe.1_Missense_Mutation_p.G139V|CPEB1_uc002biu.2_Missense_Mutation_p.G163V|CPEB1_uc010uof.1_Missense_Mutation_p.G61V|CPEB1_uc002biv.2_Missense_Mutation_p.G136V|CPEB1_uc002bip.2_5'Flank	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding	136					mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			TAGGACATTTCCCAGTGGGTT	0.502													26	64	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85406027	85406027	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85406027G>A	uc002ble.2	+	10	5064	c.4897G>A	c.(4897-4899)GGG>AGG	p.G1633R	ALPK3_uc010upc.1_5'Flank	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1633	Alpha-type protein kinase.				heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GGTCATCTACGGGCTGGAACC	0.607													20	40	---	---	---	---	PASS
CRK	1398	broad.mit.edu	37	17	1326915	1326915	+	Silent	SNP	A	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1326915A>G	uc002fsl.2	-	3	940	c.807T>C	c.(805-807)ATT>ATC	p.I269I	CRK_uc002fsm.2_3'UTR	NM_016823	NP_058431	P46108	CRK_HUMAN	v-crk sarcoma virus CT10 oncogene homolog	269	SH3 2.				actin cytoskeleton organization|activation of MAPKK activity|blood coagulation|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of transcription from RNA polymerase II promoter	cytosol|endosome|nucleus|plasma membrane	protein binding|SH2 domain binding			lung(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.083)		CACTCACATTAATCTTCGTAA	0.488													45	120	---	---	---	---	PASS
OR1A1	8383	broad.mit.edu	37	17	3119395	3119395	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3119395C>A	uc010vrc.1	+	1	481	c.481C>A	c.(481-483)CTG>ATG	p.L161M		NM_014565	NP_055380	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A,	161	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CCCCCACACTCTGCTCACAGC	0.502													50	122	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	14673519	14673519	+	IGR	SNP	C	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14673519C>G								HS3ST3B1 (424027 upstream) : PMP22 (459578 downstream)																							TGCCACTGTTCCCCAGGGCAG	0.468													17	56	---	---	---	---	PASS
C17orf103	256302	broad.mit.edu	37	17	21147503	21147503	+	Silent	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21147503G>A	uc010vzx.1	-	3	143	c.141C>T	c.(139-141)TAC>TAT	p.Y47Y		NM_152914	NP_690878	Q8N6N6	GTL3B_HUMAN	transcript expressed during hematopoiesis 2	47											0						GCTTGCCCACGTACTCATAGA	0.627													13	31	---	---	---	---	PASS
EVPL	2125	broad.mit.edu	37	17	74011147	74011147	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74011147C>T	uc002jqi.2	-	17	2300	c.2072G>A	c.(2071-2073)CGG>CAG	p.R691Q	EVPL_uc010wss.1_Missense_Mutation_p.R713Q|EVPL_uc010wst.1_Missense_Mutation_p.R161Q	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	691	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						GCGGTGTAGCCGCAGCACGCA	0.687													4	31	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7026067	7026067	+	Silent	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7026067C>T	uc002knm.2	-	17	2407	c.2313G>A	c.(2311-2313)CAG>CAA	p.Q771Q	LAMA1_uc010wzj.1_Silent_p.Q247Q	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	771	Laminin EGF-like 6.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CGGGCAAGCACTGCTCACAGT	0.572													8	23	---	---	---	---	PASS
C3	718	broad.mit.edu	37	19	6686809	6686809	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6686809C>G	uc002mfm.2	-	28	3656	c.3594G>C	c.(3592-3594)CAG>CAC	p.Q1198H	C3_uc002mfl.2_5'UTR	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1198					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		GCCTGCCCATCTGGGCCAGAG	0.532													81	204	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8165827	8165827	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8165827C>T	uc002mjf.2	-	40	5140	c.5119G>A	c.(5119-5121)GCC>ACC	p.A1707T		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1707						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						AATCCCGGGGCCTGATTTCCA	0.617													36	112	---	---	---	---	PASS
RHPN2	85415	broad.mit.edu	37	19	33493761	33493761	+	Silent	SNP	A	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33493761A>G	uc002nuf.2	-	8	972	c.906T>C	c.(904-906)AAT>AAC	p.N302N	RHPN2_uc010xro.1_Silent_p.N151N|RHPN2_uc002nue.2_Silent_p.N32N	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	302	BRO1.				signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					TGAAGAATTCATTCCGGATCC	0.542													16	56	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640818	57640818	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640818G>T	uc002qny.2	+	4	1131	c.775G>T	c.(775-777)GAA>TAA	p.E259*		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	259					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATCTCCATTGGAACCAGAGCA	0.478													31	84	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40944427	40944427	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40944427T>C	uc002xkg.2	-	12	2259	c.2075A>G	c.(2074-2076)AAC>AGC	p.N692S	PTPRT_uc010ggj.2_Missense_Mutation_p.N692S	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	692	Extracellular (Potential).|Fibronectin type-III 4.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GAGAGGAGGGTTCCAGTAGCC	0.502													40	72	---	---	---	---	PASS
NPBWR2	2832	broad.mit.edu	37	20	62737383	62737383	+	Missense_Mutation	SNP	C	T	T	rs140478149		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62737383C>T	uc011abt.1	-	1	802	c.802G>A	c.(802-804)GTG>ATG	p.V268M		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	268	Helical; Name=6; (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					AGGAGGCACACGGCCAGCACG	0.677													16	26	---	---	---	---	PASS
TLR8	51311	broad.mit.edu	37	X	12939545	12939545	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12939545C>A	uc004cve.2	+	2	2454	c.2386C>A	c.(2386-2388)CCC>ACC	p.P796T	TLR8_uc004cvd.2_Missense_Mutation_p.P814T	NM_138636	NP_619542	Q9NR97	TLR8_HUMAN	toll-like receptor 8 precursor	796	Extracellular (Potential).|LRRCT.				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity			ovary(4)|lung(2)|large_intestine(1)	7						TGTCAAAATTCCCAGACTGGT	0.433													73	152	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17745608	17745608	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17745608C>G	uc004cxx.2	+	6	3657	c.3319C>G	c.(3319-3321)CCA>GCA	p.P1107A	NHS_uc011mix.1_Missense_Mutation_p.P1128A|NHS_uc004cxy.2_Missense_Mutation_p.P951A|NHS_uc004cxz.2_Missense_Mutation_p.P930A|NHS_uc004cya.2_Missense_Mutation_p.P830A	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1107						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					GTCGAATCCTCCACCGTCCCT	0.403													79	200	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18836212	18836212	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18836212C>T	uc004cyq.2	+	16	1931	c.1450C>T	c.(1450-1452)CGA>TGA	p.R484*	PPEF1_uc004cyp.2_Nonsense_Mutation_p.R456*|PPEF1_uc004cyr.2_Nonsense_Mutation_p.R422*|PPEF1_uc004cys.2_Nonsense_Mutation_p.R484*|PPEF1_uc011mja.1_Nonsense_Mutation_p.R419*|PPEF1_uc011mjb.1_Nonsense_Mutation_p.R428*	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	484	EF-hand 1.				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					AGTGATTTCACGAAAAAGTGA	0.343													48	105	---	---	---	---	PASS
PHKA2	5256	broad.mit.edu	37	X	18970644	18970644	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18970644T>A	uc004cyv.3	-	3	683	c.253A>T	c.(253-255)ATG>TTG	p.M85L	PHKA2_uc010nfh.1_RNA|PHKA2_uc010nfi.1_Missense_Mutation_p.M27L	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	85					glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					AGACCTCGCATCAGCTTCACC	0.512													33	65	---	---	---	---	PASS
CPXCR1	53336	broad.mit.edu	37	X	88009260	88009260	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88009260G>A	uc004efd.3	+	3	1104	c.845G>A	c.(844-846)GGA>GAA	p.G282E	CPXCR1_uc004efc.3_Missense_Mutation_p.G282E	NM_033048	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	282						intracellular	zinc ion binding			ovary(3)	3						CCCATCTGTGGAAGGCTTTTT	0.299													35	76	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2609	2609	+	5'Flank	SNP	T	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2609T>C	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		cataatcacttgttccttaaa	0.229													4	0	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14353	14353	+	RNA	SNP	T	C	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14353T>C	uc004cox.3	+	1		c.2017T>C			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CCATCATACTCTTTCACCCAC	0.483													5	3	---	---	---	---	PASS
ST3GAL3	6487	broad.mit.edu	37	1	44323172	44323174	+	Intron	DEL	CCT	-	-	rs3082975		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44323172_44323174delCCT	uc001ckc.2	+						ST3GAL3_uc009vwu.1_Intron|ST3GAL3_uc010okj.1_Intron|ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270	Q11203	SIAT6_HUMAN	sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				tccttccttccctcttccttcct	0.039													4	2	---	---	---	---	
CEPT1	10390	broad.mit.edu	37	1	111703576	111703576	+	Intron	DEL	A	-	-	rs143334479		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111703576delA	uc001eah.1	+						CEPT1_uc001eai.1_Intron|CEPT1_uc001eaj.1_Intron	NM_001007794	NP_001007795	Q9Y6K0	CEPT1_HUMAN	choline/ethanolaminephosphotransferase							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	diacylglycerol cholinephosphotransferase activity|ethanolaminephosphotransferase activity|metal ion binding				0		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	GTGATTTGGTAAAAAAAAAAA	0.299													9	4	---	---	---	---	
TTF2	8458	broad.mit.edu	37	1	117628870	117628871	+	Intron	DEL	TG	-	-	rs3831091		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117628870_117628871delTG	uc001egy.2	+							NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		ACCTCCAAAAtgtgtgtgtgtg	0.337													5	3	---	---	---	---	
POU2F1	5451	broad.mit.edu	37	1	167385178	167385179	+	3'UTR	INS	-	A	A	rs71850487		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167385178_167385179insA	uc001gec.2	+	17					POU2F1_uc001ged.2_3'UTR|POU2F1_uc001gee.2_3'UTR|POU2F1_uc010plh.1_3'UTR|POU2F1_uc001gef.2_3'UTR|POU2F1_uc001geg.2_Intron	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						AGAGAAGGGAGAAAAAAAAAAA	0.406													7	5	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247076400	247076400	+	Intron	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247076400delT	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTAAAATACCTTTTTTTTTTT	0.299													5	3	---	---	---	---	
COBLL1	22837	broad.mit.edu	37	2	165561792	165561792	+	Intron	DEL	G	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165561792delG	uc010zcw.1	-						COBLL1_uc002ucp.2_Intron|COBLL1_uc002ucq.2_Intron|COBLL1_uc010zcx.1_Intron|COBLL1_uc002ucs.1_Intron|COBLL1_uc002uco.2_Intron	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1											ovary(2)|pancreas(1)	3						ggatagatatgtaaagaaaaa	0.075													6	3	---	---	---	---	
OBFC2A	64859	broad.mit.edu	37	2	192548842	192548842	+	Intron	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192548842delA	uc002usx.2	+						OBFC2A_uc002usw.2_Intron|OBFC2A_uc002usy.2_Intron|OBFC2A_uc002usz.2_Intron|OBFC2A_uc002uta.2_Intron	NM_001031716	NP_001026886	Q96AH0	SOSB2_HUMAN	oligonucleotide/oligosaccharide-binding fold						double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	single-stranded DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.061)|Epithelial(96;0.244)			tttgttaattaaaaaaaaaaa	0.234													3	3	---	---	---	---	
MARS2	92935	broad.mit.edu	37	2	198572076	198572077	+	3'UTR	INS	-	TTC	TTC	rs150680100	by1000genomes	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198572076_198572077insTTC	uc002uuq.2	+	1					uc002uup.2_Intron	NM_138395	NP_612404	Q96GW9	SYMM_HUMAN	methionine-tRNA synthetase 2 precursor						methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					L-Methionine(DB00134)	GCCTGCTCCTATTCATTTCTCT	0.416													4	2	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218322136	218322137	+	Intron	DEL	TG	-	-	rs2373062	by1000genomes	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218322136_218322137delTG	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						TTCATTTCTCtgtgtgtgtgtg	0.223													4	2	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071889	220071889	+	Intron	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071889delT	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGGGGGGTGGTCAGCGGC	0.627													5	3	---	---	---	---	
ITGA9	3680	broad.mit.edu	37	3	37790239	37790241	+	Intron	DEL	AAA	-	-	rs34841037		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37790239_37790241delAAA	uc003chd.2	+							NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		actctgtcttaaaaaaaaaaaaa	0.207													3	3	---	---	---	---	
SR140	23350	broad.mit.edu	37	3	142774049	142774049	+	Intron	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142774049delT	uc003evh.1	+						SR140_uc003evi.1_Intron|SR140_uc003evj.1_Intron|SR140_uc003evk.1_Intron	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein						RNA processing	nucleus	nucleotide binding|RNA binding				0						TTGGCATACATTTTTTTTTTT	0.318													4	2	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	191888074	191888074	+	Intron	DEL	A	-	-	rs11293703		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191888074delA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		gcctcaaaagaaaaaaaaaaa	0.159													4	4	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195711343	195711344	+	Intron	INS	-	T	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195711343_195711344insT	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AAAGACTTCTCTGTGAGCTTTG	0.381													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49558138	49558138	+	IGR	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49558138delT								CWH43 (494045 upstream) : None (None downstream)																							ttaaacattattttttttttt	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	79569417	79569424	+	Intron	DEL	CCTTCCTT	-	-	rs72257120		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79569417_79569424delCCTTCCTT	uc003hlf.2	+						uc003hlg.2_Intron|uc003hlh.2_Intron|uc003hli.2_Intron					Homo sapiens cDNA FLJ32651 fis, clone SYNOV2001581.																		tttctttctcccttccttccttccttcc	0.038													4	2	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	99995851	99995852	+	Intron	INS	-	AGG	AGG	rs148777339	by1000genomes	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99995851_99995852insAGG	uc003hui.2	-						ADH5_uc003huj.2_Intron	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	TCCTATGTTTCAGGTGAGCACC	0.411													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111260224	111260225	+	IGR	INS	-	TT	TT	rs77074291		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111260224_111260225insTT								ELOVL6 (140404 upstream) : ENPEP (137004 downstream)																							tccttccttccccttccttcct	0.000													4	2	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173408430	173408431	+	Intron	INS	-	TTCTTTCC	TTCTTTCC	rs11281424		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173408430_173408431insTTCTTTCC	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						ttcctctttctttctttccttc	0.020													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6571952	6571955	+	IGR	DEL	AGGG	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6571952_6571955delAGGG								UBE2QL1 (79247 upstream) : LOC255167 (10332 downstream)																							ggaggaagaaagggagggagggag	0.054													4	2	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121787399	121787400	+	Intron	INS	-	A	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121787399_121787400insA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GAATCCCCAGGAAAAAAAAAAA	0.376													4	2	---	---	---	---	
SEC24A	10802	broad.mit.edu	37	5	134017933	134017933	+	Intron	DEL	A	-	-	rs79922505		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134017933delA	uc003kzs.2	+						SEC24A_uc011cxu.1_Intron	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			actctgtctcaaaaaaaaaaa	0.109													8	5	---	---	---	---	
CYFIP2	26999	broad.mit.edu	37	5	156734664	156734665	+	Intron	DEL	TA	-	-	rs57764989		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156734664_156734665delTA	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			tgtgtgtgtgtatgtgtgtgtg	0.277													5	3	---	---	---	---	
RASGEF1C	255426	broad.mit.edu	37	5	179528352	179528352	+	3'UTR	DEL	G	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179528352delG	uc003mlq.2	-	13					RASGEF1C_uc003mlr.2_3'UTR|RASGEF1C_uc003mlp.3_3'UTR	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCCACTGTGGGGGGGGGGG	0.672													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9661051	9661051	+	IGR	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9661051delA								None (None upstream) : TFAP2A (735866 downstream)																							GTGTTACAGCAAAAAAAAAAA	0.299													5	3	---	---	---	---	
KDM1B	221656	broad.mit.edu	37	6	18213668	18213668	+	Intron	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18213668delA	uc003nco.1	+						KDM1B_uc003ncn.1_Intron|KDM1B_uc003ncp.1_Intron|KDM1B_uc003ncq.1_Intron	NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN	amine oxidase (flavin containing) domain 1						multicellular organismal development|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding			skin(1)	1						actccgtctcaaaaaaaaaaa	0.154													13	6	---	---	---	---	
TINAG	27283	broad.mit.edu	37	6	54207930	54207930	+	Intron	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54207930delA	uc003pcj.2	+						TINAG_uc010jzt.2_Intron	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			aaaataatttaaaaaataatt	0.289													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85139395	85139395	+	IGR	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85139395delT								KIAA1009 (202060 upstream) : TBX18 (257686 downstream)																							CACTGGTTCCTTCCTCTGCCA	0.488													35	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	92356678	92356678	+	Intron	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92356678delA	uc003pod.2	-											Homo sapiens cDNA clone IMAGE:5284581.																		aattttagccAAAAAAAAAAA	0.045													5	4	---	---	---	---	
SH2D4A	63898	broad.mit.edu	37	8	19252273	19252277	+	3'UTR	DEL	AAAGT	-	-	rs5889869		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19252273_19252277delAAAGT	uc003wzb.2	+	10					SH2D4A_uc011kym.1_3'UTR|SH2D4A_uc003wzc.2_3'UTR	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A							cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		TGATCAACTGAAAGTAAAGTATCCA	0.454													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	42538760	42538760	+	IGR	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42538760delA								C8orf40 (130621 upstream) : CHRNB3 (13802 downstream)																							aaactccatcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
KCNV1	27012	broad.mit.edu	37	8	110985209	110985209	+	Intron	DEL	T	-	-	rs113449582		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110985209delT	uc003ynr.3	-						KCNV1_uc010mcw.2_Intron	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1							voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			TTAtttttccttttttttttt	0.134													2	4	---	---	---	---	
CNTNAP3	79937	broad.mit.edu	37	9	39154071	39154071	+	Intron	DEL	G	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39154071delG	uc004abi.2	-						CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Intron|CNTNAP3_uc011lqs.1_Intron|CNTNAP3_uc004abl.1_Intron	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor						cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AAAAAAAAAAGATGCCCCCAT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69787982	69787985	+	IGR	DEL	AACA	-	-	rs59524350		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69787982_69787985delAACA								LOC100133920 (123033 upstream) : FOXD4L5 (387724 downstream)																							AGATAGAGGTAACAAACTTAAATA	0.368													4	2	---	---	---	---	
CCDC109A	90550	broad.mit.edu	37	10	74628693	74628693	+	Intron	DEL	C	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74628693delC	uc001jtc.2	+						CCDC109A_uc009xqp.1_Intron|CCDC109A_uc009xqq.1_Intron|CCDC109A_uc010qjy.1_Intron|CCDC109A_uc009xqr.2_Intron|CCDC109A_uc001jtd.2_Intron	NM_138357	NP_612366	Q8NE86	MCU_HUMAN	coiled-coil domain containing 109A						elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)					TCTGTTTTTTCTTGTAAGTTT	0.348													17	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	121307751	121307752	+	IGR	DEL	AA	-	-	rs140806064		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121307751_121307752delAA								RGS10 (5529 upstream) : TIAL1 (25226 downstream)																							acgctatctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
POLR2L	5441	broad.mit.edu	37	11	840579	840579	+	Intron	DEL	C	-	-	rs34627090		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840579delC	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951	P62875	RPAB5_HUMAN	DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGCCTCACCCCCCCCGCC	0.607													4	5	---	---	---	---	
CAPRIN1	4076	broad.mit.edu	37	11	34110806	34110806	+	Intron	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34110806delA	uc001mvh.1	+						CAPRIN1_uc001mvg.2_Intron|CAPRIN1_uc001mvi.2_Intron|CAPRIN1_uc001mvj.1_Intron	NM_005898	NP_005889	Q14444	CAPR1_HUMAN	membrane component chromosome 11 surface marker						negative regulation of translation|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis	cytoplasmic mRNA processing body|cytosol|dendrite|integral to plasma membrane|stress granule	protein binding|RNA binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				acagagtgagacactcccccc	0.080													2	4	---	---	---	---	
UCP2	7351	broad.mit.edu	37	11	73686860	73686862	+	Intron	DEL	CTT	-	-	rs141148353		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73686860_73686862delCTT	uc001oup.1	-						UCP2_uc001ouq.1_Intron	NM_003355	NP_003346	P55851	UCP2_HUMAN	uncoupling protein 2						proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding				0	Breast(11;0.000112)					taatccaggacttcttttggagg	0.118													3	3	---	---	---	---	
PCBP2	5094	broad.mit.edu	37	12	53865788	53865789	+	Intron	INS	-	G	G	rs150610551	by1000genomes	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53865788_53865789insG	uc001sdl.3	+						PCBP2_uc001sdc.3_Intron|PCBP2_uc001sdb.3_Intron|PCBP2_uc001sde.3_Intron|PCBP2_uc001sdi.3_Intron|PCBP2_uc001sdd.3_Intron|PCBP2_uc001sdf.3_Intron|PCBP2_uc009zna.2_Intron|PCBP2_uc010soi.1_Intron|PCBP2_uc001sdj.3_Intron|PCBP2_uc010soj.1_Intron|PCBP2_uc001sdk.3_Intron	NM_001128911	NP_001122383	Q15366	PCBP2_HUMAN	poly(rC) binding protein 2 isoform d						innate immune response|negative regulation of defense response to virus|negative regulation of type I interferon production|nuclear mRNA splicing, via spliceosome|proteasomal ubiquitin-dependent protein catabolic process|response to virus	cytosol|nucleoplasm|ribonucleoprotein complex	DNA binding|RNA binding|ubiquitin protein ligase binding				0						AAGGGGTTGGTGGGGGGGGGAG	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55736919	55736919	+	IGR	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55736919delT								OR6C3 (10500 upstream) : OR6C75 (21976 downstream)																							AGCTCAGTTGTTTTTCTTCAT	0.353													9	11	---	---	---	---	
BAZ2A	11176	broad.mit.edu	37	12	56999208	56999208	+	Intron	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56999208delT	uc001slq.1	-						BAZ2A_uc001slp.1_Intron|BAZ2A_uc009zov.1_5'Flank|BAZ2A_uc009zow.1_Intron	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A						chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0						TTTTATGTAAttttttttttt	0.174													6	5	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72287220	72287221	+	Intron	INS	-	TG	TG	rs139574467	by1000genomes	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72287220_72287221insTG	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						ATACATAGATATGTGTGTGTGT	0.322													5	3	---	---	---	---	
POC1B	282809	broad.mit.edu	37	12	89885726	89885726	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89885726delC	uc001tbc.2	-	4	544	c.439delG	c.(439-441)GTAfs	p.V147fs	POC1B_uc001tba.2_Frame_Shift_Del_p.V105fs|POC1B_uc001tbb.2_Frame_Shift_Del_p.V17fs|POC1B_uc010sun.1_RNA|POC1B_uc009zsp.2_RNA|POC1B_uc009zsq.2_RNA	NM_172240	NP_758440	Q8TC44	POC1B_HUMAN	WD repeat domain 51B	147	WD 4.				cell projection organization	centriole|microtubule basal body				ovary(1)	1						GCACAGCGTACCCAGTGTGTA	0.418													123	111	---	---	---	---	
NTN4	59277	broad.mit.edu	37	12	96181160	96181161	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96181160_96181161delAG	uc001tei.2	-	2	590_591	c.141_142delCT	c.(139-144)CTCTGGfs	p.L47fs	NTN4_uc009ztf.2_Frame_Shift_Del_p.L47fs|NTN4_uc009ztg.2_Frame_Shift_Del_p.L10fs	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor	47_48	Laminin N-terminal.				axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						GTGTCTGCCCAGAGTTTTCGCC	0.520													81	54	---	---	---	---	
PLBD2	196463	broad.mit.edu	37	12	113821802	113821802	+	Intron	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113821802delA	uc001tve.2	+						PLBD2_uc001tvf.2_Intron	NM_173542	NP_775813	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2 isoform 1						lipid catabolic process	lysosomal lumen	hydrolase activity				0						actctatctcaaaaaaaaaaa	0.209													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145296	119145298	+	IGR	DEL	CAA	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145296_119145298delCAA								SUDS3 (289457 upstream) : SRRM4 (274098 downstream)																							gtggtgatggcaatggtggtggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128753892	128753893	+	IGR	INS	-	GTGTGTGT	GTGTGTGT	rs150080355	by1000genomes	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128753892_128753893insGTGTGTGT								None (None upstream) : TMEM132C (145398 downstream)																							GCTCACATTCCgtgtgtgtgtg	0.401													5	3	---	---	---	---	
ARHGAP5	394	broad.mit.edu	37	14	32560575	32560575	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32560575delA	uc001wrl.2	+	2	939	c.700delA	c.(700-702)AACfs	p.N234fs	ARHGAP5_uc001wrm.2_Frame_Shift_Del_p.N234fs|ARHGAP5_uc001wrn.2_Frame_Shift_Del_p.N234fs|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	234					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		ATTTAATGTCAACATTGAAAC	0.348													143	97	---	---	---	---	
C14orf50	145376	broad.mit.edu	37	14	65054183	65054184	+	Intron	INS	-	CCC	CCC			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65054183_65054184insCCC	uc001xhl.1	+						C14orf50_uc001xhm.1_Intron	NM_172365	NP_758953	Q96LQ0	CN050_HUMAN	hypothetical protein LOC145376											skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00382)|all cancers(60;0.00427)|BRCA - Breast invasive adenocarcinoma(234;0.0488)		tttttttttttttttttttttt	0.094													4	2	---	---	---	---	
TC2N	123036	broad.mit.edu	37	14	92265558	92265559	+	Intron	DEL	AA	-	-	rs35831554		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92265558_92265559delAA	uc001xzu.3	-						TC2N_uc001xzt.3_Intron|TC2N_uc010auc.2_Intron|TC2N_uc001xzv.3_Intron	NM_001128595	NP_001122067	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear							nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)		CAGGTAGTGGAAAAAAAAAAAA	0.327													7	4	---	---	---	---	
SORD	6652	broad.mit.edu	37	15	45330377	45330378	+	Intron	INS	-	T	T	rs71114304		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45330377_45330378insT	uc001zul.3	+						SORD_uc010uel.1_Intron|SORD_uc001zum.3_Intron|SORD_uc010bdz.2_Intron	NM_003104	NP_003095	Q00796	DHSO_HUMAN	sorbitol dehydrogenase						fructose biosynthetic process|glucose metabolic process|L-xylitol catabolic process|sorbitol catabolic process|sperm motility	cilium|extracellular space|flagellum|membrane fraction|mitochondrial membrane|soluble fraction	L-iditol 2-dehydrogenase activity|NAD binding|sugar binding|zinc ion binding				0		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)	NADH(DB00157)	ttccttccttccttccttcctt	0.218													4	2	---	---	---	---	
IQGAP1	8826	broad.mit.edu	37	15	91018049	91018049	+	Intron	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91018049delT	uc002bpl.1	+							NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1						energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CCATAAGAGCttttttttttt	0.274													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96732138	96732139	+	IGR	DEL	AC	-	-	rs35480884		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96732138_96732139delAC								LOC145820 (681064 upstream) : NR2F2 (137018 downstream)																							ggatcctggaacacacacacac	0.144													4	2	---	---	---	---	
TBL3	10607	broad.mit.edu	37	16	2023984	2023984	+	Intron	DEL	C	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2023984delC	uc002cnu.1	+						TBL3_uc002cnv.1_Intron|TBL3_uc010bsb.1_5'Flank|TBL3_uc010bsc.1_5'Flank|TBL3_uc010uvt.1_5'Flank	NM_006453	NP_006444	Q12788	TBL3_HUMAN	transducin beta-like 3						G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0						TGGAGAGGAGCACCTAGCACA	0.632													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13966971	13966973	+	IGR	DEL	TGG	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13966971_13966973delTGG								SHISA9 (632699 upstream) : ERCC4 (47041 downstream)																							gtggtggtgatggtggtggtggt	0.177													7	4	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27990984	27990985	+	Intron	INS	-	AA	AA	rs35672057		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27990984_27990985insAA	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						aagaaagaaagagagagagaga	0.000													4	5	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83030548	83030550	+	Intron	DEL	TGT	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83030548_83030550delTGT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		attacgatggtgttgttgatgat	0.000													4	3	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10424898	10424899	+	Intron	DEL	AT	-	-	rs147245930		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10424898_10424899delAT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TATTGATGTCATatatatatat	0.248													5	4	---	---	---	---	
SOCS7	30837	broad.mit.edu	37	17	36546897	36546898	+	Intron	INS	-	TTCC	TTCC	rs113153732		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36546897_36546898insTTCC	uc002hqa.2	+						SOCS7_uc010cvl.2_Intron|SOCS7_uc002hqb.2_Intron	NM_014598	NP_055413	O14512	SOCS7_HUMAN	suppressor of cytokine signaling 7						intracellular signal transduction|negative regulation of signal transduction|regulation of growth	cytoplasm|nucleus|plasma membrane	protein binding|SH3 domain binding			skin(1)	1	Breast(7;3.47e-17)					ttttgttcgttttccttccttc	0.000													6	3	---	---	---	---	
UBTF	7343	broad.mit.edu	37	17	42284469	42284469	+	3'UTR	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42284469delT	uc002igb.2	-	20					UBTF_uc002igc.2_3'UTR|UBTF_uc010czs.2_3'UTR|UBTF_uc002igd.2_3'UTR|UBTF_uc010czt.2_3'UTR	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCCCACCGTATTTTTTTTTTT	0.562													3	4	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47655768	47655768	+	Intron	DEL	T	-	-	rs67095119		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655768delT	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					GGGGGGGGGGTGACCCAACTG	0.527													4	3	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64302446	64302446	+	Intron	DEL	A	-	-	rs141495406		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64302446delA	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	TTCTCATTGGAAAAAAAAAAA	0.323													6	3	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	4257973	4257974	+	Intron	INS	-	TG	TG	rs60634395		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4257973_4257974insTG	uc010wyz.1	-							NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				AGTTATACATAtgtgtgtgtgt	0.198													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49715876	49715877	+	IGR	INS	-	CCTC	CCTC	rs143181876	by1000genomes	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49715876_49715877insCCTC								TRPM4 (785 upstream) : SLC6A16 (77017 downstream)																							cttccttccttcctccctccct	0.035													4	4	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49966675	49966676	+	Intron	DEL	GG	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49966675_49966676delGG	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		aggaggggctgggggcctggac	0.000													4	2	---	---	---	---	
GART	2618	broad.mit.edu	37	21	34883415	34883415	+	Intron	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34883415delT	uc002yrx.2	-						GART_uc002yrz.2_Intron|GART_uc010gmd.2_Intron|GART_uc002yry.2_Intron	NM_000819	NP_000810	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase,						'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|metal ion binding|methyltransferase activity|phosphoribosylamine-glycine ligase activity|phosphoribosylformylglycinamidine cyclo-ligase activity|phosphoribosylglycinamide formyltransferase activity|protein binding			ovary(1)	1					Pemetrexed(DB00642)	gggtgggtgctgtcatgttac	0.249													16	7	---	---	---	---	
PCNT	5116	broad.mit.edu	37	21	47810134	47810136	+	Intron	DEL	AGG	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47810134_47810136delAGG	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					aggctgaggcaggaggattgctt	0.030													4	2	---	---	---	---	
APOL1	8542	broad.mit.edu	37	22	36651357	36651358	+	Intron	DEL	CT	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36651357_36651358delCT	uc003apf.2	+						APOL1_uc011amn.1_Intron|APOL1_uc003apc.2_Intron|APOL1_uc003ape.2_Intron|APOL1_uc011amo.1_Intron|APOL1_uc011amp.1_Intron|APOL1_uc011amq.1_Intron|APOL1_uc010gwx.2_Intron	NM_003661	NP_003652	O14791	APOL1_HUMAN	apolipoprotein L1 isoform a precursor						cholesterol metabolic process|cytolysis|innate immune response|killing of cells of other organism|lipid transport|lipoprotein metabolic process	high-density lipoprotein particle|very-low-density lipoprotein particle	chloride channel activity|lipid binding|protein binding			breast(2)|ovary(1)	3						GAGGCACCAGCTCTCTCTACCC	0.604													4	3	---	---	---	---	
SYTL5	94122	broad.mit.edu	37	X	37913837	37913838	+	Intron	DEL	GT	-	-	rs71844138		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37913837_37913838delGT	uc004ddu.2	+						SYTL5_uc004ddv.2_Intron|SYTL5_uc004ddx.2_Intron	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1						intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						GGGCTCTGGGgtgtgtgtgtgt	0.243													4	2	---	---	---	---	
PHKA1	5255	broad.mit.edu	37	X	71835603	71835606	+	Intron	DEL	GGAA	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71835603_71835606delGGAA	uc004eax.3	-						PHKA1_uc004eay.3_Intron|PHKA1_uc011mqi.1_Intron	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					aaggagggggggaaggaaggaagg	0.000													4	2	---	---	---	---	
DIAPH2	1730	broad.mit.edu	37	X	96194530	96194531	+	Intron	DEL	TA	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96194530_96194531delTA	uc004efu.3	+						DIAPH2_uc004eft.3_Intron	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						tatatatatgtatatatatatg	0.069													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	124329863	124329866	+	IGR	DEL	GAAG	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124329863_124329866delGAAG								ODZ1 (232197 upstream) : DCAF12L2 (968648 downstream)																							aagaaggaacgaaggaaggaagga	0.147													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	135223959	135223959	+	IGR	DEL	A	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135223959delA								SLC9A6 (94533 upstream) : FHL1 (4902 downstream)																							gccataaaacaaaagaatgaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	136030245	136030245	+	Intron	DEL	T	-	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136030245delT	uc004fai.1	+											Homo sapiens cDNA FLJ31132 fis, clone IMR322000953.																		GAGAACCTGCTTTTTTTTTTT	0.438													4	2	---	---	---	---	
